Draft · 2020. 5. 8. · 67 oxidation reduction potential (ORP) (Saby et al. 2003), the anaerobic solid retention 68 time (SRTASSR) (Semblante et al., 2016; Cheng et al. 2018a), side-stream

Draft

Effects of bioporous carriers on the performance and microbial community structure in side-stream anaerobic

membrane bioreactors

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2019-0632.R2

Manuscript Type: Article

Date Submitted by the Author: 22-Mar-2020

Complete List of Authors: Bin , Zhang; School of food and biotechnology, Xihua UniversityJiao, Yue; Xihua UniversityYu, Guo; Sichuan University of Science and EngineeringTaixin, Liu; Sichuan University of Science and EngineeringMin, Zhou; Sichuan University of Science and EngineeringYing, Yang; Sichuan University of Science and EngineeringJiaxu , Wu; Sichuan University of Science and EngineeringYang , Zeng; Sichuan University of Science and EngineeringXinqiang, Ning; Sichuan University of Science and Engineering,

Keyword: Anaerobic side-stream reactor; Porous carriers; Sludge reduction; Microbial community

Is the invited manuscript for consideration in a Special

Issue? :Not applicable (regular submission)

Note: The following files were submitted by the author for peer review, but cannot be converted to PDF. You must view these files (e.g. movies) online.

Figures.rar

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

1 Effects of bioporous carriers on the performance and microbial

2 community structure in side-stream anaerobic membrane

3 bioreactors

4 Bin Zhanga, c, Jiao Yuea, Yu Guob, Taixin Liub, Min Zhoub, Ying Yangb, Jiaxu Wub, Yang Zengb,

5 Xinqiang Ningb

6 a School of Civil Engineering and Construction and Environment, Xihua University, Chengdu

7 610039, China;

8 b School of Civil Engineering, Sichuan University of Science & Engineering, Zigong 643000,

9 China;

10 c School of food and biotechnology, Xihua University, Chengdu 610039, China

11 Corresponding author: X.Q. Ning

12 E-mail addresses: [email protected]

13 Bin Zhang and Jiao Yue contributed equally to this manuscript.

Page 1 of 49



mailto:[email protected]

Draft

2

15 Abstract: The aim of this study was to investigate the effects of volcanic rock

16 porous carriers (VRPC) on sludge reduction, pollutant removal and microbial

17 community structure in an anaerobic side-stream reactor (ASSR). Three lab-scale

18 membrane bioreactors (MBRs), including an anoxic-oxic MBR(AO-MBR) that served

19 as control(C-MBR), an ASSR coupled MBR (A-MBR), an A-MBR filled with VRPC

20 (FA-MBR) were stably and simultaneously operated for 120 day. The effect of the

21 three reactors on the removal of COD was almost negligible (all greater than 95%),

22 but the average removal efficiency of NH4+-N, TN, and TP was significantly

23 improved by the insertion of an ASSR, especially when the ASSR was filled with

24 VRPC. Finally, A-MBR and FA-MBR achieved 16.2% and 26.4% sludge reduction

25 rates, with observed sludge yield Yobs of 0.124 and 0.109 g SS/g COD, respectively.

26 Illumina-MiSeq sequencing revealed that microbial diversity and richness were

27 highest in the VRPC, indicating that a large number of microorganisms formed on the

28 carrier surface in the form of a biofilm. Abundant denitrifying bacteria (Azospira,

29 Comamonadaceae_unclassified and Flavobacterium) were immobilized on the carrier

30 biofilm, which contributed to increased nitrogen removal. The addition of VRPC to

31 the ASSR successfully immobilized abundant hydrolytic, fermentative and

32 slow-growing microorganisms, which all contributed to reductions in sludge yield.

33

34 Keywords: Anaerobic side-stream reactor; Porous carriers; Sludge reduction;

35 Microbial community

36

Page 2 of 49



Draft

3

37 Introduction

38 The biological treatment of conventional activated sludge (CAS) is a common

39 procedure in the treatment of domestic and industrial wastewater treatment plants

40 (WWTPs) (De Oliveira et al. 2018; Niu et al. 2016). However, the increasing quantity

41 of waste activated sludge (WAS) produced during this process has become a critical

42 issue with recent dramatic increases in the quantities of wastewater and more stringent

43 environmental constraints (Ferrentino et al. 2019). Activated sludge contains active

44 (live) and inactive (dead) microorganisms that must be treated before disposal to

45 prevent adverse health and environmental effects on the public, and subsequent

46 treatment and disposal of WAS accounts for 25%--65% of plant operating costs

47 (Ferrentino et al. 2016a; Semblante et al. 2014). Given economic and environmental

48 pressures, a cost-effective strategy for removing and reducing sludge production is

49 urgently needed in wastewater treatment (An et al. 2017). The sludge in situ reduction

50 (SIR) strategy has been widely promoted and implemented throughout the wastewater

51 treatment industry and is considered a promising approach to minimize WAS

52 production within biological wastewater treatment, rather than struggling with

53 posterior sludge treatment and disposal (Pang et al. 2018; Zheng et al. 2019a).

54 Recently, much research has been conducted on biological SIR techniques (Zhou et al.

55 2014). Among several sludge reduction strategies, the biological SIR process that

56 involves an anaerobic side-stream reactor (ASSR) placed in the sludge return loop

57 provides a particularly promising approach for reducing sludge, as this technique can

58 remove sludge without producing negative impacts on pollutant removal and sludge

Page 3 of 49



Draft

4

59 dewaterability (Zheng et al. 2019a). Indeed, previous studies have demonstrated the

60 efficiency of a laboratory-scale ASSR process in sludge reduction: ASSR processes

61 can reduce sludge yield by 40%-- 60% compared to CAS processes (Ferrentino et al.

62 2016b). The combination of membrane bioreactors (MBRs) with ASSR technology

63 provides a particularly promising means of sludge reduction by preventing the

64 deterioration of effluent quality, enhancing biological metabolism and reducing

65 footprint requirements (Cheng et al. 2017).

66 To date, most research has focused on the effect of several parameters, such as

67 oxidation reduction potential (ORP) (Saby et al. 2003), the anaerobic solid retention

68 time (SRTASSR) (Semblante et al., 2016; Cheng et al. 2018a), side-stream ratio (Coma

69 et al. 2013) and aeration conditions (Haberdasher et al. 2015), on sludge reduction and

70 the performance of ASSRs. These studies have been critical for promoting practical

71 applications of ASSR technology and for deepening our understanding of sludge

72 reduction mechanisms. Possible mechanism of on-site sludge reduction in such

73 reactors, including energy uncoupling, endogenous decay, destruction of extracellular

74 polymers (EPS), biomass feasting/fasting and selective enrichment of bacterial

75 populations, have been discussed in previous studies (Semblante et al. 2014;

76 Ferrentino et al. 2016b). It is worth noting that sludge reduction in the ASSR process

77 is driven by the selection of different microbial communities as a result of sludge

78 exchange between different redox systems; thus, the structure of the microbial

79 community in ASSR systems is often different from that in CAS. From a

80 microbiological perspective, inserting an ASSR in the sludge return line induces the

Page 4 of 49



Draft

5

81 selection of the microbial community. Ning et al. (2014) used 454 pyrosequencing to

82 reveal that the accumulation of special fermentation bacteria and nitrifying bacteria in

83 an anoxic–oxic–settling–anaerobic (A+OSA) process may affect sludge reduction

84 performance and stable nitrogen removal. Zhou et al. (2015) found that anaerobic

85 bacteria, such as fermentative, hydrogenogenic and acidogenic bacteria were enriched

86 in an ASSR and played an important role in reducing sludge by biomass decay and

87 hydrolysis of particulate organic matter. Meanwhile, pyrosequencing analysis by

88 Cheng et al. (2017) has shown that a higher side-stream ratio (SR) favored the growth

89 of slow-growing bacteria, while a lower SR favored the enrichment of hydrolytic and

90 predatory bacteria. Ferrentino et al. (2019) observed that slow-growing, EPS-releasing

91 and predatory bacteria responsible for biomass decomposition survived in the external

92 anaerobic reactor. These findings indicated that the alternation of anaerobic and

93 aerobic environments resulted in the exchange of sludge biomass, promoted the

94 enrichment of functional microorganisms and reduced sludge yield. Therefore, more

95 detailed research was needed to address how functional microorganisms could be

96 enriched in the ASSR process to enhance sludge reduction performance and the

97 efficiency of pollutant removal.

98 Previous studies have shown that immobilization of activated sludge on a solid

99 carrier can significantly improve the density and biodiversity of microorganisms in

100 the treatment line, thereby improving the speed and depth of sewage treatment (Litti

101 et al. 2013; Zhang et al. 2016). Selection of an appropriate carrier type is critical for

102 the maintenance of the optimal active biomass and for fostering an ideal microbial

Page 5 of 49



Draft

6

103 population. Compared with other suspended carriers, porous carriers with large

104 surface area can ensure a high concentration of biomass and the effective enrichment

105 of functional microorganisms. Xing et al. (1999) found that the presence of

106 microorganisms immobilized on porous carriers could effectively decrease the time

107 needed for sludge acclimation as well as remove nitrogen compounds produced by

108 degradation of nitroaromatic hydrocarbons. Feng et al. (2008) detected protozoa and

109 metazoa, as well as rich nitrifying and denitrifying bacteria on porous biological

110 carriers of a sludge reduction fixed-bed bioreactor. Zhao et al. (2015) concluded that

111 adding carrier to duckweed system successfully immobilized abundant N-removing

112 microorganisms (mainly ammonia-oxidizing bacteria, nitrite oxidizing bacteria and

113 nitrogen-fixing bacteria), and contributed to higher nitrogen removal. Therefore, in

114 order to effectively enrich microorganisms related to sludge reduction and pollutant

115 removal, special porous biological carriers need to be added to the ASSR. Volcanic

116 rock porous carrier (VRPC) has the advantage of being permeable, having large

117 specific surface area, and being able to facilitate the immobilization and establishment

118 of a biofilm of microorganisms. Moreover, VRPC has no harmful effects on

119 immobilized microorganisms, and does not significantly affect the biological activity

120 of immobilized microorganisms. Therefore, the VRPC might prove useful to the

121 sewage treatment sludge reduction system.

122 In this study, three lab-scale MBRs, including an AO-MBR for control (C-MBR),

123 a MBR with ASSR (A-MBR) and a MBR with an ASSR filled with VRPC (FA-MBR)

124 were operated in parallel to evaluate the ability of VRPCs to reduce sludge and

Page 6 of 49



Draft

7

125 remove pollutants. The removal efficiency of organic matter, nitrogen, phosphorus

126 and sludge was monitored during 120 days of continuous and stable operation of the

127 reactor. High-throughput sequencing technology has been applied to detect the

128 structure of the microbial community and microbial populations in three reactors and

129 carriers. Overall, this study provides insight into the volcanic rock porous carriers

130 could be used to facilitate ASSR processes in reducing sludge yield.

131 Materials and methods

132 Experimental setup and operating conditions

133 The activated sludge used in the experiment was collected from the oxidation

134 ditch of a sewage treatment plant in Zigong, China. The mass concentration of

135 inoculated sludge mixed liquid suspended solids (MLSS) was about 5000 mg/L.

136 Before the experiment, the inoculated sludge was acclimated via several steps. First,

137 the sludge was screened and filtered three times. After aeration for 24 hours and

138 settling for two hours, approximately 1/3 of the supernatant was removed. Next, the

139 sludge was supplemented with an equal volume of synthetic wastewater. Then

140 continue the operation of aeration, sedimentation, drainage and injection of synthetic

141 wastewater. After 16 days of acclimation, the inoculated sludge gradually adapted to

142 the synthetic wastewater, indicating that the acclimation process was completed. In

143 this study, three lab-scale MBRs, including C-MBR, A-MBR and FA-MBR (Fig. 1)

144 were continuously fed with synthetic wastewater. Within 120 days of stable operation,

145 three reactors were placed in the same closed room, and the indoor temperature was

146 maintained at 25°C by an air conditioner. Three identical MBRs contained anoxic,

Page 7 of 49



Draft

8

147 oxic and membrane zone with effective volumes of 4, 13.5 and 4.7 L, respectively,

148 and their corresponding hydraulic retention times (HRTs) were 1.96, 6.62 and 2.3 h,

149 respectively. In the aerobic/membrane reactor, a blower connected to three thin

150 bubble diffusers was placed at the bottom to provide a supply of oxygen. This same

151 blower also provided air to the membrane to scour the fibers and thus reduce pollution.

152 Therefore, the level of dissolved oxygen (DO) of the aerobic zone was maintained at

153 2.0–4.0 mg/L, while the DO concentration of the membrane zone was maintained at

154 6.0–8.0 mg/L. A mechanical stirrer was placed in the anoxic tank to mix the activated

155 sludge.

156 In contrast to the C-MBR system, an ASSR with an available volume of 14.6L

157 was inserted into the sludge recycling line in the A-MBR and FA-MBR. The HRT

158 (volume of ASSR/sludge return flow) for the ASSRs lasted 6.95h in the A-MBR and

159 FA-MBR systems.The returned activated sludge line from the membrane to the

160 aerobic tank was pumped into the ASSRs at a flow rate equal to 2.1 L/h and then

161 recycled to the anoxic reactor. The ASSR module in the FA-MBR was packed with

162 VRPC at a packing ratio of 15.88% (v/v). This carrier is made of a natural porous

163 volcanic rock ore that has undergone a series of processes, such as ore dressing,

164 crushing, screening and grinding. Its main components are dozens of minerals such as

165 silicon, aluminium, calcium, and a few trace elements. According to the production

166 manual provided by the manufacturer, the diameter, pore size, porosity and specific

167 surface area of the carrier are 2–4cm, 1–5mm, 73–82%m2/g, respectively. The carriers

168 were evenly distributed on the wall of the pond around the ASSR and fixed in place

Page 8 of 49



Draft

9

169 with a tubular wire mesh, which is the same as the center of the anaerobic reactor. In

170 the three systems, the influent flow rate was maintained at 48.96L/d using peristaltic

171 pumps. To be consistent with previous studies, the interchange rate (the rate at which

172 solids passed through the ASSR) was controlled to be 100% of the influent flow rate,

173 while the mixed liquor recirculation ratio was maintained at 300% for denitrification

174 (Coma et al. 2013).

175 Analytical methods

176 Chemical oxygen demand (COD), total nitrogen (TN), ammonium nitrogen

177 (NH4+-N), nitrate nitrogen (NO3

--N), total phosphorus (TP) and total suspended solids

178 (TSS) and volatile suspended solids (VSS) in the influent and effluent were analyzed

179 every two days following standard methods. The mixed liquid samples were extracted

180 from the water inlet, anoxic zone, and the outlets of the MBRs and ASSRs for

181 analysis of soluble COD (SCOD), TN, NH4+-N, NO3

--N and TP once a week. Values

182 of DO, pH and ORP were monitored daily using an HQ30d portable meter (HACH,

183 USA).

184 One-way ANOVAs (α = 0.05) were used to compare differences between the

185 pollutants in the effluent of the three systems. Data were processed using Office Excel

186 2010 (Microsoft, USA).

187 Estimate of observed sludge yield

188 The observed sludge yield (Yobs, g MLSS/g COD) was calculated using the

189 following method (Ferrentino et al. 2018).

190 (1)

Page 9 of 49



Draft

10

191 The reduction in sludge after insertion of ASSRs was estimated by comparing

192 observed sludge production of the A-MBR, FA-MBR and C-MBR systems using the

193 following equation:

194 (2)

195 Where Yobs,ASSRS is the observed sludge yield of the A-MBR or FA-MBR reactor.

196 Following the method of Cheng et al. (2018a), the Spearman’s rank correlation

197 coefficient in the SPSS software package was used to estimate the correlated release

198 of substrate.

199 Microbial community analysis

200 DNA extraction and PCR amplification

201 Four sludge samples were collected from three MBRs (C-MBR, A-MBR and

202 FA-MBR) and sludge was attached on the surface of VRPC on Day 104 operations of

203 these three systems had reached their steady state. The sequencing of sludge samples

204 was completed using the Illumina-MiSeq platform (Majorbio Bio-Pharm Technology,

205 Shanghai, China) to characterize differences in the structure of the microbial

206 communities between the three MBRs. Samples were extracted and processed with

207 the E.Z.N.A. soil DNA kit (Omega, USA) following the manufacturer’s protocol. 16S

208 rRNA gene fragments containing V3 and V4 regions were amplified from the

209 template using primers the 338F (ACTCCTACGGGAGGCAGCAG) and 806R

210 (GGACTACHVGGGTWTCTAAT) (Niu et al. 2016; Cheng et al. 2017). Triplicate

211 PCR amplifications were performed in a 20μL reactor containing 4 μL of 5 × FastPfu

212 Buffer, 2μL of 2.5 mM dNTPs, 0.8μL of each primer (5 mM), 10 ng of Template

Page 10 of 49



Draft

11

213 DNA and 0.4μL FastPfu Polymerase. (TransGen AP221-02, Beijing, China). The

214 conditions for PCR were the following: initial denaturation at 94°C for for 3 min

215 followed by 27 cycles of 94°C for 30 sec; 55 °C for 30 s and 72 °C for 45 s; and a

216 final extension at 72°C for 10 min. After PCR amplification, 2% agarose gel was

217 formulated to detect the triplicate products for each sample; products were recovered

218 with an AxyPrep DNA Purification Kit (Axygen Biosciences, USA).

219 MiSeq sequencing

220 After purification, PCR products were assayed using the Illumina Miseq platform

221 according to standard protocols outlined by Majorbio Bio-Pharm Technology. To

222 obtain the effective sequence database for each sample, all raw sequences were

223 trimmed and removed for random sequencing errors and low-quality sequences

224 following the method of Yuan et al. (2015). Finally, after filtering low quality reads,

225 primers were trimmed using SEQCLN and MOTHUR software.

226 Biodiversity analysis and phylogenetic classification

227 MOTHUR clustering software was used to generate the operational transform

228 unit (OTU) with a cluster similarity of 97%. OTU species identification was

229 compared with the SILVA prokaryotic ribosomal sequence library (Release128

230 http://www.arb-silva.de) with a confidence threshold set to 80%. The results from

231 pyrosequencing were then deposited into the NCBI short reads archive database

232 (accession No. SRP231106). Based on the clustering results, the following parameters

233 were obtained from the four samples using MOTHUR software: dilution curve, Chao

234 and Ace, Shannon and Simpson and Good's coverage (Cheng et al., 2017).

Page 11 of 49



http://www.arb-silva.de

Draft

12

235 Results

236 Pollutant removal and sludge reduction performance

237 Following microbial acclimation, the three reactors were stably operated for 120

238 days. The changes in concentration of the pollutants in the influent and effluent are

239 shown in Fig. 2. As shown in Fig. 2a, the influent COD concentration fluctuated

240 around 497.81 ± 67.08 mg/L, a one-way ANOVA showed that the C-MBR, A-MBR

241 and FA-MBR did not significantly differ (p=0.84) in removal efficiency, with average

242 COD concentrations in the effluent of 14.82 ± 9.67, 15.60 ± 10.94 and 14.44 ± 10.64

243 mg/L, respectively. Thus, the addition of an ASSR in the C-MBR had no noticeable

244 effect on the degradation of organic matter.

245 With an average NH4+-N concentration in the influent of 59.38 ± 8.54 mg/L, the

246 average removal efficiencies of NH4+-N in the C-MBR, A-MBR and FA-MBR were

247 98.4%, 99.42% and 99.32%, respectively. The results of a one-way ANOVA (p<0.01)

248 showed that there was a highly significant difference in the removal efficiency of

249 NH4+-N between the C-MBR and the other two systems; however, the addition of

250 VRPC to the ASSR did not have an effect on NH4+-N removal as there was no

251 significant difference in NH4+-N removal efficiency between the A-MBR and

252 FA-MBR.

253 The changes in TN concentration in the influent and effluent of the three reactors

254 are shown in Fig. 2c. The average effluent TN of the C-MBR, A-MBR and FA-MBR

255 were 26.56±13.49, 16.63±5.72 and 15.15±4.77 mg/L with corresponding removal

256 efficiencies of 63.66%, 77.24% and 79.27%, respectively. A one-way ANOVA

Page 12 of 49



Draft

13

257 (p<0.01) showed that there was a significant difference in TN concentration in the

258 three systems, indicating that the addition of ASSRs and VRPC enhanced nitrogen

259 removal.

260 Fig. 2d shows variation in TP concentration in the influent and effluent of the

261 three systems. Compared with the C-MBR with an average TP removal of 63.59%,

262 the A-MBR and FA-MBR facilitated higher TP removal efficiencies of 71.86% and

263 75.43%. According to a one-way ANOVA (p=0.028) of the three reactors, the

264 addition of ASSRs had a significant positive effect on the removal of TP.

265 As shown in Fig. 3, the curve plotting cumulative biomass and cumulative

266 substrate consumption was applied to fit a linear regression, and the value of Yobs was

267 determined by the slope of each linear regression curve. The highest Yobs of 0.148 g

268 SS/g COD was observed in the C-MBR, which was similar to the traditional MBR

269 with a Yobs of 0.135 g SS/g COD (Cheng et al. 2017). In the A-MBR and FA-MBR,

270 Yobs were 0.124 and 0.109 g SS/g COD, and the mean reduction in sludge was 16.2%

271 and 26.4% lower compared with the C-MBR. The sludge reduction efficiency

272 observed in the A-MBR is consistent with previous studies that have examined the

273 OSA process (6%–61%) (Zhou et al. 2015; Pang et al. 2018). The highest rate of

274 sludge reduction was observed in the FA-MBR system and suggested that the addition

275 of carriers to the ASSR reduces sludge production.

276 Analysis of microbial community structure

277 Richness and diversity of bacteria phylotypes

278 There were 40906(C-MBR), 40954(A-MBR), 41006(FA-MBR) and

Page 13 of 49



Draft

14

279 48688(VRPC) high quality sequence labels normalized to the average length of 416bp

280 for the four sludge samples. To compare the variability of each sample at the same

281 sequence depth, 40906 reads were normalized to each high-throughput datum for

282 further analysis. As shown in Table 1 and Fig.4, these sludge samples were calculated

283 at the 97% classification level for the OTU, Chao1 and Shannon diversity indices of

284 the microbial community. The coverage indexes of the four sludge samples were

285 greater than 0.95, indicating that the sequencing depth attained expected requirements

286 and that the OTU of each processed sludge sample could be used to effectively

287 characterize the microbial community. Fig. 4, the number of OTUs in the sludge

288 samples of the three systems was 625 (C-MBR), 760 (A-MBR) and 799 (FA-MBR),

289 respectively, compared with 1163 in the VRPC. Furthermore, the number of OTUs

290 shared by the four samples was 446, and the unique number of OTUs in carriers was

291 as large as 304, accounting for 26.14% of the total number of OTUs. The results

292 suggest that the biomass attached to the carrier in the fluidized sludge reactor

293 increases due to the large specific surface area. After long-term domestication,

294 biofilms formed on the VRPC are more biodiverse. In contrast, the number of OTUs

295 unique to the FA-MBR system was 2.13% lower than that of the C-MBR and A-MBR,

296 (4.64% and 2.24%, respectively), indicating that more OTUs were shared by different

297 communities after filling the ASSR with VRPC. In Table 1, comparison of the

298 richness index (Ace and Chao) indicated that the microbial abundance in the A-MBR

299 and FA-MBR was significantly increased following the addition of ASSR.

300 Interestingly, there was a slight difference in the microbial richness and diversity

Page 14 of 49



Draft

15

301 between the A-MBR and FA-MBR, indicating that the addition of VRPC possibly had

302 an impact on the structure of the microbial communities in these systems. Meanwhile,

303 the higher Shannon index in the FA-MBR confirmed that the microbial community

304 was more diverse and more evenly distributed than that of the A-MBR. Notably,

305 VRPC had the highest Ace, Chao and Shannon values out of all of the samples with

306 1308, 1331 and 5.22, respectively. This finding indicated that a stable biofilm was

307 formed on the surface of the carrier with a higher microbial richness and diversity

308 compared with other sludge samples.

309 Classification complexity of microbial communities

310 To characterize the predominant bacterial taxa in the three MBR systems, we

311 made comparisons of microbial community structure at different taxonomic levels

312 from phylum to genus (Fig. 5). A total of 25, 30 and 32 bacterial phyla were identified

313 in the C-MBR, A-MBR and FA-MBR, respectively, whereas 43 identified phyla were

314 recovered from the VRPC. As shown in Fig. 5a, Proteobacteria (19.55%–48.73%),

315 Bacteroidetes (17.20%–37.51%) and Saccharibacteria (12.24%–33.60%) were the

316 most dominant phyla in the three samples, which is consistent with the findings of a

317 previous study (Pang et al. 2018). Proteobacteria achieved its highest relative

318 abundance in the C-MBR (48.73%). In contrast, Bacteroidetes had the lowest relative

319 abundance and only accounted for 17.2% of bacterial taxa detected. In anaerobic

320 environments, Proteobacteria induce cell lysis and release intracellular substances,

321 while Bacteroidetes utilize the secondary substrate for hydrolytic fermentation and

322 growth (Cheng et al. 2018b). Saccharibacteria, which was clearly enriched in the

Page 15 of 49



Draft

16

323 FA-MBR as it represented 33.60% of bacterial taxa detected, has been documented to

324 be a specialized epiphytic parasite that grows on the surface of host bacteria (Bor et al.

325 2016). Actinobacteria and Chloroflexi have been found to be associated with the

326 degradation of organic matter (Xie et al. 2014); indeed, Actinobacteria and

327 Chloroflexi were most abundant in the FA-MBR and made up 13.76% and 5.35% of

328 bacterial taxa detected, respectively. This finding indicated that the addition of

329 carriers to anaerobic side-stream reactors increased the abundance of these phyla.

330 Other phyla, such as Acidobacteria, Firmicutes and Verrucomicrobia, were also

331 enriched in the FA-MBR and had the highest relative abundances among the three

332 MBRs. However, the phyla Nitrospirae and Gemmatimonadetes showed the opposite

333 pattern, wherein relative abundance was highest in the C-MBR but lowest in VRPC.

334 Fig. 4b shows the relative abundances of bacterial taxa that made up more than

335 1% in at least one sample and demonstrates that even more diversity in microbial

336 community profiles existed at the class level. Sixteen bacterial classes were detected

337 in all four communities, and the three most common classes included norank

338 __Saccharibacteria, Sphingobacteriia and Gammaproteobacteria. Norank

339 __Saccharibacteria, which belongs to the phylum Saccharibacteria, had the highest

340 relative abundance in the FA-MBR (33.60%)—a finding consistent with phylum-level

341 results. The relative abundance of Sphingobacteriia was 17.60% in VRPC, which was

342 much higher than that documented in the C-MBR (13.58%), A-MBR (14.38%) and

343 FA-MBR (13.63%). Gammaproteobacteria, which is in the phylum Proteobacteria,

344 was the most dominant class in the C-MBR (33.07%). Betaproteobacteria, which was

Page 16 of 49



Draft

17

345 correlated with polysaccharide utilization and butyric acid fermentation (Niu et al.

346 2016), were more abundant in the A-MBR (11.92%), FA-MBR (10.6%) and VRPC

347 (15.03%) relative to the C-MBR (4.07%). Furthermore, Alphaproteobacteria and

348 Deltaproteobacteria of the phylum Proteobacteria were enriched in the A-MBR

349 (8.82% and 5.69%, respectively). In addition, Acidobacteria (1.04%–6.78%) and

350 Anaerolineae (0.67–3.49%), which are play a role in the hydrolysis and fermentation

351 of organic matter (Zhou et al. 2015), were enriched in filling carriers in the FA-MBR.

352 Flavobacteriia, which is involved in the secretion of EPS and plays a role in

353 membrane fouling according to Zheng et al. (2019b), was abundant in VRPC (3.78%).

354 Other dominant classes, such as Nitrospira, Cytophagia and Gemmatimonadetes,

355 were most abundant in the C-MBR with relative abundances at 3.35%, 1.81% and

356 1.61%, respectively.

357 Comparisons at the genus level were made using a hierarchically clustered

358 heatmap to obtain more information on microbial communities (Fig. 5c).

359 Norank_Saccharibacteria, which plays an important role in the decomposition of

360 various complex organic compounds under aerobic, nitrate-reducing and anaerobic

361 environments (Zheng et al. 2019a), was the most dominant genus in the FA-MBR and

362 in VRPC. The relative abundance of norank_Saprospiraceae was significantly higher

363 in the A-MBR (29.42%) relative to the C-MBR (8.51%) and FA-MBR (9.23%).

364 Thiothrix, which belongs to the class Gammaproteobacteria, is known to be capable

365 of oxidizing sulfur-containing compounds in bioreactors using organic matter (Li et al.

366 2014). Thiothrix was significantly more abundant in the C-MBR (28.72%) relative to

Page 17 of 49



Draft

18

367 the other reactors. Some genera, such as Azospira, Anaerolineaceae and

368 Flavobacterium, are often observed in activated sludge systems and MBRs (Zhou et al.

369 2015). Azospira, Anaerolineaceae and Flavobacterium were enriched in VRPC with

370 relative abundances in VRPCs of 3.59%, 3.12% and 2.59%, respectively. However,

371 the relative abundances of Nitrospira, Rhodobacter and unclassified __Micrococcales

372 were highest in the C-MBR, indicating that the insertion of ASSRs greatly decreased

373 their abundance in MBR units.

374 In this study, porous carrier structures enriched six other bacteria that had

375 relative richnesses greater than 1% at the genus level. The five no-rank bacteria

376 among these were SC-I-84, Verrucomicrobiaceae, Acidobacteria, Phyllobacteriaceae

377 and NS9_marine_group. The highest relative richness was in SC-I-84 bacteria

378 (2.68%), which belong to Proteobacteria and are often detected in soil wetlands.

379 Verrucomicrobiaceae, within the phylum Verrucomicrobia, has been primarily

380 detected in aquatic and soil environments, yet, the majority of Verrucomicrobiaceae

381 detected have not been able to be identified beyond the level of phylum, and their

382 functions remain unknown (Stevenson et al. 2004). Acidobacteria consists of

383 Gram-negative bacteria that had a relative abundance of 1.94%. Its functional role in

384 the environment includes the decomposition of various biopolymers as well as

385 participation in the global cycling of carbon, iron and hydrogen (Janssen et al. 2002).

386 The relative richnesses of Phyllobacteriaceae and NS9_marine_group bacteria, which

387 belong to the Proteobacteria and Bacteroides, were 1.09% and 1.03%, respectively.

388 Additionally, Ferruginibacter was also considered to be a dominant genus of bacteria

Page 18 of 49



Draft

19

389 that was enriched on carriers, as it had a relative richness of 1.03%. It consists of

390 Gram-negative bacteria that are often found in sewage treatment plants and contribute

391 to the fermentation of glucose (Lee et al. 2014).

392 Discussion

393 Process performance

394 Previous studies have shown that ASSRs do not adversely affect the efficacy of

395 sewage treatment (Semblante et al. 2017; Ferrentino et al. 2018). In contrast, ASSRs

396 have been shown to promote the removal of nitrogen and phosphorus. Most studies

397 have shown that the removal efficiency of SCOD in ASSRs is equal to or slightly

398 greater than that in conventional reference systems. In a few cases, ASSR devices

399 reduce the removal efficiency of SCOD (Ferrentino et al. 2016b). Saby et al. (2003)

400 proposed that "fasted" sludge in the MBR-OSA anaerobic tank consumes the substrate

401 more quickly when it is supplemented by the lost energy under the "feasting"

402 conditions of the aerobic reactor, thereby improving the removal efficiency of SCOD.

403 Semblante et al. (2014) argued that, although sludge attenuation in ASSRs promoted

404 the release of SCOD and increased its concentration, the return of sludge back to the

405 MBR results in the consumption of SOD, meaning that most of the remaining SCOD

406 produced by the OSA process was biodegradable and had little impact on the overall

407 removal of SCOD. Zheng et al. (2019b) tested three different ASSR-MBRs and found

408 that there were no differences in the removal efficiency of SCOD. Furthermore, they

409 found that concentrations in the effluent were all below 15 mg/L compared with those

410 in the AO-MBR system.

Page 19 of 49



Draft

20

411 With respect to nitrogen removal, previous researchers have found that inserting

412 an ASSR in the sludge return loop does not adversely affect nitrogen removal

413 (Ferrentino et al. 2016b; Cheng et al. 2017). In contrast, Zhou et al. (2015) found that

414 the reduction in nitrification efficiency in an A + OSA system primarily stemmed

415 from the anaerobic degradation of nitrifying bacteria in the ASSR. However, soluble

416 COD might be released during the process of cell dissolution and particulate organic

417 matter hydrolysis in the ASSR, which could provide an additional source of carbon

418 for denitrification and promote TN removal as a result. Pang et al. (2018)

419 demonstrated that the removal efficiency of TN increased by 16.6% following the

420 insertion of an ASSR compared with the AO-MBR; however, the NH4+-N

421 concentration in the effluent was slightly higher due to the recirculation of Total

422 Kjeldahl Nitrogen (TKN, NH4+-N and organic nitrogen [O-N]) released from the

423 ASSR. Zheng et al. (2019a) found that under normal temperatures (21.6 ± 4.9°C) the

424 TN removal efficiency of A-MBR and AP-MBR (with carriers packed in the ASSR)

425 increased by 19.9% and 28.6%, respectively, relative to the reference system. At low

426 temperatures (6.5 ±1.7 °C and 2.6 ±1.4°C), pollutant removal performance

427 deteriorated, and the removal efficiency of NH4+-N and TN decreased. In this study,

428 the A-MBR and FA-MBR were more efficient in the removal of TN (77.24% and

429 79.27%, respectively) relative to the C-MBR (63.66%), which is roughly consistent

430 with the findings of previous studies.

431 At present, few studies have evaluated the effect of ASSRs on phosphorus

432 removal. The traditional phosphorus removal mechanism in the sludge cycle takes

Page 20 of 49



Draft

21

433 place between the aerobic and anaerobic phases, which drives phosphorous

434 accumulating organisms (PAOs) to absorb and release orthophosphate; thus,

435 phosphorus becomes separated from wastewater through the treatment of sludge rich

436 in orthophosphate (Semblante et al. 2014). The results of Chudoba et al. (1992)

437 showed that the biomass of the OSA system contained approximately 60% PAOs,

438 while that of the traditional activated sludge system contained 10%. This difference in

439 the biomass of PAOs stems primarily from the physiological impact that anaerobic or

440 anoxic microorganisms experience due to a lack of oxygen and food. Ye et al. (2008)

441 found that in OSA systems where sludge was retained for 5.5 h, 7.6 h and 11.5 h in

442 ASSRs, the average removal rates of TP were 48%, 59% and 58%, respectively. This

443 finding indicated that the insertion of the anaerobic sludge tank reduced the

444 concentration of TP in wastewater and likely resulted from the high concentration of

445 organic substrates. Cheng's (2017) results confirmed that long SRTs and low degrees

446 of COD in influent water resulted in lower TP removal efficiency.

447 Yobs values vary among previous studies and appear to depend on wastewater

448 characteristics, operating parameters (e.g., hydraulic retention times) and

449 environmental conditions (e.g., temperature) (Wang et al. 2013). Saby et al. (2003)

450 operated two pilot-scale reactors using synthetic wastewater and found that the Yobs of

451 the MBR-OSA was 0.18–0.32 TSS/COD lower than that of the reference system (0.40

452 TSS/COD). Cheng et al. (2017) observed that increasing HRT of the ASSR from 3.3

453 to 6.6 h permitted ASSR-MBRs to attain Yobs of 0.081, 0.062 and 0052 g SS/g COD

454 and reduced sludge production by 8.0%, 29.5% and 40.9%, respectively. Zheng et al.

Page 21 of 49



Draft

22

455 (2019a) reported that the MBR-OSA system had a sludge production rate of 0.139 g

456 SS/g COD, which was lower than that of the control MBR (0.171 g SS/g COD) at

457 normal temperatures. At low temperatures, the Yobs value of the MBR-ASSR was

458 0.131 g SS/g COD, and AO-MBR was reduced to 0.143 g SS/g COD.

459 Effects of carriers on microorganisms associated with nutrient

460 removal

461 The microbiome is the most important component of activated sludge. The

462 microbiome associated with nitrogen metabolism functions plays a particularly

463 important role in system denitrification. As shown in Fig. 6a, nitrifying bacteria in the

464 genus Nitrospira were immobilized on the carrier biofilm and had a relative richness

465 of 0.73%. Nitrospira enrichment in the carrier biofilm promoted nitrogen conversion

466 from NH4+-N to NO3--N and NO2

--N, enhancing the potential for NH4+-N

467 concentration to be reduced in the effluent in the FA-MBR system. In addition, Koch

468 et al. (2015) found that Nitrospira not only oxidized nitrites under aerobic conditions

469 but also was flexible both ecologically and physiologically in reducing nitrates and

470 utilizing organic products from fermented organisms. The relative abundances of

471 Nitrospira, a chemolithoautotrophic nitrifier (Cheng et al., 2018a), were 3.53%,

472 1.07% and 0.98% in the C-MBR, A-MBR and FA-MBR, respectively. Thus, the

473 difference in the availability of oxygen between the ASSR, an anaerobic environment,

474 and the MBR, an aerobic environment, potentially selected for some microorganisms.

475 The release of NH4+-N provided an indicator of sludge decay in the ASSR given that

476 the ammoniation and hydrolysis of particulate organic matter were accompanied by

Page 22 of 49



Draft

23

477 anaerobic sludge decay (Cheng et al. 2017). The average concentration of NH4+-N in

478 the A-MBR and FA-MBR in the anaerobic side stream was 0.87 mg/L and 2.0 mg/L,

479 respectively, suggesting that the addition of VAPC contributed to the more complete

480 breakdown of sludge flocs.

481 As shown in Fig. 6b, the average concentrations of nitrogen in the anoxic tank

482 and in the ASSR of the A-MBR and FA-MBR were negligible (<0.24mg/L);

483 moreover, the concentrations of nitrous nitrogen were also low. For these reasons,

484 these data are not shown here. These observations suggest that the release of

485 secondary substrate caused by sludge decay in anaerobic side-stream reactors created

486 conditions conducive to denitrification; as a result, the NO3--N circulating in the

487 ASSR can be completely denitrified (Zheng et al. 2019a). Meanwhile, the residual

488 secondary substrate was recirculated into the anoxic tank and enhanced denitrification

489 of the main stream. The average concentrations of NO3--N in the effluent from the

490 three systems were significantly higher than that of the aerobic pond. This difference

491 in concentrations might stem from the fact that a membrane tank with a high level of

492 dissolved oxygen (6.0~8.0mg/L) added at the end of the aerobic pond, which might

493 have further promoted the completion of nitrification. In addition, the discovery of

494 anaerobic ammonia oxidation bacteria might also be responsible for the decrease in

495 nitrous nitrogen. The phylum Planctomycetes, which has been shown to be capable of

496 carrying out anaerobic ammonia oxidation coupled with nitrate reduction (Wiseschart

497 et al. 2018), was more enriched in the FA-MBR (0.65%) and in VRPC (0.84%) than

498 in the C-MBR (0.52%). Moreover, the average concentration of NO3--N in the effluent

Page 23 of 49



Draft

24

499 of the FA-MBR system was lower than that in the C-MBR and A-MBR, which might

500 explain the immobilization of microorganisms on the carrier biofilm. The biofilm of

501 the carrier contained considerably greater abundances of Azospira (approximately

502 3.59%) compared with the other three systems, suggesting that Azospira has a

503 preference for enriching in biofilms rather than in sludge. The slowly growing

504 Azospira was not only a denitrifying bacterium, but also functioned as hydrolytic

505 bacteria that reduced sludge (Pang et al. 2018). Indeed, Azospira was preferentially

506 enriched in the FA-MBR (2.84%) with a relative abundance of 13.52 and 2.36 times

507 that observed in the C-MBR and A-MBR, respectively. The complete dominance of

508 Azospira in the carrier biofilm and FA-MBR was expected to contribute to the

509 reduction in NO3--N. This expectation was consistent with lower NO3

--N

510 concentrations in the FA-MBR effluent. Moreover, Comamonadaceae_unclassified

511 has long been known to consist of potentially aerobic denitrifying bacteria (DNB) for

512 simultaneous nitrification and denitrification (Li et al. 2018). Consistent with this

513 expectation, Comamonadaceae_unclassified was also apparently immobilized on the

514 VRPC biofilm with a relative abundance of 2.48%. Other DNB, such as

515 Flavobacterium, Rhizobacter, Hyphomicrobium and Sulfuritalea were also classified

516 as hydrolytic bacteria and were abundant on the carrier biofilm. Therefore, the

517 addition of VRPC resulted in an increased abundance of DNB and improved the

518 potential efficiency of nitrogen removal.

519 In Fig. 6c, the concentration of TP showed a slightly increasing trend in the

520 anoxic tank of the FA-MBR. This pattern might have been caused by the fact that the

Page 24 of 49



Draft

25

521 assimilated TP in a highly anaerobic environment was converted from polyphosphate

522 to orthophosphate as it was resuspended and returned to the anoxic tank. This trend

523 was different from the other two MBRs, where the average TP concentration

524 decreased from the influent to the anoxic tank. As Figure 6c shows, the lowest

525 average concentration of TP in the A-MBR was in the effluent, possibly due to the

526 enrichment of PAOs. Dechloromonas, a slow-growing taxon associated with

527 denitrification, has been detected as a PAO in enhanced biological phosphorus

528 removal reactors (Zhou et al. 2015; Cheng et al. 2018b). Indeed, we found that

529 Dechloromonas reached its highest relative abundance of 3.48% in the A-MBR. This

530 result was inconsistent with the observed average removal efficiency of phosphorus

531 over the long-term operation of the three reactors. This inconsistency might stem from

532 the porous structure of the carrier, which might have facilitated the growth of

533 phosphorus-accumulating bacteria of the genus Dechloromonas on the VRPC biofilm.

534 The relative abundance of another denitrifying PAO genus

535 Candidatus_Accumulibacter (Zheng et al. 2019a) was low in the three MBRs.

536 Relevant studies have shown that there are many explanations for the removal of

537 enhanced phosphorus in ASSR processes, such as the accumulation of PAO and the

538 means of substrate loading. Thus, more detailed research is needed to explain the

539 mechanisms underlying phosphorus removal efficiency (Ferrentino et al. 2016b).

540 In summary, the addition of VRPC to ASSRs successfully immobilized abundant

541 nitrogen and phosphorus-related microorganisms, especially denitrifying bacteria, and

542 contributed to the greater degree of nitrogen and phosphorus removal.

Page 25 of 49



Draft

26

543 Effect of carriers on microorganisms related to sludge reduction

544 Previous studies have confirmed that the hydrolysis of particulate organic matter

545 (POM), lysis of bacterial biomass and slow growth are the three main mechanisms

546 underlying the sludge reduction of SSRs, which are, in turn, realized by the

547 enrichment of hydrolyzed fermented bacteria, predatory bacteria and slow-growing

548 microorganisms, respectively (Zheng et al. 2019a). Therefore, we compared the

549 microbial genera underlying variation in sludge reduction among four sludge samples

550 (Table 2).

551 The hydrolysis of POM is a rate-limiting step in the process of lysis-cryptic

552 growth (Khursheed and Kazmi 2011). Thus, improvement of the conversion

553 efficiency of POM to dissolved forms can reduce the production of sludge (Niu et al.

554 2016). As shown in Table 2, the carrier biofilm contained a high quantity of

555 hydrolytic bacteria with a total relative abundance of 38.06% from primarily four

556 no-rank genera: Saccharibacteria, Saprospiraceae, Comamonadaceae and

557 Xanthomonadaceae. In addition, the relative abundance of Terrimonas and

558 Flavobacterium on carriers was significantly higher than that in the three systems,

559 which promoted the transformation of particulate organic matter into the dissolved

560 state and then into small molecules. The genus norank __Saccharibacteria improved

561 the efficiency of sludge reduction in the FA-MBR as norank __Saccharibacteria was

562 more enriched in the FA-MBR (33.60%) than in the C-MBR (12.24%) and A-MBR

563 (15.81%). Norank__Saprospiraceae, which has been shown to be associated with the

564 hydrolysis and utilization of complex carbon sources and the predation of other

Page 26 of 49



Draft

27

565 bacteria (Cheng et al. 2018b), was the most dominant genus in the A-MBR (29.42%).

566 This high abundance might stem from the partial immobilization of hydrolytic

567 bacteria on the carrier biofilm, resulting in a relative decrease in their content in the

568 FA-MBR system. Specially, the total relative abundances of Rhodobacter and

569 norank__Cytophagaceae, were highest in the C-MBR (3.78%), followed by the

570 A-MBR (2.93%) and FA-MBR (2.47%). Such a pattern might be caused by the fact

571 that the hydrolysis of particulate organic matter primarily occurred in the main stream.

572 Furthermore, fermentation bacteria were dominant on the biofilm of the porous

573 carrier. An abundance of fermentation bacteria should further promote the conversion

574 of soluble hydrolysates, such as amino acids and sugars, to short-chain fatty acids so

575 that they can be incorporated more effectively into the secondary matrix and

576 consumed by other microorganisms. The total relative richness of Ferruginibacter,

577 norank__Verrucomicrobiaceae, unclassified__Comamonadaceae and

578 norank__Anaerolineaceae, major fermented bacteria responsible for reductions in

579 sludge yield, reached 8.59% in VRPCs, which was significantly higher than the

580 relative richness of these taxa in the three MBRs. The

581 unclassified__Comamonadaceae and norank__Anaerolineaceae that were related to

582 the degradation of complex organic matter were obviously immobilized on the biofilm

583 of the carrier and had a relative richness of 2.48% and 3.12%, respectively. Thus,

584 VRPC can provide surfaces or porous structures that promote the attachment and

585 retention of fermentation microorganisms. In the three reactors, the total relative

586 abundances of fermentative bacteria were 3.46%, 3.44% and 5.49% in the C-MBR,

Page 27 of 49



Draft

28

587 A-MBR and FA-MBR, respectively. The results showed that the addition of VRPC in

588 ASSRs increased the efficacy of hydrolysis and the production of organic substrate,

589 thereby promoting the growth of fermented bacteria. Furthermore, the increase in the

590 relative percentage of fermentation bacteria provided more carbon sources for

591 denitrification and increased the TN removal rate (Jiang et al. 2018).

592 In addition, the addition of VRPC enriched two slow-growing microorganisms,

593 Dechloromonas and Azospira, which both had a relative richness greater than 1%.

594 Dechloromonas, as a solid-phased denitrifier, is capable of degrading lignocellulosic

595 as carbon sources (Feng et al. 2017). Thus, Dechloromonas also functioned as

596 hydrolytic bacteria and was most common in VRPC with a relative abundance of

597 3.48%. The relative abundance of Azospira, a dominant chlorate-reducing genus in the

598 natural environment (Byrne-Bailey et al. 2012), was higher in VRPC (3.59%) and in

599 the FA-MBR (2.84%) than in the C-MBR (0.21%) and A-MBR (1.20%). Other

600 slow-growing bacteria in MBRs responsible for lower Yobs primarily included

601 Thauera, Trichococcus, Sulfuritalea and Denitratisoma. The total relative abundances

602 of these genera were highest in the FA-MBR (1.82%) relative to the C-MBR (0.81%)

603 and A-MBR (1.37%), suggesting that the addition of the carrier in the ASSR was

604 more conducive to the growth of slow-growing microorganisms. Trichococcus, a type

605 of slow-growing fermentation bacterium (Zhou et al. 2015), was enriched in FA-MBR

606 with highest relative abudance 1.60%. Denitratisoma, classified as a

607 chemoorganoheterotrophic denitrifier (Ferrentino et al. 2016a), was not detected in

608 the C-MBR, and its abundance in the ASSR-MBRs was low. The denitrifying,

Page 28 of 49



Draft

29

609 slow-growing Thauera and Sulfuritalea grow either heterotrophically or

610 chemolithoautotrophically under anaerobic conditions (Cheng et al. 2017). The

611 patterns of growth of these two genera showed insignificant trends in the four sludge

612 samples.

613 The enrichment of predatory bacteria in the sludge reduction process is

614 considered to result from an enhancement in cell lysis, which might be in part

615 responsible for the lower Yobs. Predatory bacteria in the four sludge samples were

616 low (0.33%~1.31%) and included Haliangium, Bdellovibrio and Polyangiaceae. The

617 results therefore indicated that predation may not be the main cause underlying

618 sludge reduction in MBRs, a conclusion consistent with previous studies conducted

619 by Jiang et al. (2018). The relative richnesses of these predatory bacteria in the

620 FA-MBR and in VRPCs were lower than those in the C-MBR and A-MBR,

621 indicating that the addition of carriers may have had adverse effects on the

622 immobilization of predatory bacteria.

623 In summary, the microorganisms responsible for sludge reduction, such as

624 hydrolytic, fermentative, slow-growing and predatory bacteria, are important

625 components of the sewage treatment system. Reduction of excess sludge production

626 is achieved through the effective enrichment of these functional microorganisms.

627 Therefore, the addition of VRPC provides an efficient approach for reducing sludge

628 yield by enhancing the advantageous properties of slow-growing microbes and

629 promoting the interaction between bacteria, enzymes and substrates to facilitate

630 particle hydrolysis.

Page 29 of 49



Draft

30

631 Conclusion

632 This lab-scale study indicated that the addition of VRPC not only affected sludge

633 reduction and pollutant removal in an ASSR but also changed microbial community

634 structure. Compared with the C-MBR, the A-MBR and FA-MBR achieved greater

635 reductions in sludge of 16.2% and 26.4%, respectively. The removal of TN and TP

636 was significantly improved by the addition of a carrier. Illumina Miseq sequencing

637 results showed that a large number of microorganisms were immobilized on the

638 carrier surface in the form of a biofilm. The enrichment of nitrifying bacteria on the

639 carrier biofilm improved the efficiency of nitrogen removal. The immobilization of

640 hydrolysis as well as the fermentation and slow growth of bacteria on the carrier

641 biofilm reduced sludge production in the reactor.

642 Acknowledgements

643 This research was supported by the Young Scientists Fund of the National Natural

644 Science Foundation of China (51608339), the key SCI-tech project of Science and

645 Technology Bureau of Zigong (2019YYJC09), the Fund of Postgraduate of Xihua

646 University (ycjj2018115), the Ministry of education Chunhui plan project

647 (191650[2018-93]), the Young Scholars Project of Xihua University in 2019 and the

648 Department of Science and Technology of Sichuan Province (2017JY0129), China

649 Postdoctoral Science Foundation (2019M650860), the Natural Science Foundation of

650 Hebei Province (E2019402410). Thanks for Yufeng Xu’s suggestions concerning this

651 paper.

652 Author contributions

Page 30 of 49



Draft

31

653 Xinqiang Ning, Bin Zhang and Jiao Yue designed research; Yu Guo, Taixin Liu, Min

654 Zhou and Ying Yang performed research; Jiaxu Wu and Yang Zeng analyzed data;

655 Xinqiang Ning and Jiao Yue wrote the paper; Xinqiang Ning, Bin Zhang, Jiao Yue

656 and Yufeng Xu, advised research. All authors reviewed the manuscript.

657 Conflict of interest

658 The authors declare that they have no conflict of interest.

659

Page 31 of 49



Draft

32

661

662 Reference

663 An, Y., Zhou, Z., Yao, J, Niu, T.H., Qiu, Z., Ruan, D.N., Wei, H.J. 2017. Sludge

664 reduction and microbial community structure in an anaerobic/anoxic/oxic process

665 coupled with potassium ferrate disintegration. Bioresource Technology,

666 245:954-961. doi:10.1016/j.biortech.2017.09.023 .

667 Bor, B., Poweleit, N., Bois, J.S., Cen, L., Bedree, J.K., Zhou, Z.H., Gunsalus, R.P.,

668 Lux, R., et al. 2016. Phenotypic and physiological characterization of the

669 epibiotic interaction between Tm7x and its basibiont Actinomyces. Microbial

670 Ecology, 71:243–255. doi:10.1007/s00248-015-0711-7.

671 Byrne-Bailey, K.G., Coates, J.D. 2012. Complete genome sequence of the anaerobic

672 perchlorate-reducing bacterium azospira suillum strain ps. Journal of

673 Bacteriology, 194(10): 2767-2768. doi:10.1128/JB.00124-12.

674 Cheng, C., Zhou, Z., Niu, T.H., An, Y., Shen, X.L., Pan, W., Chen, Z.H., Liu, J. 2017.

675 Effects of side-stream ratio on sludge reduction and microbial structures of

676 anaerobic side-stream reactor coupled membrane bioreactors. Bioresource

677 Technology, 234: 380-388. doi:10.1016/j.biortech.2017.03.077.

678 Cheng, C., Zhou, Z., Pang, H.J., Zheng, Y., Chen, L.Y., Jiang, L.M., Zhao, X.D.

679 2018a. Correlation of microbial community structure with pollutants removal,

680 sludge reduction and sludge characteristics in micro-aerobic side-stream reactor

681 coupled membrane bioreactors under different hydraulic retention times.

682 Bioresource Technology, 260: 177-185. doi:10.1016/j.biortech.2018.03.088.

683 Cheng, C., Zhou, Z., Qiu, Z., Yang, J.Y., Wu, W., Pang, H.J. 2018b. Enhancement of

Page 32 of 49



http://dx.doi.org/10.1016/j.biortech.2017.09.023

https://doi.org/10.1007/s00248-015-0711-7

https://doi.org/10.1128/JB.00124-12


https://doi.org/10.1016/j.biortech.2018.03.088

Draft

33

684 sludge reduction by ultrasonic pretreatment and packing carriers in the anaerobic

685 side-stream reactor: Performance, sludge characteristics and microbial

686 community structure. Bioresource Technology, 249:298-306.

687 doi:10.1016/j.biortech.2017.10.043.

688 Chudoba, P., Morel, A., Capdeville, B. 1992. The case of both energetic uncoupling

689 and metabolic selection of microorganisms in the OSA activated sludge system.

690 Environmental Technology, 13:761- 770. doi:10.1080/09593339209385207.

691 Coma, M., Rovira, S., Canals, J., Colprim, J. 2013. Minimization of sludge production

692 by a side-stream reactor under anoxic conditions in a pilot plant. Bioresource

693 Technology, 129:229-235. doi:10.1016/j.biortech.2012.11.055.

694 De, Oliveira. T.S., Corsino, S.F., Di, Trapani. D., Torregrossa, M., Viviani, G. 2018.

695 Biological minimization of excess sludge in a membrane bioreactor: Effect of

696 plant conFig.uration on sludge production, nutrient removal efficiency and

697 membrane fouling tendency. Bioresource Technology, 259:146-155.

698 doi:10.1016/j.biortech.2018.03.035.

699 Feng, L.J., Chen, K., Han, D.D., Zhao, J., Lu, Y., Yang, G.F., Mu, J., Zhao, X.J. 2017.

700 Comparison of nitrogen removal and microbial properties in solid-phase

701 denitrification systems for water purification with various pretreated

702 lignocellulosic carriers. Bioresource Technology, 224:236-245.

703 doi:10.1016/j.biortech.2016.11.002.

704 Feng, Q., Yu, A.F., Chu, L.B., Xing, X.H.2008. Performance study of the reduction of

705 excess sludge and simultaneous removal of organic carbon and nitrogen by a

Page 33 of 49




https://doi.org/10.1080/09593339209385207




Draft

34

706 combination of fluidized- and fixed-bed bioreactors with different structured

707 macroporous carriers. Biochemical Engineering Journal, 39:344–352.

708 doi:10.1016/j.bej.2007.10.006.

709 Ferrentino, R., Langone, M., Merzari, F., Tramonte, L. 2016a. A review of anaerobic

710 side-stream reactor for excess sludge reduction: configurations, mechanisms and

711 efficiency. Crit. Rev. Environmental Science & Technology, 46(4):382-405.

712 doi:10.1080/10643389.2015.1096879.

713 Ferrentin, R., Langone, M., Gandolfi, I., Bertolini, V., Franzetti, A., Andreottola, G.

714 2016b. Shift in microbial community structure of anaerobic side-stream reactor in

715 response to changes to anaerobic solid retention time and sludge interchange ratio.

716 Bioresource Technology, 221:588-597. doi:10.1016/j.biortech.2016.09.077.

717 Ferrentino, R., Langone, M., Villa, R., Andreottola, G. 2018. Strict anaerobic

718 side-stream reactor: effect of the sludge interchange ratio on sludge reduction in a

719 biological nutrient removal process. Environmental Science and Pollution

720 Research, 25(2):1243-1256. doi:10.1007/s11356-017-0448-6.

721 Ferrentino, R., Langone, M., Andreottola, G. 2019 Progress toward full scale

722 application of the anaerobic side-stream reactor (ASSR) process. Bioresource

723 Technology, 272: 267-274. doi:10.1016/j.biortech.2018.10.028.

724 Habermacher, J., Benetti, A.D., Derlon, N., Morgenroth, E. 2015. The effect of

725 different aeration conditions in activated sludge – Side-stream system on sludge

726 production, sludge degradation rates, active biomass and extracellular polymeric

727 substances. Water Research, 85:46-56. doi:10.1016/j.watres.2015.08.002.

Page 34 of 49



https://doi.org/10.1016/j.bej.2007.10.006

https://doi.org/10.1080/10643389.2015.1096879


https://doi.org/10.1007/s11356-017-0448-6


https://doi.org/10.1016/j.watres.2015.08.002

Draft

35

728 Janssen, P.H., Yates, P.S., Grinton, B.E., Taylor, P.M., Sait, M. 2002. Improved

729 culturability of soil bacteria and isolation in pure culture of novel members of the

730 divisions Acidobacteria, Actinobacteria, Proteobacteria, and Verrucomicrobia.

731 Applied and Environmental Microbiology, 68(5):2391-2396.

732 doi:10.1128/AEM.68.5.2391-2396.2002.

733 Jiang, L.M., Zhou, Z., Niu, T.H., Jiang, L.Y., Chen, G., Pang, H.J., Zhao, X.D., Qiu,

734 Z. 2018. Effects of hydraulic retention time on process performance of anaerobic

735 side-stream reactor coupled membrane bioreactors: Kinetic model, sludge

736 reduction mechanism and microbial community structures. Bioresource

737 Technology, 267: 218–226. doi:10.1016/j.biortech.2018.07.047.

738 Khursheed, A., Kazmi, A.A. 2011. Retrospective of ecological approaches to excess

739 sludge reduction. Water Research, 45(15):4287-4310.

740 doi:10.1016/j.watres.2011.05.018.

741 Koch, H., Lücker, S., Albertsen, M., Kitzinger, K., Herbold, C., Spieck, E., Nielsen,

742 P.H., Wagner, M., et al. 2015. Expanded metabolic versatility of ubiquitous

743 nitrite-oxidizing bacteria from the genus Nitrospira. Proceedings of the National

744 Academy of Sciences of the United States of America, 112(36):11371–11376.

745 doi:10.1073/pnas.1506533112.

746 Lee, B.I., Kang, H., Kim, H., Joung, Y., Joh, K. 2014. Ferruginibacter yonginensis

747 sp.nov. isolated from a mesotrophic artificial lake. International Journal of

748 Systematic and Evolutionary Microbiology, 64:846-850.

749 doi:10.1099/ijs.0.057083-0.

Page 35 of 49



https://doi.org/10.1128/AEM.68.5.2391-2396.2002



https://doi.org/10.1073/pnas.1506533112

https://doi.org/10.1099/ijs.0.057083-0

Draft

36

750 Li, L., Dong, Y.H., Qian, G.S., Hu, X., Ye, L.L. 2018. Performance and microbial

751 community analysis of bio-electrocoagulation on simultaneous nitrification and

752 denitrification in submerged membrane bioreactor at limited dissolved oxygen.

753 Bioresource Technology, 258:168-176. doi:10.1016/j.biortech.2018.02.121.

754 Li, X.X., Liu, X.C., Wu, S.H., Rasool, A., Zuo, J.N., Li, C., Liu, Y. 2014. Microbial

755 diversity and community distribution in different functional zones of continuous

756 aerobic–anaerobic coupled process for sludge in situ reduction. Chemical

757 Engineering Journal, 257: 74-81. doi:10.1016/j.cej.2014.07.028.

758 Litti, Y.V., Nekrasova, V.K., Kulikov, N.I., Siman'kova, M.V., Nozhevnikova, A.N.

759 2013. Detection of anaerobic processes and microorganisms in immobilized

760 activated sludge of a wastewater treatment plant with intense aeration.

761 Microbiology, 82(6):690-697. doi:10.1134/S0026261713060076.

762 Ning, X.Q., Qiao, W.W., Zhang, L., Gao, X. 2014. Microbial community in

763 anoxic–oxic–settling–anaerobic sludge reduction process revealed by 454

764 pyrosequencing analysis. Canadian Journal of Microbiology, 60:99–809.

765 doi:10.1139/cjm-2014-0263.

766 Niu, T.H., Zhou, Z., Shen, X.L., Qiao, W.M., Jiang, L.M., Pan, W., Zhou, J.J. 2016.

767 Effects of dissolved oxygen on performance and microbial community structure

768 in a micro-aerobic hydrolysis sludge in situ reduction process. Water Research,

769 90:69-377. doi:10.1016/j.watres.2015.12.050.

770 Pang, H.J., Zhou, Z., Niu, T.H., Jiang, M., Chen, G., Xu, B., Jiang, L.Y., Qiu, Z. 2018.

771 Sludge reduction and microbial structures of aerobic, micro-aerobic and

Page 36 of 49




http://dx.doi.org/10.1016/j.cej.2014.07.028

https://doi.org/10.1134/S0026261713060076

https://dx.doi.org/10.1139/cjm-2014-0263

http://dx.doi.org/10.1016/j.watres.2015.12.050

Draft

37

772 anaerobic side-stream reactor coupled membrane bioreactors. Bioresource


774 Saby, S., Djafer, M., Chen, G.H. 2003. Effect of low ORP in anoxic sludge zone on

775 excess sludge production in oxic-settling-anoxic activated sludge process. Water

776 Research, 37(1):11-20. doi:10.1016/S0043-1354(02)00253-1.

777 Semblante, G.U., Hai, F.I., Ngo, H.H., Guo, W.S., You, S.J., Price, W.E., Nghiem,

778 L.D. 2014. Sludge cycling between aerobic, anoxic and anaerobic regimes to

779 reduce sludge production during wastewater treatment: Performance, mechanisms,

780 and implications. Bioresource Technology, 155:395-409.

781 doi:10.1016/j.biortech.2014.01.029.

782 Semblante, G.U., Hai, F.I., Bustamante, H., Price, W.E., Nghiem, L.D. 2016. Effects

783 of sludge retention time on oxic-settling-anoxic process performance: Biosolids

784 reduction and dewatering properties. Bioresource Technology, 218:1187-1194.

785 doi:10.1016/j.biortech.2016.07.061.

786 Semblante, G.U., Phan, H.V., Hai, F.I., Xu, Z.Q., Price, W.E., Nghiem, L.D. 2017.

787 The role of microbial diversity and composition in minimizing sludge production

788 in the oxic-settling-anoxic process. Science of the Total Environment,

789 607:558-567. doi: 10.1016/j.scitotenv.2017.06.253.

790 Stevenson, B.S., Eichorst, A., Wertz, J.T., Schmidt, T.M., Breznak, J.A. 2004. New

791 strategies for cultivation and detection of previously uncultured microbes.

792 Applied and Environmental Microbiology, 70(8):4748-4755.

793 doi:0.1128/AEM.70.8.4748-4755.2004.

Page 37 of 49




http://dx.doi.org/10.1016/S0043-1354(02)00253-1



http://dx.doi.org/10.1016/j.scitotenv.2017.06.253

https://doi.org/10.1128/AEM.70.8.4748-4755.2004

Draft

38

794 Wang, Z.W., Yu, H.G., Ma, J.X., Zheng, X., Wu, Z.C. 2013. Recent advances in

795 membrane bio-technologies for sludge reduction and treatment. Biotechnology

796 Advances, 31:1187-1199. doi: 10.1016/j.biotechadv.2013.02.004.

797 Wiseschart, A., Mhuanthong, W., Thongkam, P., Tangphatsornruang, S., Chantasingh,

798 D., Pootanakit, K. 2018. Bacterial diversity and phylogenetic analysis of type ii

799 polyketide synthase gene from manao-pee cave, Thailand. Geomicrobiology

800 Journal, 35(6):518-527. doi:10.1080/01490451.2017.1411993.

801 Xie, Z.F., Wang, Z.W., Wang, Q.Y., Zhu, C.W., Wu, Z.C. 2014. An anaerobic

802 dynamic membrane bioreactor (AnDMBR) for landfill leachate treatment:

803 Performance and microbial community identification. Bioresource Technology,

804 161:29-39. doi:10.1016/j.biortech.2014.03.014.

805 Xing, X.H., Inoue, T., Tang, Ji. Y., Unno, H. 1999. Enhanced microbial adaptation to

806 p-nitrophenol using activated sludge retained in porous carrier particles and

807 simultaneous removal of nitrite released from degradation of p-nitrophenol.

808 Journal of Bioscience and Bioengineering, 87(3):372-377.

809 doi:10.1140/epjd/e2003-00282-6.

810 Ye, F.X., Zhu, R.F., Li, Y. 2008. Effect of sludge retention time in sludge holding

811 tank on excess sludge production in the oxic-settling-anoxic (OSA) activated

812 sludge process. Journal of Chemical Technology and Biotechnology,

813 83(1):109-114. doi:org/10.1002/jctb.1781.

814 Yuan, Y., Wang, S.Y., Liu, Y., Li, B.K., Wang, B., Peng, Y.Z. 2015. Long-term effect

815 of pH on short-chain fatty acids accumulation and microbial community in sludge

Page 38 of 49



http://dx.doi.org/10.1016/j.biotechadv.2013.02.004

https://doi.org/10.1080/01490451.2017.1411993


https://doi.org/10.1140/epjd/e2003-00282-6

https://doi.org/10.1002/jctb.1781

Draft

39

816 fermentation systems. Bioresource Technology, 197:56-63.

817 doi:10.1016/j.biortech.2015.08.025.

818 Zhang, X.Y., Li, J., Yu, YB., Xu, R.R., Wu, Z.C. 2016. Biofilm characteristics in

819 natural ventilation trickling filters (NVTFs) for municipal wastewater treatment:

820 Comparison of three kinds of biofilm carriers. Biochemical Engineering Journal,

821 106:87-96. doi:10.1016/j.bej.2015.11.009.

822 Zhao, Y.G., Fang, Y., Jin, Y.L., Huang, J., Ma, X.R., He, K., He, Z.M., Wang, F., et

823 al. 2015. Microbial community and removal of nitrogen via the addition of a

824 carrier in a pilot-scale duckweed-based wastewater treatment system. Bioresource


826 Zheng, Y., Cheng, C., Zhou, Z., Pang, H.J., Chen, L.Y., Jiang, L.M. 2019a. Insight

827 into the roles of packing carriers and ultrasonication in anaerobic side-stream

828 reactor coupled membrane bioreactors: Sludge reduction performance and

829 mechanism. Water Research, 155:310-319. doi:10.1016/j.watres.2019.02.039.

830 Zheng, Y., Zhou, Z., Cheng, C., Wang, Z.W., Pang, H.J., Jiang, L.Y., Jiang, L.M.

831 2019b. Effects of packing carriers and ultrasonication on membrane fouling and

832 sludge properties of anaerobic side-stream reactor coupled membrane reactors for

833 sludge reduction. Journal of Membrane Science, 581:312-320.

834 doi:10.1016/j.memsci.2019.03.064.

835 Zhou, Z., Qiao, W.M., Xing, C., Wang, Y.J., Wang, C.Y., Wang, Y.F., Wang, Y.R.,

836 Wang, L.C. 2014. Sludge reduction and performance analysis of a modified

837 sludge reduction process. Water Science and Technology, 69(5):934-940.

Page 39 of 49




https://doi.org/10.1016/j.bej.2015.11.009




https://doi.org/10.1016/j.memsci.2019.03.064

Draft

40

838 doi:10.2166/wst.2013.797.

839 Zhou, Z., Qiao, W.M., Xing, C., An, Y., Shen, X.L., Ren, W.C., Jiang, L.M., Wang,

840 L.C. 2015. Microbial community structure of anoxic–oxic-settling-anaerobic

841 sludge reduction process revealed by 454-pyrosequencing. Chemical Engineering

842 Journal, 266:249-257. doi:10.1016/j.cej.2014.12.095.

Page 40 of 49



https://doi.org/10.2166/wst.2013.797

http://dx.doi.org/10.1016/j.cej.2014.12.095

Draft

41

844 Table 1 Richness and diversity estimators of microbial communities in the three

845 MBRs and the carriers (α=0.03)

Items Shannon Simpson Ace Chao Coverage

C-MBR 3.89 0.0948 721 703 0.9971

A-MBR 4.15 0.0649 913 929 0.9956

FA-MBR 4.50 0.0310 955 944 0.9955

VRPC 5.22 0.0133 1308 1331 0.9961

846

847

848

849

850

851

852

853

854

855

856

857

858

859

860

861

862

863

864

865

866

867

Page 41 of 49



Draft

42

868 Table 2 Relative abundance of microbial bacteria related to sludge reduction in the

869 three MBRs and the carriers

Function Bacteria C-MBR A-MBR FA-MBR VRPCHydrolysis norank__Saccharibacteria 12.24% 15.81% 33.60% 17.66%

norank__Saprospiraceae 8.51% 29.42% 9.23% 11.87%Rhodobacter 2.00% 2.10% 1.32% 0.86%norank__Xanthomonadaceae 1.87% 0.83% 0.43% 1.17%norank__Cytophagaceae 1.78% 0.83% 1.15% 1.45%Terrimonas 0.93% 1.15% 0.82% 1.64%Flavobacterium 0.19% 1.57% 1.08% 2.59%norank__Latescibacteria 0.00% 0.02% 0.04% 0.09%norank__Caldilineaceae 0.13% 0.56% 0.81% 0.73%

Total 27.65% 52.29% 48.48% 38.06%

Fermentation norank__Verrucomicrobiaceae 0.02% 0.19% 0.90% 1.96%Sorangium 0.01% 0.03% 0.01% 0.03%unclassified__Comamonadaceae 1.09% 1.69% 1.49% 2.48%norank__Anaerolineaceae 0.64% 1.03% 2.35% 3.12%norank__Chitinophagaceae 0.06% 0.29% 0.20% 0.22%Ferruginibacter 1.72% 0.53% 0.75% 1.03%

Total 3.54% 3.76% 5.70% 8.84%

Slow grower Dechloromonas 0.29% 3.48% 2.92% 1.49%Azospira 0.21% 1.20% 2.84% 3.59%Thauera 0.05% 0.06% 0.10% 0.16%Sulfuritalea 0.02% 0.09% 0.09% 0.08%Denitratisoma 0.00% 0.02% 0.03% 0.11%Trichococcus 0.74% 1.20% 1.60% 0.97%

Total 1.31% 6.05% 7.58% 6.40

Predation Haliangium 0.58% 0.25% 0.14% 0.15%Bdellovibrio 0.38% 0.98% 0.14% 0.29%Polyangiaceae 0.04% 0.08% 0.05% 0.09%Total 1.00% 1.31% 0.33% 0.53%

870

871872873874875876877878879

Page 42 of 49



Draft

43

880 Figure legends

881 Fig. 1 Schematic of the FA-MBR experimental setup

882 Fig. 2 Variation in (a) COD, (b) NH4+-N (c) TN and (d) TN in the influent and

883 effluent of the three MBRs

884 Fig. 3 Yobs in the three MBRs and their relationship with substrate liberated in MBRs

885 Fig. 4 Venn map of bacterial communities with shared and unique operational taxa

886 (OTU) (3% distance level) among different samples. The number of OTUs in the

887 Venn diagram represents the number of OTUs in the sample.

888 Fig. 5 Classification of microbial communities in the three MBRs and i VRPC at the

889 level of (a) phylum, (b) class and (c) genus. Relative abundance of a given

890 phylogenetic group was set as the number of sequences affiliated to that group divided

891 by the total number of sequences per sample.

892 Fig.6 Variation in nitrogen and phosphorus of the three MBRs.

Page 43 of 49



Draft

44

894 Fig. 1

895

896

Page 44 of 49



Draft

45

898 Fig. 2

899900

901

902

903

904

905

906

907

908

909

910

911

912

913

914

Page 45 of 49



Draft

46

915 Fig. 3

916

917

918

919

920

921

922

923

924

925

926

927

928

929

930

931

932

933

934

Page 46 of 49



Draft

47

935 Fig. 4

936

937

938

939

940

941

942

943

944

945

946

947

948

949

950

951

952

953

954

955 Fig. 5

Page 47 of 49



Draft

48956

Page 48 of 49



Draft

49

957958 Fig.6

959960961

Page 49 of 49



Documents

Draft · 2020. 5. 8. · 67 oxidation reduction potential (ORP) (Saby et al. 2003), the anaerobic solid retention 68 time (SRTASSR) (Semblante et al., 2016; Cheng et al. 2018a), side-stream