Draft
Effects of bioporous carriers on the performance and microbial community structure in side-stream anaerobic
membrane bioreactors
Journal: Canadian Journal of Microbiology
Manuscript ID cjm-2019-0632.R2
Manuscript Type: Article
Date Submitted by the Author: 22-Mar-2020
Complete List of Authors: Bin , Zhang; School of food and biotechnology, Xihua UniversityJiao, Yue; Xihua UniversityYu, Guo; Sichuan University of Science and EngineeringTaixin, Liu; Sichuan University of Science and EngineeringMin, Zhou; Sichuan University of Science and EngineeringYing, Yang; Sichuan University of Science and EngineeringJiaxu , Wu; Sichuan University of Science and EngineeringYang , Zeng; Sichuan University of Science and EngineeringXinqiang, Ning; Sichuan University of Science and Engineering,
Keyword: Anaerobic side-stream reactor; Porous carriers; Sludge reduction; Microbial community
Is the invited manuscript for consideration in a Special
Issue? :Not applicable (regular submission)
Note: The following files were submitted by the author for peer review, but cannot be converted to PDF. You must view these files (e.g. movies) online.
Figures.rar
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
1
1 Effects of bioporous carriers on the performance and microbial
2 community structure in side-stream anaerobic membrane
3 bioreactors
4 Bin Zhanga, c, Jiao Yuea, Yu Guob, Taixin Liub, Min Zhoub, Ying Yangb, Jiaxu Wub, Yang Zengb,
5 Xinqiang Ningb
6 a School of Civil Engineering and Construction and Environment, Xihua University, Chengdu
7 610039, China;
8 b School of Civil Engineering, Sichuan University of Science & Engineering, Zigong 643000,
9 China;
10 c School of food and biotechnology, Xihua University, Chengdu 610039, China
11 Corresponding author: X.Q. Ning
12 E-mail addresses: [email protected]
13 Bin Zhang and Jiao Yue contributed equally to this manuscript.
Page 1 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
2
15 Abstract: The aim of this study was to investigate the effects of volcanic rock
16 porous carriers (VRPC) on sludge reduction, pollutant removal and microbial
17 community structure in an anaerobic side-stream reactor (ASSR). Three lab-scale
18 membrane bioreactors (MBRs), including an anoxic-oxic MBR(AO-MBR) that served
19 as control(C-MBR), an ASSR coupled MBR (A-MBR), an A-MBR filled with VRPC
20 (FA-MBR) were stably and simultaneously operated for 120 day. The effect of the
21 three reactors on the removal of COD was almost negligible (all greater than 95%),
22 but the average removal efficiency of NH4+-N, TN, and TP was significantly
23 improved by the insertion of an ASSR, especially when the ASSR was filled with
24 VRPC. Finally, A-MBR and FA-MBR achieved 16.2% and 26.4% sludge reduction
25 rates, with observed sludge yield Yobs of 0.124 and 0.109 g SS/g COD, respectively.
26 Illumina-MiSeq sequencing revealed that microbial diversity and richness were
27 highest in the VRPC, indicating that a large number of microorganisms formed on the
28 carrier surface in the form of a biofilm. Abundant denitrifying bacteria (Azospira,
29 Comamonadaceae_unclassified and Flavobacterium) were immobilized on the carrier
30 biofilm, which contributed to increased nitrogen removal. The addition of VRPC to
31 the ASSR successfully immobilized abundant hydrolytic, fermentative and
32 slow-growing microorganisms, which all contributed to reductions in sludge yield.
33
34 Keywords: Anaerobic side-stream reactor; Porous carriers; Sludge reduction;
35 Microbial community
36
Page 2 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
3
37 Introduction
38 The biological treatment of conventional activated sludge (CAS) is a common
39 procedure in the treatment of domestic and industrial wastewater treatment plants
40 (WWTPs) (De Oliveira et al. 2018; Niu et al. 2016). However, the increasing quantity
41 of waste activated sludge (WAS) produced during this process has become a critical
42 issue with recent dramatic increases in the quantities of wastewater and more stringent
43 environmental constraints (Ferrentino et al. 2019). Activated sludge contains active
44 (live) and inactive (dead) microorganisms that must be treated before disposal to
45 prevent adverse health and environmental effects on the public, and subsequent
46 treatment and disposal of WAS accounts for 25%--65% of plant operating costs
47 (Ferrentino et al. 2016a; Semblante et al. 2014). Given economic and environmental
48 pressures, a cost-effective strategy for removing and reducing sludge production is
49 urgently needed in wastewater treatment (An et al. 2017). The sludge in situ reduction
50 (SIR) strategy has been widely promoted and implemented throughout the wastewater
51 treatment industry and is considered a promising approach to minimize WAS
52 production within biological wastewater treatment, rather than struggling with
53 posterior sludge treatment and disposal (Pang et al. 2018; Zheng et al. 2019a).
54 Recently, much research has been conducted on biological SIR techniques (Zhou et al.
55 2014). Among several sludge reduction strategies, the biological SIR process that
56 involves an anaerobic side-stream reactor (ASSR) placed in the sludge return loop
57 provides a particularly promising approach for reducing sludge, as this technique can
58 remove sludge without producing negative impacts on pollutant removal and sludge
Page 3 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
4
59 dewaterability (Zheng et al. 2019a). Indeed, previous studies have demonstrated the
60 efficiency of a laboratory-scale ASSR process in sludge reduction: ASSR processes
61 can reduce sludge yield by 40%-- 60% compared to CAS processes (Ferrentino et al.
62 2016b). The combination of membrane bioreactors (MBRs) with ASSR technology
63 provides a particularly promising means of sludge reduction by preventing the
64 deterioration of effluent quality, enhancing biological metabolism and reducing
65 footprint requirements (Cheng et al. 2017).
66 To date, most research has focused on the effect of several parameters, such as
67 oxidation reduction potential (ORP) (Saby et al. 2003), the anaerobic solid retention
68 time (SRTASSR) (Semblante et al., 2016; Cheng et al. 2018a), side-stream ratio (Coma
69 et al. 2013) and aeration conditions (Haberdasher et al. 2015), on sludge reduction and
70 the performance of ASSRs. These studies have been critical for promoting practical
71 applications of ASSR technology and for deepening our understanding of sludge
72 reduction mechanisms. Possible mechanism of on-site sludge reduction in such
73 reactors, including energy uncoupling, endogenous decay, destruction of extracellular
74 polymers (EPS), biomass feasting/fasting and selective enrichment of bacterial
75 populations, have been discussed in previous studies (Semblante et al. 2014;
76 Ferrentino et al. 2016b). It is worth noting that sludge reduction in the ASSR process
77 is driven by the selection of different microbial communities as a result of sludge
78 exchange between different redox systems; thus, the structure of the microbial
79 community in ASSR systems is often different from that in CAS. From a
80 microbiological perspective, inserting an ASSR in the sludge return line induces the
Page 4 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
5
81 selection of the microbial community. Ning et al. (2014) used 454 pyrosequencing to
82 reveal that the accumulation of special fermentation bacteria and nitrifying bacteria in
83 an anoxic–oxic–settling–anaerobic (A+OSA) process may affect sludge reduction
84 performance and stable nitrogen removal. Zhou et al. (2015) found that anaerobic
85 bacteria, such as fermentative, hydrogenogenic and acidogenic bacteria were enriched
86 in an ASSR and played an important role in reducing sludge by biomass decay and
87 hydrolysis of particulate organic matter. Meanwhile, pyrosequencing analysis by
88 Cheng et al. (2017) has shown that a higher side-stream ratio (SR) favored the growth
89 of slow-growing bacteria, while a lower SR favored the enrichment of hydrolytic and
90 predatory bacteria. Ferrentino et al. (2019) observed that slow-growing, EPS-releasing
91 and predatory bacteria responsible for biomass decomposition survived in the external
92 anaerobic reactor. These findings indicated that the alternation of anaerobic and
93 aerobic environments resulted in the exchange of sludge biomass, promoted the
94 enrichment of functional microorganisms and reduced sludge yield. Therefore, more
95 detailed research was needed to address how functional microorganisms could be
96 enriched in the ASSR process to enhance sludge reduction performance and the
97 efficiency of pollutant removal.
98 Previous studies have shown that immobilization of activated sludge on a solid
99 carrier can significantly improve the density and biodiversity of microorganisms in
100 the treatment line, thereby improving the speed and depth of sewage treatment (Litti
101 et al. 2013; Zhang et al. 2016). Selection of an appropriate carrier type is critical for
102 the maintenance of the optimal active biomass and for fostering an ideal microbial
Page 5 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
6
103 population. Compared with other suspended carriers, porous carriers with large
104 surface area can ensure a high concentration of biomass and the effective enrichment
105 of functional microorganisms. Xing et al. (1999) found that the presence of
106 microorganisms immobilized on porous carriers could effectively decrease the time
107 needed for sludge acclimation as well as remove nitrogen compounds produced by
108 degradation of nitroaromatic hydrocarbons. Feng et al. (2008) detected protozoa and
109 metazoa, as well as rich nitrifying and denitrifying bacteria on porous biological
110 carriers of a sludge reduction fixed-bed bioreactor. Zhao et al. (2015) concluded that
111 adding carrier to duckweed system successfully immobilized abundant N-removing
112 microorganisms (mainly ammonia-oxidizing bacteria, nitrite oxidizing bacteria and
113 nitrogen-fixing bacteria), and contributed to higher nitrogen removal. Therefore, in
114 order to effectively enrich microorganisms related to sludge reduction and pollutant
115 removal, special porous biological carriers need to be added to the ASSR. Volcanic
116 rock porous carrier (VRPC) has the advantage of being permeable, having large
117 specific surface area, and being able to facilitate the immobilization and establishment
118 of a biofilm of microorganisms. Moreover, VRPC has no harmful effects on
119 immobilized microorganisms, and does not significantly affect the biological activity
120 of immobilized microorganisms. Therefore, the VRPC might prove useful to the
121 sewage treatment sludge reduction system.
122 In this study, three lab-scale MBRs, including an AO-MBR for control (C-MBR),
123 a MBR with ASSR (A-MBR) and a MBR with an ASSR filled with VRPC (FA-MBR)
124 were operated in parallel to evaluate the ability of VRPCs to reduce sludge and
Page 6 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
7
125 remove pollutants. The removal efficiency of organic matter, nitrogen, phosphorus
126 and sludge was monitored during 120 days of continuous and stable operation of the
127 reactor. High-throughput sequencing technology has been applied to detect the
128 structure of the microbial community and microbial populations in three reactors and
129 carriers. Overall, this study provides insight into the volcanic rock porous carriers
130 could be used to facilitate ASSR processes in reducing sludge yield.
131 Materials and methods
132 Experimental setup and operating conditions
133 The activated sludge used in the experiment was collected from the oxidation
134 ditch of a sewage treatment plant in Zigong, China. The mass concentration of
135 inoculated sludge mixed liquid suspended solids (MLSS) was about 5000 mg/L.
136 Before the experiment, the inoculated sludge was acclimated via several steps. First,
137 the sludge was screened and filtered three times. After aeration for 24 hours and
138 settling for two hours, approximately 1/3 of the supernatant was removed. Next, the
139 sludge was supplemented with an equal volume of synthetic wastewater. Then
140 continue the operation of aeration, sedimentation, drainage and injection of synthetic
141 wastewater. After 16 days of acclimation, the inoculated sludge gradually adapted to
142 the synthetic wastewater, indicating that the acclimation process was completed. In
143 this study, three lab-scale MBRs, including C-MBR, A-MBR and FA-MBR (Fig. 1)
144 were continuously fed with synthetic wastewater. Within 120 days of stable operation,
145 three reactors were placed in the same closed room, and the indoor temperature was
146 maintained at 25°C by an air conditioner. Three identical MBRs contained anoxic,
Page 7 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
8
147 oxic and membrane zone with effective volumes of 4, 13.5 and 4.7 L, respectively,
148 and their corresponding hydraulic retention times (HRTs) were 1.96, 6.62 and 2.3 h,
149 respectively. In the aerobic/membrane reactor, a blower connected to three thin
150 bubble diffusers was placed at the bottom to provide a supply of oxygen. This same
151 blower also provided air to the membrane to scour the fibers and thus reduce pollution.
152 Therefore, the level of dissolved oxygen (DO) of the aerobic zone was maintained at
153 2.0–4.0 mg/L, while the DO concentration of the membrane zone was maintained at
154 6.0–8.0 mg/L. A mechanical stirrer was placed in the anoxic tank to mix the activated
155 sludge.
156 In contrast to the C-MBR system, an ASSR with an available volume of 14.6L
157 was inserted into the sludge recycling line in the A-MBR and FA-MBR. The HRT
158 (volume of ASSR/sludge return flow) for the ASSRs lasted 6.95h in the A-MBR and
159 FA-MBR systems.The returned activated sludge line from the membrane to the
160 aerobic tank was pumped into the ASSRs at a flow rate equal to 2.1 L/h and then
161 recycled to the anoxic reactor. The ASSR module in the FA-MBR was packed with
162 VRPC at a packing ratio of 15.88% (v/v). This carrier is made of a natural porous
163 volcanic rock ore that has undergone a series of processes, such as ore dressing,
164 crushing, screening and grinding. Its main components are dozens of minerals such as
165 silicon, aluminium, calcium, and a few trace elements. According to the production
166 manual provided by the manufacturer, the diameter, pore size, porosity and specific
167 surface area of the carrier are 2–4cm, 1–5mm, 73–82%m2/g, respectively. The carriers
168 were evenly distributed on the wall of the pond around the ASSR and fixed in place
Page 8 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
9
169 with a tubular wire mesh, which is the same as the center of the anaerobic reactor. In
170 the three systems, the influent flow rate was maintained at 48.96L/d using peristaltic
171 pumps. To be consistent with previous studies, the interchange rate (the rate at which
172 solids passed through the ASSR) was controlled to be 100% of the influent flow rate,
173 while the mixed liquor recirculation ratio was maintained at 300% for denitrification
174 (Coma et al. 2013).
175 Analytical methods
176 Chemical oxygen demand (COD), total nitrogen (TN), ammonium nitrogen
177 (NH4+-N), nitrate nitrogen (NO3
--N), total phosphorus (TP) and total suspended solids
178 (TSS) and volatile suspended solids (VSS) in the influent and effluent were analyzed
179 every two days following standard methods. The mixed liquid samples were extracted
180 from the water inlet, anoxic zone, and the outlets of the MBRs and ASSRs for
181 analysis of soluble COD (SCOD), TN, NH4+-N, NO3
--N and TP once a week. Values
182 of DO, pH and ORP were monitored daily using an HQ30d portable meter (HACH,
183 USA).
184 One-way ANOVAs (α = 0.05) were used to compare differences between the
185 pollutants in the effluent of the three systems. Data were processed using Office Excel
186 2010 (Microsoft, USA).
187 Estimate of observed sludge yield
188 The observed sludge yield (Yobs, g MLSS/g COD) was calculated using the
189 following method (Ferrentino et al. 2018).
190 (1)
Page 9 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
10
191 The reduction in sludge after insertion of ASSRs was estimated by comparing
192 observed sludge production of the A-MBR, FA-MBR and C-MBR systems using the
193 following equation:
194 (2)
195 Where Yobs,ASSRS is the observed sludge yield of the A-MBR or FA-MBR reactor.
196 Following the method of Cheng et al. (2018a), the Spearman’s rank correlation
197 coefficient in the SPSS software package was used to estimate the correlated release
198 of substrate.
199 Microbial community analysis
200 DNA extraction and PCR amplification
201 Four sludge samples were collected from three MBRs (C-MBR, A-MBR and
202 FA-MBR) and sludge was attached on the surface of VRPC on Day 104 operations of
203 these three systems had reached their steady state. The sequencing of sludge samples
204 was completed using the Illumina-MiSeq platform (Majorbio Bio-Pharm Technology,
205 Shanghai, China) to characterize differences in the structure of the microbial
206 communities between the three MBRs. Samples were extracted and processed with
207 the E.Z.N.A. soil DNA kit (Omega, USA) following the manufacturer’s protocol. 16S
208 rRNA gene fragments containing V3 and V4 regions were amplified from the
209 template using primers the 338F (ACTCCTACGGGAGGCAGCAG) and 806R
210 (GGACTACHVGGGTWTCTAAT) (Niu et al. 2016; Cheng et al. 2017). Triplicate
211 PCR amplifications were performed in a 20μL reactor containing 4 μL of 5 × FastPfu
212 Buffer, 2μL of 2.5 mM dNTPs, 0.8μL of each primer (5 mM), 10 ng of Template
Page 10 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
11
213 DNA and 0.4μL FastPfu Polymerase. (TransGen AP221-02, Beijing, China). The
214 conditions for PCR were the following: initial denaturation at 94°C for for 3 min
215 followed by 27 cycles of 94°C for 30 sec; 55 °C for 30 s and 72 °C for 45 s; and a
216 final extension at 72°C for 10 min. After PCR amplification, 2% agarose gel was
217 formulated to detect the triplicate products for each sample; products were recovered
218 with an AxyPrep DNA Purification Kit (Axygen Biosciences, USA).
219 MiSeq sequencing
220 After purification, PCR products were assayed using the Illumina Miseq platform
221 according to standard protocols outlined by Majorbio Bio-Pharm Technology. To
222 obtain the effective sequence database for each sample, all raw sequences were
223 trimmed and removed for random sequencing errors and low-quality sequences
224 following the method of Yuan et al. (2015). Finally, after filtering low quality reads,
225 primers were trimmed using SEQCLN and MOTHUR software.
226 Biodiversity analysis and phylogenetic classification
227 MOTHUR clustering software was used to generate the operational transform
228 unit (OTU) with a cluster similarity of 97%. OTU species identification was
229 compared with the SILVA prokaryotic ribosomal sequence library (Release128
230 http://www.arb-silva.de) with a confidence threshold set to 80%. The results from
231 pyrosequencing were then deposited into the NCBI short reads archive database
232 (accession No. SRP231106). Based on the clustering results, the following parameters
233 were obtained from the four samples using MOTHUR software: dilution curve, Chao
234 and Ace, Shannon and Simpson and Good's coverage (Cheng et al., 2017).
Page 11 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
12
235 Results
236 Pollutant removal and sludge reduction performance
237 Following microbial acclimation, the three reactors were stably operated for 120
238 days. The changes in concentration of the pollutants in the influent and effluent are
239 shown in Fig. 2. As shown in Fig. 2a, the influent COD concentration fluctuated
240 around 497.81 ± 67.08 mg/L, a one-way ANOVA showed that the C-MBR, A-MBR
241 and FA-MBR did not significantly differ (p=0.84) in removal efficiency, with average
242 COD concentrations in the effluent of 14.82 ± 9.67, 15.60 ± 10.94 and 14.44 ± 10.64
243 mg/L, respectively. Thus, the addition of an ASSR in the C-MBR had no noticeable
244 effect on the degradation of organic matter.
245 With an average NH4+-N concentration in the influent of 59.38 ± 8.54 mg/L, the
246 average removal efficiencies of NH4+-N in the C-MBR, A-MBR and FA-MBR were
247 98.4%, 99.42% and 99.32%, respectively. The results of a one-way ANOVA (p<0.01)
248 showed that there was a highly significant difference in the removal efficiency of
249 NH4+-N between the C-MBR and the other two systems; however, the addition of
250 VRPC to the ASSR did not have an effect on NH4+-N removal as there was no
251 significant difference in NH4+-N removal efficiency between the A-MBR and
252 FA-MBR.
253 The changes in TN concentration in the influent and effluent of the three reactors
254 are shown in Fig. 2c. The average effluent TN of the C-MBR, A-MBR and FA-MBR
255 were 26.56±13.49, 16.63±5.72 and 15.15±4.77 mg/L with corresponding removal
256 efficiencies of 63.66%, 77.24% and 79.27%, respectively. A one-way ANOVA
Page 12 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
13
257 (p<0.01) showed that there was a significant difference in TN concentration in the
258 three systems, indicating that the addition of ASSRs and VRPC enhanced nitrogen
259 removal.
260 Fig. 2d shows variation in TP concentration in the influent and effluent of the
261 three systems. Compared with the C-MBR with an average TP removal of 63.59%,
262 the A-MBR and FA-MBR facilitated higher TP removal efficiencies of 71.86% and
263 75.43%. According to a one-way ANOVA (p=0.028) of the three reactors, the
264 addition of ASSRs had a significant positive effect on the removal of TP.
265 As shown in Fig. 3, the curve plotting cumulative biomass and cumulative
266 substrate consumption was applied to fit a linear regression, and the value of Yobs was
267 determined by the slope of each linear regression curve. The highest Yobs of 0.148 g
268 SS/g COD was observed in the C-MBR, which was similar to the traditional MBR
269 with a Yobs of 0.135 g SS/g COD (Cheng et al. 2017). In the A-MBR and FA-MBR,
270 Yobs were 0.124 and 0.109 g SS/g COD, and the mean reduction in sludge was 16.2%
271 and 26.4% lower compared with the C-MBR. The sludge reduction efficiency
272 observed in the A-MBR is consistent with previous studies that have examined the
273 OSA process (6%–61%) (Zhou et al. 2015; Pang et al. 2018). The highest rate of
274 sludge reduction was observed in the FA-MBR system and suggested that the addition
275 of carriers to the ASSR reduces sludge production.
276 Analysis of microbial community structure
277 Richness and diversity of bacteria phylotypes
278 There were 40906(C-MBR), 40954(A-MBR), 41006(FA-MBR) and
Page 13 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
14
279 48688(VRPC) high quality sequence labels normalized to the average length of 416bp
280 for the four sludge samples. To compare the variability of each sample at the same
281 sequence depth, 40906 reads were normalized to each high-throughput datum for
282 further analysis. As shown in Table 1 and Fig.4, these sludge samples were calculated
283 at the 97% classification level for the OTU, Chao1 and Shannon diversity indices of
284 the microbial community. The coverage indexes of the four sludge samples were
285 greater than 0.95, indicating that the sequencing depth attained expected requirements
286 and that the OTU of each processed sludge sample could be used to effectively
287 characterize the microbial community. Fig. 4, the number of OTUs in the sludge
288 samples of the three systems was 625 (C-MBR), 760 (A-MBR) and 799 (FA-MBR),
289 respectively, compared with 1163 in the VRPC. Furthermore, the number of OTUs
290 shared by the four samples was 446, and the unique number of OTUs in carriers was
291 as large as 304, accounting for 26.14% of the total number of OTUs. The results
292 suggest that the biomass attached to the carrier in the fluidized sludge reactor
293 increases due to the large specific surface area. After long-term domestication,
294 biofilms formed on the VRPC are more biodiverse. In contrast, the number of OTUs
295 unique to the FA-MBR system was 2.13% lower than that of the C-MBR and A-MBR,
296 (4.64% and 2.24%, respectively), indicating that more OTUs were shared by different
297 communities after filling the ASSR with VRPC. In Table 1, comparison of the
298 richness index (Ace and Chao) indicated that the microbial abundance in the A-MBR
299 and FA-MBR was significantly increased following the addition of ASSR.
300 Interestingly, there was a slight difference in the microbial richness and diversity
Page 14 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
15
301 between the A-MBR and FA-MBR, indicating that the addition of VRPC possibly had
302 an impact on the structure of the microbial communities in these systems. Meanwhile,
303 the higher Shannon index in the FA-MBR confirmed that the microbial community
304 was more diverse and more evenly distributed than that of the A-MBR. Notably,
305 VRPC had the highest Ace, Chao and Shannon values out of all of the samples with
306 1308, 1331 and 5.22, respectively. This finding indicated that a stable biofilm was
307 formed on the surface of the carrier with a higher microbial richness and diversity
308 compared with other sludge samples.
309 Classification complexity of microbial communities
310 To characterize the predominant bacterial taxa in the three MBR systems, we
311 made comparisons of microbial community structure at different taxonomic levels
312 from phylum to genus (Fig. 5). A total of 25, 30 and 32 bacterial phyla were identified
313 in the C-MBR, A-MBR and FA-MBR, respectively, whereas 43 identified phyla were
314 recovered from the VRPC. As shown in Fig. 5a, Proteobacteria (19.55%–48.73%),
315 Bacteroidetes (17.20%–37.51%) and Saccharibacteria (12.24%–33.60%) were the
316 most dominant phyla in the three samples, which is consistent with the findings of a
317 previous study (Pang et al. 2018). Proteobacteria achieved its highest relative
318 abundance in the C-MBR (48.73%). In contrast, Bacteroidetes had the lowest relative
319 abundance and only accounted for 17.2% of bacterial taxa detected. In anaerobic
320 environments, Proteobacteria induce cell lysis and release intracellular substances,
321 while Bacteroidetes utilize the secondary substrate for hydrolytic fermentation and
322 growth (Cheng et al. 2018b). Saccharibacteria, which was clearly enriched in the
Page 15 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
16
323 FA-MBR as it represented 33.60% of bacterial taxa detected, has been documented to
324 be a specialized epiphytic parasite that grows on the surface of host bacteria (Bor et al.
325 2016). Actinobacteria and Chloroflexi have been found to be associated with the
326 degradation of organic matter (Xie et al. 2014); indeed, Actinobacteria and
327 Chloroflexi were most abundant in the FA-MBR and made up 13.76% and 5.35% of
328 bacterial taxa detected, respectively. This finding indicated that the addition of
329 carriers to anaerobic side-stream reactors increased the abundance of these phyla.
330 Other phyla, such as Acidobacteria, Firmicutes and Verrucomicrobia, were also
331 enriched in the FA-MBR and had the highest relative abundances among the three
332 MBRs. However, the phyla Nitrospirae and Gemmatimonadetes showed the opposite
333 pattern, wherein relative abundance was highest in the C-MBR but lowest in VRPC.
334 Fig. 4b shows the relative abundances of bacterial taxa that made up more than
335 1% in at least one sample and demonstrates that even more diversity in microbial
336 community profiles existed at the class level. Sixteen bacterial classes were detected
337 in all four communities, and the three most common classes included norank
338 __Saccharibacteria, Sphingobacteriia and Gammaproteobacteria. Norank
339 __Saccharibacteria, which belongs to the phylum Saccharibacteria, had the highest
340 relative abundance in the FA-MBR (33.60%)—a finding consistent with phylum-level
341 results. The relative abundance of Sphingobacteriia was 17.60% in VRPC, which was
342 much higher than that documented in the C-MBR (13.58%), A-MBR (14.38%) and
343 FA-MBR (13.63%). Gammaproteobacteria, which is in the phylum Proteobacteria,
344 was the most dominant class in the C-MBR (33.07%). Betaproteobacteria, which was
Page 16 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
17
345 correlated with polysaccharide utilization and butyric acid fermentation (Niu et al.
346 2016), were more abundant in the A-MBR (11.92%), FA-MBR (10.6%) and VRPC
347 (15.03%) relative to the C-MBR (4.07%). Furthermore, Alphaproteobacteria and
348 Deltaproteobacteria of the phylum Proteobacteria were enriched in the A-MBR
349 (8.82% and 5.69%, respectively). In addition, Acidobacteria (1.04%–6.78%) and
350 Anaerolineae (0.67–3.49%), which are play a role in the hydrolysis and fermentation
351 of organic matter (Zhou et al. 2015), were enriched in filling carriers in the FA-MBR.
352 Flavobacteriia, which is involved in the secretion of EPS and plays a role in
353 membrane fouling according to Zheng et al. (2019b), was abundant in VRPC (3.78%).
354 Other dominant classes, such as Nitrospira, Cytophagia and Gemmatimonadetes,
355 were most abundant in the C-MBR with relative abundances at 3.35%, 1.81% and
356 1.61%, respectively.
357 Comparisons at the genus level were made using a hierarchically clustered
358 heatmap to obtain more information on microbial communities (Fig. 5c).
359 Norank_Saccharibacteria, which plays an important role in the decomposition of
360 various complex organic compounds under aerobic, nitrate-reducing and anaerobic
361 environments (Zheng et al. 2019a), was the most dominant genus in the FA-MBR and
362 in VRPC. The relative abundance of norank_Saprospiraceae was significantly higher
363 in the A-MBR (29.42%) relative to the C-MBR (8.51%) and FA-MBR (9.23%).
364 Thiothrix, which belongs to the class Gammaproteobacteria, is known to be capable
365 of oxidizing sulfur-containing compounds in bioreactors using organic matter (Li et al.
366 2014). Thiothrix was significantly more abundant in the C-MBR (28.72%) relative to
Page 17 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
18
367 the other reactors. Some genera, such as Azospira, Anaerolineaceae and
368 Flavobacterium, are often observed in activated sludge systems and MBRs (Zhou et al.
369 2015). Azospira, Anaerolineaceae and Flavobacterium were enriched in VRPC with
370 relative abundances in VRPCs of 3.59%, 3.12% and 2.59%, respectively. However,
371 the relative abundances of Nitrospira, Rhodobacter and unclassified __Micrococcales
372 were highest in the C-MBR, indicating that the insertion of ASSRs greatly decreased
373 their abundance in MBR units.
374 In this study, porous carrier structures enriched six other bacteria that had
375 relative richnesses greater than 1% at the genus level. The five no-rank bacteria
376 among these were SC-I-84, Verrucomicrobiaceae, Acidobacteria, Phyllobacteriaceae
377 and NS9_marine_group. The highest relative richness was in SC-I-84 bacteria
378 (2.68%), which belong to Proteobacteria and are often detected in soil wetlands.
379 Verrucomicrobiaceae, within the phylum Verrucomicrobia, has been primarily
380 detected in aquatic and soil environments, yet, the majority of Verrucomicrobiaceae
381 detected have not been able to be identified beyond the level of phylum, and their
382 functions remain unknown (Stevenson et al. 2004). Acidobacteria consists of
383 Gram-negative bacteria that had a relative abundance of 1.94%. Its functional role in
384 the environment includes the decomposition of various biopolymers as well as
385 participation in the global cycling of carbon, iron and hydrogen (Janssen et al. 2002).
386 The relative richnesses of Phyllobacteriaceae and NS9_marine_group bacteria, which
387 belong to the Proteobacteria and Bacteroides, were 1.09% and 1.03%, respectively.
388 Additionally, Ferruginibacter was also considered to be a dominant genus of bacteria
Page 18 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
19
389 that was enriched on carriers, as it had a relative richness of 1.03%. It consists of
390 Gram-negative bacteria that are often found in sewage treatment plants and contribute
391 to the fermentation of glucose (Lee et al. 2014).
392 Discussion
393 Process performance
394 Previous studies have shown that ASSRs do not adversely affect the efficacy of
395 sewage treatment (Semblante et al. 2017; Ferrentino et al. 2018). In contrast, ASSRs
396 have been shown to promote the removal of nitrogen and phosphorus. Most studies
397 have shown that the removal efficiency of SCOD in ASSRs is equal to or slightly
398 greater than that in conventional reference systems. In a few cases, ASSR devices
399 reduce the removal efficiency of SCOD (Ferrentino et al. 2016b). Saby et al. (2003)
400 proposed that "fasted" sludge in the MBR-OSA anaerobic tank consumes the substrate
401 more quickly when it is supplemented by the lost energy under the "feasting"
402 conditions of the aerobic reactor, thereby improving the removal efficiency of SCOD.
403 Semblante et al. (2014) argued that, although sludge attenuation in ASSRs promoted
404 the release of SCOD and increased its concentration, the return of sludge back to the
405 MBR results in the consumption of SOD, meaning that most of the remaining SCOD
406 produced by the OSA process was biodegradable and had little impact on the overall
407 removal of SCOD. Zheng et al. (2019b) tested three different ASSR-MBRs and found
408 that there were no differences in the removal efficiency of SCOD. Furthermore, they
409 found that concentrations in the effluent were all below 15 mg/L compared with those
410 in the AO-MBR system.
Page 19 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
20
411 With respect to nitrogen removal, previous researchers have found that inserting
412 an ASSR in the sludge return loop does not adversely affect nitrogen removal
413 (Ferrentino et al. 2016b; Cheng et al. 2017). In contrast, Zhou et al. (2015) found that
414 the reduction in nitrification efficiency in an A + OSA system primarily stemmed
415 from the anaerobic degradation of nitrifying bacteria in the ASSR. However, soluble
416 COD might be released during the process of cell dissolution and particulate organic
417 matter hydrolysis in the ASSR, which could provide an additional source of carbon
418 for denitrification and promote TN removal as a result. Pang et al. (2018)
419 demonstrated that the removal efficiency of TN increased by 16.6% following the
420 insertion of an ASSR compared with the AO-MBR; however, the NH4+-N
421 concentration in the effluent was slightly higher due to the recirculation of Total
422 Kjeldahl Nitrogen (TKN, NH4+-N and organic nitrogen [O-N]) released from the
423 ASSR. Zheng et al. (2019a) found that under normal temperatures (21.6 ± 4.9°C) the
424 TN removal efficiency of A-MBR and AP-MBR (with carriers packed in the ASSR)
425 increased by 19.9% and 28.6%, respectively, relative to the reference system. At low
426 temperatures (6.5 ±1.7 °C and 2.6 ±1.4°C), pollutant removal performance
427 deteriorated, and the removal efficiency of NH4+-N and TN decreased. In this study,
428 the A-MBR and FA-MBR were more efficient in the removal of TN (77.24% and
429 79.27%, respectively) relative to the C-MBR (63.66%), which is roughly consistent
430 with the findings of previous studies.
431 At present, few studies have evaluated the effect of ASSRs on phosphorus
432 removal. The traditional phosphorus removal mechanism in the sludge cycle takes
Page 20 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
21
433 place between the aerobic and anaerobic phases, which drives phosphorous
434 accumulating organisms (PAOs) to absorb and release orthophosphate; thus,
435 phosphorus becomes separated from wastewater through the treatment of sludge rich
436 in orthophosphate (Semblante et al. 2014). The results of Chudoba et al. (1992)
437 showed that the biomass of the OSA system contained approximately 60% PAOs,
438 while that of the traditional activated sludge system contained 10%. This difference in
439 the biomass of PAOs stems primarily from the physiological impact that anaerobic or
440 anoxic microorganisms experience due to a lack of oxygen and food. Ye et al. (2008)
441 found that in OSA systems where sludge was retained for 5.5 h, 7.6 h and 11.5 h in
442 ASSRs, the average removal rates of TP were 48%, 59% and 58%, respectively. This
443 finding indicated that the insertion of the anaerobic sludge tank reduced the
444 concentration of TP in wastewater and likely resulted from the high concentration of
445 organic substrates. Cheng's (2017) results confirmed that long SRTs and low degrees
446 of COD in influent water resulted in lower TP removal efficiency.
447 Yobs values vary among previous studies and appear to depend on wastewater
448 characteristics, operating parameters (e.g., hydraulic retention times) and
449 environmental conditions (e.g., temperature) (Wang et al. 2013). Saby et al. (2003)
450 operated two pilot-scale reactors using synthetic wastewater and found that the Yobs of
451 the MBR-OSA was 0.18–0.32 TSS/COD lower than that of the reference system (0.40
452 TSS/COD). Cheng et al. (2017) observed that increasing HRT of the ASSR from 3.3
453 to 6.6 h permitted ASSR-MBRs to attain Yobs of 0.081, 0.062 and 0052 g SS/g COD
454 and reduced sludge production by 8.0%, 29.5% and 40.9%, respectively. Zheng et al.
Page 21 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
22
455 (2019a) reported that the MBR-OSA system had a sludge production rate of 0.139 g
456 SS/g COD, which was lower than that of the control MBR (0.171 g SS/g COD) at
457 normal temperatures. At low temperatures, the Yobs value of the MBR-ASSR was
458 0.131 g SS/g COD, and AO-MBR was reduced to 0.143 g SS/g COD.
459 Effects of carriers on microorganisms associated with nutrient
460 removal
461 The microbiome is the most important component of activated sludge. The
462 microbiome associated with nitrogen metabolism functions plays a particularly
463 important role in system denitrification. As shown in Fig. 6a, nitrifying bacteria in the
464 genus Nitrospira were immobilized on the carrier biofilm and had a relative richness
465 of 0.73%. Nitrospira enrichment in the carrier biofilm promoted nitrogen conversion
466 from NH4+-N to NO3--N and NO2
--N, enhancing the potential for NH4+-N
467 concentration to be reduced in the effluent in the FA-MBR system. In addition, Koch
468 et al. (2015) found that Nitrospira not only oxidized nitrites under aerobic conditions
469 but also was flexible both ecologically and physiologically in reducing nitrates and
470 utilizing organic products from fermented organisms. The relative abundances of
471 Nitrospira, a chemolithoautotrophic nitrifier (Cheng et al., 2018a), were 3.53%,
472 1.07% and 0.98% in the C-MBR, A-MBR and FA-MBR, respectively. Thus, the
473 difference in the availability of oxygen between the ASSR, an anaerobic environment,
474 and the MBR, an aerobic environment, potentially selected for some microorganisms.
475 The release of NH4+-N provided an indicator of sludge decay in the ASSR given that
476 the ammoniation and hydrolysis of particulate organic matter were accompanied by
Page 22 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
23
477 anaerobic sludge decay (Cheng et al. 2017). The average concentration of NH4+-N in
478 the A-MBR and FA-MBR in the anaerobic side stream was 0.87 mg/L and 2.0 mg/L,
479 respectively, suggesting that the addition of VAPC contributed to the more complete
480 breakdown of sludge flocs.
481 As shown in Fig. 6b, the average concentrations of nitrogen in the anoxic tank
482 and in the ASSR of the A-MBR and FA-MBR were negligible (<0.24mg/L);
483 moreover, the concentrations of nitrous nitrogen were also low. For these reasons,
484 these data are not shown here. These observations suggest that the release of
485 secondary substrate caused by sludge decay in anaerobic side-stream reactors created
486 conditions conducive to denitrification; as a result, the NO3--N circulating in the
487 ASSR can be completely denitrified (Zheng et al. 2019a). Meanwhile, the residual
488 secondary substrate was recirculated into the anoxic tank and enhanced denitrification
489 of the main stream. The average concentrations of NO3--N in the effluent from the
490 three systems were significantly higher than that of the aerobic pond. This difference
491 in concentrations might stem from the fact that a membrane tank with a high level of
492 dissolved oxygen (6.0~8.0mg/L) added at the end of the aerobic pond, which might
493 have further promoted the completion of nitrification. In addition, the discovery of
494 anaerobic ammonia oxidation bacteria might also be responsible for the decrease in
495 nitrous nitrogen. The phylum Planctomycetes, which has been shown to be capable of
496 carrying out anaerobic ammonia oxidation coupled with nitrate reduction (Wiseschart
497 et al. 2018), was more enriched in the FA-MBR (0.65%) and in VRPC (0.84%) than
498 in the C-MBR (0.52%). Moreover, the average concentration of NO3--N in the effluent
Page 23 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
24
499 of the FA-MBR system was lower than that in the C-MBR and A-MBR, which might
500 explain the immobilization of microorganisms on the carrier biofilm. The biofilm of
501 the carrier contained considerably greater abundances of Azospira (approximately
502 3.59%) compared with the other three systems, suggesting that Azospira has a
503 preference for enriching in biofilms rather than in sludge. The slowly growing
504 Azospira was not only a denitrifying bacterium, but also functioned as hydrolytic
505 bacteria that reduced sludge (Pang et al. 2018). Indeed, Azospira was preferentially
506 enriched in the FA-MBR (2.84%) with a relative abundance of 13.52 and 2.36 times
507 that observed in the C-MBR and A-MBR, respectively. The complete dominance of
508 Azospira in the carrier biofilm and FA-MBR was expected to contribute to the
509 reduction in NO3--N. This expectation was consistent with lower NO3
--N
510 concentrations in the FA-MBR effluent. Moreover, Comamonadaceae_unclassified
511 has long been known to consist of potentially aerobic denitrifying bacteria (DNB) for
512 simultaneous nitrification and denitrification (Li et al. 2018). Consistent with this
513 expectation, Comamonadaceae_unclassified was also apparently immobilized on the
514 VRPC biofilm with a relative abundance of 2.48%. Other DNB, such as
515 Flavobacterium, Rhizobacter, Hyphomicrobium and Sulfuritalea were also classified
516 as hydrolytic bacteria and were abundant on the carrier biofilm. Therefore, the
517 addition of VRPC resulted in an increased abundance of DNB and improved the
518 potential efficiency of nitrogen removal.
519 In Fig. 6c, the concentration of TP showed a slightly increasing trend in the
520 anoxic tank of the FA-MBR. This pattern might have been caused by the fact that the
Page 24 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
25
521 assimilated TP in a highly anaerobic environment was converted from polyphosphate
522 to orthophosphate as it was resuspended and returned to the anoxic tank. This trend
523 was different from the other two MBRs, where the average TP concentration
524 decreased from the influent to the anoxic tank. As Figure 6c shows, the lowest
525 average concentration of TP in the A-MBR was in the effluent, possibly due to the
526 enrichment of PAOs. Dechloromonas, a slow-growing taxon associated with
527 denitrification, has been detected as a PAO in enhanced biological phosphorus
528 removal reactors (Zhou et al. 2015; Cheng et al. 2018b). Indeed, we found that
529 Dechloromonas reached its highest relative abundance of 3.48% in the A-MBR. This
530 result was inconsistent with the observed average removal efficiency of phosphorus
531 over the long-term operation of the three reactors. This inconsistency might stem from
532 the porous structure of the carrier, which might have facilitated the growth of
533 phosphorus-accumulating bacteria of the genus Dechloromonas on the VRPC biofilm.
534 The relative abundance of another denitrifying PAO genus
535 Candidatus_Accumulibacter (Zheng et al. 2019a) was low in the three MBRs.
536 Relevant studies have shown that there are many explanations for the removal of
537 enhanced phosphorus in ASSR processes, such as the accumulation of PAO and the
538 means of substrate loading. Thus, more detailed research is needed to explain the
539 mechanisms underlying phosphorus removal efficiency (Ferrentino et al. 2016b).
540 In summary, the addition of VRPC to ASSRs successfully immobilized abundant
541 nitrogen and phosphorus-related microorganisms, especially denitrifying bacteria, and
542 contributed to the greater degree of nitrogen and phosphorus removal.
Page 25 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
26
543 Effect of carriers on microorganisms related to sludge reduction
544 Previous studies have confirmed that the hydrolysis of particulate organic matter
545 (POM), lysis of bacterial biomass and slow growth are the three main mechanisms
546 underlying the sludge reduction of SSRs, which are, in turn, realized by the
547 enrichment of hydrolyzed fermented bacteria, predatory bacteria and slow-growing
548 microorganisms, respectively (Zheng et al. 2019a). Therefore, we compared the
549 microbial genera underlying variation in sludge reduction among four sludge samples
550 (Table 2).
551 The hydrolysis of POM is a rate-limiting step in the process of lysis-cryptic
552 growth (Khursheed and Kazmi 2011). Thus, improvement of the conversion
553 efficiency of POM to dissolved forms can reduce the production of sludge (Niu et al.
554 2016). As shown in Table 2, the carrier biofilm contained a high quantity of
555 hydrolytic bacteria with a total relative abundance of 38.06% from primarily four
556 no-rank genera: Saccharibacteria, Saprospiraceae, Comamonadaceae and
557 Xanthomonadaceae. In addition, the relative abundance of Terrimonas and
558 Flavobacterium on carriers was significantly higher than that in the three systems,
559 which promoted the transformation of particulate organic matter into the dissolved
560 state and then into small molecules. The genus norank __Saccharibacteria improved
561 the efficiency of sludge reduction in the FA-MBR as norank __Saccharibacteria was
562 more enriched in the FA-MBR (33.60%) than in the C-MBR (12.24%) and A-MBR
563 (15.81%). Norank__Saprospiraceae, which has been shown to be associated with the
564 hydrolysis and utilization of complex carbon sources and the predation of other
Page 26 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
27
565 bacteria (Cheng et al. 2018b), was the most dominant genus in the A-MBR (29.42%).
566 This high abundance might stem from the partial immobilization of hydrolytic
567 bacteria on the carrier biofilm, resulting in a relative decrease in their content in the
568 FA-MBR system. Specially, the total relative abundances of Rhodobacter and
569 norank__Cytophagaceae, were highest in the C-MBR (3.78%), followed by the
570 A-MBR (2.93%) and FA-MBR (2.47%). Such a pattern might be caused by the fact
571 that the hydrolysis of particulate organic matter primarily occurred in the main stream.
572 Furthermore, fermentation bacteria were dominant on the biofilm of the porous
573 carrier. An abundance of fermentation bacteria should further promote the conversion
574 of soluble hydrolysates, such as amino acids and sugars, to short-chain fatty acids so
575 that they can be incorporated more effectively into the secondary matrix and
576 consumed by other microorganisms. The total relative richness of Ferruginibacter,
577 norank__Verrucomicrobiaceae, unclassified__Comamonadaceae and
578 norank__Anaerolineaceae, major fermented bacteria responsible for reductions in
579 sludge yield, reached 8.59% in VRPCs, which was significantly higher than the
580 relative richness of these taxa in the three MBRs. The
581 unclassified__Comamonadaceae and norank__Anaerolineaceae that were related to
582 the degradation of complex organic matter were obviously immobilized on the biofilm
583 of the carrier and had a relative richness of 2.48% and 3.12%, respectively. Thus,
584 VRPC can provide surfaces or porous structures that promote the attachment and
585 retention of fermentation microorganisms. In the three reactors, the total relative
586 abundances of fermentative bacteria were 3.46%, 3.44% and 5.49% in the C-MBR,
Page 27 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
28
587 A-MBR and FA-MBR, respectively. The results showed that the addition of VRPC in
588 ASSRs increased the efficacy of hydrolysis and the production of organic substrate,
589 thereby promoting the growth of fermented bacteria. Furthermore, the increase in the
590 relative percentage of fermentation bacteria provided more carbon sources for
591 denitrification and increased the TN removal rate (Jiang et al. 2018).
592 In addition, the addition of VRPC enriched two slow-growing microorganisms,
593 Dechloromonas and Azospira, which both had a relative richness greater than 1%.
594 Dechloromonas, as a solid-phased denitrifier, is capable of degrading lignocellulosic
595 as carbon sources (Feng et al. 2017). Thus, Dechloromonas also functioned as
596 hydrolytic bacteria and was most common in VRPC with a relative abundance of
597 3.48%. The relative abundance of Azospira, a dominant chlorate-reducing genus in the
598 natural environment (Byrne-Bailey et al. 2012), was higher in VRPC (3.59%) and in
599 the FA-MBR (2.84%) than in the C-MBR (0.21%) and A-MBR (1.20%). Other
600 slow-growing bacteria in MBRs responsible for lower Yobs primarily included
601 Thauera, Trichococcus, Sulfuritalea and Denitratisoma. The total relative abundances
602 of these genera were highest in the FA-MBR (1.82%) relative to the C-MBR (0.81%)
603 and A-MBR (1.37%), suggesting that the addition of the carrier in the ASSR was
604 more conducive to the growth of slow-growing microorganisms. Trichococcus, a type
605 of slow-growing fermentation bacterium (Zhou et al. 2015), was enriched in FA-MBR
606 with highest relative abudance 1.60%. Denitratisoma, classified as a
607 chemoorganoheterotrophic denitrifier (Ferrentino et al. 2016a), was not detected in
608 the C-MBR, and its abundance in the ASSR-MBRs was low. The denitrifying,
Page 28 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
29
609 slow-growing Thauera and Sulfuritalea grow either heterotrophically or
610 chemolithoautotrophically under anaerobic conditions (Cheng et al. 2017). The
611 patterns of growth of these two genera showed insignificant trends in the four sludge
612 samples.
613 The enrichment of predatory bacteria in the sludge reduction process is
614 considered to result from an enhancement in cell lysis, which might be in part
615 responsible for the lower Yobs. Predatory bacteria in the four sludge samples were
616 low (0.33%~1.31%) and included Haliangium, Bdellovibrio and Polyangiaceae. The
617 results therefore indicated that predation may not be the main cause underlying
618 sludge reduction in MBRs, a conclusion consistent with previous studies conducted
619 by Jiang et al. (2018). The relative richnesses of these predatory bacteria in the
620 FA-MBR and in VRPCs were lower than those in the C-MBR and A-MBR,
621 indicating that the addition of carriers may have had adverse effects on the
622 immobilization of predatory bacteria.
623 In summary, the microorganisms responsible for sludge reduction, such as
624 hydrolytic, fermentative, slow-growing and predatory bacteria, are important
625 components of the sewage treatment system. Reduction of excess sludge production
626 is achieved through the effective enrichment of these functional microorganisms.
627 Therefore, the addition of VRPC provides an efficient approach for reducing sludge
628 yield by enhancing the advantageous properties of slow-growing microbes and
629 promoting the interaction between bacteria, enzymes and substrates to facilitate
630 particle hydrolysis.
Page 29 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
30
631 Conclusion
632 This lab-scale study indicated that the addition of VRPC not only affected sludge
633 reduction and pollutant removal in an ASSR but also changed microbial community
634 structure. Compared with the C-MBR, the A-MBR and FA-MBR achieved greater
635 reductions in sludge of 16.2% and 26.4%, respectively. The removal of TN and TP
636 was significantly improved by the addition of a carrier. Illumina Miseq sequencing
637 results showed that a large number of microorganisms were immobilized on the
638 carrier surface in the form of a biofilm. The enrichment of nitrifying bacteria on the
639 carrier biofilm improved the efficiency of nitrogen removal. The immobilization of
640 hydrolysis as well as the fermentation and slow growth of bacteria on the carrier
641 biofilm reduced sludge production in the reactor.
642 Acknowledgements
643 This research was supported by the Young Scientists Fund of the National Natural
644 Science Foundation of China (51608339), the key SCI-tech project of Science and
645 Technology Bureau of Zigong (2019YYJC09), the Fund of Postgraduate of Xihua
646 University (ycjj2018115), the Ministry of education Chunhui plan project
647 (191650[2018-93]), the Young Scholars Project of Xihua University in 2019 and the
648 Department of Science and Technology of Sichuan Province (2017JY0129), China
649 Postdoctoral Science Foundation (2019M650860), the Natural Science Foundation of
650 Hebei Province (E2019402410). Thanks for Yufeng Xu’s suggestions concerning this
651 paper.
652 Author contributions
Page 30 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
31
653 Xinqiang Ning, Bin Zhang and Jiao Yue designed research; Yu Guo, Taixin Liu, Min
654 Zhou and Ying Yang performed research; Jiaxu Wu and Yang Zeng analyzed data;
655 Xinqiang Ning and Jiao Yue wrote the paper; Xinqiang Ning, Bin Zhang, Jiao Yue
656 and Yufeng Xu, advised research. All authors reviewed the manuscript.
657 Conflict of interest
658 The authors declare that they have no conflict of interest.
659
Page 31 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
32
661
662 Reference
663 An, Y., Zhou, Z., Yao, J, Niu, T.H., Qiu, Z., Ruan, D.N., Wei, H.J. 2017. Sludge
664 reduction and microbial community structure in an anaerobic/anoxic/oxic process
665 coupled with potassium ferrate disintegration. Bioresource Technology,
666 245:954-961. doi:10.1016/j.biortech.2017.09.023 .
667 Bor, B., Poweleit, N., Bois, J.S., Cen, L., Bedree, J.K., Zhou, Z.H., Gunsalus, R.P.,
668 Lux, R., et al. 2016. Phenotypic and physiological characterization of the
669 epibiotic interaction between Tm7x and its basibiont Actinomyces. Microbial
670 Ecology, 71:243–255. doi:10.1007/s00248-015-0711-7.
671 Byrne-Bailey, K.G., Coates, J.D. 2012. Complete genome sequence of the anaerobic
672 perchlorate-reducing bacterium azospira suillum strain ps. Journal of
673 Bacteriology, 194(10): 2767-2768. doi:10.1128/JB.00124-12.
674 Cheng, C., Zhou, Z., Niu, T.H., An, Y., Shen, X.L., Pan, W., Chen, Z.H., Liu, J. 2017.
675 Effects of side-stream ratio on sludge reduction and microbial structures of
676 anaerobic side-stream reactor coupled membrane bioreactors. Bioresource
677 Technology, 234: 380-388. doi:10.1016/j.biortech.2017.03.077.
678 Cheng, C., Zhou, Z., Pang, H.J., Zheng, Y., Chen, L.Y., Jiang, L.M., Zhao, X.D.
679 2018a. Correlation of microbial community structure with pollutants removal,
680 sludge reduction and sludge characteristics in micro-aerobic side-stream reactor
681 coupled membrane bioreactors under different hydraulic retention times.
682 Bioresource Technology, 260: 177-185. doi:10.1016/j.biortech.2018.03.088.
683 Cheng, C., Zhou, Z., Qiu, Z., Yang, J.Y., Wu, W., Pang, H.J. 2018b. Enhancement of
Page 32 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
33
684 sludge reduction by ultrasonic pretreatment and packing carriers in the anaerobic
685 side-stream reactor: Performance, sludge characteristics and microbial
686 community structure. Bioresource Technology, 249:298-306.
687 doi:10.1016/j.biortech.2017.10.043.
688 Chudoba, P., Morel, A., Capdeville, B. 1992. The case of both energetic uncoupling
689 and metabolic selection of microorganisms in the OSA activated sludge system.
690 Environmental Technology, 13:761- 770. doi:10.1080/09593339209385207.
691 Coma, M., Rovira, S., Canals, J., Colprim, J. 2013. Minimization of sludge production
692 by a side-stream reactor under anoxic conditions in a pilot plant. Bioresource
693 Technology, 129:229-235. doi:10.1016/j.biortech.2012.11.055.
694 De, Oliveira. T.S., Corsino, S.F., Di, Trapani. D., Torregrossa, M., Viviani, G. 2018.
695 Biological minimization of excess sludge in a membrane bioreactor: Effect of
696 plant conFig.uration on sludge production, nutrient removal efficiency and
697 membrane fouling tendency. Bioresource Technology, 259:146-155.
698 doi:10.1016/j.biortech.2018.03.035.
699 Feng, L.J., Chen, K., Han, D.D., Zhao, J., Lu, Y., Yang, G.F., Mu, J., Zhao, X.J. 2017.
700 Comparison of nitrogen removal and microbial properties in solid-phase
701 denitrification systems for water purification with various pretreated
702 lignocellulosic carriers. Bioresource Technology, 224:236-245.
703 doi:10.1016/j.biortech.2016.11.002.
704 Feng, Q., Yu, A.F., Chu, L.B., Xing, X.H.2008. Performance study of the reduction of
705 excess sludge and simultaneous removal of organic carbon and nitrogen by a
Page 33 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
34
706 combination of fluidized- and fixed-bed bioreactors with different structured
707 macroporous carriers. Biochemical Engineering Journal, 39:344–352.
708 doi:10.1016/j.bej.2007.10.006.
709 Ferrentino, R., Langone, M., Merzari, F., Tramonte, L. 2016a. A review of anaerobic
710 side-stream reactor for excess sludge reduction: configurations, mechanisms and
711 efficiency. Crit. Rev. Environmental Science & Technology, 46(4):382-405.
712 doi:10.1080/10643389.2015.1096879.
713 Ferrentin, R., Langone, M., Gandolfi, I., Bertolini, V., Franzetti, A., Andreottola, G.
714 2016b. Shift in microbial community structure of anaerobic side-stream reactor in
715 response to changes to anaerobic solid retention time and sludge interchange ratio.
716 Bioresource Technology, 221:588-597. doi:10.1016/j.biortech.2016.09.077.
717 Ferrentino, R., Langone, M., Villa, R., Andreottola, G. 2018. Strict anaerobic
718 side-stream reactor: effect of the sludge interchange ratio on sludge reduction in a
719 biological nutrient removal process. Environmental Science and Pollution
720 Research, 25(2):1243-1256. doi:10.1007/s11356-017-0448-6.
721 Ferrentino, R., Langone, M., Andreottola, G. 2019 Progress toward full scale
722 application of the anaerobic side-stream reactor (ASSR) process. Bioresource
723 Technology, 272: 267-274. doi:10.1016/j.biortech.2018.10.028.
724 Habermacher, J., Benetti, A.D., Derlon, N., Morgenroth, E. 2015. The effect of
725 different aeration conditions in activated sludge – Side-stream system on sludge
726 production, sludge degradation rates, active biomass and extracellular polymeric
727 substances. Water Research, 85:46-56. doi:10.1016/j.watres.2015.08.002.
Page 34 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
35
728 Janssen, P.H., Yates, P.S., Grinton, B.E., Taylor, P.M., Sait, M. 2002. Improved
729 culturability of soil bacteria and isolation in pure culture of novel members of the
730 divisions Acidobacteria, Actinobacteria, Proteobacteria, and Verrucomicrobia.
731 Applied and Environmental Microbiology, 68(5):2391-2396.
732 doi:10.1128/AEM.68.5.2391-2396.2002.
733 Jiang, L.M., Zhou, Z., Niu, T.H., Jiang, L.Y., Chen, G., Pang, H.J., Zhao, X.D., Qiu,
734 Z. 2018. Effects of hydraulic retention time on process performance of anaerobic
735 side-stream reactor coupled membrane bioreactors: Kinetic model, sludge
736 reduction mechanism and microbial community structures. Bioresource
737 Technology, 267: 218–226. doi:10.1016/j.biortech.2018.07.047.
738 Khursheed, A., Kazmi, A.A. 2011. Retrospective of ecological approaches to excess
739 sludge reduction. Water Research, 45(15):4287-4310.
740 doi:10.1016/j.watres.2011.05.018.
741 Koch, H., Lücker, S., Albertsen, M., Kitzinger, K., Herbold, C., Spieck, E., Nielsen,
742 P.H., Wagner, M., et al. 2015. Expanded metabolic versatility of ubiquitous
743 nitrite-oxidizing bacteria from the genus Nitrospira. Proceedings of the National
744 Academy of Sciences of the United States of America, 112(36):11371–11376.
745 doi:10.1073/pnas.1506533112.
746 Lee, B.I., Kang, H., Kim, H., Joung, Y., Joh, K. 2014. Ferruginibacter yonginensis
747 sp.nov. isolated from a mesotrophic artificial lake. International Journal of
748 Systematic and Evolutionary Microbiology, 64:846-850.
749 doi:10.1099/ijs.0.057083-0.
Page 35 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
36
750 Li, L., Dong, Y.H., Qian, G.S., Hu, X., Ye, L.L. 2018. Performance and microbial
751 community analysis of bio-electrocoagulation on simultaneous nitrification and
752 denitrification in submerged membrane bioreactor at limited dissolved oxygen.
753 Bioresource Technology, 258:168-176. doi:10.1016/j.biortech.2018.02.121.
754 Li, X.X., Liu, X.C., Wu, S.H., Rasool, A., Zuo, J.N., Li, C., Liu, Y. 2014. Microbial
755 diversity and community distribution in different functional zones of continuous
756 aerobic–anaerobic coupled process for sludge in situ reduction. Chemical
757 Engineering Journal, 257: 74-81. doi:10.1016/j.cej.2014.07.028.
758 Litti, Y.V., Nekrasova, V.K., Kulikov, N.I., Siman'kova, M.V., Nozhevnikova, A.N.
759 2013. Detection of anaerobic processes and microorganisms in immobilized
760 activated sludge of a wastewater treatment plant with intense aeration.
761 Microbiology, 82(6):690-697. doi:10.1134/S0026261713060076.
762 Ning, X.Q., Qiao, W.W., Zhang, L., Gao, X. 2014. Microbial community in
763 anoxic–oxic–settling–anaerobic sludge reduction process revealed by 454
764 pyrosequencing analysis. Canadian Journal of Microbiology, 60:99–809.
765 doi:10.1139/cjm-2014-0263.
766 Niu, T.H., Zhou, Z., Shen, X.L., Qiao, W.M., Jiang, L.M., Pan, W., Zhou, J.J. 2016.
767 Effects of dissolved oxygen on performance and microbial community structure
768 in a micro-aerobic hydrolysis sludge in situ reduction process. Water Research,
769 90:69-377. doi:10.1016/j.watres.2015.12.050.
770 Pang, H.J., Zhou, Z., Niu, T.H., Jiang, M., Chen, G., Xu, B., Jiang, L.Y., Qiu, Z. 2018.
771 Sludge reduction and microbial structures of aerobic, micro-aerobic and
Page 36 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
37
772 anaerobic side-stream reactor coupled membrane bioreactors. Bioresource
773 Technology, 268:36-44. doi:10.1016/j.biortech.2018.07.097.
774 Saby, S., Djafer, M., Chen, G.H. 2003. Effect of low ORP in anoxic sludge zone on
775 excess sludge production in oxic-settling-anoxic activated sludge process. Water
776 Research, 37(1):11-20. doi:10.1016/S0043-1354(02)00253-1.
777 Semblante, G.U., Hai, F.I., Ngo, H.H., Guo, W.S., You, S.J., Price, W.E., Nghiem,
778 L.D. 2014. Sludge cycling between aerobic, anoxic and anaerobic regimes to
779 reduce sludge production during wastewater treatment: Performance, mechanisms,
780 and implications. Bioresource Technology, 155:395-409.
781 doi:10.1016/j.biortech.2014.01.029.
782 Semblante, G.U., Hai, F.I., Bustamante, H., Price, W.E., Nghiem, L.D. 2016. Effects
783 of sludge retention time on oxic-settling-anoxic process performance: Biosolids
784 reduction and dewatering properties. Bioresource Technology, 218:1187-1194.
785 doi:10.1016/j.biortech.2016.07.061.
786 Semblante, G.U., Phan, H.V., Hai, F.I., Xu, Z.Q., Price, W.E., Nghiem, L.D. 2017.
787 The role of microbial diversity and composition in minimizing sludge production
788 in the oxic-settling-anoxic process. Science of the Total Environment,
789 607:558-567. doi: 10.1016/j.scitotenv.2017.06.253.
790 Stevenson, B.S., Eichorst, A., Wertz, J.T., Schmidt, T.M., Breznak, J.A. 2004. New
791 strategies for cultivation and detection of previously uncultured microbes.
792 Applied and Environmental Microbiology, 70(8):4748-4755.
793 doi:0.1128/AEM.70.8.4748-4755.2004.
Page 37 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
38
794 Wang, Z.W., Yu, H.G., Ma, J.X., Zheng, X., Wu, Z.C. 2013. Recent advances in
795 membrane bio-technologies for sludge reduction and treatment. Biotechnology
796 Advances, 31:1187-1199. doi: 10.1016/j.biotechadv.2013.02.004.
797 Wiseschart, A., Mhuanthong, W., Thongkam, P., Tangphatsornruang, S., Chantasingh,
798 D., Pootanakit, K. 2018. Bacterial diversity and phylogenetic analysis of type ii
799 polyketide synthase gene from manao-pee cave, Thailand. Geomicrobiology
800 Journal, 35(6):518-527. doi:10.1080/01490451.2017.1411993.
801 Xie, Z.F., Wang, Z.W., Wang, Q.Y., Zhu, C.W., Wu, Z.C. 2014. An anaerobic
802 dynamic membrane bioreactor (AnDMBR) for landfill leachate treatment:
803 Performance and microbial community identification. Bioresource Technology,
804 161:29-39. doi:10.1016/j.biortech.2014.03.014.
805 Xing, X.H., Inoue, T., Tang, Ji. Y., Unno, H. 1999. Enhanced microbial adaptation to
806 p-nitrophenol using activated sludge retained in porous carrier particles and
807 simultaneous removal of nitrite released from degradation of p-nitrophenol.
808 Journal of Bioscience and Bioengineering, 87(3):372-377.
809 doi:10.1140/epjd/e2003-00282-6.
810 Ye, F.X., Zhu, R.F., Li, Y. 2008. Effect of sludge retention time in sludge holding
811 tank on excess sludge production in the oxic-settling-anoxic (OSA) activated
812 sludge process. Journal of Chemical Technology and Biotechnology,
813 83(1):109-114. doi:org/10.1002/jctb.1781.
814 Yuan, Y., Wang, S.Y., Liu, Y., Li, B.K., Wang, B., Peng, Y.Z. 2015. Long-term effect
815 of pH on short-chain fatty acids accumulation and microbial community in sludge
Page 38 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
39
816 fermentation systems. Bioresource Technology, 197:56-63.
817 doi:10.1016/j.biortech.2015.08.025.
818 Zhang, X.Y., Li, J., Yu, YB., Xu, R.R., Wu, Z.C. 2016. Biofilm characteristics in
819 natural ventilation trickling filters (NVTFs) for municipal wastewater treatment:
820 Comparison of three kinds of biofilm carriers. Biochemical Engineering Journal,
821 106:87-96. doi:10.1016/j.bej.2015.11.009.
822 Zhao, Y.G., Fang, Y., Jin, Y.L., Huang, J., Ma, X.R., He, K., He, Z.M., Wang, F., et
823 al. 2015. Microbial community and removal of nitrogen via the addition of a
824 carrier in a pilot-scale duckweed-based wastewater treatment system. Bioresource
825 Technology, 179:549-558. doi:10.1016/j.biortech.2014.12.037.
826 Zheng, Y., Cheng, C., Zhou, Z., Pang, H.J., Chen, L.Y., Jiang, L.M. 2019a. Insight
827 into the roles of packing carriers and ultrasonication in anaerobic side-stream
828 reactor coupled membrane bioreactors: Sludge reduction performance and
829 mechanism. Water Research, 155:310-319. doi:10.1016/j.watres.2019.02.039.
830 Zheng, Y., Zhou, Z., Cheng, C., Wang, Z.W., Pang, H.J., Jiang, L.Y., Jiang, L.M.
831 2019b. Effects of packing carriers and ultrasonication on membrane fouling and
832 sludge properties of anaerobic side-stream reactor coupled membrane reactors for
833 sludge reduction. Journal of Membrane Science, 581:312-320.
834 doi:10.1016/j.memsci.2019.03.064.
835 Zhou, Z., Qiao, W.M., Xing, C., Wang, Y.J., Wang, C.Y., Wang, Y.F., Wang, Y.R.,
836 Wang, L.C. 2014. Sludge reduction and performance analysis of a modified
837 sludge reduction process. Water Science and Technology, 69(5):934-940.
Page 39 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
40
838 doi:10.2166/wst.2013.797.
839 Zhou, Z., Qiao, W.M., Xing, C., An, Y., Shen, X.L., Ren, W.C., Jiang, L.M., Wang,
840 L.C. 2015. Microbial community structure of anoxic–oxic-settling-anaerobic
841 sludge reduction process revealed by 454-pyrosequencing. Chemical Engineering
842 Journal, 266:249-257. doi:10.1016/j.cej.2014.12.095.
Page 40 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
41
844 Table 1 Richness and diversity estimators of microbial communities in the three
845 MBRs and the carriers (α=0.03)
Items Shannon Simpson Ace Chao Coverage
C-MBR 3.89 0.0948 721 703 0.9971
A-MBR 4.15 0.0649 913 929 0.9956
FA-MBR 4.50 0.0310 955 944 0.9955
VRPC 5.22 0.0133 1308 1331 0.9961
846
847
848
849
850
851
852
853
854
855
856
857
858
859
860
861
862
863
864
865
866
867
Page 41 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
42
868 Table 2 Relative abundance of microbial bacteria related to sludge reduction in the
869 three MBRs and the carriers
Function Bacteria C-MBR A-MBR FA-MBR VRPCHydrolysis norank__Saccharibacteria 12.24% 15.81% 33.60% 17.66%
norank__Saprospiraceae 8.51% 29.42% 9.23% 11.87%Rhodobacter 2.00% 2.10% 1.32% 0.86%norank__Xanthomonadaceae 1.87% 0.83% 0.43% 1.17%norank__Cytophagaceae 1.78% 0.83% 1.15% 1.45%Terrimonas 0.93% 1.15% 0.82% 1.64%Flavobacterium 0.19% 1.57% 1.08% 2.59%norank__Latescibacteria 0.00% 0.02% 0.04% 0.09%norank__Caldilineaceae 0.13% 0.56% 0.81% 0.73%
Total 27.65% 52.29% 48.48% 38.06%
Fermentation norank__Verrucomicrobiaceae 0.02% 0.19% 0.90% 1.96%Sorangium 0.01% 0.03% 0.01% 0.03%unclassified__Comamonadaceae 1.09% 1.69% 1.49% 2.48%norank__Anaerolineaceae 0.64% 1.03% 2.35% 3.12%norank__Chitinophagaceae 0.06% 0.29% 0.20% 0.22%Ferruginibacter 1.72% 0.53% 0.75% 1.03%
Total 3.54% 3.76% 5.70% 8.84%
Slow grower Dechloromonas 0.29% 3.48% 2.92% 1.49%Azospira 0.21% 1.20% 2.84% 3.59%Thauera 0.05% 0.06% 0.10% 0.16%Sulfuritalea 0.02% 0.09% 0.09% 0.08%Denitratisoma 0.00% 0.02% 0.03% 0.11%Trichococcus 0.74% 1.20% 1.60% 0.97%
Total 1.31% 6.05% 7.58% 6.40
Predation Haliangium 0.58% 0.25% 0.14% 0.15%Bdellovibrio 0.38% 0.98% 0.14% 0.29%Polyangiaceae 0.04% 0.08% 0.05% 0.09%Total 1.00% 1.31% 0.33% 0.53%
870
871872873874875876877878879
Page 42 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
43
880 Figure legends
881 Fig. 1 Schematic of the FA-MBR experimental setup
882 Fig. 2 Variation in (a) COD, (b) NH4+-N (c) TN and (d) TN in the influent and
883 effluent of the three MBRs
884 Fig. 3 Yobs in the three MBRs and their relationship with substrate liberated in MBRs
885 Fig. 4 Venn map of bacterial communities with shared and unique operational taxa
886 (OTU) (3% distance level) among different samples. The number of OTUs in the
887 Venn diagram represents the number of OTUs in the sample.
888 Fig. 5 Classification of microbial communities in the three MBRs and i VRPC at the
889 level of (a) phylum, (b) class and (c) genus. Relative abundance of a given
890 phylogenetic group was set as the number of sequences affiliated to that group divided
891 by the total number of sequences per sample.
892 Fig.6 Variation in nitrogen and phosphorus of the three MBRs.
Page 43 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
44
894 Fig. 1
895
896
Page 44 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
45
898 Fig. 2
899900
901
902
903
904
905
906
907
908
909
910
911
912
913
914
Page 45 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
46
915 Fig. 3
916
917
918
919
920
921
922
923
924
925
926
927
928
929
930
931
932
933
934
Page 46 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
47
935 Fig. 4
936
937
938
939
940
941
942
943
944
945
946
947
948
949
950
951
952
953
954
955 Fig. 5
Page 47 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
48956
Page 48 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
49
957958 Fig.6
959960961
Page 49 of 49
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology