1

DNase I Footprinting

Keith R. Fox

1. Introduction Footprinting provides a simple, quick, and reasonably inexpensive method

for assessing the sequence specific interaction of ligands with DNA. Although the technique was developed in 1978 for studying the interaction of DNA-binding proteins with their target sites (1), it has proved invaluable for deter­mining the sequence specificity of many small ligands

1.1. Footprinting

Footprinting is essentially a protection assay, in which cleavage of DNA is inhibited at discrete locations by the sequence specific binding of a hgand or protein. In this technique, a DNA fragment of known sequence and length (typi­cally a restriction fragment of 100-200 bp), which has been selectively radiola­beled at one end of one strand, is lightly digested by a suitable endonucleolytic probe in the presence and absence of the drug under investigation The cleav­age agent is prevented from cutting around the drug-binding sites so that, when the products of reaction are separated on a denaturing polyacrylamide gel and exposed to autoradiography, the position of the Hgand can be seen as a gap in the otherwise continuous ladder of bands (see Fig. 1). In this figure, cleavage at position "a" will produce, after denaturing the DNA, one long fragment (9 bases) corresponding to the left hand strand, and two short fragments (7 bases and 2 bases) from cleavage of the right hand strand. Since the bands are located by autoradiography, only the shortest of these species bearing the radioactive label will be visualized. The conditions of the cleavage reaction are adjusted so that, on average, each DNA fragment is cut no more than once. As a result, each of the bands on the autoradiograph is produced by a single cleavage event, i.e., single-hit kinetics. If an excessive amount of cleavage agent is used, then

From Methods in Molecular Biology, Vol 90 Drug—DNA Interaction Protocols Edited by K R Fox Humana Press Inc , Totowa, NJ

1

2

3' 5'

DNase I

a denaturing

polyacrylamide gel electrophoresis

DNase I

-*

Fig 1 Schematic representation of the footpnnting experiment The DNA is labeled (*) at the 3' end of the right-hand strand

labeled products can arise from more than one cleavage event, biasing the dis­tribution of fragments toward short products. In general, the extent of cleavage is adjusted so that between 60 and 90% of the radiolabeled DNA remains uncut, though longer fragments require greater amounts of digestion to produce suit­able band intensities.

DNase I footpnnting has been successfully employed for mdentifying or confirming the preferred DNA binding sites for several ligands including acti-nomycin (2—4), mithramycin (5), quinoxaline antibiotics (6,7), daunomycm (8,9), nogalamycin (10), various minor groove binding agents (2,3,11), and triplex binding oligonucleotides (12,13). Various other cleavage agents, both enzymic and chemical, have also been used as footprinting probes for drug— DNA interactions including micrococcal nuclease (14), DNase II (6,15), cop­per phenanthrohne (16,17), methidiumpropyl-EDTA.Fe(II) (MPE) (18-21), uranyl photocleavage (22,23), and hydroxyl radicals (24—26). Each of these has a different cleavage mechanism, revealing different aspects of drug—DNA interactions.

An ideal footpnnting agent should be sequence neutral and generate an even ladder of DNA cleavage products in the absence of the ligand This property is almost achieved by certain chemical probes, such as MPE and hydroxyl radi­cals. However, the most commonly used cleavage agent (because of its cost and ease of use) is the enzyme DNase I, which produces an uneven cleavage pattern that varies according DNA sequence and local structure (see Subhead­ing 1.2.). Cleavage at individual phosphodiester bonds can vary by over an order

DNase I Footprinting 3

of magnitude in a manner determined by both local and global DNA structure (27,28). In addition, drugs that modify DNA structure can induce enhanced DNase I activity in regions surrounding their binding sites if they alter the DNA structure so as to render it more susceptible to cleavage (3,6,15,29,30). This is most frequently seen in regions that are particularly refractory to cleav­age in the drug-free controls.

1.2. DNase I DNase I is a monomenc glycoprotein of mol wt 30,400. It is a double strand-

specific endonuclease, which introduces single strand nicks in the phosphodiester backbone, cleaving the 03'-P bond. Single stranded DNA is degraded at least four orders of magnitude more slowly (31,32). The enzyme requires divalent cations and shows optimal activity in the presence of calcium and magnesium (33). Although it cuts all phosphodiester bonds, and it does not possess any simple sequence dependency, its cleavage pattern is very uneven and is thought to reflect variations in DNA structure (27,34). In particular, An • Tn tracts and GC-nch regions are poor substrates for the enzyme. The most important fac­tors affecting its cleavage are thought to be minor groove width (27,28) and DNA flexibility (35,36).

Several crystal structures have been determined for both the enzyme and its complex with oligonucleotides (37—42). These show that DNase I binds by inserting an exposed loop into the DNA minor groove, interacting with the phosphate backbone, as well as the walls of the groove. This explains why cleavage is poor in regions, such as An • Tn tracts on account of their narrow minor groove, to which the enzyme cannot bind. An additional feature of these crystal structures is that the DNA is always bent by about 21 ° toward the major groove, away from the enzyme. If this bending is a necessary feature of the catalytic reaction, then rigid regions, such as GC-rich sequences, may be refrac­tory to cleavage. However, these factors do not explain the very different cutting rates that are often observed at adjacent dinucleotide steps. It is possible that this is determined by precise orientation of the scissile phosphodiester bond. How­ever, the crystal structures show that there may be other specific interactions between the exposed loop and DNA bases removed from the cutting site. In particular, tyrosme-76 interacts with the base 2 positions to the 5' side of the cutting site and arginme-41 binds to the base at position—3. This latter interac­tion is sterically hindered by a GC base pair in this position. By examining the characteristics of several good DNase I cleavage sites, Herrera and Chaires (43) suggested that the best cleavage site was WYW/WVN (where W = A or T, Y = C or T, and V = any base except T).

The DNA-binding surface of DNase I covers about 10 bp, i.e., one complete turn the DNA helix. This has important consequences for interpreting

4 Fox

Fig 2. Schematic representation of the 3'-staggered cleavage produced by DNase I The DNA helix has been opened out and is viewed along the minor groove The hatched box represents DNase I, the filled box represents a DNA-binding ligand

footprinting results and explains the observation that the enzyme overestimates drug-binding site sizes Although DNA bases he perpendicular to the helical axis, they are inclined relative to the phosphodiester backbone. As a result, clos­est phosphates, positioned across the minor groove, are not attached to a single base pair, but are staggered by about 2-3 bases in the 3' direction. This is illus­trated in Fig. 2A, in which the DNA has been drawn looking along the minor groove, showing the inclination of the DNA base pairs. Since DNase I (hatched box) binds across this groove, its binding site on the top strand is located 2 bases to the 3' side of that on the lower strand. When a DNA-binding ligand is added (filled box in Fig. 2B), it can be seen that the closest approach of the enzyme is not the same on each strand. DNase I can approach closer to the enzyme on the lower strand; the region of the upper strand protected extends by about 2 bases beyond the actual ligand-binding site. As a result, DNase I footprints are stag­gered by about 2-3 bases in the 3' direction across the two strands

2. Materials 2.1. DNase I

For most footprinting experiments the DNase I does not need to be espe­cially pure. There is little advantage in purchasing HPLC-pure, RNase-free enzymes. Currently purchased is the type IV enzyme, from bovine pancreas, from Sigma (St. Louis, MO). This should be dissolved in 0.15 MNaCl contain­ing 1 mMMgCl2 at a concentration of 7200 Kumtz U/mL. This can be stored at -20°C, and is stable to frequent freezing and thawing. The enzyme is diluted to working concentrations immediately before use; the remainder of the diluted enzyme should be discarded

DNase I Footprinting 5

Table 1 Sequence of the tyrJ DNA Fragment

AATTCCGGTTACCTTTAATCCGTTACGGATGAAAATTACGCAACCAGTTCATTTTTCTCAACGTAACAC 0 10 20 30 40 50 60

3'-AAGGCCAATGGAAATTAGGCAATGCCTACTTTTAATGCGTTGGTCAAGTAAAAAGAGTTGCATTGTG

TTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGATAAGGGAGCAGGCCAGTAAAAAGCATT 70 80 90 100 110 120 130

AAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAGGGCTATTCCCTCGTCCGGTCATTTTTCGTAA

ACCCCGTGGTGGGGGTTCCC 140 150

TGGGGCACCACCCCCAAGGGCT-5'

The fragment is obtained by cutting with EcoRl and Aval oc-32P-dATP is used to label the 3' end of the lower strand, whereas a-32P-dCTP is used to label the upper strand

2.2. Choice of DNA Fragment

2.2.1. Natural DNA Fragments

For footprinting experiments, the length of fragment used depends on both convenience (how easily a specific fragment can be generated) and the resolu­tion limit of the polyacrylamide gels. The chosen fragment length is typically between 50 and 200 bp. Although different laboratories have adopted different natural fragments as standard substrates for footprinting experiments, a few have been used more widely Among these are the 160 bp tyrl fragment (sequence shown in Table 1) (4-8), the EcoRl-Pvull fragments from pBS (Stratagene) (44-46), and several fragments from pBR322 (Hindlll-Haelll, Hindlll-Ncil, or EcoRl-Rsal). The plasmids from which these can be prepared are available from commercial sources or from the author's laboratory. In many ways it would be convenient if a few fragments did become recognized standards, since this would facilitate direct comparison of the relative specificities of hgands prepared in different laboratories. Since many sequence selective small mol­ecules have recognition sites of between 2 and 4 bp, there is a reasonable prob­ability that their preferred sites will be present in a 100- to 200-bp restriction fragment. However, it should be noted that there are 2 different bp, 10 different dinucleotides, 32 trinucleotides, 136 tetranucleotides, 512 pentanucleotides, and 2080 hexanucleotides. It can therefore be seen that the chance of finding a particular binding site within a given DNA fragment becomes more remote the greater the selectivity of the ligand. A further complicating factor is that, although many hgands specifically recognize only a dinucleotide step, their binding affinity is often influenced by the nature of the surrounding bases,

6 Fox

which alter the local DNA structure (47-49). It is therefore possible that using a natural fragment may fail to detect the optimum binding sites for the most selective hgands. This becomes especially relevant since many novel synthetic ligands possess enhanced sequence recognition properties, with binding sites of eight or more base pairs.

2.2.2. Synthetic Oligonucleotides

As explained, although footpnnting experiments with natural DNA frag­ments provide a reasonable estimate of a ligand's preferred binding sites, these are complicated by the limited number of sequences studied, together with ambiguities over the exact binding site within a larger footprint. The next step in confirming the sequence preference may be to prepare a synthetic DNA fragment containing the putative binding site and to use this as a substrate for footpnnting experiments (50,51). In addition, for compounds that have been produced as the result of rational design, one may be able to predict their pre­ferred binding site. Synthesis of suitable length oligonucleotides (50 bases or longer) is now routine. However, the results obtained with short oligonucle­otides need to be interpreted with caution and rigorously controlled for several reasons. First, binding sites located close to the ends of short oligonucleotides may not adopt the same configuration as when located within longer sequences because of "end effects." Second, since the synthetic fragments will contain only one or two binding sites, it is necessary to ensure that other sequences with equal or greater affinity have not been excluded. This can be investigated by comparing the interaction with other closely related sequences, in which one or two bases in or around the cognate sequence are altered in turn. Analy­sis is simplified further if the variant sites are contained within the same DNA fragment.

2.2.3. Synthetic Fragments

A frequent variant on the above is to clone the synthetic oligonucleotides into longer DNA fragments. This removes the problems associated with end effects and provides other common flanking sequences to which ligand bind­ing can be compared. An added advantage is that, once it has been cloned, the sequence can be readily isolated from bacteria. The authors usually clone syn­thetic oligonucleotides into the BamWl site of pUC plasmids. They have pre­pared a wide range of such cloned inserts, containing central GC, CG, or (A/T)n

sites (11,15,29,30), which are available from the authors' laboratory on request. DNA fragments containing the synthetic inserts can be prepared and radiola­beled at either end (see Subheading 3.2.) by isolating the modified polyhnker. Once again a proper analysis will require fragments containing both cognate and closely related noncognate sequences.

DNase I Footprinting 7

2.3. Buffers 2.3.1. Solutions for Plasmid Preparation

1 Resuspension solution 50 mMTns-HCl, pH 7 5, containing 10 mMEDTA. 2. Lysis solution. 0.1% SDS, 0.1 MNaOH. 3 Neutralization solution 3 M potassium acetate, 2 M acetic acid

2.3.2. General Buffers

1 10 mMTris-HCl, pH 7 5, containing 0 1 mMEDTA This is used for dissolving DNA. 2. 10 mMTris-HCl, pH 7.5, containing 10 mMNaCl. This is used for preparing

drug solutions 3 DNase I buffer 20 raM NaCl, 2 mM MgCl2, 2 mM MnCl2

2.3.3. Reagents for Electrophoresis

1. TBE electrophoresis buffer This should be made up as a 5X stock solution con­taining 108 g Tns, 55 g Boric acid, and 9.4 g EDTA made up to 2 L with water

2 Acrylamide solutions Polyacrylamide sequencing gels are made from a mixture containing acrylamide'bisacrylamide in the ratio 19.1. Because of the toxic nature of these compounds, acrylamide solution are best purchased from a commercial supplier (National Diagnostics [Atlanta, GA], Anachem [Luton, Beds, UK]) and should be used according to the manufacturers instructions

3 DNase I stop solution. Formamide containing 10 mM EDTA and 0 1% (w/v) bromophenol blue

3. Methods 3.1. Plasmid Preparation

Several methods are available for preparing plasmid DNA, which is suitable for restriction digestion and radiolabeling, including several commercial kits (including Qiagen or Wizard) and caesium chloride density gradient centrifu-gation. It is beyond the scope of this article to review the relative merits of each procedure, except to note that in many instances it is not necessary to generate high purity plasmid preparations. Since the radiolabeled restriction fragments are eventually isolated and purified by gel electrophoresis, prior purification of the plasmids may not be necessary, so long as the preparations do not contain nucleases or any agents that inhibit restriction enzymes or polymerases. As a result, plasmids are usually prepared by standard alkaline lysis procedures, fol­lowed by extraction with phenol/chloroform. A very brief protocol for extract­ing pUC plasmids is described as follows:

1 Grow 50 mL bacteria overnight. 2 Spin culture at 3000g (l e., 5000 rpm in a Beckman JA20 rotor) for 5 min in

Oakridge tube.

8 Fox

3 Resuspend the bacterial pellet in 5 mL cell resuspension solution (50 mM Tns-HCl, pH 7.5, containing 10 mMEDTA)

4. Add 5 mL cell lysis solution (0 1% SDS, 0 1 MNaOH) and mix gently until the solution becomes clear

5 Add 5 mL neutralization solution (3 M potassium acetate, 2 M acetic acid) 6 Spin at 17,000g (12,000 rpm) for 15 mm 7. Remove the supernatant and add 0 6 vol of isopropanol. 8 Spin at 17,000g (12,000 rpm) for 15 mm 9. Remove the supernatant and wash the crude DNA pellet with 5-10 mL 70% etha-

nol Transfer the pellet to an Eppendorf tube and dry 10 Redissolve pellet in 0 5 mL 10 mM Tns-HCl, pH 7 5, containing 0.1 mM EDTA

and 100 ug/mL RNase Leave at 37°C to dissolve for at least 30 mm 11 Extract twice with 0 5 mL phenol/chloroform (phenol forms the bottom layer and

should be discarded) The interface will probably be very messy, leave the junk behind

12. Remove any dissolved phenol by extracting twice with 0 5 mL ether (which forms the top layer and should be discarded) Allow excess ether to evaporate by stand­ing at 37°C for a few minutes

13 Precipitate with ethanol, dry and dissolve in 100-150 uL Tns-HCl, pH 7 5, con­taining 0.1 mMEDTA

3.2. Radiolabeling the DNA

DNA fragments can be efficiently labeled at either the 5' end (using poly­nucleotide kinase) or 3' end using a DNA polymerase. However, the results of DNase I digestion are easiest to interpret for 3'-end-labeled fragments. Since DNase I cuts the 03'-P bond, the products of digestion possess a 3'-hydroxyl and 5'-phosphate group. In contrast, Maxam-Gilbert sequencing reactions, which are used as markers in footprmting gels (see Subheading 3.3.), leave phosphate groups on both sides of the cleavage point (52). As a result, the radiolabeled products of DNase I cleavage and Maxam-Gilbert sequencing reactions will be identical if the DNA is labeled at the 3' end (i.e., both possess a phosphate at the 5' end). However, if the DNA is labeled at the 5' end then the labeled DNase I products will possess an extra phosphate group and so run slightly faster than the corresponding Maxam-Gilbert products. Although this difference is often over­looked in footprmting gels, it becomes significant for short fragments for which the difference in mobility may be as great as 2—3 bands. For enzymes that cut the 0-5' bond, such as DNase II and micrococcal nuclease, 5'-end-labeled fragments comigrate with the Maxam-Gilbert marker lanes.

3.2.1. 3'-End Labeling with Reverse Transcriptase

The production of 3'-end-labeled DNA fragments can be achieved by cut­ting with a restriction enzyme that generates sticky ends with 3'-overhanging

DNase I Footpnnting 9

ends, followed by filling in with a polymerase using a suitable [a-32P]-dNTP. The fragment of interest is then released from the remainder of the plasmid by cleaving with a second enzyme that cuts the other side of the region of interest. The two restriction enzymes usually cut at single locations in the plasmid, though this is not necessary so long as the various radiolabeled fragments can be separated from each other. The most commonly used polymerase is the Klenow fragment. However, it is found that the most efficient labeling is achieved using AMV reverse transcriptase, even though this is actually an RNA-dependent DNA polymerase. However, not all commercially sources of this enzyme are equally reliable; consistent results are obtained with reverse transcriptase from Promega or Pharmacia

3 2 1.1 RESTRICTION DIGESTION AND 3'-END LABELING

Using the aforementioned procedure for DNA isolation, the following is used for generating radiolabeled Hindlll-EcoRl polylinker fragments from pUC plasmids.

1. Mix 30 |aL plasmid (about 50 ug DNA) with 10 pL of 10X restriction enzyme buffer (as supplied by the manufacturer), 45 uL water.

2 Add 3 uL Hindlll (A/AGCTT) and incubate at 37°C for 2 h 3. Add 1 |aL [a-32P]-dATP (3000 Ci/mmol, Amersham) together with 1 uL reverse

transcriptase and incubate for a further 1 h 4 The reverse transcriptase is then inactivated (to prevent further incorporation of

radiolabel at the 3' end of the second restriction site) by heating at 65°C for 5 mm 5 After cooling to 37°C, 3 uL EcoRl (G/AATTC) is added and the mixture incu­

bated for a further 1-2 h In this case, the DNA can be labeled on the opposite strand by reversing the order of addition of EcoRl and Hindlll

If the second enzyme produces blunt ends or sticky ends with 5' overhangs, or if the 3' overhangs sites can not be filled in with dATP, then all the enzymes can be added simultaneously. Examples of such combinations for pUC polylinker fragments are Hindlll-Sacl, and EcoRl-Pstl. The tyrl fragment can be prepared by simultaneous digestion with EcoRl and Aval. In this instance the EcoRl end is labeled with [a-32P]-dATP, whereas the Aval end can be labeled with [a-32P]dCTP. Although various enzymes are supplied with differ­ent reaction buffers, it is found that there is usually no need to change buffers between the first and second enzymes.

6 The mixture of radiolabeled fragments is precipitated by adding 10 uL of 3 M sodium acetate and 300 uL ethanol, followed by centnfugation in a suitable microfuge, at top speed The pellet is washed with 70% ethanol, dried and dis­solved in 15-20 uL Tris-HCl containing 0 1 mMEDTA. Then 4 uL of loading dye (20% Ficoll, 10 mMEDTA, 0 1% [w/v] bromophenol blue) is added before

10 Fox

loading onto a polyacrylamide gel (typically 6-8%). The gel should be run cold, so as not to denature the DNA, it is usually run 0 3-mm-thick, 40-cm-long gels in IX TBE at 800 V Samples are loaded into slots 10 mm wide by 15 mm deep After the bromophenol blue has reached the bottom of the gel (about 2 h), the plates are separated and the gel covered with Saran wrap Scanning the gel with a hand-held Geiger counter should give a reading off scale (l e , at least 3000 cps) over the radiolabeled bands The precise location of the radiolabeled bands is determined by short (2-10 min) autoradiography This autoradiograph is placed under the glass plates and used to locate the band of interest, which is cut out using a sharp razor blade

3.2.1.2 EXTRACTION OF RADIOLABELED DNA FRAGMENTS

The simplest, cheapest, and most efficient method for extracting radio­labeled DNA fragments from polyacrylamide gel slices is by diffusion Place a small glass wool plug in the bottom of a 1 mL (PI000) pipet tip and seal the bottom end with parafilm. Add the gel slice containing the radiolabeled DNA and cover this with 10 mMTns-HCl, pH 7 5, containing 10 mMEDTA (about 300 uL is sufficient). Cover the top of the pipet tip with parafilm and incubate at 37°C with gentle agitation. This is usually incubated overnight, though most of the DNA elutes after 2 h. Remove the parafilm from the top and bottom of the tip and expel the buffer into an Eppendorf tube using a pipet and/or low-speed centnfugation (1500g in an Eppendorf centrifuge). The gel slice should be retained in the pipet tip by the plug of glass wool, though a small amount of polyacrylamide does occasionally come through This can be removed by cen­tnfugation. For fragments shorter than 200 bp, this procedure recovers about 95% of the radiolabel in the gel slice, though the efficiency decreases for longer fragments. The DNA should then be precipitated with ethanol and redissolved in Tns-HCl containing 0.1 mMEDTA so as to generate at least 10 cps per uL on a hand-held counter. For most footprinting experiments it is not necessary to know the absolute DNA concentration, since this is vamshingly small. The important factor is concentration of the radiolabel, which should be sufficient to produce an autoradiograph within 1—2 d exposure.

3.3. Maxam-Gilbert Marker Lanes

Bands in the DNase I digestion patterns are identified by comparison with suitable marker lanes. Since each DNA fragment produces a characteristic sequence dependent digestion pattern, it is sometimes possible to identify the bonds by comparison with a previous (published) pattern.

3.3.1. G-Tracks

The simplest and most commonly used marker lane is the dimethylsulfate-pipendine marker specific for guanine (52). Since the procedure is more time-

DNase I Footprintmg 11

consuming than DNase I digestion itself, it is usual to prepare sufficient quantity of "G-track" for several footpnnting experiments with the batch of radiolabeled DNA.

Add 10 uL radiolabeled DNA to 200 u.L of 10 mM Tris-HCl, pH 7.5, con-taming 10 mA/NaCl. To this add 1 y,L dimethylsulfate and incubate at room temperature for 1 min before stopping the reaction by adding 50 uL of a solution containing 1.5 Msodium acetate and 1 Mmercaptoethanol followed by 750 u.L ethanol. Some laboratories include tRNA in this G-stop, as a coprecipitant, but it is found that this is not generally necessary. Leave the mixture on dry ice for 10 min, then spin at full speed in an Eppendorf centrifuge (12,000g) for 10 min. Remove the supernatant and wash the pellet twice with 70% ethanol. After drying the pellet, add 50-100 uX of 10% (v/v) piperidine and heat at 100°C for between 20 and 30 min. Remove the piperidine by either lyophilization or in a speed-vac. Redissolve the sample in loading dye (formamide containing 10 mM EDTA and 0.1% [w/v] bromophenol blue) so that each electrophoresis sample contains about 10 cps.

3.3.2. G+A Tracks

Although the preparation of a G-track is reliable, it is time-consuming and involves some highly toxic compounds (dimethylsulfate). G+A marker lanes are also widely used and are usually prepared by limited acid depunnation using formic acid-piperidine reactions. During the DNase I footprintmg work it was noted that occasional careless handling of the samples resulted in purine tracks appearing in the DNase I cleavage lanes. This observation has been used to establish an empirical method for rapidly preparing G+A marker lanes

To 2 uL of radiolabeled DNA, add 15-20 pX of Tris-HCl, pH 7.5, contain­ing 10 mMNaCl and 5 uX of loading dye (formamide containing 10 mMEDTA and 0.1% [w/v] bromophenol blue). Heat at 100°C for about 20 mm in an Ep­pendorf tube, with the cap open This reduces the volume to about 5-6 uL, sufficient for loading onto the gel and generates a clean G+A track. Since this method is rapid, each marker lane can be freshly prepared while performing the DNase I digestions.

3.4. DNase I Footprinting 3.4.1. Basic Footprinting Protocol

The basic procedure for DNase I footprinting is quick and simple (hence its popu­larity as a footpnnting agent) and can readily be adapted to suit a range of conditions.

1. Mix 2 uL radiolabeled DNA (dissolved in 10 mMTns-HCl, pH 8.0, containing 0.1 mM EDTA) with 2 uL ligand (dissolved in a suitable buffer, such as 10 mM Tris-HCl, pH 7.5, containing 10 mM NaCl). See Note 5 for suitable ligand concentrations.

12 Fox

2 Leave this to equilibrate for an appropriate length of time. For most small hgands, such as minor groove binding ligands or simple intercalators, the interaction with DNA is very fast, though some ligands require in excess of 30 min for equilib­rium distribution.

3. Start the digestion by adding 2 uL DNase I (dissolved in 2 mM MgCl2, 2 mM MnCl2,20mMNaCl)

4 After 1 minute stop the reaction by adding 3 uL of formamide containing 10 mM EDTA and 0 1% (w/v) bromophenol blue

The concentration of DNase I required will depend on the reaction conditions, i.e , temperature, pH, DNA concentration, ionic strength This should be adjusted empirically so as to give suitable extent of digestion (see Notes 1—4). It is typically found that, at 20°C with 10 mMNaCl, a suitable enzyme concentra­tion is about 0.03 Kunitz U/mL (i.e., dilute 2 p.L of stock DNase I [7200 U/mL] in 1 mL DNase I buffer, followed by adding 2 uL of this dilution to a further 1 mL buffer Each of these dilutions should be mixed gently, avoiding vigorous agi­tation) The enzyme should be freshly diluted immediately before use.

3.5. Electrophoresis and Autoradiography 1 After DNase I digestion the samples should be denatured by boiling for about

3 min, before loading onto a denaturing polyacrylamide gel Samples can be loaded directly from the boiling conditions, though excessive heating can pro­duce some depunnation. However, it is probably best rapidly to cool the samples on ice before loading For most footpnntmg reactions there is no need to use sharks teeth combs, and simple slots are sufficient

Denaturing polyacrylamide gels (6-12% depending on fragment length) should contain 8 M urea and are run in IX TBE buffer. For some GC-rich DNAs these denaturing conditions are not harsh enough and some bands are compressed. This can be alleviated by including formamide (up to 30%) in the gel mixture and can be further improved by prerunning the gel for 30 min before use. Formamide containing gels run slightly slower than conventional gels and should be of a slightly higher percentage. For footpnntmg experi­ments 0.3-mm-thick gels are normally used that are 40 cm long; these are run at 1500 V until the bromophenol blue reaches the bottom (about 2 h). The gels should be run hot, maintaining the DNA in a denatured form. Although many modern electrophoresis tanks are thermostatically controlled, "smiling" of the lanes can also be avoided by clamping a metal plate over the glass surface, ensuring an even distribution of heat.

2. After electrophoresis the plates are separated and the gel is soaked in 10% (v/v) acetic acid. This serves to fix the DNA and remove much of the urea, prior to drying Each 2 L of 10% acetic acid can be used to fix up to three gels.

DNase I Footprmting 13

3 After fixing, the gels are transferred to Whatman 3MM paper, covered with Saran wrap and dried at 80°C in a commercial gel drier

4. The dried gels are exposed to autoradiography If the DNA is suitably "hot," then 1-2 d exposure at-70°C with an intensifying screen should be sufficient.

3.6. Analysis Although rigorous quantitative analysis is required for assessing the relative

binding affinity at different sites, and for measuring binding constants, the location of drug-induced footprints can usually be directly assessed by visual inspection. Quantitative analysis requires additional equipment (densitometer or phosphorimager) and is beyond the scope of this chapter (see Chapter 2). However, since DNase I footprints are necessarily larger than the actual hgand binding site, on account of the size of the enzyme, both visual and quantitative analyses leave some uncertainties. The footprint will be larger than the binding site, and this too may be larger than the recognition site. For example, although actinomycin D specifically recognizes the dmucleotide GpC, it covers about 4 bp and protects about 6 bases from DNase I cleavage. For small ligands that rec­ognize only 2 or 3 bp, and which may generate several discrete footprints on any given DNA fragment, the ambiguity concerning the exact binding can often be resolved by determining the sequences that are common to each of the foot­prints. Additional information is gleaned by comparing the location of the foot­prints on each of the DNA strands, visualized by performing separate experiments with DNA labeled on each strand. Since DNase I footprints are staggered in the 3' direction by 2—3 bases, the exact binding site will be located toward the 5' end of each footprint and will be contained in the region of over­lap protected on both strands. If there are still uncertainties about the sequence recognition properties, then it may be necessary to synthesize (a series of) syn­thetic fragments that contain putative binding sites based on the preliminary footprinting data. An example of this is the AT-selective bifunctional intercalator TANDEM Footprinting experiments with natural DNA fragments confirmed the AT-selectivity, but could not determine whether the recognition site was ApT or TpA (7). This was resolved by producing fragments contain­ing a series of different AT-rich binding sites, i.e., AT AT, TATA, TTAA, and AATT (53). These demonstrated that the recognition site is TpA not ApT. An alternative strategy is to use another footprinting agent such as MPE, hydroxyl radicals, micrococcal nuclease, DNase II, or uranyl radicals, though these suf­fer to different degrees from the same problems of locating the exact ligand binding site.

3.7. A Worked Example Figure 3 shows DNase I digestion of the tyrT DNA fragment m the pres­

ence of varying concentrations of the AT-selective antibiotic distamycin. The

14 Fox

con 0.2 1 5 25 100

100-

9 0 -

8 0 -

70-

1 §• • • • *

J lilfi.

5 0 -m rf?ff*=|

3 0 - .

Fig. 3. DNase I footprinting of distamycin on the 160 bp tyrl DNA fragment, whose sequence is presented in Table 2. The EcoR\-Ava\ fragment is labeled at the 3' end of the EcoRl site. The distamycin concentration (uA/) is shown at the top of the lanes. Each pair of lanes corresponds to cleavage by the enzyme for 1 and 5 min.

sequence of this DNA fragment is presented in Table 1. The DNA fragment in Fig. 3 has been obtained by digesting with EcoRl and Aval and has been labeled at the 3' end of the EcoRl site with a-32P dATP, using reverse transcriptase, revealing the bottom strand in Table 1. Since this fragment has been widely used as a footprinting substrate, the bands have been assigned by comparison with other published data. Samples have been removed from the digestion mix­ture at times of 1 and 5 min. This figure will be used to illustrate several aspects of DNase 1 footprinting.

It can be seen that DNase I cleavage in the drug-free control is not even (see Note 6). Some regions are cut poorly, particularly between 26—32 and 42—50. These are staggered to the 3' side of the An • Tn blocks at 27—33 and 46—52.

DNase I Footpnnting 15

Cleavage is also poor around position 100, in a GC-nch block. In addition some positions are cut much better than the surrounding bonds (e.g., 41, 69, and 81), whereas others are cut less well (e.g., 39, 58, 83). The poor cutting in the AT-rich regions of the control presents an obvious problem for this ligand that is AT-selective since the binding sites correspond to regions where there is little or no cleavage in the control.

Visual inspection reveals that distamycin has altered the DNase I cleavage pattern. Clear protections from DNase I cleavage are evident at the lowest ligand concentration (0.2 \iM) at positions 26-32 and 43—50. These sites corre­spond to regions that are poor sites of DNase I cleavage in the control. Other regions of protection can be seen at 1 and 5 \iM at 56-68, 78-89, and around 110. Each of these positions corresponds to an AT-nch sequence. The first contains two distamycin binding sites (TTA and TAAA) that produce a single overlapping footprint, as does the second (AAT and ATAT), whereas the third contains a single site TTAT. At concentrations of 25 and 100 uMmost of the cleavage in the lower portion of the fragment is protected. It can be seen that each of these protections is staggered by 2—3 bases in the 3' (lower) direction relative to the actual binding site For example, the protection around posi­tion 60 extends down at least as far as position 56, whereas the AT-binding site ends at position 59 In contrast, the 5' (upper) end of the footprint is coincident with the edge of the binding sites (position 69) As a result of the overlapping footprints, and the poor cleavage of the enzyme around some binding sites, it is not possible to determine the ligand binding site size from these footprints.

The intensity of certain bands is increased at distamycin concentrations of 5 [iM and above, especially at positions 72/73,94/95, and 99/100, each of which is located in a GC-nch region. Indeed at the highest ligand concentration the bands at 72/73 and 94/95 are the only cleavage products remaining. These regions of enhanced cleavage have previously been interpreted as arising from ligand induced changes in DNA structure (4). However, in view of small amount of free DNA available for enzyme cleavage these enhancements could simply reflect changes in the ratio of free DNA to enzyme (54,55). Since most of the enzyme binding sites are occupied by the ligand, the relative concentration of enzyme at these sites will be much greater, hence the greater cleavage effi­ciency (see Note 8).

It should be noted that, in this example, the 5-min lanes are overdigested; only a small proportion of the DNA is uncut. As a result, bands toward the top of the gel are much lighter, whereas those toward the bottom are overrepre-sented, since they arise from multiple cleavage events. Although it is still pos­sible to discern the footpnnting sites in the lower portion, this is less clear m the upper part, and could certainly not be used in any quantitative analysis.

16 Fox

Table 2 The Effect of Various Conditions on the Relative Concentration of DNase I Required in Footprinting Experiments

Relative Relative Relative enzyme Ionic enzyme enzyme

Temperature concentration strength concentration pH concentration

4°C 6 0 01 1 50 5 20°C 1 0.1 5 6.0 3 37°C 0 5 10 10 7 0 1 50°C 1 80 1 65°C 2

4. Notes 1 The activity of DNase I will, of course, vary according to the different reaction

conditions, affecting the extent of digestion, and suitable adjustments should be made to ensure sufficient cleavage, yet maintaining "single-hit" kinetics This can be achieved either by altering the digestion time or varying the concentration of the enzyme The latter is generally varied A rough guide for the effect of various conditions on the relative concentration of DNase I required is presented in Table 2 For initial experiments it is often worth performing a time course for the enzyme digestion, increasing the volume of the reactants and removing ah-quots e g., say, 1, 5, and 30 min

2. DNase I requires the presence of divalent metal ions, particularly magnesium, and so its action can be stopped by adding EDTA The enzyme has more than one binding site for divalent cations, though only one of these is at the catalytic site The literature on the preferred metal ions is confusing with various claims for different sites for calcium and/or magnesium suggesting that both ions are required However, good cleavage is observed with either calcium or magnesium, although slightly higher enzyme concentrations are required when using calcium alone Since manganese has been shown to increase the rate of digestion, equimolar concentrations of manganese and magnesium are generally used It is found that the cleavage pattern is largely unaffected by the nature of the divalent metal ion, even though crystallographic data has suggested an alternative binding site for manganese that might produce a different cleavage pattern In contrast, milhmo-lar concentrations of ions such as Co2+ and Zn2+ inhibit the activity of DNase I

3 DNase I is reasonably tolerant to a variety of organic solvents including metha­nol, ethanol, and dimethylsulfoxide (DMSO) This is useful since many DNA-bindmg ligands are only sparingly soluble ra water and must be prepared as stock solutions in various other solvents. DMSO concentrations as high as 40% require a threefold higher enzyme concentration, though this does modify the cleavage pattern, increasing the cutting in regions that are poor substrates for DNase I, such as polydA tracts

DNase I Footprinting 17

4. A glance at the literature reveals that many laboratories include known concen­tration of unlabeled carrier DNA in the footprinting reaction. This is only neces­sary for experiments in which the absolute DNA concentration is needed (1 e , some forms of quantitative footprinting analysis) and can be omitted for most experiments However, one advantage of including a fixed concentration of car­rier DNA is that the concentration of DNase I required to produce a given level of cleavage does not vary between experiments in which the absolute amount of radiolabeled DNA may not be constant

5 In most footprinting reactions the concentration of the target DNA is vanishingly small (nanomolar) whereas the DNA binding ligand is present in micromolar amounts The extent of binding is, therefore, not determined by the stoichiometric ratio of drug to DNA, but by the equilibrium binding constant In this regard footprinting reactions resemble typical pharmacological experiments, in which the concentration of the target site is small and unknown and in which the prob­ability of each site being occupied is 50% at a ligand concentration equivalent to the equilibrium dissociation constant Since many hgands bind to DNA with affini­ties of between 1 and 100 \x.M~\ drug concentrations between 1 and 100 uMare usually examined. For drugs that bind more tightly, lower ligand concentrations should be explored. It is generally best to test a range of ligand concentrations, extending down to a concentration at which the digestion is not noticeably affected High ligand concentrations (100 \xM) often inhibit DNase I digestion throughout the DNA fragment, this could be the result of nonspecific interaction with DNA or direct inhibition of the enzyme itself

6 A major problem with using DNase I as a footprinting tool is that the enzyme cuts different sequences with efficiencies that can vary over two orders of magni­tude. These variations can be both local, in which isolated bonds are cut better or worse than average, or global, where long DNA regions are cut poorly In gen­eral, polydA polydT tracts are poor substrates for DNase I, on account of their narrow minor grooves GC-rich regions are also cut poorly, probably because they are more rigid and resist the bending that may be an important part of the DNase I catalytic reaction. In addition, RpY steps are generally cut better than YpR. Ligands that bind to those regions that are cut poorly by DNase I, produce footprints that are difficult to detect. The only way round this problem is to use a different footprinting probe

7 A similar problem is encountered when assessing the exact size of a footprint if bands at the edges of the footprint are cut poorly in the control Although this may be clarified by examining the cleavage of the other strand, the ambiguity often remains so that the footprinting site size can usually only be quoted to within an accuracy of ±1 base.

8 As well as producing footprints, many ligands also generate enhanced DNase I cleavage in regions surrounding their binding sites. These have been explained in two different ways, each of which is correct in different circumstances First, these may arise from drug-induced changes in DNA structure, which are propa­gated into neighboring regions, and which render the DNA more susceptible to

18 Fox

DNase I cleavage. Second, they may simply reflect a change in the ratio of free DNA to enzyme in the presence of the ligand (54,55) These two possibilities can only be properly distinguished by quantitative footpnnting experiments How­ever, a few other factors may indicate which is occurring. Enhancements arising from changes in the ratio of free DNA to enzyme should be constant at all points to which the ligand is not bound, whereas those that are directly attributable to ligand binding will be located closest to the ligand binding sites A further possi­bility, which is rarely considered, is that of ligand-induced protections from enzyme cleavage, in surrounding regions

9 An apparently minor detail, which is rarely addressed, concerns the ligand con­centration Does this refer to the actual concentration before or after adding the DNase P For a ligand in fast exchange with the DNA, a new equilibrium will rapidly be established after the small dilution because of the addition of the enzyme In contrast, if the dissociation is slow compared with the time course of the diges­tion, then the distribution of the ligand will resemble the starting conditions throughout the reaction In the former case the ligand concentration should be that after adding the DNase I, whereas in the latter case this should refer to the concentration before In theory, the answer to the question requires some prior knowledge of the kinetics of ligand binding, though in practice one or other is consistently adopted

10 Unwanted bands sometimes appear in the lanes, which clearly do not arise from enzyme digestion These may be contaminants in the DNA preparation and can be checked by running a sample of DNA that has not been digested with the enzyme Artifactual bands, particularly depunnation products, can be produced by the boiling procedure. These can be obviated by including a small amount of sodium hydroxide (1-2 mM) in the stop solution

11. Since DNase I cuts from the minor groove, protections are easiest to interpret for ligands that also bind m this groove, stencally inhibiting enzyme activity How­ever, major groove binding agents, such as triplex-forming oligonucleotides, also generate clear DNase I footprints (12,13) In this case cleavage inhibition cannot result from steric hinderance, but must arise from changes in the DNA structure and/or rigidity and are, therefore, less easily interpreted It should be noted that the footpnnting pattern should still be staggered across the two strands by about 2—3 bases in the 3' direction since this is a function of the cleavage agent, rather than the ligand under investigation Agents that cut from the major groove would be expected to generate a 5' stagger

12 Another ambiguity in DNase I footprinting gels, which is rarely addressed, con­cerns the numbering/assignment of the cleavage products. Although this would seem to be a trivial problem the uncertainty arises because, whereas most DNA sequences number the bases, DNase I cleavage products correspond to the phosphodiester bonds When Maxam-Gilbert markers are used alongside DNase I cleavage of 3'-end-labeled fragments, each band in the marker lane (X) comigrates with the band corresponding to cleavage of the phosphodiester bond on the 3' side, 1 e , the XpY step

DNase I Footprintmg 19

13 By adapting the simple footprintmg protocol it can also be used for measuring slow kinetic parameters, by removing samples from a reaction mixture and sub­jecting to short DNase I footprinting (48,49).

14. It is possible that some sequence selective compounds will not produce DNase I footprints if they are in rapid exchange with the DNA. In such cases footprints can be induced by lowering the temperature, thereby increasing their persistence time on the preferred binding sites (56).

Acknowledgments Work in the author's laboratory is supported by grants from the Medical

Research Council and the Cancer Research Campaign.

References 1 Galas, D J. and Schmitz, A (1978) DNAase footprinting—simple method for

detection of protein-DNA binding specificity Nucleic Acids Res 5, 3157—3170 2 Lane, M. J , Dabrowiak, J C , and Vournakis, J N. (1983) Sequence specificity of

actinomycin D and netropsin binding to pBR322 analysed by protection from DNAase I. Proc Natl Acad Sci USA 80, 3260-3264

3 Scamrov, A V. and Beabealashvilh, R Sh. (1983) Binding of actinomycin D to DNA revealed by DNAase I footprinting. FEBS Lett 164, 97-101.

4 Fox, K R and Waring, M J (1984) DNA structural variations produced by acti­nomycin and distamycin as revealed by DNAase I footprinting Nucleic Acids Res 12,9271-9285

5 Fox, K R. and Howarth, N R (1985) Investigations into the sequence-selective bind­ing of mithramycin and related ligands to DNA Nucleic Acids Res 13, 8695—8714

6. Low, C M L , Drew, H R , and Waring, M J (1984) Sequence-specific binding of echinomycin to DNA. evidence for conformational changes affecting flanking sequences. Nucleic Acids Res 12, 4865-4879

7. Low, C. M L , Olsen, R K., and Waring, M. J. (1984) Sequence preferences in the binding to DNA of tnostin A and TANDEM as reported by DNase I footprintmg. FEBS Lett 176,414-419.

8 Chaires, J. B., Fox, K. R, Herrera, J E., Britt, M, and Waring, M J (1987) Site and sequence specificity of the daunomycin-DNA interaction Biochemistry 26,8227—8236

9 Chaires, J B , Herrera, J E , and Waring, M J (1990) Preferential binding of daunomycin to 5'(A/T)CG and 5'(A/T)GC sequences revealed by footprinting titration experiments Biochemistry 29, 6145-6153

10 Fox, K. R. and Waring, M J. (1986) Nucleotide sequence binding preferences of nogalamycin investigated by DNase I footprinting. Biochemistry 25,4349-4356

11 Abu-Daya, A , Brown, P M., and Fox, K. R. (1995) DNA sequence preferences of several AT-selective minor groove binding ligands Nucleic Acids Res 23, 3385-3392

12 Cooney, M., Czernuszewicz, G., Postel, E. H , Flint, S. J., and Hogan, M E (1988) Site-specific oligonucleotide binding represses transcription of the human c-myc gene in vitro Science 241, 456-459

20 Fox

13 Cheng, A-J and van Dyke, M W (1994) Ohgodeoxyribonucleotide length and sequence effects on lntermolecular purine-punne-pyrimidine triple-helix forma­tion Nucleic Acids Res 22,4742-4747

14 Fox, K. R and Waring, M. J (1987) The use of micrococcal nuclease as a probe for drug-binding sites on DNA Biochim Biophys Acta 909, 145—155

15 Cons, B M G and Fox, K R (1990) The GC-selective ligand mithramycin alters the structure of (AT)n sequences flanking its binding sites FEBS Lett 264, 100-104

16. Sigman, D. S. (1990) Chemical nucleases. Biochemistry 29, 9097-9105 17 Spassky, A and Sigamn, D S (1985) Nuclease activity of 1,10 phenanthrohne-

copper ion. conformational analysis and footpnnting of the lac operon Biochem­istry 24, 8050-8056.

18 Van Dyke, M W , Hertzberg, R P , and Dervan, P B (1982) Map of distamycin, netropsin and actinomycm binding sites on heterogeneous DNA DNA cleavage inhibition patterns with methidiumpropyl-EDTA-Fe(II). Proc Natl Acad Sci USA 79,5470-5474

19. Van Dyke, M W and Dervan, P. B (1983) Chromomycin, mithramycin and olivomycin binding sites on heterogeneous deoxyribonucleic acid Footprinting with (methidiumpropyl-EDTA)Iron(II) Biochemistry 22, 2373-2377

20 Hertzberg, J P and Dervan, P B. (1984) Cleavage of DNA with methidiumpropyl-EDTA-Iron(II) reaction conditions and product analyses Biochemistry 23, 3934-3945

21. Van Dyke, M. W. and Dervan, P B. (1983) Methidiumpropyl-EDTA.Fe(II) and DNase I footprinting report different small molecule binding site sizes on DNA Nucleic Acids Res 10, 5555-5567

22. Nielsen, P E., Jeppesen, C, and Buchardt, O. (1988) Uranyl salts as photochemi­cal agents for cleavage of DNA and probing of protein DNA contacts FEBS Lett 235, 122-124.

23. Nielsen, P E., Hiort, C , Sonnichsen, S H., Buchardt, O., Dahl, 0„ and Norden, B. (1993) DNA binding and photocleavage by uranyl(VI)(U02

2+) salts J Am Chem Soc 114,4967-4975

24. Cons, B. M. G. and Fox, K R. (1989) High Resolution hydroxyl radical footprinting of the binding of mithramycin and related antibiotics to DNA Nucleic Acids Res 17,5447-5459

25. Churchill, M. E. A , Hayes, J J, and Tulhus, T D. (1990) Detection of drug binding to DNA by hydroxyl radical footprinting Relationship of distamycin binding sites to DNA structure and positioned nucleosomes on 5S RNA genes of Xenopus Biochemistry 29, 6043-6050.

26 Portugal, J and Waring, M J. (1987) Hydroxyl radical footprinting of the sequence-selective binding of netropsin and distamycin to DNA. FEBS Lett 225,195-200

27 Drew, H. R and Travers, A A. (1984) DNA structural variations in the E coh tyrT promoter. Cell 37, 491-502

28. Drew, H. R. (1984) Structural specificities of five commonly used DNA nucleases J Mol Biol 176, 535-557

DNase I Footprinting 21

29. Waterloh, K. and Fox, K R. (1991) The effects of actinomycin on the structure of dAn • dTn and (dA-dT)n regions surrounding its GC binding site: a footprinting study J Biol Chem. 266,6381-6388.

30. Waterloh, K. and Fox, K R. (1991) Interaction of echinomycin with An Tn and (AT)n regions flanking its CG binding site Nucleic Acids Res 19,6719-6724

31. Laskowski, M (1971)DeoxynbonucleaseI, in The Enzymes, vol. 4(Boyer, P D, ed ), Academice, London, pp 289—311.

32. Kunitz, M. (1950) Crystalline deoxynbonuclease I isolation and general proper­ties spectrophotometric method for the measurement of deoxynbonuclease activ­ity. J Gen Physiol 33, 349-369

33. Price, P. A (1975) The essential role of Ca2+ in the activity of bovine pancreatic deoxynbonuclease J Biol Chem 250, 1981-1986

34 Lomonossoff, G. P , Butler, P. J. G , and Klug, A. (1981) Sequence-dependent variation in the conformation of DNA. J Mol Biol 149, 745-760.

35 Hogan, M. E., Roberson, M W., and Austin, R. H. (1989) DNA flexibility varia­tion may dominate DNase I cleavage Proc Natl Acad Sci USA 86, 9273-9277

36 Brukner, I., Jurukovski, V , and Savic, A. (1990) Sequence-dependent structural variations of DNA revealed by DNase I. Nucleic Acids Res 18, 891-894

37. Suck, D., Oefner, C , and Kabasch, W. (1984) Three-dimensional structure of bovine pancreatic DNAase I at 2.5A resolution. EMBOJ 3, 2423-2430.

38 Suck, D. and Oefner, C (1986) Structure of DNasel at 2A resolution suggests a mechanism for binding to and cutting DNA Nature 321, 620-625.

39 Oefner, C and Suck, D (1986) Crystallographic refinement and structure of DNAase I at 2A resolution. J Mol Biol. 192, 605-632.

40 Suck, D , Lahm, A , and Oefner, C (1988) Structure refined to 2A of anicked octanulceotide complex with DNAase I Nature 332, 464-468

41 Weston, S A , Lahm, A , and Suck, D. (1992) X-ray structure of the DNase I-d(GGTATACC)2 complex at 2 3A resolution. J Mol Biol 226, 1237-1256

42 Lahm, A. and Suck, D (1991) DNase I-induced DNA conformation. 2A structure of a DNase I-octamer complex J Mol Biol 221, 645—667

43. Herrera, J. E. and Chaires, J B (1994) Characterization of preferred Deoxynbo­nuclease I cleavage sites J Mol Biol 236,405-411

44. Bailly, C, Donker, I. O., Gentle, D., Thornalley, M., and Waring, M. J (1994) Sequence selective binding to DNA of cis- and trans- butamidine analogues of the anti-Pneumocystis carinn pneumonia drug pentamidine. Mol Pharm 46, 313-322

45 Bailly, C , Gentle, D , Hamy, F , Purcell, M., and Waring, M J. (1994) Localized chemical reactivity in DNA associated with the sequence specific bisintercalation of echinomycin Bwchem J 300, 165—173

46 Ridge, G. S , Bailly, C , Graves, D. E„ and Waring, M J (1994) Daunomycin modifies the sequence-selective recognition of DNA by actinomycin. Nucleic Acids Res. 22,5241-5246.

47. Waterloh, K. and Fox, K. R. (1992) Secondary (non-GpC) binding sites for acti­nomycin on DNA. Biochim Biophys Acta 1131, 300-306

22 Fox

48 Fletcher, M C and Fox, K R. (1993) Visualising the kinetics of dissociation ofactinomycin from individual binding sites in mixed sequence DNA by DNase I footpnnting Nucleic Acids Res 21, 1339—1344

49 Fletcher, M C and Fox, K R (1996) Dissociation kinetics of echinomycin from CpG sites in different sequence environment Biochemistry 35, 1064-1075

50 Huang, Y -Q , Rehfuss, R. P , LaPlante, S. R„ Boudreau, E Borer, P N , and Lane, M J (1988) Actinomycin D induced DNAase I cleavage enhancement caused by sequence specific propagation of an altered DNA structure Nucleic Acids Res 16,11,125-11,139

51 Bishop, K D , Borer, P N , Huang, Y -Q., and Lane, M J (1991) Actinomycin D induced DNase I hypersensitivity and asymmetric structure transmission in a DNA hexadecamer Nucleic Acids Res 19,871—875

52 Maxam, A M and Gilbert, W (1980) Sequencing end labelled DNA with base-specific chemical cleavages Methods Enzymol 65, 499—560

53 Lavesa, ML, Olsen, R K , and Fox, K. R (1993) Sequence specific binding of [N-MeCys3,jV-MleCys7] TANDEM to TpA. Bwchem J 289, 605-607.

54 Ward, B. Rehfuss, R , Goodisman, J , and Dabrowiak, J C (1988) Rate enhance­ments in the DNase I footpnnting experiment Nucleic Acids Res 16, 1359-1369

55 Ward, B. Rehfuss, R Goodisman, J., and Dabrowiak, J D. (1988) Determination of netropsin-DNA binding constants from footpnnting data Biochemistry 27, 1198-1205

56 Fox, K R and Waring, Ml J (1987) Footpnnting at low temperatures-evidence that ethidium and other simple mtercalators can discriminate between different nucleotide sequences Nucleic Acids Res 15,491-507