Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Effect of Gossypol on Bovine Ovarian Physiology
ウシ卵巣生理におよぼすゴシポールの影響
THET SU MYAT
テッスミャッ
2016
DOCTOR OF PHILOSOPHY PROGRAM BIOPRODUCTION SCIENCE
THE UNITED GRADUATE SCHOOL OF AGRICULTURAL SCIENCES
IWATE UNIVERSITY JAPAN
i
LIST OF CONTENTS
Page
TITLE PAGE
LIST OF CONTENTS
i
CHAPTER 1
GENERAL INTRODUCTION
1
CHAPTER 2
MATERIALS AND METHODS
13
CHAPTER 3
GOSSYPOL INHIBITS LH-INDUCED STEROIDOGENESIS IN BOVINE
THECA CELLS
Introduction
18
Materials and methods
20
Results
23
Discussion
25
Tables and Figures
30
ii
CHAPTER 4
GOSSYPOL INHIBITS BOVINE THECA CELLS STEROIDEGENESIS VIA
cAMP DEPENDENT PATHWAY
Introduction
37
Materials and methods
39
Results
42 Discussion
44
Tables and Figures
47
CHAPTER 5
EFFECT OF GOSSYPOL ON BOVINE THECA CELLS CARBODYDRATE
METABOLSIM
Introduction
50
Materials and methods
52 Results
55
Discussion
56
Tables and Figures
61
iii
CHAPTER 6
GENERAL DISCUSSION
66
ACKNOWLEDGEMENTS
71
REFERENCES
73
1
CHAPTER 1 1
GENERAL INTRODUCTION 2
What is gossypol? 3
Gossypol is a yellowish polyphenolic compound found in the seeds, stems and roots 4
of the cotton plant genus Gossypium. Gossypol was first isolated in 1899. The name is 5
derived from the plant genus scientific name (Gossypium) combined with the ending “ol” 6
from phenol. Gossypol has a 518.55 Dalton molecular weight, has a yellow pigment, is 7
crystalline, insoluble in water and hexane, soluble in acetone, chloroform, ether, and methyl 8
ethyl ketone (butanone), and is partly soluble in crude vegetable oils. Gossypol is 9
composed of three tautomeric forms that account for the numerous chemical and 10
physiological reactions often associated with this compound (Berardi & Goldblatt 1969; 11
Randel et al. 1992). Gossypol has an ultraviolet (UV) absorption maximum at about 385 12
nm (ε 18,000) (solvent dependent). It melts at temperatures around 200°C depending on its 13
polymorphic form. Many polymorphic forms and crystalline solvates of gossypol exist 14
depending on the solvent of crystallization. 15
Gossypol in cottonseed 16
There are some 20 species of the genus Gossypium, but only four are cultivated for 17
fiber production worldwide: Gossypium hirsutum L., Gossypium barbadense L., Gossypium 18
arboreum L., and Gossypium herbaceum L. (Stephens 1958; Berardi & Goldblatt 1969). 19
The two most economically important cotton species are G. hirsutum (Upland cotton, white 20
2
or fuzzy cottonseed with attached short fibers), which is grown to produce 90% of the 21
world’s cotton and Gossypium barbadense (Pima cotton, bare, black seed without attached 22
short fibers). Gossypol is found in all Gossypium species. Gossypol pigment is located 23
almost exclusively in pigment gland structures appearing as dark dots in the plant tissue. In 24
the plant, gossypol serves as a natural insecticide making the plant less palatable to animals. 25
Non-processed whole cottonseeds, as well as processed cottonseed meal may therefore 26
contain large amounts of free gossypol, which may cause adverse and toxic effects if used 27
as a feeding stuff. The high levels of gossypol in cottonseed and cottonseed products have 28
restricted their use as feed for ruminants and have prevented the use of cottonseed products 29
for feeding non-ruminants (Randel et al. 1992). Cottonseed may contain concentrations 30
greater than 14,000 mg/kg of total gossypol and 7,000 mg/kg of free gossypol. Cottonseed 31
(kernels) can contain several percent (up to 10 %, 0.1-100 g/kg) of gossypol (Alexdaner et 32
al. 2008). Total gossypol production is influenced by several factors, including weather 33
conditions and cotton species; gossypol production is positively correlated with the rainfall 34
rate and negatively correlated with temperature (Pons et al. 1953). Pima cottonseed 35
contains higher amount of gossypol and that is why Pima is more toxic than upland 36
cottonseed (Wang et al. 1987b). Storage, steam and heat, and extrusion of oil, reduce free 37
gossypol concentrations in cottonseed and its products. 38
Toxicokinetics of gossypol 39
In cottonseed, gossypol exists as a mixture of two stereoisomers, (+) and (-), with 40
the negative isomer appearing to have the greatest biological activity, slowly eliminated 41
3
and is the isomer responsible for negative effects. Two gossypol forms have been observed; 42
free and bound. The free form is toxic whereas the bound form is non-toxic because it is 43
bound to proteins. When gossypol is bound to proteins in the stomach it becomes 44
chemically inactive. Therefore, when fed in low levels that the body can detoxify gossypol 45
in this way it is not harmful to animals and people as a feed source (Randel et al. 1992). It 46
is the level of free gossypol in the body after consumption that determines how toxic the 47
product will be. The gossypol absorption rate is inversely proportional to the amount of 48
iron in the diet (Barraza et al. 1991), and dietary supplementation with ferrous sulfate 49
inactivates free gossypol (Schneider et al. 2002). The absorbed gossypol accumulates in the 50
liver and kidneys. The primary gossypol excretion route is through bile; it is then 51
eliminated through feces after conjugation with glucuronides and sulfates. Small amounts 52
of gossypol are also excreted in urine, and in expired air. Little to no gossypol is excreted in 53
the milk. The half-lives of total (+) and (−) gossypol in rats following a single intravenous 54
dose were estimated as 25.26 hours and 10.53 hours, respectively (Chen et al. 1987). 55
Usage of cottonseed as an animal feedstuff 56
Cottonseed and cottonseed meal is known as an excellent and economically 57
available source of feed for ruminant animals. Cottonseed meal is a prominent additive in 58
cattle diets and is the large source of supplemental protein for cattle (Risco et al. 1993). 59
Cottonseed meal contains 44.9 % of crude protein (NRC 2001) whereas upland and Pima 60
cottonseeds contain 23.0 and 24.6% crude protein respectively (Calhoun et al. 1995; 61
Robinson et al. 2001). Coppock et al. (1985) stated that cottonseed has an unusual feature 62
4
of having both high energy and high fiber. This makes cottonseed a very attractive source 63
of supplementation to the cattle industry. It has been reported that adding the desired level 64
of cottonseed in the dairy ration can increase lactation performance (Santos et al. 2003). 65
However its unlimited usage as animal feed in both ruminants and non-ruminants is 66
restricted because of high levels of gossypol in cottonseed and cottonseed products. 67
Recommended feeding rates for ruminants (in USA) suggested a maximum of 20 % of the 68
concentrate mix for growing beef cattle, with lower inclusion rates for younger or milk-69
producing livestock or not more than 0.5 % of body weight per day for mature cows and 70
0.33 % of body weight for weaned calves (Lonsdale 1989; Ewing 1997). 71
Gossypol toxicity in animals 72
There are two types of gossypol poisoning; acute and chronic or cumulative 73
poisoning. Acute gossypol intoxication of non-ruminant animals causes circulatory failure. 74
Acute toxicity has been shown in the heart, lung, liver, and blood cells, resulting in 75
increased erythrocyte fragility. Sub-acute toxicity causes pulmonary edema and symptoms 76
of malnutrition (Alexander et al. 2008). 77
General signs of acute toxicity are similar among animal species and include 78
respiratory distress, impaired body weight gain, anorexia, anemia, weakness, pneumonia, 79
apathy, gastro-enteritis, listlessness, hypoprothrombinemia, depressed hemoglobin levels, 80
lowered hematocrit and death after several days. Heart failure was reported in calves, lambs, 81
and dogs. Feeding of male calves with a diet containing 400 mg free gossypol/kg can cause 82
lethal effects (Velasquez-Pereira et al. 1999). 83
5
Post mortem findings include generalized edema with fluid-filled thoracic and 84
peritoneal cavities, congestion of lungs and liver, myocardial degeneration, centrilobular 85
liver necrosis, and hypertrophic cardiac fiber degeneration. In calves, the major pathologic 86
findings are ascites, visceral edema, acute centrilobular hepatocyte necrosis, kidney damage, 87
and cardiovascular lesions (Alexander et al. 2008). 88
Different species react differently to being fed gossypol in cottonseed and 89
cottonseed products. Gossypol is particularly toxic to swine, while poultry and horses seem 90
to be relatively unaffected (Berardi & Goldblatt 1969). It is however, even less toxic to 91
adult ruminant animals because their fully functional rumens have the ability to bind large 92
amount of free gossypol with soluble proteins (Haschek et al. 1989). However, young 93
calves are highly susceptible to gossypol toxicity before the rumen is fully functional 94
(Berardi & Goldblatt 1969). In comparison with (+)-gossypol, the (–)-enantiomer generally 95
exhibits more pronounced effects. 96
Effect of gossypol on reproductive physiology 97
Male reproduction 98
First interest in gossypol was taken in 1960s in Chinese men. In 1957, Liu reported 99
that a village in the Jiangsu province in China did not have any childbirth between the 100
1930s and 1940s. Later it was realized that this infertility incident was due to a large-scale 101
contamination of cotton oil for human consumption with gossypol. More than 8000 102
Chinese males on the use of gossypol pill as an anti-contraceptive have been carried out 103
using 20 mg (±)-gossypol/day and the study revealed that the drug was efficient and well 104
6
tolerated, and did not cause changes in blood pressure or biochemical parameters. However, 105
the study was discontinued because hypokalemia affected around 10 % of gossypol-taken 106
males (Liu 1985; Coutinho 2002). 107
The main target organ of gossypol toxicity following repeated exposure is the testis. 108
Gossypol inhibits spermatogenesis, which decreases the sperm count and spermatozoid 109
motility and viability (Randel et al. 1992). The lowest oral doses inhibiting 110
spermatogenesis in humans and monkeys were 0.1 and 0.35 mg/kg body weight, 111
respectively. The effects are dose and time dependent. Suppressed spermatogenesis in 112
human is irreversible, particularly in males with varicocele (Alexander et al. 2008). 113
Chronic administration of gossypol leads to mitochondrial and flagella damage in testicular 114
and epididymal spermatozoa (Hoffer 1982; Oko & Hrudka 1982) and to decrease of sperm 115
ATP content with a concomitant loss of motility (Ke & Tso 1982). 116
The gossypol-mediated spermatozoid disturbance mechanism includes the 117
inhibition of release and utilization of ATP by the sperm cells (Ueno et al. 1988). Another 118
effect of gossypol is the reduction of cellular and microtubular-tubular content in 119
spermatocytes and spermatids (Teng et al. 1997). Furthermore, gossypol inhibits calcium 120
influx (Breitbart et al. 1984, 1989) and Mg-ATPase and Ca-Mg-ATPase activity in 121
spermatozoid plasmatic membranes (Breitbart et al. 1984). Abnormal spermatozoids are 122
produced because gossypol produces ultrastructural alterations in the nuclear membrane, 123
endoplasmic reticulum, and mitochondria (Chenoweth et al. 2000; Hoffer 1982; Arshami 124
1988). In cultured sertoli cells from piglets, gossypol also decreases cellular oxidase 125
7
activity and damages the DNA (Zhang et al. 2011). Reduced nuclear expression of 126
androgen receptors was observed in leydig cells, sertoli cells, and myoid cells from rats fed 127
gossypol-rich cottonseed flour (Timurkaan et al. 2011). 128
Although ruminants with a well-developed rumen are able to detoxify gossypol by 129
converting free to bound gossypol within rumen, rumen protein-binding detoxifying 130
mechanism can be overwhelmed if the total gossypol content is excessive, or when protein 131
content is low in the rumen (Adams et al. 1998). In bulls, feeding cottonseed high in 132
gossypol content has been associated with reduced sperm production, increased sperm 133
abnormalities, decreased sperm motility, and decreased thickness of the germinal 134
epithelium of the testis, showing similar effects as in human (Brocas et al. 1997). 135
Female reproduction 136
In China, women ingesting cottonseed oil suffered from burning fever, developed 137
amenorrhoea and uterus atrophy (Wu 1989). Human trials have been performed using doses 138
of 20 mg/day of racemic gossypol for 2-3 months followed by a maintenance dose of 40 139
mg/week for 4-5 months. Endometriosis, uterine myoma and functional uterine bleeding 140
were occurred in the women and these resulted in amenomania and atrophy of the 141
endometrium. Examination of uterine biopsies showed a local cytotoxic effect on the uterus 142
together with a systemic effect on the ovarian function (Wu 1989; Randel et al. 1992). 143
Gossypol has been shown to exert antifertile effects in female animals, such as 144
disturbing estrous cycle, decreasing conception rate and increasing incidence of abortion 145
(Lagerlöf & Tone 1985; Santos et al. 2003). These irregular cycles appear to be caused by 146
8
gossypol’s ability to suppress ovary secretion of progesterone (P4) and estradiol-17β (Lin 147
et al. 1985). Gossypol also seems to disrupt pregnancy and early embryo development, 148
particularly in the monogastric species (Abou-Donia 1976; Berardi & Goldblatt 1969; 149
Randel et al. 1992; Dodou 2005). The early pregnancy loss promoted by gossypol is not 150
due exclusively to direct damage to embryos but also to interference with implantation of 151
the embryo (Lin et al. 1991). Gossypol also affects bovine oocyte cumulus expansion and 152
nuclear maturation (Lin et al. 1994). Gossypol-mediated embryotoxic effect has also been 153
observed in vitro (Brocas et al. 1997; Zirkle et al. 1988, Hernández et al. 2005; Villaseñor 154
et al. 2008; Lin et al. 1994) and in vivo (Lagerlöf & Tone 1985; Lin et al. 1991; Li et al. 155
1989) studies. Villaseñor et al (2008) stated that gossypol may reach the uterine fluids 156
through the maternal circulation. 157
The ruminant female appears to have relatively resistance to antifertility effects of 158
gossypol. However, many in vitro studies indicated gossypol inhibited embryonic 159
development and ovarian steroidogenesis. 160
Effects of gossypol on steroidogenesis 161
The ovary possesses two primary steroidogenic cell types, theca cells and granulosa 162
cells. Both theca cells and granulosa cells are required for ovarian follicles for the 163
regulation of the estrus cycle and follicular development for producing estrogen and 164
progesterone. The steroidogenic activity of theca cells is regulated by luteinizing hormone 165
(LH) and local factors. The key enzymes required for thecal androgen biosynthesis are 166
steroidogenic acute regulatory protein (StAR), cytochrome P450 cholesterol side-chain 167
9
cleavage enzyme (P450scc, CYP11A1), 17β-hydroxylase/17,20-lyase (CYP17A1) and 3β-168
hydroxysteroid dehydrogenase (HSD3B). Cholesterol is a major substrate for progesterone 169
synthesis. StAR transports cholesterol into mitochondria. It is then first converted to 170
pregnenolone by CYP11A1. Pregnenolone is later converted to dehydroepiandrosterone 171
(DHEA) by CYP17A1. DHEA is finally converted to androstenedione (A4) by HSD3B. 172
HSD3B also converts pregnenolone to progesterone (P4). P4 is also able to be converted to 173
A4 by HSD3B. Androgens synthesized in the theca cells are transported to the granulosa 174
cells where P450 aromatase converts them to estrone and 17β-estradiol. Although the 175
mechanisms behind the gossypol actions have not been fully clarified, it is likely that it 176
exerts the antifertility effects through inhibiting ovarian steroidogenesis. Gossypol has been 177
shown to affect production of estrogen (E2) and P4 in granulosa and luteal cells in rats, pigs 178
and cattle (Gu et al. 1990a, b, 1991; Akira et al. 1994; Lin et al. 1994; Ohmura 1996; 179
Vranová et al. 1999; Basini et al. 2009). Gossypol inhibits the activities of some enzymes 180
involved in steroidogenesis such as side-chain cleavage enzyme complex (cytochrome 181
P450scc/CYP11A1) (Gu et al. 1991) and 3βhydroxysteroid dehydrogenase-isomerase 182
complex (3βHSD/HSD3B) (Gu et al. 1990a).The antisteroidogenic effect of gossypol is 183
also reported due to inhibiting adenylate cyclase or cAMP production in in cultured 184
granulosa (Lin et al. 1994) and luteal cells in cattle (Gu et al. 1990a), luteal cells in rats 185
(Wang et al. 1987), in bovine luteal cells (Gu et al. 1990a) and mouse leydig cells (Pearce 186
et al. 1986a, b). As gossypol inhibits cAMP production, it is highly likely that gossypol 187
inhibition of steroidogenesis is related to cAMP dependent enzymes (protein kinase A or 188
PKA). Other possible pathway of gossypol inhibition is PKC (protein kinase C) pathway. 189
10
However, the effect of gossypol on these mechanisms has never studied yet. In male, 190
gossypol has been shown to inhibit leydig cell androgen production (Lin et al. 1981; 191
Donaldson et al. 1985; Sufi et al. 1985; Pearce et al. 1986a). Since gossypol has been 192
shown to inhibit androgen production in leydig cells (Lin et al. 1981; Donaldson et al. 193
1985; Sufi et al. 1985; Pearce et al. 1986a), the male equivalent of theca cells, it is possible 194
that gossypol also inhibits androgen synthesis in theca cells. However, little is known about 195
the effect of gossypol on androgen production in theca cells. 196
Effects of gossypol on energy metabolism 197
Glucose is the principal substrate for the production of energy and the synthesis of 198
key biological materials. The glycolysis, a metabolic pathway that converts glucose to 199
pyruvate, is the central metabolic pathway necessary to produce (adenosine triphosphate) 200
ATP and cofactor reduced nicotinamide adenine dinucleotide (NADP). In the bovine ovary 201
the predominant energy substrate appears to be glucose (Rabiee et al. 1997). Glucose is 202
transported into cell by glucose transporters such as GLUT across the cell membrane. The 203
rate of glucose utilization is regulated by GLUT, which limits cellular glucose uptake, and 204
glycolytic enzymes that set the rate of glucose metabolism. There are 10 steps of glycolysis 205
and 10 enzymes involved in glycolysis, namely hexokinase (HK), glucose phosphate 206
isomerase (GPI), phosphofructokinase (PFK), aldolase (Aldo), triphosphate isomerase 207
(TPI), glyceraldehyde phosphate dehydrogenase (GAPDH), phosphoglycerate kinase 208
(PGK), phosphoglycerate mutase (PGM), enolase (ENO) and pyruvate kinase (PK) or 209
lactate dehydrogenase (LDH) in case of anaerobic glycolysis. Of these 10 enzymes, HK, 210
11
PFK, PK and LDH are considered as rate limiting enzymes of the glycolysis. At the final 211
stage of anaerobic glycolysis, lactate dehydrogenase enzyme (LDH) catalyzes the 212
conversion of pyruvate to lactate and back, as it converts NADH to NAD+ and back (Li 213
1990). 214
Inhibition of LDH activity by gossypol was reported in mouse kidney, liver and 215
testis (Lee et al. 1981), in rat testis (Giridharan et al. 1982) and in bull spermatozoa (Rovan 216
et al. 1984). Disturbances of sperm energy metabolism in spermatozoa by inhibiting 217
glucose and fructose utilization in the presence of gossypol is also reported by Wichmann 218
et al. (1983). However, little is known about the effect of gossypol on carbohydrate 219
metabolism in theca cells. 220
Effects of gossypol on incidence of apoptosis 221
Gossypol has been known to have apoptotic property. In recent years, gossypol has 222
been used as an anticancer drug in clinical researches. Previously, gossypol’s proapoptotic 223
activity has been demonstrated on various cell types including human breast cancer cells 224
(Gilbert et al. 1995), human prostate cancer cells (Jiang et al. 2004) and human colon 225
carcinoma cells (Zhang et al. 2003). Several investigators demonstrated various kinds of 226
molecular mechanisms including death receptor pathways, mitochondrial pathways and 227
DNA breaks or DNA fragmentation for gossypol-induced antiproliferative activity in 228
various cancer cells (Chang et al. 2004; Hu et al. 1993; Jarvis et al. 1994; Shelley et al. 229
2000; Zhang et al. 2003). 230
12
Mitochondrial involvement is also implicated by studies suggesting that gossypol 231
may act as an uncoupler of mitochondrial oxidative phosphorylation (Abou-Donia & 232
Dieckert 1974) and inhibit LDH as it participates in a shuttle system transferring H+ from 233
cystol to mitochondria (Burgos et al. 1978). 234
Objectives of the present study 235
Taken the above studies together, it should be concluded that gossypol act through 236
several different pathways to inhibit cell functions. Although many investigators have 237
reported several pathways of gossypol induced-apoptotic mechanism in various cell types, 238
no study on the molecular mechanisms of gossypol on LH-induced theca cell viability, 239
steroidogenesis and carbohydrate metabolism has yet come into our knowledge. Therefore, 240
the present study was undertaken to investigate 1) the effect of gossypol on the production 241
of steroids and the expression of genes encoding steroidogenic enzymes (Chapter 3), 2) 242
mechanism of gossypol action in intracellular signaling pathways (Chapter 4), and 3) the 243
effect of gossypol on anaerobic glycolysis (Chapter 5) in cultured bovine theca cells. 244
245
246
247
248
249
250
251
13
252
253
254
CHAPTER 2 255
MATERIALS AND METHODS 256
This study was conducted entirely in vitro using abattoir-derived materials. All 257
chemicals and reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA), unless 258
indicated otherwise. 259
Isolation and culture of theca cells 260
Bovine ovaries were obtained from the local abattoir and were kept in Dulbecco’s 261
phosphate buffered saline (DPBS) supplemented with 17.5 mM glucose and 15mM 262
MgCl2.6H2O at 20℃ overnight. The ovaries were transported to the laboratory in the next 263
morning. Ovaries were washed for several times with 70% ethanol and sterilized saline. 264
Large follicles, 10-15 mm in diameter were used in this study. Healthy follicles were 265
selected and follicular fluid was aspirated using 22 gauge needle. Follicles were then cut 266
open and granulosa cells were scraped gently by using a small spatula. Follicular walls 267
were peeled off and washed in DPBS for several times to remove as much remaining 268
granulosa cells as possible. Only follicular walls from apparently healthy developing 269
follicles with vascularized theca layers and transparent follicular fluid were used in the 270
study. The follicular walls were dissected into small pieces and digested in 5ml DPBS in 271
15mL conical tubes (for approximately 5 follicles) containing 1 mg/mL collagenase, 1 272
14
mg/mL hyaluronidase, 1 mg/mL protease and 0.4% BSA for 1h at 37℃ in a water bath 273
with rocking platform shaker. After the digestion, 10 mL of serum free culture medium 274
(DMEM:F/12) supplemented with 0.1% BSA, 100 IU/mL penicillin, 100 µg/mL 275
streptomycin, 2.5 g/mL amphotericin, L-glutamine 3 mM, 10 ng/mL insulin, 2.5 µg/mL 276
transferrin, 4 ng/mL sodium selenite was added to the cell preparation. Dispersed cells were 277
pelleted by centrifugation at 800g for 10 min. Cells were resuspended and washed in DPBS 278
and washed twice with serum free medium. Contaminated red blood cells were removed by 279
incubating cells in tris-HCL buffer (pH 8.0) at 37℃ for 1min. The cell pellet was then 280
resuspended in serum free culture medium. The number and viability of the theca cells 281
were counted using trypan blue exclusion method. Cell viability was more than 90%. 282
Approximately 7x104 viable cells were seeded in 96 well culture plates (Nunclon Delta 283
surface; Thermo Fisher Scientific, Rochester, NY, USA) in 200 µL culture medium and 284
cultured at 37℃ and 5% CO₂ in air. 285
Steroid assays 286
Concentration of A4 and P4 in the culture medium was determined by using 287
commercial kits (Androstenedione Human ELISA kit; Immunospec Corporation, Canoga 288
Park, CA, USA and Progesterone EIA kit; Cayman Chemical Co., Ann Arbor, MI, USA) 289
following the procedures provided by the manufacturers. Range of the standard curve for 290
A4 was 0-10 ng/mL. Range of the standard curve for P4 was 0-1000 pg/mL. Intra- and 291
inter-assay coefficients of variation were less than 10% for all assays. 292
Glucose and lactate assays 293
15
Glucose concentration in the spent medium and follicular fluid was measured using 294
a commercial glucose assay kit (Wako Pure Chemical Industries, Osaka, Japan) following 295
the procedures provided by the supplier. Lactate production in the medium was measured 296
by using a commercial assay kit (Determiner LA, Kyowa Medex Co., Tokyo). Ranges of 297
the standard curves were 0-200 mg/dL for glucose and 0-10 mg/dL for lactate. The intra- 298
and inter assay coefficient of variations for both assays were less than 10%. 299
cAMP assay 300
cAMP concentration in the spent media was measured by cAMP complete elisa kit 301
(Enzo Life Sciences, Farmingdale, New York, USA) following the procedures provided by 302
the supplier. The range of standard curve was 0.078-20 pmol/mL (acetylated format). The 303
intra- and inter assay coefficient of variations were less than 10%. 304
RNA extraction, reverse transcription (RT), quantitative polymerase chain reaction 305
(qPCR) 306
RNA extraction 307
Total RNA was extracted from theca cells by using TRIzol Reagent (Life 308
technologies, Carlsbad, CA, USA) and reverse-transcribed using Ominiscript Reverse 309
Transcription kit (QIAGEN, GmbH, Hilden, Germany) following the procedures provided 310
by the manufacturers. 311
RT-PCR 312
16
The abundance of mRNAs encoding target genes were quantified by a real-time 313
quantitative PCR using LightCycler Nano (Roche, Basel, Swizerland) using FastStart 314
Essential DNA Green Master (Roche). Specific primers for target genes were designed by 315
using National Centre for Bilotechnoligical Information (NCBI) primer designing tool 316
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on reported bovine sequences 317
(Table. 3.1). The amplification program consisted of an initial activation at 95℃ for 10 min 318
followed by 45cycles of the PCR steps (denaturation at 94℃ for 10sec, annealing at 60℃ 319
for 10sec and extension at 72℃ for 15sec). All cDNA samples were amplified in 320
duplication and each transcript level was normalized to the geometric mean of 3 reference 321
genes selected by geNorm as mentioned in the following section. The intra- and inter-assay 322
coefficient of variations was less than 10% for all measurements. 323
Selection of stable internal control genes by geNorm analysis 324
The three most stable reference genes were selected from 8 candidate genes 325
(glyceraldehyde-3-phosphate dehydrogenase; GAPDH, β-actin; ACTB, 18S ribosomal 326
RNA; 18S rRNA, β2-microglobulin; B2M, large ribosomal protein P0; RPLP0, ribosomal 327
protein L4; RPL4, TATA box binding protein; TBP and heat shock protein 90-kDα, class B 328
member 1; HSPCB) by using the geNorm Visual Basic application for Microsoft Excel 329
(Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of 330
multiple internal control genes (Vandesompele et al. 2002). Accordingly TBP, RPL4 and 331
HSPCB were selected as the reference genes. 332
Statistical analysis 333
17
All data were presented as mean ± SEM. Data were subjected to either one-way or 334
two-way analysis of variance (ANOVA) with Tukey multiple comparison test. Levels of 335
gene expression were analyzed using one-way repeated measures ANOVA. P < 0.05 was 336
considered to be statistically significant. 337
338
339
340
341
342
343
344
345
346
347
348
349
350
351
352
353
354
355
356
18
357
358
CHAPTER 3 359
GOSSYPOL INHIBITS LH-INDUCED BOVINE THECA CELL 360
STEROIDOGENESIS 361
Introduction 362
Cottonseed and cottonseed meal are popular protein sources for livestock especially 363
in cotton growing developing countries. High content of gossypol, a polyphenolic aldehyde 364
found in the pigment glands of the seed, however, has restricted the usage of it as a 365
valuable feedstuff. Gossypol is known to inhibit spermatogenesis and testicular 366
steroidogenesis in many species (Lin et al. 1981; Donaldson et al. 1985; Pearce et al. 367
1986a) and has been used as a contraceptive agent in humans (Coutinho et al. 2000; 368
Coutinho 2002). Although less appreciated, gossypol has been shown to exert antifertility 369
effects in female animals, such as disturbing estrous cycle, decreasing conception rate and 370
increasing incidence of abortion (Lagerlöf & Tone 1985; Santos et al. 2003). 371
Although the mechanisms behind the gossypol actions have not been fully clarified, 372
it is likely that it exerts the antifertility effects through inhibiting ovarian steroidogenesis. 373
Gossypol has been shown to affect production of estrogen (E2) and progesterone (P4) in 374
granulosa and luteal cells in rats, pigs and cattle (Gu et al. 1990a, b, 1991; Akira et al. 375
1994; Lin et al. 1994; Ohmura 1996; Vranová et al. 1999; Basini et al. 2009). However, 376
little is known about the effect of gossypol on androgen production in theca cells. 377
19
It is well known that theca cells play a crucial role in follicular development by 378
supplying androgen for estradiol synthesis in the adjacent granulosa cells. Since gossypol 379
has been shown to inhibit androgen production in leydig cells (Lin et al. 1981; Donaldson 380
et al. 1985; Sufi et al. 1985; Pearce et al. 1986a), the male equivalent of theca cells, it is 381
likely that gossypol also inhibits androgen synthesis in theca cells. 382
Therefore, the present study was undertaken to investigate the effect of gossypol on 383
the production of androstenedione (A4), the major androgen produced in the ovarian 384
follicle, as well as P4 and expression of genes responsible for androgen production in 385
cultured bovine theca cells. 386
387
20
Materials and methods 388
Isolation and culture of theca cells 389
Bovine ovaries were obtained from the local abattoir. Theca cells were prepared as 390
mentioned in Chapter 2. Approximately 7x104 viable cells were seeded in 96 well culture 391
plates in 200 µL culture medium and cultured at 37ºC in 5% CO₂ in air. 392
Experimental design 393
Two cell models were set up to examine the effect of gossypol on theca cell 394
functions during the preovulatory period (non-luteinized theca cell: Fig. 3.1, NL) and the 395
luteal phase (luteinized theca cell: Fig. 3.1, L). For the non-luteinized cell model, theca 396
cells were cultured in 200 µL medium supplemented with 5% fetal calf serum (FCS: Fetal 397
clone III, Hyclone laboratories, Logan, Utah, USA), 1 ng/mL LH (bovine LH, AFP-398
11118B, National Institute of Diabetes and Digestive and Kidney Disease, Baltimore, MD, 399
USA) and various concentration of gossypol (0, 0.2, 1, 5 and 25 µg/mL) for 24h (Fig. 3.1, 400
NL). During this period theca cells produce twice as much A4 as P4 (Fig. 3.1, NL). For the 401
luteinized cell model, theca cells were initially cultured as for the non-luteinized cells but 402
without gossypol for 24h. At day 2, theca cells were treated with a high dose of LH (100 403
ng/mL) for 24 h to induce luteinization. After the treatment, theca cells were further 404
cultured for 4 days with 1% FCS and 1 ng/mL LH with medium being changed every 24 h. 405
During this period, P4 production in theca cells steadily increased whereas A4 production 406
became minimal (Fig. 3.1). At day 7, theca cells were treated with gossypol (0, 0.2, 1, 5 and 407
21
25 µg/mL) for 24 h as for the non-luteinized cell model (Fig. 3.1, L). At the end of the 408
experimental periods, the spent medium was collected and stored at -20ºC for steroid assays. 409
Theca cells were collected and live and dead theca cells were counted using trypan blue 410
exclusion method. 411
Steroid assay 412
Concentration of A4 in the culture medium was measured by using a commercial kit 413
(Androstenedione Human ELISA kit; Immunospec Corporation, Canoga Park, CA, USA). 414
Concentration of P4 was measured by using a commercial kit (Progesterone EIA kit; 415
Cayman Chemical Co., Ann Arbor, MI, USA). Intra- and inter-assay coefficients of 416
variation were less than 10% for all assays. 417
RNA extraction, reverse transcription (RT) and quantitative polymerase chain 418
reaction (qPCR) 419
Total RNA was extracted from theca cells by using phenol-chloroform method and 420
reverse-transcribed using a commercial kit (Ominiscript Reverse Transcription kit; 421
QIAGEN, GmbH, Hilden, Germany) following the procedures provided by the 422
manufacturers. The abundance of mRNAs encoding LH receptor (LHR), steroidogenic 423
acute regulatory protein (StAR), cholesterol side-chain cleavage enzyme (CYP11A1), 3-β-424
hydroxysteroid dehydrogenase/Δ-5-4 isomerase (HSD3B), and 17α-hydroxylase/17,20 425
lyase (CYP17A1) were quantified by a real-time quantitative PCR (LightCycler Nano; 426
Roche, Basel, Swizerland) using a commercial real-time PCR kit (FastStart Essential DNA 427
Green Master; Roche). Specific primers for target genes were designed by using National 428
22
Center for Biotechnological Information (NCBI) primer designing tool 429
(http://www.ncbi.nlm.nih.gov/tools/primer-blast/) based on reported bovine sequences 430
(Table. 3.1). All cDNA samples were amplified in duplication and the resultant data were 431
normalized to the geometric means of 3 stably expressed reference genes, TATA box 432
binding protein (TBP), ribosomal protein L4 (RPL4) and heat shock protein 90-kDα, class 433
B member 1 (HSPCB), following the procedures reported by Vandesompele et al. (2002). 434
The intra- and inter-assay coefficient of variations was less than 10% for all measurements. 435
Statistical analysis 436
Number of cells, cell viability and levels of steroids were compared by one-way 437
analysis of variance (ANOVA) with Tukey multiple comparison test. Two sets of data were 438
compared with t-test. Levels of gene expression were analyzed using one-way repeated 439
measures ANOVA. P < 0.05 was considered to be statistically significant. All data were 440
presented as mean ± SEM. 441
442
443
444
445
446
447
23
448
Results 449
Effect of gossypol on viability of non-luteinized and luteinized bovine theca cells 450
After the 24-h experimental periods, cultured theca cells were collected and number 451
of live and dead cells was counted. The treatment with LH (1 ng/mL) increased cellular 452
viability both in non-luteinized (P<0.01) and luteinized cells (P<0.1) whereas the treatment 453
with gossypol did not affect cellular viability of LH-treated theca cells regardless of the 454
doses used in both cell types (Fig. 3.2A, B). 455
Effect of gossypol on production of androstenedione and progesterone in non-456
luteinized and luteinized bovine theca cells 457
Treatment with LH (1 ng/mL) significantly increased A4 and P4 production both in 458
non-luteinized (P<0.05; Figs. 3.3A, B) and luteinized theca cells (P<0.05; Figs. 3.4A, B). 459
Production of A4 was more than four fold higher than that of P4 in non-luteinized theca 460
cells not treated with gossypol (Fig. 3.3C). In luteinized theca cells, production of P4 far 461
exceeded that of A4 (Fig. 3.4C). Treatment with gossypol dose-dependently decreased LH-462
induced theca cell androgen production both in non-luteinized and luteinized cells (P<0.05; 463
Figs. 3.3A, 3.4A). LH-induced P4 production was not affected or even increased by 464
gossypol at doses 5 µg/mL and less but decreased at 25 µg/mL (Figs. 3.3B, 3.4B). 465
Consequently the ratio of A4 to P4 decreased dose-dependently in both cell types (Figs. 466
3.3C, 3.4C). 467
24
468
Effect of gossypol on gene expression of LHR, StAR, CYP11A1, HSD3B and 469
CYP17A1 in non-luteinized and luteinized bovine theca cells 470
Treatment with LH tended to increase the gene expression of StAR, CYP11A1, 471
HSD3B and CYP17A1 in non-luteinized theca cells. Treatment with gossypol blocked the 472
LH effect and further down-regulated gene expression of CYP11A1, CYP17A1 and StAR 473
below control level at concentrations of 0.2-5 µg/mL (P<0.05; Fig. 3.5B, C, E). The 474
expression of LHR was not affected by gossypol at any doses tested (Fig. 3.5A). In 475
luteinized theca cells, the effect of LH was largely lost except for the expression of 476
CYP11A1 (Fig. 3.6C). Treatment with gossypol did not affect the expression of these genes 477
except HSD3B where the expression was significantly increased by gossypol at 25 µg/mL 478
(P<0.05; Fig. 3.6D). 479
480
481
482
25
Discussion 483
This study demonstrated that the treatment with gossypol inhibited steroidogenesis 484
in cultured bovine theca cells without affecting cell viability. To our knowledge, this is the 485
first report that demonstrates direct effects of gossypol on the theca cell functions in any 486
species. 487
Antifertility effects of gossypol have been reported in many species. It is well 488
known that gossypol exerts inhibitory effects on spermatogenesis and testicular functions in 489
human, livestock and laboratory animals (Randel et al. 1992; Akinola et al. 2006; Taha et 490
al. 2006). Although less appreciated, gossypol also disrupts reproductive functions in 491
female animals. Gossypol has been reported to disrupt the estrus cycle and decrease 492
fertility in rats and cattle (Lagerlöf & Tone 1985; Santos et al. 2003). 493
These Antifertility effects of gossypol appear to be at least partially mediated by 494
impairment of gonadal steroidogenesis. In male, gossypol has been shown to inhibit leydig 495
cell androgen production (Lin et al. 1981; Donaldson et al. 1985; Sufi et al. 1985; Pearce et 496
al. 1986a). In female, gossypol has been shown to decrease production of E2 and P4 in 497
cultured granulosa cells in cattle (Lin et al. 1994), pigs (Akira et al. 1994; Ohmura et al. 498
1996; Vranová et al. 1999; Basini et al. 2009) and rats (Lin et al. 1985), and luteal cells in 499
cattle (Gu et al. 1990a, b, 1991). Gossypol was also shown to inhibit FSH-stimulated 500
progesterone production in porcine cumulus cells (Kolena et al. 2001). 501
The results of the present study demonstrated that gossypol as low as 5 µg/mL or 502
less can suppress A4 production in cultured bovine theca cells. These doses are comparable 503
26
to, or even lower than the doses reported to suppress P4 or E2 production in cultured 504
granulosa cells in pigs (Vranová et al. 1999; Basini et al. 2009) and cattle (Lin et al. 1994), 505
and luteal cells in cattle (Gu et al. 1990a, b). 506
Production of A4 appears to be more easily affected by gossypol than that of P4 in 507
bovine theca cells. In the present study, gossypol started to decrease A4 production at 1 to 5 508
µg/mL while it was only effective to suppress P4 at 25 µg/mL. In the consequence the 509
treatment with gossypol shifted theca cell steroidogenesis from A4 to P4 production in a 510
dose-dependent manner. These results imply that the androgen production in theca cells 511
may be the prime target of gossypol action. In addition to this, well vascularized theca layer 512
is more likely to be affected by circulating gossypol compared to avascular granulosa layer. 513
Sensitivity to gossypol appears to vary among species (Randel et al. 1992). 514
Ruminants are more resistant to gossypol compared to non-ruminants due to their ability to 515
detoxify gossypol in the rumen (Reiser & Fu 1962). It was reported that beef heifers and 516
cows fed high levels of dietary gossypol (20 g/animal/day and 20 mg/kg BW/day, 517
respectively) for extended periods (62 days and 33 weeks, respectively) showed no adverse 518
effect on reproductive performance (Gray et al. 1993). Nevertheless, feeding with excessive 519
levels of gossypol was shown to cause reproductive disorders such as decreased conception 520
rate and increased incidence of abortion in dairy cattle (Santos et al. 2003). In these animals, 521
plasma levels of gossypol reached more than 5 µg/mL (Santos et al. 2003), the level that 522
effectively suppress theca cell androgen production in vitro. Comparable levels of gossypol 523
were also reported by other authors in lactating Holstein cows fed large amounts of 524
27
cottonseed meal (Lindsey et al. 1980) and Brown Swiss cows given a bolus of gossypol 525
(Lin et al. 1991). The safe upper limit of plasma gossypol concentration was estimated as 4 526
μg/mL (Noftsger et al. 2000). The present results demonstrated that theca cell 527
steroidogenesis could be affected by gossypol at lower concentrations. The terminal 528
elimination half-lives of gossypol from the circulation was estimated to be 2-3 days (Lin et 529
al. 1991). Thus, continuous feeding with cottonseed meal may result in a gradual built up 530
of gossypol in the circulation to the level hazardous to reproduction. 531
Estradiol produced in the preovulatory follicle and P4 produced in the corpus 532
luteum are both crucial for induction of estrus, ovulation and subsequent embryo 533
development. It has been reported that gossypol inhibits E2 production in porcine granulosa 534
cells (Akira et al. 1994; Ohmura 1996; Basini et al. 2009). Gossypol appears to inhibit E2 535
production by suppressing conversion of androgen to estrogen by aromatase in granulosa 536
cells (Akira et al. 1994). In cattle, supply of androgen from theca cells is absolutely 537
necessary for E2 production in the adjacent granulosa cells. Production of androgen in 538
theca cells, in turn, is also supported by pregnenolone and P4 supplied by the granulosa 539
cells (Fortune 1986). Our results indicate that E2 production is also inhibited by gossypol at 540
the level of thecal androgen production. 541
Gossypol appears to suppress gonadal steroidogenesis through various mechanisms. 542
Since gossypol is known to exert cell toxicity in variety of cell types, it may suppress 543
gonadal steroidogenesis through inducing cell death among follicular and luteal cell 544
populations (Qiu et al. 2002). Indeed, gossypol has been shown to increase the incidence 545
28
of follicular atresia among follicles in various developmental stages in rats (Gadelha et al. 546
2014). However, in vitro studies utilizing isolated granulosa and luteal cells do not support 547
this view: gossypol did not affect viability of cultured leydig cells (Pearce et al. 1985), 548
cultured granulosa cells (Akira et al. 1994), or it even increased number of cultured 549
granulosa cells in pigs (Basini et al. 2009). Similarly, it was reported that gossypol as high 550
as 170 µM did not affect viability of cultured bovine luteal cells (Gu et al. 1990b). Our 551
results also demonstrated that the treatment with gossypol up to 25 µg/mL (approx. 50 µM) 552
did not affect viability of cultured bovine non-luteinized and luteinized theca cells. Taken 553
together these results indicate that anti-steroidogenic effect of gossypol on ovarian cells is 554
not caused by decrease in cell viability. 555
Gossypol has been shown to inhibit gonadotropin-stimulated cAMP production in 556
cultured granulosa (Lin et al. 1994) and luteal cells in cattle (Gu et al. 1990a), and luteal 557
cells in rats (Wang et al. 1987). Gossypol appears to inhibit cAMP production at the level 558
of adenylate cyclase since cAMP production stimulated by forskolin, an activator of 559
adenylate cyclase, was shown to be inhibited by gossypol in bovine luteal cells (Gu et al. 560
1990a) and mouse leydig cells (Pearce et al. 1986 a, b). On the other hand, hCG binding to 561
LH receptor was not altered by gossypol in rat luteal cells (Wang et al. 1987) and mouse 562
leydig cells (Pearce et al. 1986b). Our result, that gossypol does not affect expression of 563
LHR, is in accordance with these results. Gossypol appears to suppress steroidogenesis also 564
at a distal to the cAMP production for it was shown to suppress dibutyryl cAMP stimulated 565
activities of CYP11A1 and HSD3B in bovine luteal cells (Gu et al. 1990b). In the present 566
study, the treatment with gossypol as low as 0.2 µg/mL blocked LH-stimulated expression 567
29
of CYP11A1, HSD3B and CYP17A1 in non-luteinized bovine theca cells. These results 568
indicate that gossypol suppresses thecal steroidogenesis at multiple sites distal to LHR 569
leading to down-regulation of genes encoding steroidogenic enzymes. 570
In conclusion, these results imply that gossypol inhibits ovarian steroidogenesis 571
through disturbing LH-stimulated thecal androgen production in cattle. The effect of 572
gossypol is at least partially exerted through down-regulation of genes encoding 573
steroidogenic enzymes responsible for P4 and A4 production. Effective doses of gossypol 574
to suppress steroidogenesis appears to be within the range reported in cattle fed large 575
amount of cottonseed meal. Since antifertility effects of gossypol were potentiated by 576
Trypanosoma brucei infection especially in protein-malnourished animals (Akingbemi et al. 577
1996), a special attention should be given to gossypol toxicity especially in countries where 578
cottonseed meal is used widely as an important protein source for livestock feed. 579
580
30
Table 3.1 Primers used for quantitative RT-PCR 581
Gene (size: bp) Primer Sequence (5’-3’) GeneBank No. Positiona
TBP (200) Sense gccttgtgcttacccaccaacagttc NM_001075742.1 1133 - 1158
Anti-Sense tgtcttcctgaaacccttcagaataggg 1332 - 1305
RPL4 (116) Sense actccgagcaccacgcaaga NM_001014894.1 945 - 964
Anti-Sense tggtgttcctgcgcatggtct 1060 - 1040
HSPCB (126) Sense cgaggacgcctctcgcatgg NM_001079637.1 2229 – 2248
Anti-Sense agaggaaaccatgtgggcca 2354 - 2333
LHR (202) Sense aggaaaatgcacgcctggag AF491303.1 620 - 639
Anti-Sense gtggcatccaggaggttggt 821 - 802
StAR (121) Sense cagcagaagggtgtcatcagag NM_174189.2 767 - 788
Anti-Sense gccatcccttgaggtcaatgct 887 - 866
CYP11A1 (118) Sense ccctgaaagtgacttggttcttca NM_176644.2 1209 - 1232
Anti-Sense gtcaaacttgtccggactggag 1326 - 1305
HSD3B (118) Sense ccttgtacacttgtgccctgag X17614.1 640 - 661
Anti-Sense aacttgcagtgattggtcagga 757 - 736
CYP17A1 (60) Sense ccaccctctcccaccatt
NM_174304.2 1622 - 1639
Anti-Sense gcaggctgggaaagaagg 1681 - 1664
aNucleotide position in the reported sequence. 582
583
584
31
585
Figure 3.1 Experimental schemes of gossypol treatments in non-luteinized theca cells and 586
luteinized theca cells. Bovine theca cells were harvested from healthy preovulatory follicles 587
and cultured with a low dose of LH (1 ng/mL) for the first 24 h, followed by a treatment 588
with a high dose of LH (100 ng/mL) for 24 h, and subsequently cultured with a low dose of 589
LH (1 ng/mL) for 7 days. Theca cells were treated with gossypol for 24 h at day 1 (non-590
luteinized theca cells: NL) or at day 7 (luteinized theca cells: L). A representative data 591
show changes in androstenedione (A4) and progesterone (P4) production by theca cells 592
during 9 days culture period. Data were expressed as mean ± SEM (n=4). 593
594
595
32
596
Figure 3.2 Effect of gossypol on the viability of non-luteinized and luteinized bovine theca 597
cells. Non-luteinized (A) and luteinized (B) bovine theca cells were cultured without or 598
with LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned in the materials and 599
methods and Figure 1. After the experimental periods, cells were collected and viability 600
(percentage of live cells) was determined. Data were expressed as mean ± SEM (n=4). 601
33
602
Figure 3.3 Effect of gossypol on the production of androstenedione and progesterone in 603
non-luteinized bovine theca cells. Non-luteinized bovine theca cells were cultured 604
with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24h as mentioned above. 605
After the culture, culture media were collected and production of A4 (A) and P4 (B), and a 606
ratio of A4 to P4 (C) were determined. Results of a representative experiment out of three 607
repeated trials were presented as mean ± SEM (n=4). Different letters (a,b,c) indicate 608
significant differences; P<0.05. 609
34
610
Figure 3.4 Effect of gossypol on the production of androstenedione (A4) and progesterone 611
(P4) in luteinized bovine theca cells. Luteinized bovine theca cells were cultured 612
with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned above. 613
After the culture, culture media were collected and production of A4 (A) and P4 (B), and a 614
ratio of A4 to P4 (C) were determined. Results of a representative experiment out of three 615
repeated trials were presented as mean ± SEM (n=4). Different letters (a,b,c) indicate 616
significant differences; P<0.05. 617
35
618
Figure 3.5 Effect of gossypol on the gene expression of LHR, StAR, CYP11A1, HSD3B and 619
CYP17A1 in non-luteinized bovine theca cells. Non-luteinized bovine theca cells were 620
cultured with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned 621
above. After the culture, theca cells were collected and mRNA was extracted. Levels of 622
gene expression were quantified by a real-time PCR and normalized to the geometric 623
means of three reference genes, TBP, RPL4 and HSPCB for LHR (A), StAR (B), CYP11A1 624
(C), HSD3B (D) and CYP17A1 (E). Data were expressed as mean ± SEM of three repeated 625
experiments. Different letters (a,b) indicate significant differences; P<0.05. 626
36
627
Figure 3.6 Effect of gossypol on the gene expression of LHR, StAR, CYP11A1, HSD3B and 628
CYP17A1 in luteinized bovine theca cells. Luteinized bovine theca cells were cultured 629
with/without LH (1 ng/mL) and gossypol (0.2-25 µg/mL) for 24 h as mentioned above. 630
After the culture, theca cells were collected and mRNA was extracted. Levels of gene 631
expression were quantified by a real-time PCR and normalized to the geometric means of 632
three reference genes, TBP, RPL4 and HSPCB for LHR (A), StAR (B), CYP11A1 (C), 633
HSD3B (D) and CYP17A1 (E). Data were expressed as mean ± SEM of three repeated 634
experiments. Different letters (a,b,c) indicate significant differences; P<0.05. 635
37
CHAPTER 4 636
GOSSYPOL INHIBITS LH-INDUCED BOVINE THECA CELLS 637
STEROIDEGENESIS VIA cAMP DEPENDENT PATHWAY 638
Introduction 639
In the chapter 3, we demonstrated that gossypol inhibits LH-induced steroid 640
production in bovine theca cells. LH-stimulated steroid production is known to be mediated 641
by the cAMP- and diacylglycerol (DAG)/inositol triphosphate (IP3)-dependent signaling 642
pathways (Davis 1994). Gossypol has been shown to suppress steroidogenesis through 643
inhibiting the former pathway: In cultured granulosa and luteal cells of rat and cattle, 644
gossypol inhibited intracellular cAMP production stimulated by hCG and forskolin, an 645
activator of adenylate cyclase (Gu et al. 1990a; Lin et al. 1994; Pearce et al. 1986b, Wang 646
et al. 1987). Gossypol also inhibited cAMP analog-stimulated steroidogenesis in rat and 647
bovine luteal cells (Wang et al. 1987; Gu et al. 1990b). Similar inhibitory effect of 648
gossypol on LH-stimulated cAMP production and dbcAMP-stimulated steroidogenesis was 649
also reported in leydig cells of mouse and rat (Pearce et al. 1986a; Olgiati et al. 1984). 650
These results indicate that gossypol inhibits cAMP-dependent signaling pathway at 651
adenylate cyclase led cAMP production as well as a step distal to cAMP production. 652
Gossypol also affects DAG/IP3-dependent signaling pathway. It was demonstrated 653
that high levels of gossypol (100-300 µM, approx. 50-150 µg/mL) inhibited activity of 654
protein kinase C (PKC) in rat spermatocyte (Teng 1995). 655
38
Taken together, these results imply that gossypol may suppress theca cell 656
steroidogenesis by inhibiting these signaling pathways. However, the mechanism how 657
gossypol inhibits LH-induced steroid production in bovine theca cells is still unknown. 658
Therefore, in this study, we investigated the effect of gossypol on cAMP- and DAG/ IP3-659
dependent signaling pathways in cultured bovine theca cells. 660
661
662
663
664
665
666
667
668
669
670
671
672
673
674
675
39
Materials and methods 676
Theca cell preparation and culture 677
Ovaries were obtained from the local abattoir. Theca cells were prepared as 678
mentioned in Chapter 2. In brief, follicular walls were harvested from apparently healthy, 679
well-vascularized follicles 10-15 mm in diameter with clear amber follicular fluid and theca 680
cells were enzymatically isolated. Approximately 7x104 viable theca cells were seeded in 681
96 well culture plates (Nunclon: Life Technologies, Paisley, UK) in 200 µL of culture 682
medium with 5% fetal calf serum (FCS: Fetal clone III, Hyclone laboratories, Logan, Utah, 683
USA) at 37℃ in 5% CO₂ in air.. 684
Experimental design 685
To examine the time dependent effect of gossypol, theca cells were cultured in 686
above culture medium without or with1 ng/mL LH (bovine LH, AFP-11118B, National 687
Institute of Diabetes and Digestive and Kidney Disease, Baltimore, MD, USA), without or 688
with 5 µg/mL of gossypol for 6h, 12h and 24h, respectively. Since significance inhibitory 689
effect of gossypol was seen at 6h, it is used as experimental model. 690
Effect of gossypol on PKA pathway 691
Theca cells were cultured in above culture medium with 3-isobutyl-1-692
methylxanthine (IBMX), 0.5 mM (Wako Pure Chemical Industries, Osaka, Japan), without 693
or with 5 µg/mL of gossypol, without or with 1ng/mL LH or without or with forskolin 10 694
µM (Wako) or without or with 0.5 mM dibutyryl-cAMP (dbcAMP) for 6h, respectively. 695
40
After 6h culture periods, the spent medium was collected and stored at -20℃ for A4 and 696
cAMP assays. 697
Effect of gossypol on PKC pathway 698
Theca cells were cultured in above culture medium without or with 5 µg/mL of 699
gossypol, without or with 1 ng/mL LH, without or with 100 nM phorbol 12-myristate 13-700
acetate (PMA) for 6h. After 6h culture periods, the spent medium was collected and stored 701
at -20℃ for A4 assay. 702
Androstenedione assay 703
Concentration of A4 in the culture medium was determined by using a commercial kit 704
(Androstenedione Human ELISA kit; Immunospec Corporation, Canoga Park, CA, USA) 705
following the procedures provided by the manufacturer. Intra- and inter-assay coefficients 706
of variation were less than 10%. 707
cAMP assay 708
cAMP concentration in the spent medium was measured by cAMP complete elisa 709
kit (Enzo Life Sciences, Farmingdale, New York, USA) following the procedures provided 710
by the supplier. The intra- and inter assay coefficient of variations were less than 10%. 711
712
713
714
41
Statistical analysis 715
All data were presented as mean ± SEM. Data were subjected to one-way or two 716
way analysis of variance (ANOVA) with Tukey multiple comparison test. P < 0.05 was 717
considered to be statistically significant. 718
719
720
721
722
723
724
725
726
727
728
729
730
731
732
733
734
735
42
Results 736
Time dependent effect of gossypol on theca cell steroid production 737
A4 production in the spent media were measured after the 6, 12 and 24-h 738
experimental periods. The treatment with LH (1 ng/mL) increased theca cell A4 production 739
in time-dependent manner (P<0.01). The treatment with gossypol (5 µg/mL) inhibited LH-740
induced A4 production (P<0.01). Significant inhibitory effect of gossypol was able to be 741
seen starting from the end of 6h culture period (Fig. 4.1). 742
Effect of gossypol on cAMP dependent/ PKA pathway 743
A4 production in the spent media were measured after the 6h experimental period. 744
Treatments with LH (1 ng/mL), forskolin (10 µM) and dbcAMP (0.5 mM) significantly 745
increased (P<0.01) A4 production about 3 fold, 4 fold and 3 fold, respectively, in theca 746
cells. Gossypol significantly inhibited (P<0.01) LH-, forskolin- and dbcAMP-induced A4 747
productions (Fig. 4.2A). 748
Effect of gossypol on LH and forskolin mediated cAMP production 749
cAMP production in the spent media were measured after the 6h experimental 750
periods. Treatments with LH (1 ng/mL) had no significant effect on cAMP production 751
whereas forskolin (10 µM) significantly increased (P<0.01) A4 production about 20 fold 752
higher than basal level in theca cells. Gossypol did not alter forskolin-stimulated cAMP 753
production (Fig. 4.2B). 754
43
Effect of gossypol on DAG/IP3-dependent signaling pathway 755
A4 production in the spent media were measured after the 6h experimental period. 756
Treatments with LH (1 ng/mL) significantly increased (P<0.01) theca cell A4 production 757
more than 2 fold higher than basal level. Treatment with PMA (100 nM) had no significant 758
effect on theca cells A4 production. Gossypol significantly inhibited (P<0.01) only LH-759
induced A4 production in this experiment (Fig. 4.3). 760
761
762
763
764
765
766
767
768
769
770
771
44
Discussion 772
In the chapter 3, we have demonstrated that gossypol suppressed LH-induced 773
bovine theca cell steroid production without affecting cellular viability. In this chapter, we 774
further investigated the mechanism of gossypol action to inhibit theca cell steroidogenesis. 775
LH stimulates steroidogenesis mainly through two intracellular signaling pathways, 776
cAMP- and DAG/IP3-dependent signaling pathways (Davis 1994). Upon binding to its 777
receptor, LH initiates a chain of intracellular events by activating the receptor coupled G-778
proteins, leading to activation of effector proteins: In cAMP-dependent signaling pathway, 779
production of cAMP by adenylate cyclase and subsequent activation of cAMP-dependent 780
protein kinase (PKA) take place, which in turn initiates cellular response such as increase in 781
steroid production (Wood & Strauss 2002). In DAG/IP3-dependent signaling pathway, 782
phospholipase C (PLC) cleaves phosphatidylinositol 4,5-bisphosphate (PIP2) to DAG and 783
IP3 and they act as second messengers to activate PKC (Davis 1994). 784
In the present study, we investigated mechanism of gossypol action in cultured 785
bovine theca cells by examining its effect on steroid and cAMP production stimulated by 786
activators of these signaling pathways. 787
In this study, treatment with low level of gossypol (5 µg/mL) significantly 788
decreased steroid production stimulated by LH, forskolin (an adenylate cyclase activator), 789
and dbcAMP (a permeable cAMP analog). These results are in accord with the results 790
previously reported in bovine granulosa and luteal cells (Gu et al. 1990a, b; Wang et al. 791
45
1987; Lin et al. 1994) and indicate that gossypol suppresses theca cell steroidogenesis 792
through cAMP-dependent signaling pathway. 793
Gossypol appears to suppress A4 production at a step distal to cAMP production. 794
In this study, forskolin and LH stimulated cAMP production was not attenuated by the 795
treatment with gossypol. Our results are in contrast with the previous results obtained in 796
rats and cattle where gossypol was shown to inhibit cAMP production in cultured granulosa 797
and luteal cells (Gu et al. 1990a, b; Pearce et al. 1986b; Lin et al. 1994; Wang et al. 1987). 798
The reason for this discrepancy is not clear but probably due to the difference in gossypol 799
doses used in these studies. The doses they used (more than 10 µg/mL) were much higher 800
than the dose used in this study. The level of gossypol we used in the present study (5 801
µg/mL) is the level that can be occurred in cattle fed cottonseed products as we discussed in 802
the Chapter 3. These results imply that gossypol suppress theca cell steroid production by 803
inhibiting PKA or downstream enzymes directly involved in the steroidogenesis. In 804
cultured mouse leydig cells, Pearce et al. (1986a) reached a similar conclusion that 805
gossypol exerts its major inhibitory effect somewhere between activation of PKA and 806
increased availability of cholesterol for side chain cleavage enzyme. Gossypol may exert its 807
inhibitory action through other cAMP dependent effecters, such as tyrosine kinase for 808
cAMP-dependent, but PKA-independent steroidogenesis was shown to occur in luteinized 809
human granulosa cells (Chin & Abayasekara 2004) and rat luteal cells (Needle et al. 2006). 810
However, a further study is necessary to elucidate this possibility. 811
46
Although PKA mediated signaling pathway is the predominant signaling cascade 812
involved in tropic hormone-stimulated StAR expression and steroid biosynthesis (Stocco & 813
Clark 1996; Jo et al. 2005; Manna & Stocco 2005), PKC mediated signaling pathway is 814
also likely to be involved in steroid biosynthesis (Manna & Stocco 2005). To investigate 815
gossypol effect on PKC mediated steroid production we treated theca cells with gossypol 816
and PMA, an activator of PKC. In the present study, PMA has no effect on bovine theca 817
cells A4 production. These results indicate that PKC is not involved in LH-stimulated A4 818
production in bovine theca cells. These results are in accord with results obtained by 819
Kaminski (2004) and Tilly & Johnson (1988, 1989), where no effect of PMA on basal 820
steroidogenesis was reported in porcine theca cells and hen granulosa cells. Nevertheless, 821
inhibitory effect of gossypol on PKC activity was reported in rat spermatocytes and liver 822
cells by Teng (1995) and Xiao et al. (1993), respectively. 823
In conclusion, the present study clearly demonstrated that inhibition of LH-824
induced steroidogenesis by gossypol is not through PKC-mediated signaling pathway but 825
through cAMP-dependent signaling pathway in bovine theca cells. Gossypol appears to 826
exert its effect at a step distal to cAMP production. 827
828
829
830
831
47
832
Figure 4.1 Time dependent effect of gossypol (5 μg/mL) on steroid production of bovine 833
theca cells. Bovine theca cells were harvested from healthy preovulatory follicles and 834
cultured without or with LH (1 ng/mL) and without or with gossypol (5 μg/mL) for 6, 12 835
and 24h, respectively. After the culture, culture media were collected and steroid 836
production (A4) was determined. Data were expressed as mean ± SEM (n=4). Different 837
letters (a,b,c,d) indicate significant differences; P<0.05. 838
839
840
841
842
843
48
844
Figure 4.2 Effect of gossypol on the cAMP dependent pathway. Bovine theca cells were 845
cultured without or with gossypol (5 μg/mL), without/with LH (1 ng/mL) or without/with 846
forskolin 10 µM or without/with dibutyryl-cAMP (dbcAMP) 0.5 mM for 6h as mentioned 847
above. After the experimental periods, spent media were collected and production of A4 848
(A) and cAMP production (B) were measured. Data were expressed as mean ± SEM (n=4). 849
Different letters (a,b,c,d,e) indicate significant differences; P<0.05. Superscripts *** 850
indicate P<0.001 between gossypol and no gossypol treatments. 851
852
49
853
Figure 4.3 Effect of gossypol on the PKC pathway in bovine theca cell. Theca cells were 854
cultured without or with gossypol (5 μg/mL), without or with LH (1 ng/mL) or without or 855
with 100 nM PMA for 6h as mentioned above. After the experimental periods, spent media 856
were collected and production of A4 in the medium was measured. Data were expressed as 857
mean ± SEM (n=4). Different letters (a,b,c) indicate significant differences; P<0.05. 858
Superscripts *** indicate P<0.001 between gossypol and no gossypol treatments. 859
860
861
862
863
864
865
866
867
50
CHAPTER 5 868
EFFECT OF GOSSYPOL ON BOVINE THECA CELLS CARBOHYDRATE 869
METABOLISM 870
Introduction 871
In the Chapter 3, it was demonstrated that gossypol at 5 µg/mL or less suppressed 872
androstenedione (A4) production by suppressing gene expression of StAR and steroidogenic 873
enzymes in cultured bovine theca cells without affecting cellular viability. These results 874
indicate that gossypol inhibits theca cell steroidogenesis through mechanisms other than 875
apoptosis. Gossypol is apparently able to act by a number of mechanisms, including the 876
inhibition of cellular energy metabolism through suppressing glycolysis and expression of 877
enzymes involved in glycolytic pathway. 878
The glycolytic pathway is the central metabolic pathway necessary for energy 879
production. Glucose metabolism through glycolytic pathway has been shown to be key 880
determinants of follicle development, maturation and ovulation (Boland et al. 1993, 1994a, 881
b). Ovarian follicles appear to utilize anaerobic glycolysis leading to production of lactate 882
for energy production (Boland et al. 1993). Since decrease in glucose supply suppresses 883
follicular steroidogenesis (Boland et al. 1994b), it is possible that gossypol decreases 884
steroidogenesis by suppressing glucose utilization. 885
Once glucose is transported into cell by glucose transporters (GLUTs) across the 886
cell membrane, it enters glycolysis mediated by 10 glycolytic enzymes, namely hexokinase 887
51
(HK), phosphoglucoisomerse (GPI), phosphofructokinase (PFK), aldolase (Aldo), 888
triosesphosphate isomerase (TPI), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 889
phosphoglycerate kinase (PGK), phosphoglycerate mutase (PGM), enolase (ENO) and 890
pyruvate kinase (PK), leading to formation of two molecules of pyruvate. In anaerobic 891
glycolysis, pyruvate is converted to lactate by lactate dehydrogenase (LDH). Of these 892
enzymes, HK, PFK, PK and LDH are considered as rate limiting enzymes. 893
Inhibition of LDH activity by gossypol was reported in mouse kidney, liver and 894
testis (Lee et al. 1981), in rat testis (Giridharan et al. 1982) and in bull spermatozoa (Rovan 895
et al. 1984). Disturbance of sperm energy metabolism by inhibiting glucose and fructose 896
utilization in the presence of gossypol is also reported by Wichmann et al. (1983). These 897
results imply that the inhibitory effect of gossypol on theca cell steroidogenesis may be 898
caused by suppression of glucose metabolism at steps mediated by LDH or/and key 899
enzymes of glycolysis. However, nothing is known about the effect of gossypol on 900
carbohydrate metabolism in the theca cell in any species. 901
The purpose of this chapter is to elucidate the effect of gossypol on carbohydrate 902
metabolism in bovine theca cells. In the first part, we elucidated gene expression of HK, 903
PFK, PK and LDH isozymes and subunits in theca tissues collected from growing and 904
maturing follicles. In the second part we elucidated effect of gossypol on the lactate 905
production and expression of these key glycolytic enzymes in cultured bovine theca cells. 906
907
908
52
Materials and methods 909
Follicles collection 910
Paired ovaries were harvested from Holstein x Japanese Black F1 heifers (21-26 911
months old) at an abattoir. Only healthy ovarian pairs were used in the present study. The 912
ovaries were prepared as mentioned previously in the Chapter 2. Physiological condition of 913
follicles (developing vs matured) were decided using the criteria mentioned in Nishimoto et 914
al. (2009). 915
Classification of follicles 916
Follicular diameters were estimated from the weight of FF using the equation: 917
y=12.96x0.31, where y = the diameter of follicles (mm) and x = the weight of FF (g) 918
(Murasawa et al. 2005). Small and large follicles were classified based on the diameter 919
("8.5 mm or <8.5 mm), relative concentrations of E2 and P4 in FF (E/P "1 or <1), the 920
stages of CL and accompanying follicles (Table 5.2). 921
Collection of theca cells 922
Bovine ovaries were obtained from the local abattoir. Ovaries were transported to 923
the laboratory in the next morning in Dulbecco’s phosphate buffered saline (DPBS) 924
supplemented with 17.5 mM glucose and 15 mM MgCl2.6H2O at 20℃. Large follicles 925
>10-15 mm with amber follicular fluid and vascularized follicles in diameter were used. 926
Theca cells were prepared as mentioned in Chapter 2. 927
53
Theca Cell culture 928
Approximately 7x104 theca cells were cultured in 96 well plates in 200 µL of 929
culture medium with 5% fetal calf serum (FCS: Fetal clone III, Hyclone laboratories, 930
Logan, Utah, USA), without or with 1 ng/mL LH (bovine LH, AFP-11118B, National 931
Institute of Diabetes and Digestive and Kidney Disease, NIDDK) and various concentration 932
of gossypol (0, 0.2, 1, 5 and 25 µg/mL) for 24h. At the end of the experimental period, the 933
spent medium was collected and stored at -20℃ for steroid assays. 934
Glucose and lactate assays 935
Glucose concentration in the spent medium and follicular fluid was measured 936
using a commercial glucose assay kit (Wako Pure Chemical Industries, Osaka, Japan) 937
following the procedures provided by the supplier. Lactate production in the medium was 938
measured by lactic acid kit (Determiner LA, Kyowa Medex Co., Tokyo). The intra- and 939
inter assay coefficient of variations were less than 10%. 940
RNA extraction, reverse transcription (RT) and quantitative polymerase chain 941
reaction (qPCR) 942
Total RNA was extracted from theca cells by using phenol-chloroform method and 943
reverse-transcribed using a commercial kit (Ominiscript Reverse Transcription kit; 944
QIAGEN, GmbH, Hilden, Germany) following the procedures provided by the 945
manufacturers. The abundance of mRNAs encoding HK1, HK2, PFKL, PFKM, PFKP, 946
PKM, LDHA and LDHB were quantified by a real-time quantitative PCR (LightCycler 947
54
Nano; Roche, Basel, Swizerland) using a commercial real-time PCR kit (FastStart Essential 948
DNA Green Master; Roche). Specific primers for target genes were designed and PCR was 949
performed as mentioned in Chapter 2 (Table. 5.1). All cDNA samples were amplified in 950
duplication and each transcript level was normalized to the geometric mean of 3 reference 951
genes selected by geNorm as mentioned in the Chapter 2. The intra- and inter-assay 952
coefficient of variations was less than 10% for all measurements. 953
Statistical analysis 954
All data were presented as mean ± SEM. Data were subjected to one-way analysis 955
of variance (ANOVA) followed by Tukey multiple comparison test or t-test. Levels of gene 956
expression were analyzed using one-way repeated measures ANOVA. P < 0.05 was 957
considered to be statistically significant. 958
959
960
961
962
963
964
965
55
Results 966
Gene Expression of glycolytic enzymes in bovine follicles 967
Gene expression of the glycolytic enzymes HK1 and HK2, but not HK3; all three 968
subunits of PFK, PFKL, PFKM, and PFKP, PKM but not PKL; and both LDHA and LDHB 969
were examined in preovulatory small growing follicles (SG) and early dominant follicles 970
(ED) (Fig. 5.1). HK2 and PKFM genes express significantly higher in early dominant 971
follicles (P<0.05) (Fig. 5.1B, D). 972
Effect of gossypol on lactate production in preovulatory bovine theca cells 973
During 6h experimental period, gossypol significantly inhibited preovulatory 974
bovine theca cell lactate production in dose-dependent manner (Fig. 5.2). 975
Effect of gossypol on gene expression of glycolytic enzymes, HK1, HK2, PFKL, PFKM, 976
PFKP, PKM, LDHA and LDHB 977
Treatment with LH seemed to have no effect on the gene expressions of HK1, HK2, 978
PFKL, PFKM, PFKP, PKM, LDHA and LDHB (Fig. 5.3). Gossypol also had no effect on 979
gene expressions of glycolytic enzymes except for PFKM (Fig. 5.3D). Expression of PFKL 980
and LDHA were tended to be slightly decreased (Fig. 5.3C, G), that of PFKP and LDHB 981
(Fig. 5.3E, H) were not affected and that of HK1, HK2 and PKM (Fig. 5.3A, B, F) seemed 982
to be increased by gossypol. 983
984
56
Discussion 985
In the present chapter, we investigated the expression of isozymes and subunits of 986
four key enzymes, HK, PFK, PK and LDH, in anaerobic glycolytic pathway in the bovine 987
theca interna and effect of gossypol on the expression of these enzymes and production of 988
lactate, the terminal product of anaerobic glycolysis, in cultured bovine theca cells. Glucose 989
is a main energy substrate in the ovary and availability of glucose has been shown to affect 990
ovarian function (Rabiee et al. 1997). Glucose appears to be mainly metabolized through 991
anaerobic glycolysis in the ovarian follicle (Boland et al. 1993). The anaerobic glycolysis is 992
mediated by10 glycolytic enzymes and LDH. Of which, four enzymes, HK, PFK, PK and 993
LDH catalyze rate-limiting steps that determine velocity of the pathway (Li et al. 2015). 994
Despite the importance of these enzymes in cellular functions, little is known about their 995
expressions and activities in the follicle of any species. Thus, we have examined the gene 996
expression of isozymes and subunits of these enzymes in the theca interna harvested from 997
bovine growing follicles (<8.5 mm) and large preovulatory follicles (>8.5 mm). 998
Our results demonstrated that the bovine theca interna expresses gene encoding 999
HK isozymes, HK1 and HK2, but not HK3; all three subunits of PFK, PFKL, PFKM and 1000
PFKP; PKM, but not PKL; and both LDHA and LDHB. HK catalyzes the first step of the 1001
glycolysis, phosphorylation of glucose to produce glucose-6-phosphate. There are three 1002
HKs with high substrate affinity (Wilson 2003; Li et al. 2015). HK1 is a ubiquitous HK 1003
found in all mammalian tissues and plays as a housekeeping HK (Wilson 2003; Li et al. 1004
2015). HK2 is a predominant HK found in skeletal muscles and heart and plays as the key 1005
57
HK regulating rate of glycolysis (Wilson 2003; Li et al. 2015). HK3 is less characterized 1006
HK and little is known about its metabolic role (Wilson 2003; Li et al. 2015). Our results, 1007
that both HKs were expressed in the bovine theca interna and the expression of HK2 but 1008
not HK1 increased as follicular development progressed indicate that the first step of the 1009
glycolysis is mediated by both HK1 and HK2 but increase in the rate of glycolysis to keep 1010
up with increasing glucose requirement associated with follicular maturation is met by HK2. 1011
The second rate-limiting step of the glycolysis is mediated by PFK, which converts 1012
fructose-6-phosphate to fructose1, 6-biphosphate at an expense of an ATP. In the present 1013
study, we identified all three PFK subunit genes encoding liver-type (PFKL), muscle-type 1014
(PFKM) and platelet type (PFKP) in the theca interna. These results indicate that PFK, a 1015
tetrameric enzyme, consists of combinations of any of these subunits in the bovine theca 1016
interna. PFK is the most important rate-limiting enzyme in the glycolytic pathway (Li et al. 1017
2015), and we observed significantly higher expression of PFKM in association with 1018
follicular development. 1019
PK catalyzes the third rate-limiting step and converts phosphoenolpyruvate to 1020
pyruvate and generates one molecule of ATP. There are two isozymes of PK, PKL and 1021
PKM (Li et al. 2015). In the present study, only PKM was found in the bovine theca interna 1022
and its expression was not significantly altered between small growing follicles and large 1023
preovulatory follicles. 1024
The interconversion of pyruvate and lactate is catalyzed by LDH. This process 1025
occurs under anaerobic condition in general but has been shown to occur in aerobic 1026
58
condition in cultured murine ovarian follicles (Boland et al. 1993). LDH is an enzyme 1027
comprises of four subunits in combinations of two forms of subunits, LDHA, an anaerobic 1028
muscle form and LDHB, an aerobic heart form (Li et al. 2015). The third LDH subunit 1029
unique to testis, LDHC was also reported (Wheat & Goldberg 1983). There are five 1030
isoforms of LDH: LDH-1 (B4), LDH-2 (B3A1), LDH-3 (B2A2), LDH-4 (B1A3) and LDH-1031
5 (A4) (Li et al. 2015). These five isozymes were shown to be expressed in the rat ovary, 1032
and gonadotropin treatment shifted ratio of the isozymes from LDH-1, LDH-2 and LDH-3 1033
to LDH-5 (Matsuzawa & Takikawa 1968). LDH activity in the human follicles was shown 1034
to mainly occur in theca interna and its activity was strong in preovulatory follicles 1035
(Breitenecker et al. 1978). Our study demonstrated that LDHA and LDHB are both 1036
expressed in bovine theca interna. However, we could not observe any significant changes 1037
in the expressions of LDHA and LDHB with the follicular development although the 1038
LDHA: LDHB ratio is in favor of LDHA. In these follicles, concomitant increase in 1039
glucose and decrease in lactate in follicular fluid were observed. These results imply that 1040
LDH isozymes are changing with follicular development with well vascularized 1041
preovulatory follicles express more aerobic forms of LDH and this shift is mainly regulated 1042
by the expression of LDHA subunit in the bovine follicle. 1043
Taken together, our results demonstrated that the glycolysis is regulated by 1044
multiple isozymes of rate-limiting enzymes in the bovine theca interna. 1045
In the present study, gossypol significantly inhibited lactate production in cultured 1046
bovine theca cells. These results clearly demonstrated that gossypol suppresses anaerobic 1047
59
glycolysis in bovine theca cells. To our knowledge, this is the first report that demonstrated 1048
antagonistic effect of gossypol on glycolysis in theca cells. 1049
Gossypol inhibition of LDH activity was well documented in various organs and 1050
cells in various species; in the kidney and liver of mice (Lee et al. 1981), in the testis of 1051
rodents (Lee et al. 1981; Giridharan et al. 1982; Kim et al. 1985) and cattle (Oligati & 1052
Toscano 1983), in the spermatozoa of rabbits, monkeys, cattle and humans (Eliasson & 1053
Virji 1983; Ikeda 1990; Rovan et al. 1984; Stephens et al. 1983). Our results are in 1054
consistent with these reports. 1055
In the present study, however, we couldn’t demonstrate clear effect of gossypol on 1056
the gene expression of the key rate-limiting enzymes of anaerobic glycolysis except for 1057
PFKM. Although expression of PFKL and LDHA was tended to be slightly decreased, that 1058
of PFKP and LDHB was not affected and that of HK1, HK2 and PKM was even increased 1059
by gossypol. It is likely that gossypol affects glycolysis through directly inhibiting enzyme 1060
activity without affecting gene expression of the enzyme. 1061
Alternatively gossypol may suppress lactate production by inhibiting glucose 1062
uptake mediated by GLUT on the cellular membrane. Bovine theca cells were shown to 1063
express passive transporter GLUT1 and GLUT3 as well as insulin-dependent active 1064
transporter GLUT4 (Nishimoto et al. 2006). Gossypol was shown to disturb sperm energy 1065
metabolism by inhibiting glucose and fructose utilization (Wichmann et al. 1983). In the 1066
present study, however, we couldn’t measure glucose consumption by theca cells since the 1067
amount of glucose consumed was much less compared to total amount of glucose present in 1068
60
the culture medium (17.5 mM) to estimate glucose consumption by subtracting the amount 1069
of glucose remains in the spent medium from the initial amount of glucose present in the 1070
medium before the culture. A further study is necessary to elucidate effect of gossypol on 1071
glucose uptake by theca cells. 1072
Taken together, our results demonstrated that gossypol inhibits glucose 1073
metabolism somewhere along glucose uptake and the following anaerobic glycolysis 1074
leading lactate production. These results imply that the inhibitory effect of gossypol on 1075
theca cell steroidogenesis may be caused by suppression of glucose metabolism through 1076
anaerobic glycolysis. It was reported that development and steroidogenesis of cultured 1077
murine follicles was dependent on glucose concentration in the culture medium and glucose 1078
lower than 2 mM retarded follicular development (Boland et al. 1994b). To prove this 1079
hypothesis, however, a further study is necessary. 1080
1081
1082
1083
1084
1085
1086
1087
61
1088
Table 5.1 Oligonucleotide primers used for quantitative real-time PCR 1089
Gene (size: bp) Primer Sequence (5’-3’) GenBank No. Positiona
HK-1 (134) Sense tgggaaaaagagatcggtggaa AF542053 1641
Anti-Sense tgatgcccatgtagtccaggaa AF542053 1774
HK-2 (152) Sense gcctcacatctgctcgcctact XM_001255831 478
Anti-Sense gctccaagccctttctccatct XM_001255831 629
HK-3 (204) Sense ggcctggaagagctgaccatatc NM_001101929 815
Anti-Sense gagctggttgctggagacttct NM_001101929 1043
PFK-L (108) Sense acatgaccatcggcacagac XM_585495 473
Anti-Sense ccatcacctccagcacaaag XM_585495 580
PFK-M (85) Sense cgcatcaagcagtcagcag NM_001075268 1718
Anti-Sense agtagccgcccatcgtttcaat NM_001075268 1784
PFK-P (149) Sense cgcgtgttcatcatcgagac NM_001193220 1802
Anti-Sense ttctccgtcaggtgctcca NM_001193220 1950
PK-L (200) Sense cgtgtaccaccggcagctctt NM_001076176 1402
Anti-Sense gggtgacggcaatgactgttg NM_001076176 1601
PK-M (135) Sense cactgaagatcaccctggac XM_590109 580
Anti-Sense gcagagaaataagcccatca XM_590109 714
LDHA (144) Sense attggactgtcagtggccgatt NM_174099 754
Anti-Sense tccattctgtcccaagatgcaa NM_174099 897
LDHB (143) Sense ctgacgagcttgctcttgtgga NM_174100 137
Anti-Sense cacgatcttggaattggcagtg NM_174100 279
GAPDH (178) Sense gcgccaagagggtcatcatc NM_001034034 409
62
Anti-Sense agtccctccacgatgccaaa NM_001034034 586
Nucleotide position in the reported sequence. 1090
Table 5.2. Size and biochemical characteristics of small and large healthy follicles 1091
Follicular
category (n)
Size
(mm)
E2
(ng/mL)
P4
(ng/mL)
E2:P4 ratio
(ng/ng)
Glucose
(mg/dL)
Lactate
(mg/dL)
Lac:Glc ratio
(mol/mol)
Small follicle
<8.5 mm (5) 8.0 ± 0.2 a 15.8 ± 3.4 a 11.6 ± 1.8 a 1.34 ± 0.22 57.8 ± 4.1 a 83.7 ± 4.7 a 1.47 ± 0.08 a
Large follicle
≥8.5 mm (5) 14.3 ± 1.7 c 55.6 ± 10.8 c 24.5 ± 3.6 b 2.35 ± 0.45 75.5 ± 1.3 c 52.7 ± 8.1 b 0.93 ± 0.14 c
Values are expressed as mean ± SD. Values with different superscripts within each column 1092
and same follicle categories are significantly different (a,b; P<0.05: a,c; P<0.01). 1093
1094
1095
1096
1097
1098
1099
1100
1101
63
1102
1103
Figure 5.1 Gene expression of glycolytic enzymes HK1 (A), HK2 (B), PFKL (C), PFKM 1104
(D), PFKP (E), PKM (F), LDHA (G) and LDHB (H) in small growing follicles (SG) and 1105
64
dominant preovulatory follicles (ED). Follicles were selected following the criteria 1106
mentioned in the materials and methods. Data were expressed as mean ± SEM (n=5). 1107
1108
Figure 5.2 Effect of gossypol on the production of lactate in preovulatory bovine theca cells. 1109
Bovine theca cells were cultured without or with LH (1 ng/mL) and gossypol (0.2-25 1110
µg/mL) for 24h as mentioned in materials and methods. After the culture, culture media 1111
were collected and amount of lactate was determined. Results of a representative 1112
experiment out of three repeated trials were presented. Data were expressed as mean ± 1113
SEM (n=4). 1114
1115
1116
1117
1118
65
1119
1120
1121
1122
Figure 5.3 Effect of gossypol on the gene expression of HK1, HK2, PFKL, PFKM, PFKP, 1123
PKM, LDHA and LDHB in cultured bovine theca cells. Bovine theca cells were harvested 1124
from healthy preovulatory follicles and cultured without or with LH (1 ng/mL) and 1125
gossypol (0.2-25 µg/mL) for 24h as mentioned in the materials and methods. After the 1126
66
culture, theca cells were collected and mRNA was extracted. Levels of gene expression 1127
were quantified by a real-time PCR and normalized to the geometric means of three 1128
reference genes, TBP, RPL4 and HSPCB for HK1 (A), HK2 (B), PFKL (C), PFKM (D), 1129
PFKP (E), PKM (F), LDHA (G) and LDHB (H). Data were expressed as mean ± SEM of 1130
three repeated experiments. 1131
CHAPTER 6 1132
GENERAL DISCUSSION 1133
In the present study, we have conducted a series of experiments to elucidate the effect 1134
of gossypol on steroidogenesis and its inhibitory mechanism in cultured bovine theca cells. 1135
The main findings are as follows; 1) gossypol inhibits cultured bovine theca cells 1136
steroidogenesis not by affecting cell viability but by suppressing expression of genes 1137
encoding steroidogenic enzymes responsible for androgen production, 2) the mechanism of 1138
antisteroidogenic effect of gossypol is mainly exerted through inhibiting cAMP dependent 1139
signaling pathway at a step distal to cAMP production, 3) gossypol inhibits anaerobic 1140
glycolysis, a carbohydrate metabolism leading to lactate production, in bovine theca cell. 1141
Gossypol has been known to suppress gonadal functions in both male and female for 1142
decades. In animals fed cottonseed or cottonseed meal containing gossypol, various 1143
negative effects on reproductive function such as deterioration of spermatogenesis, 1144
disruption of testicular function, disturbance of estrus cycle, decrease conception rate and 1145
increase incidence of abortion have been reported (Lin et al. 1981; Donaldson et al. 1985; 1146
Pearce et al. 1986a, Lagerlöf & Tone 1985; Santos et al. 2003). This holds a serious threat 1147
67
to livestock industry that heavily dependent on cottonseed as a precious nutritional source 1148
especially in cotton glowing developing countries. 1149
The deleterious effects of gossypol on reproduction are likely to be at least partially 1150
caused by suppression of gonadal steroidogenesis. 1151
To date, several studies have been conducted to investigate effect of gossypol on 1152
steroidogenesis (i.e., P4 and E2) in cultured granulosa and luteal cells in various species 1153
including cattle (Basini et al. 2009; Gu et al. 1990a, b, 1991; Ohmura et al. 1996; Vranová 1154
et al. 1998; Wang et al. 1987). However, little has been done to elucidate effect of gossypol 1155
on theca cell function in any species. Theca cells play a vital role in E2 production in 1156
follicles through supplying androgen, the substrate for estrogen production. Theca cells are 1157
likely to be more readily affected by gossypol since well vascularized theca interna is more 1158
likely affected by blood-borne gossypol than avascular granulosa cells. In the present study, 1159
therefore, we conducted a series of experiments to elucidate effect of gossypol and its 1160
inhibitory mechanism in cultured bovine theca cells. 1161
Theca cells used in the present study were harvested from large preovulatory follicles in 1162
which both estrogen and androgen production are increased (Kruip & Dieleman 1985; 1163
Nishimoto et al. 2009; Tetsuka et al. 2010). Under the present culture condition, theca cells 1164
produced more A4 than P4 at Day 1 but A4 production was sharply decreased in the 1165
subsequent days to levels much lower than P4 production (Fig. 3.1). Preliminary study 1166
showed that although theca cells maintained ability to produce androgen at the response to 1167
LH stimulation, the A4 production level never exceeded that of P4. P4 production, on the 1168
68
contrary, increased sharply after Day 4 indicating luteinization occurred. Based on these 1169
results, we employed culture period of one day (Chapter 3 & 5) or less (6h: Chapter 4) for 1170
unluteinized model and 7 days for luteinized model (Chapter 3). 1171
In the chapter 3, it was demonstrated that gossypol inhibited LH-stimulated 1172
steroidogenesis in cultured bovine theca cells. Production of A4 appeared to be more 1173
sensitive to gossypol than that of P4 as A4 production was inhibited by gossypol at a level 1174
as low as 1 μg/mL whereas P4 production was inhibited at 25 μg/mL. Although the safe 1175
upper limit of plasma gossypol concentration in cattle was advocated as 4 μg/mL (Noftsger 1176
et al. 2000), the present results indicate that ovarian steroidogenesis might be suppressed at 1177
lower levels of gossypol. Taken together, these results implicate that gossypol suppresses 1178
follicular E2 production by suppressing thecal androgen production in cattle fed large 1179
amounts of cottonseed meal. 1180
The mechanism of antisteroidogenic property of gossypol appears to be exerted through 1181
various mechanisms. One of the mechanisms is cell cytotoxicity. Because of this property, 1182
gossypol has been attracted an attention as a possible anticancer drug (Gilbert et al. 1995; 1183
Jiang et al. 2004; Zhang et al. 2003). 1184
In our study, however, gossypol up to 25 μg/mL had no effect on cell viability. The 1185
results indicate that anti-steroidogenic effect of gossypol is not caused by cytotoxicity in 1186
bovine theca cells at least under the condition used (Chapter 3). 1187
69
Since the LH-stimulated expression of steroidogenic genes, StAR, CYP11A1, HSD3B 1188
and CYP17A1 were suppressed by gossypol at a dose as low as 0.2 μg/mL (Chapter 3), we 1189
investigated effect of gossypol on intracellular signaling pathways in cultured theca cells in 1190
the following chapter (Chapter 4). 1191
LH exerts its effect mainly via two intracellular signaling pathways, cAMP-dependent 1192
PKA signaling pathway and DAG/IP3-dependent PKC signaling pathway (Davis 1994). 1193
The present results indicate that inhibitory effect of gossypol is exerted through suppression 1194
of cAMP-dependent pathway in bovine theca cells, for gossypol inhibited LH-, forskolin- 1195
and dbcAMP-stimulated but not PMA-stimulated A4 production. Both LH- and forskolin-1196
stimulated cAMP production was not affected by gossypol also indicates that gossypol 1197
exerts its inhibitory effect somewhere after the cAMP production. Taken together, the 1198
results obtained in the Chapter 3 and 4 indicate that gossypol exerts its inhibitory effect on 1199
steroidogenesis at a step or steps distal to cAMP production, and suppresses gene 1200
expressions of StAR and down-stream steroidogenic enzymes responsible for androgen 1201
biosynthesis in cultured bovine theca cells. 1202
In the Chapter 5, we investigated effect of gossypol on anaerobic glycolysis, a main 1203
metabolic pathway in the ovarian follicle (Boland et al. 1993). 1204
Unlike in the case of steroid production, LH did not stimulate lactate production in 1205
cultured bovine theca cells. Nevertheless, gossypol dose-dependently suppressed lactate 1206
production, implying that the inhibitory effect of gossypol is cAMP-dependent signaling 1207
pathway independent. Bovine theca cell expresses genes encoding multiple isozymes and 1208
70
subunits of four key rate-limiting enzymes; HK1, HK2, PFKL, PFKM, PFKP, PKM, 1209
LDHA and LDHB. Unlike in the case of steroidogenic genes, the effect of gossypol on the 1210
expression of these genes was not clear. To clarify the effect of gossypol on carbohydrate 1211
metabolism, a further study is necessary. 1212
In conclusion, gossypol inhibits LH-stimulated androgen production in cultured bovine 1213
theca cells at doses comparable to that found in the plasma in cattle fed with large amount 1214
of cottonseed. The inhibitory effect of gossypol appears to be at least partially mediated 1215
through suppression of cAMP-dependent signaling pathway at a step or steps distal to 1216
cAMP formation, leading to decrease in the expression of genes encoding StAR, CYP11A1, 1217
HSD3B and CYP17A1. Gossypol appears to also suppress anaerobic glycolysis. The 1218
mechanism of this inhibition was not clarified in the present study but it is also likely to be 1219
responsible for the gossypol-induced decrease in thecal steroidogenesis, for decrease in 1220
glucose supply was reported to affect steroidogenesis in cultured murine follicles (Boland 1221
et al. 1994b). 1222
1223
1224
1225
1226
1227
1228
1229
1230
71
1231
1232
1233
1234
1235
1236
ACKNOWLEDGEMENTS 1237
This research was made possible from the support of Japanese Government 1238
(Monbukagakusho: MEXT). 1239
First I would like to offer a sincere thank you to my supervisor Dr. Masafumi 1240
Tetsuka, Professor, Division of Animal Production Science, Obihiro University of 1241
Agriculture and Veterinary Medicine for his guidance, encouragement and comments 1242
during my PhD program. I would also like to thank him for passing his vast experience and 1243
knowledge in all things reproductive. I would like to extend my thanks to my two co-1244
chairmen, Dr. Katsuya Kida and Dr. Ken Sawai. Without their support, it would have been 1245
impossible to achieve my goal. 1246
I would like to extend my special thanks to Union Minister, Minister of Ministry of 1247
Livestock, Fisheries and Rural Development, H.S. U Ohn Myint for the opportunity to 1248
perform this work in Japan. 1249
I wish to express my sincere appreciation to Professor Dr. Mar Mar Win, the Rector 1250
of University of Veterinary Sciences, Myanmar, for her kind supports for this study. I also 1251
would like to thank all my teachers and colleagues at the University of Veterinary Science, 1252
72
Yezin, Myanmar. Their willingness to share their scholarly experience thus made it 1253
possible for me to obtain this PhD degree. 1254
A dear thanks must also go to my laboratory mates, my country mates and 1255
international friends in Obihiro City for their sincere help and moral supports throughout 1256
my stay in Japan. 1257
Lastly but not the least, I wish to express my deepest love and gratitude to my 1258
family for their exceptional care, steadfast support, sacrifices and love. 1259
1260
1261
1262
1263
1264
1265
1266
1267
1268
1269
1270
1271
1272
1273
1274
1275
73
1276
1277
1278
1279
1280
1281
1282
REFERENCES 1283
Abou-Donia MB, Dieckert JW. 1974. Urinary and biliary excretion of 14C gossypol in 1284
swine. Journal of Nutrition 104, 754-760. 1285
Abou-Donia MB. 1976. Physiological effects and metabolism of gossypol. Residue 1286
Reviews 61, 125-160. 1287
Adams AL, Staples CR, Van Horn HH, Thatcher WW. 1998. Effects of gossypol from 1288
whole cottonseed on lactation and reproductive performance of dairy cows. 35th Florida 1289
Dairy Production Conference, Gainesville. 1290
Akingbemi BT, Aire TA, Oke BO. 1996. Infection with Trypanosoma brucei potentiates 1291
the antifertility effect of gossypol, especially in the protein-malnourished male rat. 1292
International Journal of Andrology 19, 179-189. 1293
Akinola OB, Dosunmu OO, Dini L, Ajayi S. 2006. Proteinaceous diet inhibits gossypol-1294
induced spermatotoxicity. European Journal of Histochemistry 50, 205-208. 1295
74
Akira A, Ohmura H, Uzumcu M, Araki T, Lin YC. 1994. Gossypol inhibits aromatase 1296
activity in cultured porcine granulosa cells. Theriogenology 41, 1489-1497. 1297
Alexander J, Benford D, Cockburn A, Cravedi JP, Dogliotti E, Domenico AD, Férnandez 1298
ML, Fürst P, Gremmels JF, Galli CL, Grandjean P, Gzyl J, Heinemeyer G, Johansson 1299
N, Mutti A, Schlatter J, Leeuwen RV, Peteghem CV, Verger P. 2008. Gossypol as 1300
undesirable substance in animal feed. The EFSA Journal 908, 1–55. 1301
Arshami J, Ruttle JL. 1988. Effects of diets containing gossypol on spermatogenic tissues 1302
of young bulls. Theriogenology 30, 507–516. 1303
Barraza ML, Coppock CE, Brooks KN, Wilks DL, Saunders RG, Latimer GW Jr. 1991. 1304
Iron sulfate and feed pelleting to detoxify free gossypol in cottonseed diets for dairy 1305
cattle. Journal of Dairy Science 74, 3457–3467. 1306
Basini G, Bussolati S, Baioni L, Grasselli F. 2009. Gossypol, a polyphenolic aldehyde from 1307
cotton plant, interferes with swine granulosa cell function. Domestic Animal 1308
Endocrinology 37, 30-36. 1309
Berardi LC, Goldblatt LA. 1969. Gossypol. In: Liener I (ed.) Toxic constituents of plant 1310
foodstuffs. Academic Press, New York, 183-237. 1311
Boland NI, Humpherson PG, Leese HJ, Gosden RG. 1994a. Characterization of follicular 1312
energy metabolism. Human Reproduction 9, 604–609. 1313
75
Boland NI, Humpherson PG, Leese HJ, Gosden RG. 1994b. The effect of glucose 1314
metabolism on murine follicle development and steroidogenesis in vitro. Human 1315
Reproduction 9, 617-623. 1316
Boland, N.I., P.G. Humpherson, H.J. Leese, and R.G. Gosden, 1993. Pattern of lactate 1317
production and Steroidogenesis during growth and maturation of mouse ovarian 1318
follicles in vitro. Biology of Reproduction 48, 798-806. 1319
Breitbart H, Mayevsky A, Nass-Arden L. 1989. Molecular mechanisms of gossypol action 1320
on sperm motility. International Journal of Biochemistry 21, 1097–1102. 1321
Breitbart H, Rubinstein S, Nass-Arden L. 1984. Effect of gossypol-acetic acid on calcium 1322
transport and ATPase activity in plasma membranes from ram and bull spermatozoa. 1323
International Journal of Andrology 7, 439–447. 1324
Breitenecker G, Friedrich F, Kemeter P. 1978. Further investigations on the maturation and 1325
degeneration of human ovarian follicles and their oocytes. Fertility and Sterility 29, 1326
336-341. 1327
Brocas C, Rivera RM, Paula-Lopes FF, McDowell LR, Calhoun MC, Staples 1328
CR, Wilkinson NS, Boning AJ, Chenoweth PJ, Hansen PJ. 1997. Deleterious actions of 1329
gossypol on bovine spermatozoa, oocytes, and embryos. Biology of Reproduction 57, 1330
901-907. 1331
76
Burgos de NM, Burgos C, Montamat EE, Moreno J, Blanco A. 1978. A shuttle system for 1332
the transfer of reducing equivalents in mouse sperm mitochondria. Biochemical and 1333
Biophysical Research Communications 81, 644-649. 1334
Calhoun MC, Kuhlmann SW, Baldwin BC Jr. 1995. Cotton feed product composition and 1335
gossypol availability and toxicity. In Proc. National Invitational Symposium on 1336
Alternative Feeds for Dairy and Beef Cattle, St. Louis, MO, 125-145. 1337
Chang JS, Hsu YL, Kuo PL, Chiang LC, Lin CC. 2004. Upregulation of Fas/Fas ligand-1338
mediated apoptosis by gossypol in an immortalized human alveolar lung cancer cell line. 1339
Clinical and Experimental Pharmacology and Physiology 31, 716-722. 1340
Chen QQ, Chen H, Lei HP. 1987. Comparative study on the metabolism of optical 1341
gossypol in rats. Journal of Ethnopharmacology 20, 31–37. 1342
Chenoweth PJ, Chase CC Jr, Risco CA, Larsen RE. 2000. Characterization of gossypol-1343
induced sperm abnormalities in bulls. Theriogenology 53, 1193–1203. 1344
Chin EC, Abayasekara D R E. 2004. Progesterone secretion by luteinizing human 1345
granulosa cells: a possible cAMP-dependent but PKA-independent mechanism 1346
involved in its regulation. Journal of Endocrinology 183, 51-60. 1347
Chomczynski P, Sacchi N. 1987. Single step method of RNA isolation by acid guanidinium 1348
thiocyanate phenol chloroform extraction. Analytical Biochemistry 162, 156–159. 1349
Coppock CE, West JW, Moya JR, Nave DH, LaBore JM. 1985. Effects of 1350
77
amount of whole cottonseed on intake, digestibility, and physiological responses 1351
of dairy cows. Journal of Dairy Science 68, 2248-2258. 1352
Coutinho EM, Athayde C, Atta G, Gu ZP, Chen ZW, Sang GW, Emuveyan E, Adekunle 1353
AO, Mati J, Otubu J, Reidenberg MM, Segal SJ. 2000. Gossypol blood levels and 1354
inhibition of spermatogenesis in men taking gossypol as a contraceptive. A multicenter, 1355
international, dose-finding study. Contraception 61, 61-67. 1356
Coutinho EM. 2002. Gossypol: a contraceptive for men. Contraception 65, 259-63. 1357
Davis JS. 1994. Mechanisms of hormone action: luteinizing hormone receptors and 1358
secondmessenger pathways. Current Opinion in Obstetrics and Gynecology 6, 254-261. 1359
Dodou K. 2005. Investigations of gossypol – past and present developments. Expert 1360
Opinion on Investigational Drugs 14, 1419-1434. 1361
Donalson A, Sufi SB, Jeffcoate SL. 1985. Inhibition by gossypol of testosterone production 1362
by mouse leydig cells in vitro. Contraception 31, 165-171. 1363
Eliasson R, Virji. 1983. Effects of gossypol acetic acid on the activity of LDH-C4 from 1364
human and rabbit spermatozoa. International Journal of Andrology 6, 109-112. 1365
Ewing WN. 1997. The Feeds Directory. Context Publications, Ashby de la Zouch, 1366
Leicestershire, UK. 1367
Fortune JE. 1986. Bovine theca and granulosa cells interact to promote androgen 1368
production. Biology of Reproduction 35, 292-299. 1369
78
Gadelha IC, de Macedo MF, Oloris SC, Melo MM, Soto-Blanco B. 2014. Gossypol 1370
promotes degeneration of ovarian follicles in rats. The Scientific World Journal, doi: 1371
10.1155/2014/986184 . 1372
Gilbert NE, O’Reilly JE, Chang CJ, Lin YC, Brueggemeier RW. 1995. Antiproliferative 1373
activity of gossypol and gossypolone on human breast cancer cells. Life Sciences 57, 1374
61-67. 1375
Giridharan N, Mahtab S. Bamji, A.V.B. 1982. SankaramInhibition of rat testis LDH-X 1376
activity by gossypol. Contraception 26, 607-615. 1377
Gray ML, Greene LW, Williams GL. 1993. Effects of dietary gossypol consumption on 1378
metabolic homeostasis and reproductive endocrine function in beef heifers and cows. 1379
Journal of Animal Science 71, 3052-3059. 1380
Gu Y, Chang CJG, Rikihisa Y, Lin YC. 1990 a. Inhibitory effect of gossypol on human 1381
chorionic gonadotropin (hCG) induced progesterone secretion in cultured bovine luteal 1382
cells. Life Sciences 47,407-414. 1383
Gu Y, Lin YC, Rikihisa Y, Brueggemeier RW. 1991. Gossypolone suppresses progesterone 1384
synthesis in bovine luteal cells. The Journal of Steroid Biochemistry and Molecular 1385
Biology 38, 709-715. 1386
Gu Y, Lin YC, Rikihisa Y. 1990 b. Inhibitory effects of gossypol on steroidogenic 1387
pathways in cultured bovine luteal cells. Biochemical and Biophysical Research 1388
Communications 169, 455-461. 1389
79
Haschek WM, Beasley VR, Buck WB, Finnell JH. 1989. Cottonseed meal (gossypol) 1390
toxicosis in a swine herd. Journal of the American Veterinary Medical Association 195, 1391
613-615. 1392
Hernández-Cerón J, Jousan FD, Soto P, Hansen PJ. 2005. Timing of inhibitory actions of 1393
gossypol on cultured bovine embryos. Journal of Dairy Science 88, 922–928. 1394
Hoffer AR. 1982. Ultrastructural studies of spermatozoa and the epithelial lining of the 1395
epididymis and vas deferens in rats treated with gossypol. Archives of Andrology 8, 1396
233-246. 1397
Hu YF, Chang CJ, Brueggemeier RW, Lin YC. 1993. Gossypol inhibits basal and estrogen-1398
stimulated DNA synthesis in human breast carcinoma cells. Life Sciences 53, 433–438. 1399
Ikeda M. 1990. Inhibition kinetics of NAD-linked enzymes by gossypol acetic acid. 1400
Andrologia 22, 409-416. 1401
Jarvis WD, Turner AJ, Povirk LF, Traylor RS, Grant S. 1994. Induction of apoptotic DNA 1402
fragmentation and cell death in HL-60 human promyelocytic leukemia cells by 1403
pharmacological inhibitors of protein kinase C. Cancer Research 54, 1707–1714. 1404
Jiang J, Sugimoto Y, Liu S, Chang HL, Park KY, Kulp SK, Lin YC. 2004. The inhibitory 1405
effects of gossypol on human prostate cancer cells-PC3 are associated with 1406
transforming growth factor beta1 (TGFbeta1) signal transduction pathway. Anticancer 1407
Research 24: 91-100. 1408
80
Jo Y, King SR, Khan SA & Stocco DM. 2005. Involvement of protein kinase C and cyclic 1409
adenosine 3',5'-monophosphate-dependent kinase in steroidogenic acute regulatory 1410
protein expression and steroid biosynthesis in Leydig cells. Biology of Reproduction 73, 1411
244-255. 1412
Kaminski T. 2004. The response of phospholipase C/protein kinase C and adenylyl 1413
cyclase/protein kinase A pathways in porcine theca interna cells to opioid agonist FK 1414
33-824. Domestic animal endocrinology 27, 379-396. 1415
Ke YB and Tso WW. 1982. Variations of gossypol susceptibility in rat spermatozoa during 1416
spermatogenesis. International Journal of Fertility 27, 42-46. 1417
Kim IC, Waller DP, Fong HH. 1985. Inhibition of LDH-X by gossypol optical isomers. 1418
Journal of Andrology 6, 344-347. 1419
Kolena J, S Vrsanská, E Nagyová, M Jezová. 2001. Gossypol inhibits follicle stimulating 1420
hormone and epidermal growth factor-stimulated expansion of oocyte-cumulus 1421
complex from porcine preovulatory follicles. Physiological Research 50, 627-630. 1422
Kruip TA, Dieleman SJ. 1985. Steroid hormone concentrations in the fluid of bovine 1423
follicles relative to size, quality and stage of the oestrus cycle. Theriogenology 24, 395-1424
408. 1425
Lagerlöf RK, Tone JM. 1985. The effect of gossypol acetic acid on female reproduction. 1426
Drug and Chemical Toxicology 8, 469-482. 1427
81
Lee CY, Mailing HY. 1981. Selective inhibition of sperm specific lactate dehydrogenase X 1428
by an antifertility agent, gossypol. Federation Proceedings 40, 718-723. 1429
Lee CYG, Moon YS, Yuan JFI, Chen AF. 1982. Enzyme inactivation and inhibition by 1430
gossypol. Molecular and Cellular Biochemistry 47, 65-70 1431
Li SS. 1990. Human and mouse lactate dehydrogenase genes A (muscle), B (heart), and C 1432
(testis): protein structure, genomic organization, regulation of expression, and 1433
molecular evolution. Progress in Clinical and Biological Research 344, 75-99. 1434
Li YF, Booth GM, Seegmiller RE. 1989. Evidence for embryotoxicity of gossypol in mice 1435
and chicks with no evidence of mutagenic activity in the Ames test. Reproductive 1436
Toxicology 3, 59–62. 1437
Li XB, Gu JD, Zhou QH. 2015. Review of aerobic glycolysis and its key enzymes – new 1438
targets for lung cancer therapy. Thoracic Cancer 6, 17–24. 1439
Lin T, Murono EP, Osterman J, Narkin HR, Coulson PD. 1981. Gossypol inhibits testicular 1440
steroidogenesis. Fertility and Sterility 35, 563-566. 1441
Lin YC, Coskun S, Sanbuissho A. 1994. Effects of gossypol on in vitro bovine oocyte and 1442
steroidogenesis in bovine granulosa cells. Theriogenology 41, 1601-1611. 1443
Lin YC, Fukaya T, Rikihisa Y, Walton A. 1985. Gossypol in female fertility control: ovum 1444
implantation and early pregnancy inhibited in rats. Life Sciences 37, 39-47. 1445
82
Lin YC, Nuber DC, Gu Y, Cutler G, Hinchcliff KW, Haibel G. 1991. Gossypol 1446
pharmacokinetics in mid-lactation Brown Swiss dairy cows. Veterinary Research 1447
Communications 15, 379-385. 1448
Lindsey TO, Hawkins GE, Guthrie LD. 1980. Physiological responses of lactating cows to 1449
gossypol from cottonseed meal rations. Journal of Dairy Science 63, 562-573. 1450
Liu GZ 1985. Clinical trial of gossypol as a male contraceptive: a randomized controlled 1451
study. Zhonghua Yi. Xue. Za Zhi. 65, 107-109. 1452
Lonsdale CR. 1989. Straights: Raw Materials for Animal Feed Compounders and Farmers. 1453
Chalcombe Publications, Marlow, Buckinghamshire, UK. 1454
Manna PR and Stocco DM. 2005. Regulation of the steroidogenic acute regulatory protein 1455
expression: functional and physiological consequences. Current Drug Targets-Immune 1456
Endocrine Metabolic Disorder 5, 93-108. 1457
Matsuzawa T, Takikawa H. 1968. The alteration of isozymic patterns in lactate 1458
dehydrogenase during artificial maturation of rat ovary. Endocrinologia japonica 15, 1459
291-297. 1460
Murasawa M, Takahashi T, Nishimoto H, Yamamoto S, Hamano S, Tetsuka M. 2005. 1461
Relationship between ovarian weight and follicular population in heifers. Journal of 1462
Reproduction and Development 51, 689-693. 1463
83
Needle E, Piparo K, Cole D, Worrall C, Whitehead I, Mahon G, Goldsmith LT. 2007. 1464
Protein Kinase A-independent cAMP stimulation of progesterone in a luteal cell model 1465
is tyrosine kinase dependent but phosphatidylinositol-3-kinase and mitogen-motivated 1466
protein kinase independent. Biology of reproduction 77, 147-155. 1467
Nishimoto H, Hamano S, Hill GA, Miyamoto A, Tetsuka M. 2009. Classification of bovine 1468
follicles based on the concentrations of steroids, glucose and lactate in follicular fluid 1469
and the status of accompanying follicles. Journal of Reproduction and Development 55, 1470
219–224. 1471
Nishimoto H, Matsutani R, Yamamoto S, Takahashi T, Hayashi KG, Miyamoto A, 1472
Hamano S, Tetsuka M. 2006. Gene expression of glucose transporter (GLUT) 1, 3 and 1473
4 in bovine follicle and corpus luteum. Journal of Endocrinology 188, 111-119. 1474
Noftsger SM, Hopkins BA, Diaz DE, Brownie C, Whitlow W. 2000. Effect of whole and 1475
expanded-expelled cottonseed. Journal of Dairy Science 83, 2539-2547. 1476
Ohmura H. 1996. Suppressive effect of Gossypol, Gossypolone and serum from Gossypol 1477
treated rats on steroidogenesis in cultured porcine granulosa cells. Nippon Ika Daigaku 1478
Zasshi 63, 181-189. 1479
Oko R and Hrudka F. 1982. Segmentai aplasia of the mitochondrial sheath and sequelae 1480
induced by gossypol in rat spermatozoa. Biology of Reproduction 26, 183-195. 1481
Olgiati KL, Toscano DG, Atkins WM, JR. 1984. Gossypol inhibition of adenylate 1482
cyclase. Archives Biochemistry Biophysics 231, 411-415. 1483
84
Olgiati KL, Toscano WAJr. 1983. Kinetics of gossypol inhibition of bovine lactate 1484
dehydrogenase X. Biochemical and Biophysical Research Communications 115, 1485
180-185. 1486
Pearce S, Sufi SB, Donaldson A, Jeffcoate SL. 1985. The viability of mouse Leydig cells in 1487
vitro following incubation with gossypol. Contraception 32, 275-81. 1488
Pearce S, Sufi SB, O'Shaughnessy PJ, Donaldson A, Jeffcoate SL. 1986a. Site of gossypol 1489
inhibition of steroidogenesis in purified mouse Leydig cells. Journal of Steroid 1490
Biochemistry 25, 683-687. 1491
Pearce S, Sufi SB, O'Shaughnessy PJ, Donaldson A, Jeffcoate SL. 1986b. Inhibition by 1492
gossypol of cyclic AMP production in mouse leydig cells. Contraception 34, 639-46. 1493
Pons WA Jr, Hoffpauir CL, Hopper TH. 1953. Gossypol in cottonseed: influence of variety 1494
of cottonseed and environment. Journal of Agricultural and Food Chemistry 18, 1115–1495
1118. 1496
Qiu J, Levin LR, Buck J, Reidenberg MM. 2002. Different pathways of cell killing by 1497
gossypol enantiomers. Experimental Biology and Medicine 227, 398-401. 1498
Rabiee AR, Lean IJ, Gooden JM, Miller BG, Scaramuzzi RJ. 1997. An evaluation of 1499
transovarian uptake of metabolites using arterio-venous difference methods in dairy 1500
cattle. Animal Reproduction Science 48, 9-25. 1501
85
Randel RD, Chase CC, Wyse SJ. 1992. Effects of gossypol and cotton seed products on 1502
reproduction of mammals. Journal of Animal Science 70, 1628-1638. 1503
Reiser R, Fu HC. 1962. The mechanism of gossypol detoxification by ruminant animals. 1504
Journal of Nutrition 76, 215-218. 1505
Risco CA, Chenoweth PJ, Larson RE, Velez L, Shaw N, Tran T, Chase CC Jr. 1993. The 1506
effect of gossypol in cottonseed meal on performance and on hematological and semen 1507
traits in postpubertal brahman heifers. Theriogenology 40, 629-642. 1508
Robinson PH, Getachew G, DePeters EJ, Calhoun MC. 2001. Influence of variety and 1509
storage up to 22 days on nutrient composition and gossypol level of Pima cottonseed 1510
(Gossypium spp.). Animal Feed Science and Technology 91, 149-156. 1511
Rovan E, N. R. Kalla , J. Frick and H. Adam . 1984. Effect of Gossypol on Bull 1512
Spermatozoa in Vitro. Urological Research 12, 187-192. 1513
Santos JEP, Villasenor M, Robinson PH, DePeters EJ, Holmberg CA. 2003. Type of cotton 1514
seed and level of gossypol in diets of lactating dairy cows: Plasma gossypol, Health and 1515
reproductive performance. Journal of Diary Science 86, 892-905. 1516
Schneider IC, Ames ML, Rasmussen MA, Reilly PJ. 2002. Fermentation of cottonseed and 1517
other feedstuffs in cattle rumen fluid. Journal of Agricultural and Food Chemistry 50, 1518
2267–2273. 1519
86
Shelley MD, Hartley L, Groundwater PW, Fish RG. 2000. Structure–activity studies on 1520
gossypol in tumor cell lines. Anticancer Drugs 11, 209–16. 1521
Stephens DT, Critchlow LM, Hoskins DD. Metabolism of inhibition by gossypol of 1522
glycolysis and motility of monket spermatozoa in vitro. 1983. Journal of 1523
Reproduction and Fertility 69, 447-452. 1524
Stephens SG. 1958. Factors affecting seed dispersal in gossypium and their responsible 1525
evolutionary significance. North Carolina Agriculture Experiment Station 131, 32. 1526
Stocco DM & Clark BJ. 1996. Regulation of the acute production of steroids in 1527
steroidogenic cells. Endocrine Reviews 17, 221-244. 1528
Sufi SB, Donaldson A, Jeffcoate SL, Matlin SA, Zhou RH. 1985. Inhibition by (+) and (-) 1529
isomers of gossypol of testosterone release from mouse Leydig cells in vitro. 1530
Contraception 31, 159-64. 1531
Taha TA, Shaaban WF, El-Mahdy AR, El-Nouty FD, Salem MH. 2006. Reproductive 1532
toxicological effects of gossypol on male rabbits: semen characteristics and hormonal 1533
levels. Animal Science 82, 259-269. 1534
Teng CS. 1995. Gossypol-induced apoptotic DNA fragmentation correlates with inhibited 1535
protein kinase C activity in spermatocytes. Contraception 52, 389-395. 1536
Teng C. S. 1997. Reversible changes in the content of cellular and microtubular tubulin in 1537
spermatogenic cells after gossypol treatment. Contraception 55, 41–46. 1538
87
Tetsuka M, Nishimoto H, Miyamoto A, Okuda K, Hamano S. 2010. Gene Expression of 1539
11β-HSD and Glucocorticoid Receptor in the Bovine (Bos taurus) Follicle During 1540
Follicular Maturation and Atresia: The Role of Follicular Stimulating Hormone. 1541
Journal of Reproduction and Development 56, 616-622. 1542
Tilly JL and Johnson AL. 1988. Attenuation of hen granulosa cell steroidogenesis by a 1543
phorbol ester and 1-Oleoyl-2-Acetylglycerol. Biology of reproduction 39, l-8. 1544
Tilly JL and Johnson AL. 1989. Regulation of androstenedione production by adenosine 1545
3',5'-monophosphate and phorbol myristate acetate in ovarian thecal cells of the 1546
domestic hen. Endocrinology 125, 1691-1699. 1547
Timurkaan N, Yilmaz F, Timurkaan S. 2011. Effects of cottonseed flour on 1548
immunohistochemical localization of androgen receptors (AR) in rat testes. Revue de 1549
Médecine Vétérinaire 162, 13–17. 1550
Ueno H, Sahni MK, Segal SJ, Koide SS. 1988. Interaction of gossypol with sperm 1551
macromolecules and enzymes. Contraception 37, 333–341. doi:10.1016/0010-1552
7824(88)90033-9. 1553
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. 1554
2002. Accurate normalization of real-time quantitative RT-PCR data by geometric 1555
averaging of multiple internal control genes. Genome Biology 18, Research0034. 1556
Velasquez-Pereira J, Risco CA, McDowell LR, Staples CR, Prichard D, Chenoweth PJ, 1557
Martin FG, Williams SN, Rojas LX, Calhoun MC and Wilkinson NS. 1999. Long-term 1558
88
effects of feeding gossypol and vitamin E to dairy calves. Journal of dairy Science 82, 1559
1240-1251. 1560
Villaseñor M, Coscioni AC, Galvão KN, Chebel RC, Santos JEP. 2008. Gossypol disrupts 1561
embryo development in heifers. Journal of Dairy Science 91, 3015–3024. 1562
Vranová J, Ježová M, Scsuková S. 1999. Inhibitory effect of gossypol on basal and 1563
luteinization factor-stimulated progesterone synthesis in porcine granulosa cells. 1564
Physiological Research 48,119-128. 1565
Wang NG, Guan MH, Lei HP. 1987a. Effects of gossypol on rat luteal cells in vitro. 1566
Journal of Ethnopharmacology 20, 45-51. 1567
Wang NG, Zhou LF, Guan MH, Lei HP. 1987b. Effect of (-)- and (+)-gossypol on fertility 1568
in male rats. Journal of Ethnopharmacology 20, 45-51. 1569
Wichmann K, Kapyaho K, Sinervirta R, Janne J. 1983. Effect of gossypol on the motility 1570
and metabolism of human spermatozoa. Journal of Reproduction and Fertility 69, 259-1571
264. 1572
Wilson JE. 2003. Isozymes of mammalian hexokinase: structure, subcellular localization 1573
and metabolic function. Journal of Experimental Biology 206, 2049-2057. 1574
Wheat TE, Goldberg E. 1983. Sperm-specific lactate dehydrogenase C4: antigenic structure 1575
and immunosuppression of fertility. Isoenzymes Current Topics in Biological and 1576
Medical Research 7, 113-130. 1577
89
Wu D. 1989. An overview of the clinical pharmacology and therapeutic potential of 1578
gossypol as a male contraceptive agent in gynaecological disease. Drugs 38, 333-341. 1579
Xiao DM, Zhou WH, Zhang YH, Wang XL, Zhu B, Zhang JB, Yang GD, Chen HC. 1993. 1580
Comparison between the effects of (-) and (+) gossypol on protein kinase C and protein 1581
kinase A. Yao Xue Xue Bao 28, 494-498. 1582
Zhang M, He Z, Yuan H, Wen L. 2011. DNA damage and decrease of cellular oxidase 1583
activity in piglet sertoli cells exposed to gossypol. African Journal of Biotechnology 10, 1584
2797–2802. 1585
Zhang M, Liu H, Guo R, Ling Y, Wu X, Li B, Roller PP, Wang S, Yang D. 2003. 1586
Molecular mechanism of gossypol-induced cell growth inhibition and cell death of HT-1587
29 human colon carcinoma cells. Biochemical Pharmacology 66, 93-103. 1588
Zirkle SM, Lin YC, Gwazdauskas FC, Canseco RS. 1988. Effect of gossypol on bovine 1589
embryo development during the preimplantation period. Theriogenology 30,575-582. 1590
1591