Multimode SigF regulation in M. tuberculosis
1
Tuning the Mycobacterium tuberculosis alternative sigma factor SigF through the 1
multidomain regulator Rv1364c and osmosensory kinase, protein kinase D 2
3
Richa Misra1, Dilip Menon
2, Gunjan Arora
1, Richa Virmani
1, Mohita Gaur
3, Saba Naz
4, 4
Neetika Jaisinghani2, Asani Bhaduri
1, Ankur Bothra
2, Abhijit Maji
1, Anshika Singhal
1, Preeti 5
Karwal1, Christian Hentschker
5, Dörte Becher
5, Vivek Rao
2, Vinay K. Nandicoori
4, Sheetal 6
Gandotra2#
, Yogendra Singh
1,3# 7
8
1Allergy and Infectious Disease Unit, CSIR-Institute of Genomics and Integrative Biology, 9
Mall Road, Delhi-110007 10
2Chemical and Systems Biology Division, CSIR-Institute of Genomics and Integrative 11
Biology, Mathura Road, New Delhi-110020 12
3Department of Zoology, University of Delhi, Delhi 110007 13
4National Institute of Immunology, Delhi- 110067 14
5Institute of Microbiology, Ernst-Moritz-Arndt-University Greifswald, D-17487 Greifswald, 15
Germany. 16
17
Running Head: Multimode SigF regulation in M. tuberculosis 18
19
#Address correspondence to Sheetal Gandotra ([email protected]) or Yogendra 20
Singh ([email protected]) 21
22
KEYWORDS: Mycobacterium tuberculosis; sigma factor; protein‐protein interaction; 23
serine/threonine protein kinase 24
25
JB Accepted Manuscript Posted Online 14 January 2019J. Bacteriol. doi:10.1128/JB.00725-18Copyright © 2019 American Society for Microbiology. All Rights Reserved.
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
2
ABSTRACT 26
Bacterial alternative sigma factors are mostly regulated by a partner-switching mechanism. 27
Regulation of the virulence associated alternative sigma factor, SigF, of Mycobacterium 28
tuberculosis, has been an area of intrigue with more predicted regulators compared to other 29
sigma factors in this organism. Rv1364c is one such predicted regulator, the mechanism of which 30
is confounded by the presence of both anti-sigma and anti-sigma-antagonist functions in a single 31
polypeptide. Using protein binding and phosphorylation assays, we demonstrate that the anti-32
sigma factor domain of Rv1364c mediates autophosphorylation of its antagonist domain and 33
binds efficiently to SigF. Furthermore, we identified a direct role for the osmosensor 34
serine/threonine kinase PknD in regulating the SigF-Rv1364c interaction, adding to the current 35
understanding about intersection of these discrete signaling networks. Phosphorylation of SigF 36
also showed functional implications in its DNA binding ability, which may help in activation of 37
regulon. In M. tuberculosis, osmotic stress-dependent induction of espA, a SigF target involved 38
in maintaining cell wall integrity, is curtailed upon overexpression of Rv1364c, showing its role 39
as an anti-SigF factor. Overexpression of Rv1364c led to induction of another target, pks6, 40
involved in lipid metabolism. This induction is, however, curtailed in presence of osmotic stress 41
conditions, suggesting modulation of SigF target gene expression via Rv1364c. This data 42
provides evidence that Rv1364c acts an independent SigF regulator, sensitive to osmosensory 43
signal, mediating crosstalk of PknD with SigF regulon. 44
45
IMPORTANCE 120 words 46
Mycobacterium tuberculosis, capable of latently infecting the host and causing aggressive tissue 47
damage during active tuberculosis is endowed with a complex regulatory capacity built of 48
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
3
several sigma factors, protein kinases and phosphatases. These proteins regulate expression of 49
genes that allow the bacteria to adapt to various host-derived stresses like nutrient starvation, 50
acidic pH, and hypoxia The cross-talk between these systems is not well understood. SigF is one 51
such regulator of gene expression that helps M. tuberculosis to adapt to stresses and imparts 52
virulence. This work provides evidence for its inhibition by the multidomain regulator Rv1364c, 53
and activation by the kinase PknD. The co-existence of negative and positive regulators of SigF 54
in pathogenic bacteria reveals an underlying requirement for tight control of virulence factor 55
expression. 56
57
INTRODUCTION 58
Mycobacterium tuberculosis, responsible for highest mortality due to any single bacterial 59
infection worldwide, is endowed with a genome enriched in signal transduction and gene 60
regulatory modules (1, 2). Alternative sigma () factors provide bacteria with the means to 61
simultaneously regulate many genes in response to altered environmental or developmental 62
signals encountered during the infection process (3, 4). Sigma factor F, the general stress 63
response factor of M. tuberculosis is implicated in persistence (5, 6). A sigF deletion mutant of 64
M. tuberculosis is attenuated in the murine and guinea pig model of tuberculosis (7-9). Although 65
SigF regulon is characterized in several studies (7, 10-14) and includes many genes involved in 66
cell surface modification and virulence factor secretion (7, 14), there is a stark lack of uniformity 67
in phenotypic behavior of SigF mutant/overexpression strains in different studies, mostly 68
attributed to the differences in the M. tuberculosis strain used (CDC1551 versus H37Rv) (8, 10, 69
12). Furthermore, very little is understood in how signals perceived in the host enable switching 70
to the alternative factor. 71
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
4
Availability of most alternative σ factors is governed by a complex partner-switching 72
system controlled by phosphorylation-dependent regulation, best exemplified by the Bacillus 73
subtilis general stress response σ factor, SigB (15). Under unstressed conditions, SigB is 74
inactivated by the anti-σ factor, RsbW, which physically binds to it and thus prevents association 75
of SigB with RNA polymerase. The anti-σ factor antagonist, RsbV can bind and sequester RsbW 76
in an unphosphorylated form, but this is prevented by the kinase activity of RsbW. This system 77
is, in turn, regulated by two phosphatases, RsbP and RsbU, which on sensing different stress 78
signals dephosphorylate RsbV. Another set of anti-σ factor and anti-σ factor antagonist 79
homologs control the activity of RsbU. Upon dephosphorylation by either RsbP/RsbU, RsbV 80
binds RsbW, thus enabling the stress-dependent transcription by SigB containing holoenzyme 81
(15). However, the regulation of B. subtilis SigB homolog in M. tuberculosis, SigF, is not very 82
well understood. Co-transcribed with sigF, usfX encodes the cognate anti-σ factor for SigF (16). 83
Apart from this, other putative anti-σ factor regulators (Rv0516c, Rv1364c, Rv1365c, Rv1904, 84
Rv2638, Rv3687c) are present in the genome, some of which have been characterized as 85
antagonists (16-23); however, ambiguity remains about their role vis-à-vis SigF. Although 86
protein homology provides vital clues, it is difficult to extrapolate the function of these 87
regulators. A study by Hatzios et al revealed activation of SigF regulon upon disruption of 88
Rv0516c, questioning its role as an anti-σ factor antagonist (24). The existence of multiple 89
regulators for SigF suggests that the inhibition of the alternate factor must also be crucial to its 90
survival or pathogenesis. Rv1364c of M. tuberculosis is unique in its domain architecture, in that 91
it mimics a tandem array of domains [sensor - phosphatase - kinase -anti- antagonist] in a single 92
polypeptide where the kinase domain is predicted to work as the anti- factor domain (17, 19, 93
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
5
20, 22, 23). Its function vis-à-vis an antagonist or agonist of SigF remains elusive, since both 94
regulatory domains are present in a single protein. 95
In the present work, we demonstrate that Rv1364c functions primarily as a bonafide anti-96
SigF factor. We show that the kinase activity of Rv1364c is essential for its autophosphorylation 97
of the anti- antagonist domain and is capable of binding to SigF in the autophosphorylated 98
form. This may have significance in restraining SigF activity under normal growth conditions. 99
Through an independent mechanism, protein kinase D (PknD), a eukaryotic-like serine/threonine 100
protein kinase (STPK), induced phosphorylation of both proteins and mobilized SigF release 101
from Rv1364c. PknD overexpression in an earlier study has been shown to induce SigF regulon 102
indirectly (18), here we find evidence for a direct mechanistic link through phosphorylation-103
dependent dissociation with its anti- factor. 104
105
RESULTS 106
Autophosphorylation of recombinant Rv1364c and its effect on interaction with SigF 107
Previous studies on characterization of Rv1364c reported presence of an active phosphatase 108
domain in Rv1364c with D211 and D328 identified as the active site residues (19, 22). The 109
kinase activity has been questionable by two opposing reports, with both uncertain about the 110
activity of the full-length protein (19, 20). The kinase domain of Rv1364c (RsbW) is reported to 111
possess the characteristic Bergerat fold of the GHKL (gyrase, Hsp90, histidine kinase, MutL) 112
ATPase/kinase superfamily (19, 20, 23). Our earlier attempts at characterizing this protein had 113
demonstrated an inability of the protein to execute -32
P-ATP transfer to the C-terminal anti-σ 114
factor antagonist domain, belonging to the Sulfate Transporter and Anti-Sigma factor antagonist 115
(STAS) family (19). We reasoned that this could be due to the dominant activity of the 116
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
6
phosphatase in preventing retention of the transferred 32
P. To further assess the activity of the 117
anti-σ factor domain, we probed the ATPase activity of the full-length protein and found that it 118
can indeed hydrolyze ATP. The kinase conserved active site residues, E444 and N448, based on 119
sequence homology to B. subtilis proteins (19, 20, 23), were crucial for the ATPase activity 120
(Figure 1A). Surprisingly, the phosphomimetic mutant of the conserved phospho-acceptor 121
residue (Rv1364cS600E) showed comparable activity to the full-length wild-type protein (Figure 122
1A). So, we further probed if phosphorylation at the predicted S600 site was dependent on the 123
kinase activity of Rv1364c. Using the phosphoprotein stain- Pro-Q®
Diamond, we measured the 124
phosphorylation status of the purified full-length protein Rv1364c. We observed that Rv1364c 125
was efficiently phosphorylated under standard purification procedures (Figure 1B). To explore 126
the mechanism of autophosphorylation and to rule out phosphorylation due to any Escherichia 127
coli kinase, we also probed the phosphorylation status of Rv1364c variants. Mutations in the 128
kinase domain (N448A, E444A) and conserved phosphoacceptor site S600 in substrate domain 129
abolished the phosphorylation (Figure 1B). On the other hand, mutations in conserved active site 130
residues of phosphatase domain (D211A and D328A) had no effect on phosphorylation status of 131
the protein. Thus, our results indicate that Rv1364c is found in phosphorylated form when 132
expressed in E. coli and provides a plausible reason why previous attempts at detecting -32
P of 133
ATP being transferred at this site failed (19). The autophosphorylation at S600, however, does 134
not confer any additional advantage to the interaction of Rv1364c with SigF (Figure 1C). In view 135
of our previous study (19) and present results, we therefore establish that full length Rv1364c 136
possesses both phosphatase and kinase activities and can efficiently bind to SigF independent of 137
its autophosphorylation. Since PknD is known to influence SigF regulon (18), we explored the 138
crosstalk of this STPK with the SigF-Rv1364c protein pair. 139
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
7
140
Rv1364c and SigF are reversibly phosphorylated by PknD in vitro 141
STPK-mediated phosphorylation fine-tunes a variety of cellular processes in Mycobacterium 142
spp. to help these organisms rapidly adapt to host-derived stresses (25, 26). Studies have 143
suggested crosstalk of STPK-mediated signaling and σ factor regulatory systems, indicating 144
importance of multimode regulation of transcription (18, 24, 27). PknD helps M. tuberculosis to 145
adapt to osmotic stress by regulating SigF regulon, however, the exact mechanism of how SigF 146
is activated (released from its cognate anti- factors) is yet unknown (24). We performed in vitro 147
γ-32
P ATP transfer assay with PknD and His6-tagged Rv1364c and found efficient 148
phosphorylation of Rv1364c by PknD (Figure 2A). The kinase domain of PknD and Rv1364c are 149
approximately the same size; therefore, to authenticate phosphotransfer to Rv1364c rather than 150
autophosphorylation of PknD in this assay, the reaction end-products were treated with TEV 151
protease that cleaves the affinity tag from Rv1364c. Retention of radioactivity on the digested 152
product validates PknD mediated phosphorylation of Rv1364c (Figure 2A). Moreover, the 153
S600A mutant retained the ability to be phosphorylated by PknD, suggesting additional 154
phosphorylation sites on Rv1364c (Figure 2A). Independently, Rv1364c cloned with a bigger 155
MBP tag was also subjected to kinase assay in presence of wild-type PknD/PknDD138N kinase-156
dead mutant/WT PknD in presence of its specific inhibitor SP600125, to confirm PknD-mediated 157
phosphorylation of Rv1364c (Figure 2B). The complete loss of phosphorylation of Rv1364c in 158
presence of inhibitor and PknD kinase-dead mutant confirmed the specificity of the reaction. 159
Previously reported substrate of PknD, Rv0516c (18), was included as a positive control in these 160
assays. 161
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
8
To test if extrinsic signals received by STPKs can also affect SigF directly, we performed in 162
vitro γ-32
P ATP transfer assays with purified full-length/ kinase domains of PknA, PknB, PknD, 163
PknE, PknF, PknG, and PknH. The kinase domain of PknD performed the most efficient 164
phosphorylation of SigF (Figure 2C), although other STPKs were also capable of 165
phosphorylating it. The specificity of PknD-mediated phosphorylation of SigF was also 166
confirmed with PknD-kinase dead mutant (Figure 2D). The PknD-mediated phosphorylation of 167
Rv1364c and SigF is reversed by PstP (Figure 2E and 2F), the cognate phospho-Ser/Thr 168
phosphatase, denoting the reversible regulation of their effector functions. 169
170
PknD-phosphorylation attenuates interaction of SigF with its anti-σ factor, Rv1364c 171
PknD-mediated phosphorylation of Rv1364c and SigF was validated in vivo, using E. coli as a 172
surrogate host (Figure 3A). Rv1364c or SigF, co-expressed with PknD in vivo, were purified to 173
assess phosphorylation. Pro-Q®
Diamond staining of purified Rv1364c (His-tagged) and SigF 174
(GST-tagged) showed phosphorylation (Figure 3A). Two-dimensional-gel electrophoresis and 175
immunoblot analysis of native Rv1364c and Rv1364c co-expressed with PknD in E. coli was 176
also performed which indicated multiple acidic phospho-isoforms of Rv1364c generated by 177
PknD, as compared to the native Rv1364c confirming additional phosphorylation sites (Figure 178
3B). Through mass-spectrometry, we identified PknD mediated phosphorylation of Rv1364c on 179
multiple threonine and serine residues (Thr54, Thr81, Thr299, Thr390, Thr520, Thr568 and 180
Ser506) (Supplementary Figure S1). The results suggest that PknD directly phosphorylates the 181
alternative σ factor, SigF and its regulator Rv1364c. 182
To examine the effect of PknD-mediated phosphorylation on the SigF-Rv1364c 183
interaction in vitro, SigF and Rv1364c were co-expressed with and without PknD in the pACYC 184
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
9
three-way protein expression system to obtain the phosphorylated and unphosphorylated forms 185
of these proteins (Figure 3A). The protein-protein interaction was analyzed by sandwich ELISA. 186
Although the phosphorylation of only one of the interacting proteins (SigF or Rv1364) did not 187
lead to significant loss of interaction (Figure 3C), as shown in the figure inset, interaction 188
between SigF and Rv1364c reduces significantly upon in vivo phosphorylation of both proteins 189
by PknD. 190
191
PknD-phosphorylated SigF mediates tighter complex formation with RNA polymerase 192
We questioned whether PknD-phosphorylated SigF retains its ability to recruit RNA polymerase 193
to its cognate promoter. Purified SigF bound to the sigF promoter in a RNA core polymerase 194
dependent manner (Figure 4A). Using sigF promoter as the target sequence, we checked the 195
ability of SigF and PknD-phosphorylated SigF (pSigF) to recruit E. coli core RNA polymerase to 196
this DNA by electrophoretic mobility shift assay (EMSA). We found that purified SigF and 197
pSigF enable DNA-protein complex formation with RNA polymerase in a dose dependent 198
manner (Figure 4B). The phosphorylated protein reached saturation of binding at a lower protein 199
concentration (Figure 4B and 4C). Additional protein-DNA complexes of lower and higher 200
mobility were found with PknD phosphorylated SigF compared to that with SigF (asterix in 201
Figure 4B). Competition with non-radioactive probe confirmed specificity of the interaction in 202
both cases. However, release of only 50% of the radioactive probe from the pSigF-RNA 203
polymerase-DNA complex compared to 80% from the unphosphorylated SigF counterpart, at 204
even 40 times the competing probe concentration suggested tighter complex formation by pSigF 205
compared to SigF (Figure 4D and E). In view of the previous reports where PknD overexpression 206
led to activation of SigF regulon (18), our results show direct evidence of the effect of PknD-207
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
10
mediated phosphorylation of SigF on its DNA-binding ability and thereby its effect on the 208
regulon. Thus, phosphorylation of SigF by PknD is not only responsible for dissociation with its 209
anti- factor but also causes tight binding of pSigF-RNA polymerase to DNA. 210
211
Rv1364c overexpression quenches SigF target gene espA induction in osmotic stress 212
To understand how Rv1364c regulates SigF under stress, we looked at its role in the 213
osmosensory signaling pathway. Hatzios et al illustrated the PknD-mediated osmosensory 214
activation of the SigF regulon gene espA, which enables M. tuberculosis to adapt to osmotic 215
stress by cell wall remodeling and virulence factor production (24). We studied whether the 216
induction of this gene is affected by the action of Rv1364c as either anti-SigF or anti-SigF 217
antagonist. Approximately 25-fold overexpression of Rv1364c was achieved by the plasmid 218
pTC0X1Rv1364c in M. tuberculosis H37Rv (Figure 5A). As shown earlier (24), osmotic stress 219
led to a modest but statistically significant increase in expression of espA (Figure 5B). The 220
ability to increase espA expression in response to osmotic stress was curtailed in cultures 221
harboring the overexpression plasmid pTC0X1-Rv1364c (Figure 5B). This suggested Rv1364c 222
to function as an anti-SigF factor. We studied another probable SigF target gene, the expression 223
of which is not regulated by osmotic stress in wild type cells, pks6 (7, 24). Expression of pks6 224
was indeed not induced by osmotic stress in the empty vector containing strain (Figure 5C). Cells 225
overexpressing Rv1364c were found to express 50% higher levels of pks6 compared to the 226
control strain, probably due to an anti-SigF antagonist function in the basal state. Exposure to 227
osmotic stress under this scenario led to approximately 50% reduction in the expression of pks6, 228
proposing activation of anti-SigF property of Rv1364c by osmotic stress. Together, these data 229
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
11
verify the role of osmotic stress mediated control of SigF target genes via Rv1364c in M. 230
tuberculosis. 231
232
Distribution of Rv1364c-, SigF-, and PknD-like sequences in actinomycetes 233
Earlier reports of divergence in SigF orthologs in M. tuberculosis and M. smegmatis and in 234
general in pathogenic versus non-pathogenic mycobacteria suggests that divergent regulatory 235
circuits of SigF activation may play an important role in virulence associated features of this 236
alternative factor (28, 29). The phylogenetic analysis of Rv1364c orthologs revealed that 237
members from pathogenic mycobacteria form a distinct clade and appear phylogenetically closer 238
to some non-mycobacterial actinobacterial members (Supplementary Figure S2A). We observed 239
that the multidomain architecture is conserved in some actinobacterial species such as 240
Actinoplanes friuliensis, Nakamurella multipartita, Rhodococcus ruber, Modestobacter marinus, 241
Amycolatopsis vancoresmycina, Actinomadura madurae apart from the pathogenic 242
Mycobacterium. While A. madurae is an opportunistic human pathogen (30), R. ruber is a 243
species closely related to a known opportunistic human pathogen, Rhodococcus equi. A. 244
friuliensis and A. vancoresmycina are producers of friulimycin and vancoresmycin, respectively 245
(31, 32). Since these environmental organisms are relatively less studied, we suggest that such 246
unique multidomain-fusion event may endow these organisms with means to adapt to 247
environmental and host derived stresses. The non-pathogenic mycobacterial clade conspicuously 248
lacked the phosphatase-kinase-STAS occurrence. SigF orthologs formed three distinct clades of 249
pathogenic, non-pathogenic Mycobacterium and non-mycobacterial actinomycetes 250
(Supplementary Figure S2B). Interestingly, M. tuberculosis PknD sequence-specific features 251
(viz. kinase domain + NHL repeats) are mostly conserved in the pathogenic Mycobacterium sp. 252
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
12
only (Supplementary Figure S2C). This suggests presence of a co-regulatory mechanism for 253
SigF-Rv1364c-PknD in face of specific stresses faced by these pathogenic members. 254
255
DISCUSSION 256
M. tuberculosis SigF draws parallels with B. subtilis SigB, by virtue of sequence 257
homology. Compared to the paradigm of stressosome-dependent regulation of SigB in B. subtilis 258
(33-35), a stressosome-independent control mechanism exists in M. tuberculosis for its homolog, 259
SigF (Figure 6). Since Bacillus only possesses stand-alone proteins possessing regulatory 260
domains, M. tuberculosis probably evolved an alternate strategy to influence this interaction. 261
While phosphorylation-dephosphorylation mediated by GHKL family of kinases and PP2C 262
phosphatases, respectively, is known to govern the opposing activities of regulatory proteins of 263
SigB in B. subtilis (15), the regulation of M. tuberculosis SigF is not yet completely clear. 264
Interestingly, bioinformatics analyses revealed similar co-evolution pattern of SigF and its 265
regulator, Rv1364c among Mycobacterium genus (Supplementary Figure S2). Domain 266
architecture of Rv1364c possesses a unique arrangement of ‘sensor-PP2C phosphatase-GHKL 267
kinase-STAS’ domains conserved only among the pathogenic mycobacterial members (19, 20, 268
23), suggesting additional ways to control virulence-associated SigF in face of stresses (Figure 6 269
and Supplementary Figure S2). While Rv1364c possesses both phosphatase and kinase activities, 270
it primarily acts as a SigF anti-σ factor, with dominant autophosphorylation at the conserved 271
serine residue of STAS domain (Figure 1). The signal required for the switch to phosphatase 272
activity is not known yet. The eukaryotic-like STPK, PknD, has been implicated in activation of 273
SigF regulon in osmotic stress, albeit indirectly (18, 24). Here we describe a direct cross-talk 274
between PknD with SigF and its regulator, Rv1364c (Figure 2 and 3). The PknD mediated 275
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
13
phosphorylation sites in Rv1364c identified in this work map to the different domains of the 276
protein. These findings provide new directions towards understanding regulation of SigF 277
function. 278
While STPKs have been described to target other mycobacterial σ factor regulators (27, 279
36), the role of phosphorylation of a σ factor has never been described in bacteria. In the plant 280
Arabidopsis thaliana, SIG1 phosphorylation leads to inhibition of RNA polymerase recruitment 281
to photosystem-I (PS-I) promoter, thereby helping in the switch to PSII in response to redox 282
stress (37). Phosphorylation dependent relief from antagonists and simultaneous activation of 283
RNA polymerase recruitment would form a positive feed forward loop for activation of the target 284
σ factor regulon. Our work provides evidence for such a positive feed forward activation 285
mechanism of SigF by an extracellular sensor kinase, PknD, by not only destabilization of its 286
interaction with its anti-σ factor, Rv1364c, but simultaneous activation of its RNA polymerase 287
recruitment function (Figure 3 and 4). One of the possible consequences may be to initiate more 288
frequent pulses of transcription initiation events, a phenomenon associated with amplification of 289
output in response to stress (38). Phosphorylated SigF may variably occupy certain targets of 290
SigF regulon, depending on the affinity of promoter, leading to differential gene expression at 291
various time points in stress conditions. It remains to be deciphered what signals modulate 292
activation of the Ser/Thr phosphatase PstP that will drive the bacterial transcriptional regulation 293
in the opposite direction. 294
A high density of SigF targets are involved in lipid metabolism and cell surface changes 295
(11, 14). PknD activation by osmotic stress was shown to regulate espA via Rv0516c in 296
CDC1551 strain of M. tuberculosis (24). espA, an essential component of the ESX-1 secretion 297
system, is involved in maintaining integrity of the cell wall (24, 39). The lack of evidence for 298
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
14
direct interaction between Rv0516c and SigF left the pathway unlinked between phosphorylation 299
of Rv0516c by PknD and induction of SigF target espA. Our data reveals osmotic induction of 300
espA in M. tuberculosis H37Rv and inhibition of this induction upon overexpression of Rv1364c, 301
indicating its role as anti-SigF factor under osmotic stress conditions (Figure 5 and 6). Rv1364c 302
mediated repression of pks6, gene involved in cell wall lipid synthesis (40), by osmotic stress 303
also points towards its role as anti-SigF factor under osmotic stress. Interestingly, the induction 304
of pks6 upon overexpression of Rv1364c points towards an anti-sigF antagonist function which 305
could be mediated through interaction with other SigF regulators. These results put forward 306
another example of the intersection of signaling pathways mediated by eukaryotic-like STPKs 307
and alternative sigma factors, highlighting the tight regulation of signal transduction mechanism 308
in M. tuberculosis. 309
310
EXPERIMENTAL PROCEDURES 311
Bacterial strains and growth conditions 312
E. coli DH5α (Novagen) was used as a host strain for cloning purposes, and BL21 (DE3) 313
(Stratagene) was used as a host strain for the expression of recombinant proteins. E. coli cells 314
were grown at 37°C in Luria Bertani broth/LB agar (DIFCO) plates, supplemented with 100 315
μg/ml of ampicillin and/or 25μg/ml of kanamycin, when needed. M. tuberculosis H37Rv was 316
grown in Middlebrook 7H9 broth (DIFCO) supplemented with 0.2% glycerol, 0.05% Tween80 317
and ADC (DIFCO), at 37°C with shaking (150 rpm). 318
319
Constructs and gene manipulation 320
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
15
pTC-mcs and pTC0X1L were kind gifts from Dirk Schnappinger, Weill Cornell Medical College 321
(Addgene # 20317, 20315) (41). The clones for GST or His6-tagged STPKs and PstPcat were used 322
from previous studies (42-44). The plasmid coding for M. tuberculosis SigF, pLCD1, was kindly 323
provided by Dr. W. R. Bishai (Johns Hopkins School of Medicine, Baltimore, USA). For the co-324
expression studies, the dual expression vector pET-Duet1 (Novagen) and pACYCDuet-1 325
(Novagen) was used (45, 46). pETDuet-PknD construct was used from a previous study (45). 326
SigF was subsequently cloned in the MCS-1 region of the vector at HindIII-NotI sites. PknD 327
kinase domain amplicon was digested with NdeI and XhoI and cloned into corresponding sites in 328
MCS2 of pACYCDuet-1. Rv1364c was cloned into MCS1 of pACYCDuet-1 and pACYC-PknD 329
construct at BamHI/HindIII sites. Rv1364c was also cloned in pMAL vector to obtain MBP-330
Rv1364c. Rv0516c was cloned in pGEX-5X3 vector. All the DNA manipulations were carried 331
out according to the standard protocols. The gene segment encoding Rv1364c cloned in 332
pProExHTc and Rv1364cphosphatase domain, Rv1364ckinase domain, Rv1364csubstrate domain, Rv3287c (usfx) 333
cloned in pGEX-5X3 vector were used from a previous study (19). Mutagenesis of active site 334
residues of Rv1364c (D211A, D328A, E444A, N448A, S600A, S600E) and PknD kinase active 335
site residue (D138N) was carried out using HTc-Rv1364c construct and pGEX-PknD1-378 as 336
templates, respectively by QuikChange®
XL Site-Directed Mutagenesis Kit (Stratagene) as 337
described previously (19). The sequences of all clones were confirmed by DNA sequencing. The 338
primers and constructs used in this study are described in Table 1 and Table 2, respectively. 339
340
Purification of recombinant proteins 341
All the recombinant constructs were expressed and purified with Ni-NTA or Glutathione 342
Sepharose or Amylose resin affinity columns (Qiagen/NEB) as His6/GST/MBP-tagged fusion 343
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
16
proteins from E. coli as per manufacturer’s instructions and as described previously (42, 45). The 344
purified proteins were assessed by SDS-PAGE and all the pure fractions were pooled and 345
dialyzed with buffer (20mM Tris-HCl, pH 7.4, 10mM NaCl, and 10% glycerol). The protein 346
concentrations were estimated by BioRad protein assay kit and fractions were aliquoted and 347
stored at -80°C until further use. To get phosphorylated and unphosphorylated forms of SigF, 348
pETDuet construct co-expressing His6-SigF and MBP-PknD/His6-SigF and MBP alone were 349
transformed into E. coli BL21 (DE3) Codon Plus cells (Stratagene). Cultures were induced with 350
IPTG and further grown for 12–16 h at 18 °C. Cells were harvested and His6-tagged SigF and 351
His6-tagged phospho-SigF was purified using the procedure mentioned above. The three-way co-352
expression of SigF, Rv1364c with PknD was obtained by co-transforming pGEX-SigF plasmid 353
with pACYC-MBP-PknD-1364c/ pACYC-MBPalone-1364c plasmids in E. coli to get 354
phosphorylated and unphosphorylated forms of the proteins. The His6-tagged Rv1364c and GST-355
tagged SigF proteins were obtained from the overexpressed cultures by the purification 356
procedure mentioned above. 357
358
ATPase activity assay 359
The assay was essentially performed as described previously (47) with slight modifications. The 360
ATPase activity was determined in a reaction mixture containing 50 mM Tris-HCl pH 7.4, 1 mM 361
MgCl2, 1 mM dithiothreitol, 1.0Ci of α32
P-ATP (20Ci/mmol, BRIT, Hyderabad, India) and 362
3μg purified protein of Rv1364c, Rv1364cD211A, Rv1364cD328A, Rv1364cN444A, Rv1364cN448A, 363
Rv1364cS600A, Rv1364cS600E, Rv1747 (positive control, (48)). After 0 and 60 min incubation at 364
25°C, the products were separated by thin layer chromatography on polyethyleneimine cellulose 365
sheets (Merck) using 0.75M potassium phosphate buffer, pH 3.75, as solvent. The radioactive 366
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
17
signal on the dried sheets was visualized with PhosphorImager FLA 2000 (Fujifilm) and ATPase 367
activity was assayed by measuring the relative intensity of the product, ADP by Image Quant 368
software. 369
370
Phosphorylation state detection by fluorescent staining 371
For detection of phosphorylation state of Rv1364c, Pro-Q® Diamond phosphoprotein staining 372
(Invitrogen) was performed as per manufacturer’s instructions. Briefly, equal amounts of the 373
wild-type and mutant proteins were electrophoresed by SDS-PAGE and gels were fixed twice in 374
a solution of 50% v/v methanol and 10% v/v acetic acid and subsequently washed four times 375
with MilliQ water. The gels were stained with Pro-Q®
Diamond stain for 1.5h. To remove 376
nonspecific background, the gels were destained three times with 20% acetonitrile, 50 mM 377
sodium acetate (pH 4), followed by two additional washing steps. The gels were scanned using 378
the Typhoon Trio+ (GE Biosciences) (Excitation source: 532 nm laser, longpass emission filter: 379
560 nm). The same gels were then stained by SYPRO®
Ruby for total protein detection. To 380
differentiate between phosphorylated and unphosphorylated proteins, the ratio of Pro-Q®
381
Diamond dye to SYPRO®
Ruby dye signal intensities for each band were determined by imaging 382
software. The molecular weight marker run in parallel with the proteins also served as a control. 383
384
In vitro kinase assay 385
The in vitro kinase assays were performed by incubating 3μg of Rv1364c or SigF and 0.5–3μg of 386
STPKs to obtain for each specific kinase their optimal autophosphorylation activity in a 25μl 387
reaction mixture containing 20mM PIPES (pH 7.2), 5 mM MnCl2, 5 mM MgCl2 and 1μCi 388
γ32
P-ATP (BRIT, Hyderabad, India) for 30min at 25°C. PknD inhibitor, SP600125 was 389
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
18
dissolved in DMSO/water and added at a concentration of 20μM to the reaction (whenever 390
required), as described previously (18). Reactions were terminated by adding Laemmli sample 391
loading buffer followed by boiling at 100°C for 5 minutes. The proteins were separated by 392
10% SDS-PAGE, stained with Coomassie blue, dried and visualized by PhosphorImager FLA 393
2000 (Fujifilm)/ GE Typhoon Trio Imager. For visualization of the phosphorylation signal on 394
cleaved proteins, removal of recombinant tags was achieved by addition of proteases 395
(Thrombin (Novagen) for recombinant SigF and TEV for recombinant Rv1364c or its 396
mutants) after the kinase reaction according to manufacturer’s ins tructions. The reactions 397
were stopped using SDS buffer and resolved on 8-10% SDS-PAGE. Likewise, for 398
dephosphorylation of phosphorylated SigF and Rv1364c, reactions were incubated with 399
PstPcat (1 μg) for an additional 0, 5, 30 and 60 min at 25 °C and resolved on 10% SDS-400
PAGE. The signals were visualized by autoradiography. 401
402
Analysis of protein isoforms by two-dimensional PAGE and Immunoblotting 403
To assess the phosphorylation status of native Rv1364c and PknD phosphorylated Rv1364c, 404
equal amount of proteins were subjected to 2D-PAGE followed by immunoblotting as described 405
earlier (27, 49). Briefly, each sample was rehydrated into 7cm-long immobilized pH gradient 406
(IPG) strips with a pH range of 4-7/3.9-5.1, as appropriate (Bio-Rad). Isoelectric focusing was 407
performed for 15,000 V-h in a PROTEAN IEF Cell (Bio-Rad). After equilibration, strips were 408
loaded and resolved in the second dimension through a 10% SDS-PAGE. The proteins were 409
electrotransferred and immunoblot analysis was performed using anti-Rv1364c polyclonal sera 410
(customized antibody from Bangalore Genei India Pvt. Ltd.). The blots were developed using 411
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
19
ImmobilonTM
western chemiluminescent HRP substrate kit (Millipore) according to 412
manufacturer’s instructions. 413
414
Enzyme linked immunosorbent assay (ELISA) 415
ELISA was done using the method described by Lu et al. (50) with some modifications. Briefly, 416
the His6-tagged proteins were dissolved in coating buffer (0.1 M NaHCO3, pH 9.2) at a 417
concentration of 5 μg/ml and adsorbed (100μl/well) on the surface of a 96-well ELISA plate 418
(Maxisorb, Nunc) overnight at 4 °C. After rinsing the wells five times with wash buffer 419
(phosphate-buffered saline, pH 7.4, 0.05% Tween 20), the reactive sites were blocked with 420
blocking buffer (2% bovine serum albumin in wash buffer) for 2 h at room temperature. After 421
five washes, the adsorbed proteins were challenged with varying concentrations of GST-tagged 422
interacting proteins (100μl/well) dissolved in binding buffer (50 mM Tris pH 7.4, 200 mM NaCl, 423
0.02 % NP-40, 10 % glycerol) for 1 h at room temperature. Followed by five washes, the wells 424
were treated with horseradish peroxidase-conjugated GST antibody (Abcam, ab3416) at 425
1:10,000-fold dilution for 1 h at room temperature. After five washes with wash buffer and an 426
additional wash with phosphate-buffered saline, pH 7.4, the chromogenic substrate OPD 427
(0.4mg/ml o-phenylenediamine dihydrochloride in 0.1 M phosphate/citrate buffer, pH 5) and 428
H2O2 were added to visualize the interaction. After addition of stop solution (2.5 M H2SO4) the 429
absorbance was read at 490 nm. 430
431
Electrophoretic mobility shift assay (EMSA) 432
The DNA-σ factor binding by EMSA was carried out as described previously (51). DNA 433
fragment derived from the upstream region of usfX containing the predicted SigF-specific 434
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
20
promoter sequence (11, 16) was amplified from the M. tuberculosis H37Rv genome using 435
specific primers (Table 1). After purification, the 118-bp PCR product (1μg) was labeled with T4 436
polynucleotide kinase (Roche Applied Science) and [γ-32
P] ATP (BRIT, India), as per 437
manufacturer’s instructions. Radiolabeled PCR fragment was purified free of [γ-32
P] ATP and 438
PNK using nucleotide removal kit (Qiagen). EMSAs were performed by incubation of 0.2U E. 439
coli core polymerase enzyme (Epicentre Technologies) (11, 12) with varying concentrations of 440
purified SigF and pSigF in binding buffer (50 mM Tris–HCl, pH 8.0, 50 mM KCl 10 mM 441
MgCl2, 0.1 mM EDTA, 0.1 mM dithiothreitol, 5% v/v Glycerol) at 37°C for 10 min followed by 442
addition of 0.03pmol labeled DNA probe. After incubation for additional 30 minutes, 6X DNA 443
loading buffer (Fermentas) was added and the reactions were electrophoresed at 4°C on 5% 444
nondenaturing polyacrylamide gels in 0.5X TBE buffer for 2 hr at 200V and visualized by 445
autoradiography (Personal Molecular Imager system, Biorad). To quantify the amount of DNA 446
bound, ImageQuant data analysis software was used. 447
448
Gene expression analysis 449
M. tuberculosis strains containing pTC-mcs, pTC0X1-Rv1364c and pTC0X1-Rv1364c-S600A 450
were grown in Sauton’s media. Osmotic stress treatment was performed as described in (24). 451
Cultures were subcultured at OD 0.05 in Sauton’s media, grown to 0.6 OD and then NaCl added 452
to a final concentration of 140 mM or an equal volume of water followed by incubation in a 453
shaker incubator for 1h at 37C. Cultures were harvested by addition of equal volumes of 4M 454
GITC followed by centrifugation. The culture pellet was resupended in Trizol LS and RNA 455
extracted as reported previously (52). cDNA synthesis was performed using random hexamers 456
and qRT-PCR was performed using gene specific primers listed in Table 1. 457
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
21
458
Acknowledgments: We would like to thank Rakesh Sharma, Bhupesh Taneja, and Rajesh S 459
Gokhale for useful discussions during the course of this work and Ulf Gerth for helping with the 460
mass spectrometry analysis. This work was funded by CSIR Task Force Projects BSC0403, 461
BSC0123, DST Purse Grant and JC Bose Fellowship (SERB) to YS.462
The authors declare no conflict of interest with the contents of this article. 463
Author contributions: SG and YS guided the study. RM and SG wrote the manuscript. RM 464
performed all experiments in E. coli and with recombinant proteins with contributions from GA, 465
RV, MG, SN, ABo, AM, AS; DM and NJ performed experiments in M. tuberculosis; CH and 466
DB performed the mass spectrometry analysis; RM and ABh performed phylogenetic analysis; 467
VR and VKN provided strains and reagents; VR, PK and VKN provided inputs in discussion. 468
469
REFERENCES 470
1. WHO. 2014. Global tuberculosis report. World Health Organization, Geneva; 2014. 471
2. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV, Eiglmeier 472
K, Gas S, Barry CE, 3rd, Tekaia F, Badcock K, Basham D, Brown D, Chillingworth T, 473
Connor R, Davies R, Devlin K, Feltwell T, Gentles S, Hamlin N, Holroyd S, Hornsby T, 474
Jagels K, Krogh A, McLean J, Moule S, Murphy L, Oliver K, Osborne J, Quail MA, 475
Rajandream MA, Rogers J, Rutter S, Seeger K, Skelton J, Squares R, Squares S, Sulston 476
JE, Taylor K, Whitehead S, Barrell BG. 1998. Deciphering the biology of 477
Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537-44. 478
3. Rodrigue S, Provvedi R, Jacques PE, Gaudreau L, Manganelli R. 2006. The sigma factors 479
of Mycobacterium tuberculosis. FEMS Microbiol Rev 30:926-41. 480
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
22
4. Sachdeva P, Misra R, Tyagi AK, Singh Y. 2010. The sigma factors of Mycobacterium 481
tuberculosis: regulation of the regulators. FEBS J 277:605-26. 482
5. DeMaio J, Zhang Y, Ko C, Young DB, Bishai WR. 1996. A stationary-phase stress-483
response sigma factor from Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 484
93:2790-4. 485
6. Keren I, Minami S, Rubin E, Lewis K. 2011. Characterization and transcriptome analysis 486
of Mycobacterium tuberculosis persisters. MBio 2:e00100-11. 487
7. Geiman DE, Kaushal D, Ko C, Tyagi S, Manabe YC, Schroeder BG, Fleischmann RD, 488
Morrison NE, Converse PJ, Chen P, Bishai WR. 2004. Attenuation of late-stage disease 489
in mice infected by the Mycobacterium tuberculosis mutant lacking the SigF alternate 490
sigma factor and identification of SigF-dependent genes by microarray analysis. Infect 491
Immun 72:1733-45. 492
8. Chen P, Ruiz RE, Li Q, Silver RF, Bishai WR. 2000. Construction and characterization 493
of a Mycobacterium tuberculosis mutant lacking the alternate sigma factor gene, sigF. 494
Infect Immun 68:5575-80. 495
9. Karls RK, Guarner J, McMurray DN, Birkness KA, Quinn FD. 2006. Examination of 496
Mycobacterium tuberculosis sigma factor mutants using low-dose aerosol infection of 497
guinea pigs suggests a role for SigC in pathogenesis. Microbiology 152:1591-600. 498
10. Hartkoorn RC, Sala C, Uplekar S, Busso P, Rougemont J, Cole ST. 2012. Genome-wide 499
definition of the SigF regulon in Mycobacterium tuberculosis. J Bacteriol 194:2001-9. 500
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
23
11. Rodrigue S, Brodeur J, Jacques PE, Gervais AL, Brzezinski R, Gaudreau L. 2007. 501
Identification of mycobacterial sigma factor binding sites by chromatin 502
immunoprecipitation assays. J Bacteriol 189:1505-13. 503
12. Williams EP, Lee JH, Bishai WR, Colantuoni C, Karakousis PC. 2007. Mycobacterium 504
tuberculosis SigF regulates genes encoding cell wall-associated proteins and directly 505
regulates the transcriptional regulatory gene phoY1. J Bacteriol 189:4234-42. 506
13. Galagan JE, Minch K, Peterson M, Lyubetskaya A, Azizi E, Sweet L, Gomes A, Rustad 507
T, Dolganov G, Glotova I, Abeel T, Mahwinney C, Kennedy AD, Allard R, Brabant W, 508
Krueger A, Jaini S, Honda B, Yu WH, Hickey MJ, Zucker J, Garay C, Weiner B, Sisk P, 509
Stolte C, Winkler JK, Van de Peer Y, Iazzetti P, Camacho D, Dreyfuss J, Liu Y, Dorhoi 510
A, Mollenkopf HJ, Drogaris P, Lamontagne J, Zhou Y, Piquenot J, Park ST, Raman S, 511
Kaufmann SH, Mohney RP, Chelsky D, Moody DB, Sherman DR, Schoolnik GK. 2013. 512
The Mycobacterium tuberculosis regulatory network and hypoxia. Nature 499:178-83. 513
14. Minch KJ, Rustad TR, Peterson EJ, Winkler J, Reiss DJ, Ma S, Hickey M, Brabant W, 514
Morrison B, Turkarslan S, Mawhinney C, Galagan JE, Price ND, Baliga NS, Sherman 515
DR. 2015. The DNA-binding network of Mycobacterium tuberculosis. Nat Commun 516
6:5829. 517
15. Hecker M, Pane-Farre J, Volker U. 2007. SigB-dependent general stress response in 518
Bacillus subtilis and related gram-positive bacteria. Annu Rev Microbiol 61:215-36. 519
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
24
16. Beaucher J, Rodrigue S, Jacques PE, Smith I, Brzezinski R, Gaudreau L. 2002. Novel 520
Mycobacterium tuberculosis anti-sigma factor antagonists control sigmaF activity by 521
distinct mechanisms. Mol Microbiol 45:1527-40. 522
17. Parida BK, Douglas T, Nino C, Dhandayuthapani S. 2005. Interactions of anti-sigma 523
factor antagonists of Mycobacterium tuberculosis in the yeast two-hybrid system. 524
Tuberculosis 85:347-55. 525
18. Greenstein AE, MacGurn JA, Baer CE, Falick AM, Cox JS, Alber T. 2007. M. 526
tuberculosis Ser/Thr protein kinase D phosphorylates an anti-anti-sigma factor homolog. 527
PLoS Pathog 3:e49. 528
19. Sachdeva P, Narayan A, Misra R, Brahmachari V, Singh Y. 2008. Loss of kinase activity 529
in Mycobacterium tuberculosis multidomain protein Rv1364c. FEBS J 275:6295-308. 530
20. Greenstein AE, Hammel M, Cavazos A, Alber T. 2009. Interdomain communication in 531
the Mycobacterium tuberculosis environmental phosphatase Rv1364c. J Biol Chem 532
284:29828-35. 533
21. Malik SS, Luthra A, Ramachandran R. 2009. Interactions of the M. tuberculosis UsfX 534
with the cognate sigma factor SigF and the anti-anti sigma factor RsfA. Biochim Biophys 535
Acta 1794:541-53. 536
22. Jaiswal RK, Manjeera G, Gopal B. 2010. Role of a PAS sensor domain in the 537
Mycobacterium tuberculosis transcription regulator Rv1364c. Biochem Biophys Res 538
Commun 398:342-9. 539
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
25
23. King-Scott J, Konarev PV, Panjikar S, Jordanova R, Svergun DI, Tucker PA. 2011. 540
Structural characterization of the multidomain regulatory protein Rv1364c from 541
Mycobacterium tuberculosis. Structure 19:56-69. 542
24. Hatzios SK, Baer CE, Rustad TR, Siegrist MS, Pang JM, Ortega C, Alber T, Grundner C, 543
Sherman DR, Bertozzi CR. 2013. Osmosensory signaling in Mycobacterium tuberculosis 544
mediated by a eukaryotic-like Ser/Thr protein kinase. Proc Natl Acad Sci U S A 545
110:E5069-77. 546
25. Chakraborti PK, Matange N, Nandicoori VK, Singh Y, Tyagi JS, Visweswariah SS. 547
2011. Signalling mechanisms in Mycobacteria. Tuberculosis 91:432-40. 548
26. Chao J, Wong D, Zheng X, Poirier V, Bach H, Hmama Z, Av-Gay Y. 2010. Protein 549
kinase and phosphatase signaling in Mycobacterium tuberculosis physiology and 550
pathogenesis. Biochim Biophys Acta 1804:620-7. 551
27. Park ST, Kang CM, Husson RN. 2008. Regulation of the SigH stress response regulon by 552
an essential protein kinase in Mycobacterium tuberculosis. Proc Natl Acad Sci U S A 553
105:13105-10. 554
28. Humpel A, Gebhard S, Cook GM, Berney M. 2010. The SigF regulon in Mycobacterium 555
smegmatis reveals roles in adaptation to stationary phase, heat, and oxidative stress. J 556
Bacteriol 192:2491-502. 557
29. Singh AK, Singh BN. 2008. Conservation of sigma F in mycobacteria and its expression 558
in Mycobacterium smegmatis. Curr Microbiol 56:574-80. 559
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
26
30. McNeil MM, Brown JM, Scalise G, Piersimoni C. 1992. Nonmycetomic Actinomadura 560
madurae infection in a patient with AIDS. J Clin Microbiol 30:1008-10. 561
31. Vertesy L, Ehlers E, Kogler H, Kurz M, Meiwes J, Seibert G, Vogel M, Hammann P. 562
2000. Friulimicins: novel lipopeptide antibiotics with peptidoglycan synthesis inhibiting 563
activity from Actinoplanes friuliensis sp. nov. II. Isolation and structural characterization. 564
J Antibiot (Tokyo) 53:816-27. 565
32. Wink JM, Kroppenstedt RM, Ganguli BN, Nadkarni SR, Schumann P, Seibert G, 566
Stackebrandt E. 2003. Three new antibiotic producing species of the genus 567
Amycolatopsis, Amycolatopsis balhimycina sp. nov., A. tolypomycina sp. nov., A. 568
vancoresmycina sp. nov., and description of Amycolatopsis keratiniphila subsp. 569
keratiniphila subsp. nov. and A. keratiniphila subsp. nogabecina subsp. nov. Syst Appl 570
Microbiol 26:38-46. 571
33. Marles-Wright J, Grant T, Delumeau O, van Duinen G, Firbank SJ, Lewis PJ, Murray 572
JW, Newman JA, Quin MB, Race PR, Rohou A, Tichelaar W, van Heel M, Lewis RJ. 573
2008. Molecular architecture of the "stressosome," a signal integration and transduction 574
hub. Science 322:92-6. 575
34. Reeves A, Martinez L, Haldenwang W. 2010. Expression of, and in vivo stressosome 576
formation by, single members of the RsbR protein family in Bacillus subtilis. 577
Microbiology 156:990-8. 578
35. Kim TJ, Gaidenko TA, Price CW. 2004. A multicomponent protein complex mediates 579
environmental stress signaling in Bacillus subtilis. J Mol Biol 341:135-50. 580
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
27
36. Barik S, Sureka K, Mukherjee P, Basu J, Kundu M. 2010. RseA, the SigE specific anti-581
sigma factor of Mycobacterium tuberculosis, is inactivated by phosphorylation-dependent 582
ClpC1P2 proteolysis. Mol Microbiol 75:592-606. 583
37. Shimizu M, Kato H, Ogawa T, Kurachi A, Nakagawa Y, Kobayashi H. 2010. Sigma 584
factor phosphorylation in the photosynthetic control of photosystem stoichiometry. Proc 585
Natl Acad Sci U S A 107:10760-4. 586
38. Locke JC, Young JW, Fontes M, Hernandez Jimenez MJ, Elowitz MB. 2011. Stochastic 587
pulse regulation in bacterial stress response. Science 334:366-9. 588
39. Garces A, Atmakuri K, Chase MR, Woodworth JS, Krastins B, Rothchild AC, Ramsdell 589
TL, Lopez MF, Behar SM, Sarracino DA, Fortune SM. 2010. EspA acts as a critical 590
mediator of ESX1-dependent virulence in Mycobacterium tuberculosis by affecting 591
bacterial cell wall integrity. PLoS Pathog 6:e1000957. 592
40. Waddell SJ, Chung GA, Gibson KJ, Everett MJ, Minnikin DE, Besra GS, Butcher PD. 593
2005. Inactivation of polyketide synthase and related genes results in the loss of complex 594
lipids in Mycobacterium tuberculosis H37Rv. Lett Appl Microbiol 40:201-6. 595
41. Klotzsche M, Ehrt S, Schnappinger D. 2009. Improved tetracycline repressors for gene 596
silencing in mycobacteria. Nucleic Acids Res 37:1778-88. 597
42. Gupta M, Sajid A, Arora G, Tandon V, Singh Y. 2009. Forkhead-associated domain-598
containing protein Rv0019c and polyketide-associated protein PapA5, from substrates of 599
serine/threonine protein kinase PknB to interacting proteins of Mycobacterium 600
tuberculosis. J Biol Chem 284:34723-34. 601
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
28
43. Sajid A, Arora G, Gupta M, Singhal A, Chakraborty K, Nandicoori VK, Singh Y. 2011. 602
Interaction of Mycobacterium tuberculosis elongation factor Tu with GTP is regulated by 603
phosphorylation. J Bacteriol 193:5347-58. 604
44. Koul A, Choidas A, Tyagi AK, Drlica K, Singh Y, Ullrich A. 2001. Serine/threonine 605
protein kinases PknF and PknG of Mycobacterium tuberculosis: characterization and 606
localization. Microbiology 147:2307-14. 607
45. Khan S, Nagarajan SN, Parikh A, Samantaray S, Singh A, Kumar D, Roy RP, Bhatt A, 608
Nandicoori VK. 2010. Phosphorylation of enoyl-acyl carrier protein reductase InhA 609
impacts mycobacterial growth and survival. J Biol Chem 285:37860-71. 610
46. Molle V, Leiba J, Zanella-Cleon I, Becchi M, Kremer L. 2010. An improved method to 611
unravel phosphoacceptors in Ser/Thr protein kinase-phosphorylated substrates. 612
Proteomics 10:3910-5. 613
47. Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK, Singh Y. 2003. 614
Cytotoxic activity of nucleoside diphosphate kinase secreted from Mycobacterium 615
tuberculosis. Eur J Biochem 270:625-34. 616
48. Molle V, Soulat D, Jault JM, Grangeasse C, Cozzone AJ, Prost JF. 2004. Two FHA 617
domains on an ABC transporter, Rv1747, mediate its phosphorylation by PknF, a Ser/Thr 618
protein kinase from Mycobacterium tuberculosis. FEMS Microbiol Lett 234:215-23. 619
49. Singhal A, Arora G, Sajid A, Maji A, Bhat A, Virmani R, Upadhyay S, Nandicoori VK, 620
Sengupta S, Singh Y. 2013. Regulation of homocysteine metabolism by Mycobacterium 621
tuberculosis S-adenosylhomocysteine hydrolase. Sci Rep 3:2264. 622
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
29
50. Lu YB, Ratnakar PV, Mohanty BK, Bastia D. 1996. Direct physical interaction between 623
DnaG primase and DnaB helicase of Escherichia coli is necessary for optimal synthesis 624
of primer RNA. Proc Natl Acad Sci U S A 93:12902-7. 625
51. Huang X, Lopez de Saro FJ, Helmann JD. 1997. Sigma factor mutations affecting the 626
sequence-selective interaction of RNA polymerase with -10 region single-stranded DNA. 627
Nucleic Acids Res 25:2603-9. 628
52. Gandotra S, Schnappinger D, Monteleone M, Hillen W, Ehrt S. 2007. In vivo gene 629
silencing identifies the Mycobacterium tuberculosis proteasome as essential for the 630
bacteria to persist in mice. Nat Med 13:1515-20. 631
632
Tables 633
Table 1: Primers used in this study 634
Primer Name Primer Sequence (5׳3
׳) **
Rv1364c N448A F.P TCCGAATTCGTCGAGGCCGCGGTCGAACACGGATAC
Rv1364c N448A R.P GTATCCGTGTTCGACCGCGGCCTCGACGAATTCGGA
Rv1364c E444A F.P CGTGCACGCGATCTCCGCATTCGTCGAGAACGCG
Rv1364c E444A R.P CGCGTTCTCGACGAATGCGGAGATCGCGTGCACG
Rv1364c S600A F.P GTCACCCACCTTGGTGCGGCCGGCGTCGGCGCC
Rv1364c S600A R.P GGCGCCGACGCCGGCCGCACCAAGGTGGGTGAC
Rv1364c S600E F.P GTCACCCACCTTGGTGAGGCCGGCGTCGGCGCC
Rv1364c S600E R.P GGCGCCGACGCCGGCCTCACCAAGGTGGGTGAC
PknD D138N F.P GGCGTAACGCACCGCAACGTAAAACCGG
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
30
PknD D138N R.P CCGGTTTTACGTTGCGGTGCGTTACGCC
pETDuet_SigF_F.P CGACGGGCGGCATCAAGCTTGTGACGGCGCGCGC
pETDuet_SigF_R.P CTCGCCGAGATCAAGTAGGCGGCCGCCTACTCCAACTGAT
CCCG
pGEX_SigF_F.P GCCCGACGGGCGGGATCCAGCAGGTGACGG
pGEX_SigF_R.P CTCGCCGAGATCAAGTAAGGCGGCCGCCTACTCCAACTGA
TCCCG
pGEX_Rv0516c_F.P CGACGGAGAACGAGGATCCTGATGACTACCACGATCCC
pGEX_Rv0516c_R.P CACAACGACGACCCGCGGCCGCTTTAGGCTGACC
pMAL_1364_F.P GGTCCGTAGGAGGGACGGATCCATGGCGGCCGAAATGG
pMAL_1364_R.P CGTGCAGGCTCGTTGAAGCTTCTACTCCTGGGCGAAGATG
pACDuet_PknD F.P GACCTAGTGAAGGGAATTCGCATATGAGCGATGCCGTTCC
G
pACDuet_PknD R.P GCCGACGACGGCCTCGAGCTTCCGTTTGTTGCCGGC
pACDuet_Rv1364c
F.P
GTCCGTAGGAGGGATCCCCAAATGGCGGCCGAAATGG
pACDuet_Rv1364c
R.P
CCGTGCAGGCTCGTTGAAGCTTCTACTCCTGGGCGAAG
Promoter_SigF F.P GCGGCTGGAAATCCCGGCATCGCGGG
Promoter_SigF R.P GGTCGGACCTGCTGGTAGTGGGGATCTAACGC
Rv1364c_RTF TCGGTGCGGCCGAGGATGTACG
Rv1364c_RTR TAGACCTCCCGAGCGGGCTGTC
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
31
16S rRNA_RTF TACGTTCCCGGGCCTTGT
16S rRNA_RTR AATCGCCGATCCCACCTT
espA_RTF TCCGGGTGATGGCTGGTTAG
espA_RTR GGTCGTGGATCAGGCTGATG
pks6_RTF CGTAGTGCTGACTCGTTAAG
pks6_RTR TCGGTCAGAAAGTCCCATAG
635
Table2: Plasmids used in this study 636
Strain/Plasmid
construct Description Source
Escherichia coli DH5α E. coli strain used for cloning Novagen, USA
Escherichia coli BL21
(DE3) E. coli strain used for protein expression Stratagene, USA
pProEx-HTc E. coli Expression vector with N-terminal
His6-tag Invitrogen
pProEx-HTc-Rv1364c
(Rv1364c) His6-Rv1364c1-653 (full length) (19)
pProEx-HTc-Rv1364c
D211A (Rv1364c
D211A)
His6- Rv1364c1-653 carrying mutation in
phosphatase domain at 211 residue Asp
to Ala
(19)
pProEx-HTc-Rv1364c
D328A (Rv1364c
D328A)
His6- Rv1364c1-653 carrying mutation in
phosphatase domain at 328 residue Asp
to Ala
(19)
pProEx-HTc-Rv1364c
E444A (Rv1364c
E444A)
His6- Rv1364c1-653 carrying mutation in
kinase domain at 444 residue Glu to Ala This study
pProEx-HTc-Rv1364c
N448A (Rv1364c
N448A)
His6- Rv1364c1-653 carrying mutation in
kinase domain at 448 residue Asn to Ala This study
pProEx-HTc-Rv1364c
S600A (Rv1364c
S600A)
His6- Rv1364c1-653 carrying mutation in
substrate domain at 600 residue Ser to
Ala
This study
pProEx-HTc-Rv1364c
S600E (Rv1364c S600E)
His6- Rv1364c1-653 carrying mutation in
substrate domain at 600 residue Ser to
Glu
This study
pProEx-HTc-PknAcat His6-PknA1-337 (cytosolic domain) (43)
pProEx-HTc-Pstpc His6-Pstp1-300 (cytosolic domain) (42)
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
32
pLCD1-SigF His6-SigF Kind gift from
Dr. W.R. Bishai
pGEX-5X-3 E. coli Expression vector with N-
terminal Glutathione S-Transferase tag GE Healthcare
pGEX-5X-3-Rv1365c
(Rv1365c)
GST-Rv1365c1- 128 (full length) cloned
into BamHI/XhoI This study
pGEX-5X-3-Rv1904
(Rv1904)
GST-Rv19041-143 (full length) cloned
into BamHI/XhoI This study
pGEX-5X-3-Rv2638
(Rv2638) GST-Rv26381-148 (full length) (19)
pGEX-5X-3-Rv3687c
(Rv3687c) GST-Rv3687c1-122 (full length) (19)
pGEX-5X-3-
Rv1364cKD (G-
Rv1364cKD)
GST-Rv1364cc398-544 (kinase domain of
Rv1364c)
(19)
pGEX-5X-3-Rv3287c
(G-UsfX)
GST-Rv3287c1-145 (full length) cloned
into BamHI/NotI (19)
pGEX-5X-3-Rv3286c
(G-SigF) GST-Rv3286c1-261 (full length) This study
pGEX-5X-3-PknBc
(PknB) GST-PknB1-331 (cytosolic domain) (42)
pGEX-5X-3-PknDc
(PknD) GST-PknD1-378 (cytosolic domain) (43)
pGEX-5X-3-PknDc
D138N (PknDD138N)
GST-PknD1-378 carrying mutation in
kinase domain at 138 residue This study
pGEX-5X-3-PknE
(PknE) GST-PknE1-566 (full length protein) (43)
pGEX-5X-3-PknF
(PknF) GST-PknF1-476 (full length protein) (44)
pGEX-5X-3-PknG
(PknG) GST-PknG1-750 (full length protein) (44)
pGEX-5X-3-PknHc
(PknH) GST-PknH1-403 (cytosolic domain) (43)
pGEX-5X-3-Rv0516c GST- Rv0516c1-158 (full length) This study
pMAL-c2x E.coli expression vector with MBP tag NEB
pMAL-Rv1364c Rv1364c cloned into BamHi/HindIII This study
pETDuet-1™
E. coli dual expression vector, Two
multiple cloning sites (MCS1 and
MCS2), each preceded by an
independent T7 promoter
Novagen
pETDuet-MBP MBP tag cloned into Nde/EcoRV of
MCS2 (45)
pETDuet-MBP-
PknDKD
MBP-PknD Kinase domain cloned into
Nde/EcoRV of MCS2 (45)
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
33
pETDuet-MBP-SigF SigF cloned into HindIII/NotI of MCS1
of pETDuet-MBP This study
pETDuet-MBP-
PknDKD-SigF
SigF cloned into HindIII/NotI of MCS1
of pETDuet-MBP-PknDKD This study
pACYC Duet-1™
E. coli dual expression vector, Two
multiple cloning sites (MCS1 and
MCS2), each preceded by an
independent T7 promoter, ChlR
Novagen
pACDuet-PknDKD PknD Kinase domain cloned into
Nde/XhoI of MCS2 This study
pACDuet-Rv1364c His6-Rv1364c cloned into
BamHI/HindIII of MCS1
This study
pACDuet- PknDKD-
Rv1364c
PknD Kinase domain cloned into
Nde/XhoI of MCS2 and His6-Rv1364c
cloned into BamHI/HindIII of MCS1
This study
pCR-blunt E. coli blunt cloning vector. Invitrogen
pTC0X1L Mycobacterial integrative expression
vector, containing UV15tetO promoter,
kanr.
Addgene (41)
pTC-mcs Mycobacterial integrative vector, kanr. Addgene (41)
pTC0X1-Rv1364c Rv1364c was cloned at NdeI-PsiI site of
pTC0X1L plasmid.
This study
637
638
Figure Legends 639
Figure 1: Conserved ATPase and autophosphorylation activity in Rv1364c and effect on 640
interaction with SigF (A) Thin layer chromatography and autoradiography based ATPase 641
activity of purified Rv1364c, its indicated variants or the positive control, Rv1747 possessing the 642
ATPase domain, at 0 min and 60 min post incubation with [α-32
P] ATP. Buffer alone acted as 643
negative control, SD=substrate domain of Rv1364c, PD=phosphatase domain of Rv1364c. Graph 644
in the lower panel indicates relative ADP formation, measured using densitometry and expressed 645
as a percentage of activity of the wild type protein. The results from three independent 646
experiments are presented here as mean ± SEM. (B) Pro-Q®
diamond staining of recombinant 647
Rv1364c and its variants. Pro-Q®
diamond staining indicates phosphorylation level while 648
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
34
SYPRO Ruby stains total protein. Graph in the lower panel indicates ratio of the two densities 649
normalized for each protein variant to that of wild type protein. Data are mean of three 650
independent experiments, each in triplicate (mean ± SEM). ANOVA and Dunnette’s post test 651
was used to compare all groups to wild type Rv1364c (***p<0.001, **p<0.01, *p<0.05, ns=not 652
significant). (C) His6-tagged Rv1364c and its phosphoablative variant Rv1364c S600A were 653
immobilized (500 ng/well) on the surface of the microtiter plate and challenged with increasing 654
concentrations (0–1000 ng) of GST-tagged fusion proteins, SigF and GST alone (negative 655
control) in solution. The error bars indicate mean ± SD of triplicate readings. 656
657
Figure 2: PknD phosphorylates both Rv1364c and SigF (A) In vitro kinase assay of Rv1364c 658
with STPK, PknD. Digestion of the reaction products with TEV protease resolves 659
phosphorylation of Rv1364c WT/S600A and PknD. Phosphorylation of Rv1364cS600A by 660
PknD reveals a site distinct from the conserved autophosphorylation site. (B) In vitro kinase 661
assay of Rv1364c with WT PknD, WT PknD in presence of inhibitor, SP600125 and kinase-dead 662
mutant PknDD138N. Loss of phosphorylation by the PknD inhibitor and kinase-dead PknD shows 663
that PknD specifically phosphorylates Rv1364c. Rv0516c was included as a positive control. (C) 664
In vitro kinase assay of M. tuberculosis STPKs (labeled on top) to check phosphorylation of SigF 665
in presence of [γ-32
P]-ATP. Arrow indicates SigF. (D) In vitro kinase assay of SigF with WT 666
PknD and its kinase-dead mutant PknDD138N also shows specificity of PknD-mediated 667
phosphorylation of SigF. Autoradiograph (lower panel) of PknD phosphorylated Rv1364c (E) 668
and SigF (F) after incubation with purified M. tuberculosis phosphatase PstP for indicated times 669
at 25C shows reversibility of the PknD mediated phosphorylation. Top panel indicates equal 670
amount of protein in all lanes based on Coomassie brilliant blue (CBB) staining. Lower panels 671
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
35
are the autoradiograph images of the same dried protein gel visualized by PhosphorImager FLA 672
2000/ GE Typhoon Trio Imager. 673
674
Figure 3: PknD-mediated phosphorylation leads to decreased Rv1364c-SigF binding in vitro 675
Rv1364c (His6-tagged) and SigF (GST tagged) purified from cultures co-expressing MBP alone 676
and MBP-PknD were evaluated for their phosphorylation by (A) Pro-Q®
diamond staining, (B) 677
two-dimensional gel electrophoresis and interaction by (C) ELISA. (A) Top panel is the Pro-Q®
678
diamond stained gel and lower panel is coomassie brilliant blue staining of same gel. pG-SigF 679
and pRv1364c refer to the phosphorylated form of the proteins obtained from cultures co-680
expressing PknD. (B) Two-dimensional gels of Rv1364c protein purified from E. coli 681
overexpressing pACYC-PknD-Rv1364c (upper panel) or pACYC-Rv1364c (lower panel). 682
Approximately 500pg of precipitated proteins were resolved on a 7-cm pH 4–7 linear gradient 683
followed by second dimension on 10% SDS-polyacrylamide gels and subjected to 684
immunoblotting with anti-Rv1364c antibody. Rv1364c co-expressed with PknD in E. coli gets 685
phosphorylated in vivo and shows additional acidic phospho-isoforms compared to the PknD-686
naïve condition. (C) His6-tagged Rv1364c/pRv1364c was immobilized (500 ng/well) on the 687
surface of the microtiter plate and challenged with increasing concentrations (0–1000 ng) of 688
GST-tagged SigF/pG-SigF in solution. GST alone acted as negative control. The values were 689
normalized with the negative control, GST. Inset shows the same experiment with only the 690
phosphorylated forms of interacting proteins, pRv1364c and pG-SigF. The error bars indicate 691
mean±SD of three independent experiments each with three technical replicates. Student’s t-test 692
was applied for comparing means across groups (*p<0.05, **p<0.01). 693
694
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
36
Figure 4: Phosphorylated SigF binds tightly to target gene promoter A, Binding of SigF to 695
sigF promoter in presence of E. coli core RNA polymerase measured using EMSA. B and C, E. 696
coli core RNA polymerase recruitment by SigF or pSigF to sigF promoter measured using 697
EMSA. The percentage of DNA in complex was calculated using the formula: [100*bound 698
probe/total probe]. Bar graph represents mean± SD from three independent experiments (C). D 699
and E, Strength and specificity of DNA binding by SigF-RNA polymerase versus pSigF-RNA 700
polymerase complexes measured by EMSA. The percentage of released DNA was calculated 701
using the formula: 100*[1-{(free probe-SigF-free probe+SigF0
)/ (free probe-SigF-free probe+SigFx
)}timec] 702
where 0 refers to no competing probe and x refers to a particular amount of competing probe. 703
Bar graph represents mean± SD from four independent experiments (E). T-test was used for 704
comparing means between SigF and pSigF for each DNA concentration (*p<0.05, **p<0.01, 705
***p<0.001). 706
707
Figure 5: Rv1364c regulates virulence factor espA under osmotic stress. 708
Relative expression of Rv1364c, espA, and pks6 as measured by qRT-PCR in M. tuberculosis 709
cultures harboring pTC0X1-Rv1364c versus pTC-mcs, in presence or absence of osmotic stress. 710
Cultures were exposed to 140mM NaCl for 1h to induce osmotic stress. Gene expression is 711
normalized to 16S rRNA expression. Values are mean±SEM from six independent cultures. T-712
test was used for comparing means between indicated groups (ns=not significant, *p<0.05, 713
**p<0.01). 714
715
Figure 6: Schematic representation of regulation of SigF in M. tuberculosis (A) Domain 716
architecture of Rv1364c indicating each of its domains. (B) Model of SigF regulation based on 717
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from
Multimode SigF regulation in M. tuberculosis
37
previous studies (16, 18, 19, 24) and results from the current study. Two anti- factors, the 718
cognate UsfX and the multidomain regulator Rv1364c, bind to and negatively regulate SigF, the 719
M. tuberculosis homolog of B. subtilis SigB. Osmotic stress stimulated activation of PknD may 720
lead to phosphorylation of Rv1364c and SigF, thereby affecting their ability to interact with each 721
other and releasing SigF. Both the native unphosphorylated and phosphorylated SigF can recruit 722
RNA polymerase and may possibly control different genes of its regulon in response to osmotic 723
stress. Overexpression of Rv1364c may either increase expression of some genes such as pks6 or 724
negatively influence expression of others such as espA, suggesting influence of other SigF 725
regulators that can directly interact with Rv1364c and influence SigF regulon. 726
on February 5, 2021 by guest
http://jb.asm.org/
Dow
nloaded from