Etroplus Suratansis Cell Line

REPORT

Development and characterization of a new epithelialcell line PSF from caudal fin of Green chromide,Etroplus suratensis (Bloch, 1790)

T. Raja Swaminathan & Wazir S. Lakra &

A. Gopalakrishnan & V. S. Basheer & B. Khushwaha &

K. A. Sajeela

Received: 23 February 2010 /Accepted: 26 May 2010 / Editor: J. Denry Sato# The Society for In Vitro Biology 2010

Abstract A new cell line [pearlspot fin (PSF)] has beendeveloped from caudal fin of Etroplus suratensis, abrackish/freshwater fish cultivated in India. The cell linewas maintained in Leibovitz’s L-15 supplemented with10% fetal bovine serum (FBS). The PSF cell line consistedpredominantly of epithelial-like cells. The cells were able togrow at temperatures between 25°C and 32°C withoptimum temperature of 28°C. The growth rate of PSFcells increased as the FBS proportion increased from 2% to20% at 28°C with optimum growth at the concentration of10% FBS. One marine fish virus (fish nodavirus) was testedon this cell line and found not susceptible. After conflu-ency, the cells were subcultured with a split ratio of 1:2.The cells showed epithelial-like morphology and reachedconfluency on the third d after subculture. Polymerasechain reaction amplification of mitochondrial 16S rRNAand COI indicated identity of this cell line with thosereported from this fish species, confirming that the cell linewas of pearlspot origin. The cells were successfullycryopreserved and revived at the tenth, 25th, and 35thpassages. The bacterial extracellular products from Vibriocholerae MTCC 3904 were found to be toxic to PSF.Karyotyping analysis indicated that the modal chromosomenumber was 48.

Keywords Green chromide . Pearlspot . Etroplussuratensis . PSF cell line

A number of potential fish species have been prioritized todiversify the aquaculture production in India. One of thecandidate fish species for aquaculture both in brackish andfresh water in India is Etroplus suratensis (popularly knownas “pearlspot” or “karimeen” in India; Vijayaraghavan et al.1981). It is widely distributed in almost all the backwatersand freshwaters, along the coastal tracts from South Canarato Trivandrum on the west coast and later introduced todifferent water bodies along the east coast of India such asChilka Lake. It is a high-value table fish endemic toPeninsular India and Sri Lanka and is available throughoutthe year (Jhingran and Natarajan 1973). This is perhaps thefirst Indian food fish that has been transplanted to a foreigncountry (Hornell 1923). Captive breeding of E. suratensisfor production of seeds was developed in India (Bindu2006). Simultaneously, cage culture of the species in lowvolume and high density, developed by Padmakumar et al.2004) was well received in different regions of India, andmore areas are practicing cage-farming of pearlspot. Thismay lead to outbreak of infectious diseases caused bypathogens such as bacteria, virus, etc.

Cell lines from fish are particularly useful in detectingviruses (Fryer and Lannan 1994) and in studying themolecular and cellular basis of physiological processes andtoxicological mechanisms (Bols et al. 2001). In recentyears, cell lines from aquatic animals have attractedconsiderable attention as a means of expediting diseasediagnosis. Fish viruses are host-specific that makes a cellline derived from a particular fish species more appropriatefor investigating the viruses isolated from that fish. Species-specific cell lines could also be important tools for studyingtoxicology, carcinogenesis, gene regulation, and expression

T. R. Swaminathan (*) :A. Gopalakrishnan :V. S. Basheer :K. A. SajeelaNational Bureau of Fish Genetic Resources Cochin Unit,CMFRI Campus, P.O. Number 1603,Kochi, India 682018e-mail: [email protected]

W. S. Lakra : B. KhushwahaNational Bureau of Fish Genetic Resources,Canal Ring Road, P.O. Dilkusha,Lucknow, India 226002

In Vitro Cell.Dev.Biol.—AnimalDOI 10.1007/s11626-010-9326-y

in fish (Wise et al. 2002). In India, continuous cell lines frommrigal Cirrhinus mrigala (Hamilton; Sathe et al. 1995) androhu Labeo rohita (Hamilton; Sathe et al. 1997), barramundiLates calcarifer (Bloch; Lakra et al. 2006b; Sahul Hameed etal. 2006), barramundi (Parameswaran et al. 2006a, b), eyemuscle (Ahmed et al. 2008), heart (Ahmed et al. 2009b),brain (Ahmed et al. 2009a) of catla and eye of rohu (Ahmedet al. 2009a) have been established.

It is extremely important to establish a continuous cell linefor monitoring the viral diseases of fishes and for vaccineproduction against viral pathogens. In India, detailed studieson viral infections of pearlspot have not been carried outowing to lack of species-specific cell lines. Thus, a cell linein pearlspot was urgently required for isolating and identi-fying viruses causing diseases in this species. In thisbackdrop, we attempted to establish cell lines from differenttissues like fin, heart, kidney, and ovary of pearlspot.

Healthy juveniles of pearlspot with an approximate bodyweight of 15–100 g were obtained from the RegionalResearch Station, Kerala Agricultural University, Puduvype,Kochi, Kerala, India, transported live to the laboratory andacclimatized for a wk in water containing 500 IU/ml ofpenicillin and 500 μg/ml of streptomycin at room tempera-ture (25–30°C). The fish were anesthetized in ice-cold water,immersed in 5% chlorex for 5 min and wiped with 70%ethanol, and operated in vivo. A total number of 72 explantsincluding 20 heart, seven kidney, five ovary, and 40 caudalfin tissues were taken aseptically, minced into small pieces(approximately 1 mm3 in size), and washed three times inphosphate-buffered saline (PBS) containing antibiotics(500 IU/ml penicillin, 500 μg/ml streptomycin, and2.5 μg/ml Fungizone). The tissue fragments were inoculatedinto 25-cm2 cell culture flasks containing 5 ml of completegrowth medium (L-15 supplemented with 20% fetal bovineserum (FBS) and antibiotics (penicillin, 100 IU/ml andstreptomycin, 100 μg/ml) and Fungizone (2.5 μg/ml). Theflasks were incubated at 28°C in a normal atmosphereincubator and half of the medium was changed every 4 or5 d. Nikon TE2000-S (Nikon Corporation, Tokyo, Japan)equipped with phase optics was used to observe andphotograph living cell cultures every 2–3 d for primary cellcultures and subcultures.

After monolayers were obtained, each cell line wasexamined to ensure that it was free of microbial contam-ination. The morphology of the cells was normal, and thecultures were confluent. The spent medium was removed toa new flask and combined with the same volume of freshmedium to make a conditioned medium. The cells werewashed with calcium- and magnesium-free PBS threetimes. Each culture was examined under an invertedmicroscope (Nikon TE2000-S) to ensure that cells werereleased from the flask surface. Upon reaching 95%confluence, the cells were subcultured at a ratio of 1:2

following the standard trypsinization method using trypsin–EDTA solution (trypsin 0.25%, EDTA 0.02%) in phosphate-buffered saline. Finally, 5 ml of the pearlspot fin (PSF) cellsuspension was transferred to a new flask and incubated at28°C. The cells were confluent within 5–7 d. The subculturesgrew in fresh complete medium (15% FBS). After standard-ization of the FBS and temperature requirements, theconcentration of FBS was reduced to 10%.

The optimal growing conditions for the PSF cell linewere obtained by determining temperature and FBSconcentration preferences. Temperature preference wasdetermined by plating PSF cells at a density of 5.0×104

cells per well in 12-well plates with 1 ml growing medium.Cells were plated in normal growth medium as describedabove. The cells were incubated at 28°C for 24 h to allowthe cells to attach, after which the cultures were moved todifferent temperatures: 18°C, 22°C, 26°C, 28°C, 32°C, and38°C. Temperature experiments were performed usingnormal growing medium supplemented with 20% FBS.After 5 d, cells were trypsinized and then counted micro-scopically with a hemocytometer. Optimal growing serumconcentrations were determined using a similar experimentaldesign. After an incubation at 28°C for 24 h for allowing thecells to attach, the growing medium was removed, and 1 mlnew medium containing varying concentrations of FBS wasadded (5%, 7.5%, 10%, 15%, and 20% FBS). There werethree replicates for each FBS concentration. The cells,incubated at 28°C, were collected by trypsinization at 3-dintervals and counted using a hemocytometer.

The comparative effect of FBS and newborn calf serum(NBCS) on the growth of the PSF cells at 30th passage wasstudied by using FBS, NBCS, and equal mixture of FBAand NBCS in L-15 medium at varying concentrations(5%,10%, and 15%). The seeding amount of cells was 1×105 per milliliters and incubated at 28°C. The formation ofmonolayer of the cells and health status of the cells wereexamined daily. After 10 d, cells were trypsinized and thencounted microscopically with a hemocytometer.

Standard procedures with some variations were used forthe chromosome analysis (Freshney 2005). Briefly, cellsundergoing exponential growth were treated with 1 μg/mlcolcemid (GIBCO, Grand Island, NY, USA) for 6 to 12 h.The monolayer was trypsinized and pelleted as describedabove. The cells were then suspended in 5 ml of ahypotonic medium (0.075 M KCl) for 30 min and allowedto settle. To this, four volumes of fixative (3:1, methanol toglacial acetic acid) were added. After 10 to 20 min, the cellswere suspended in fresh fixative and centrifuged at1,500 rpm for 15 min. The above step was repeated twice,after which the cells were resuspended in a small volume(0.5 ml or less) of fixative. Clean slides were dipped in ice-cold 40% methanol. A drop of cell suspension wasimmediately added to one end of the slide. The cells were

T.R. SWAMINATHAN ET AL.

dispersed by blowing and finally air-dried. Chromosomeswere stained with 5% giemsa (in 10 mM potassiumphosphate, pH 6.8) for 30 min, air-dried, mounted, andphotographed. Chromosome counts were performed for 100metaphase plates.

For the storage of the cells, the cells were propagated for3 to 4 d in flasks until confluent monolayers were reached.L15 medium supplemented with 10% FBS (L-15-10) waschanged 24 h prior to harvesting. The cell suspension fromeach flask was collected in a 50-ml centrifuge tube, and thecells were counted. The cells were centrifuged at 500×g for10 min. The pellet was resuspended in ice-cold storagemedium (50% FBS, 10% dimethyl sulfoxide, and 40% L-15medium) to obtain a concentration of 6×106 cells permilliliter. Approximately 1.5-ml aliquots were dispensed into2-ml sterile plastic ampoules using a pipette. The ampouleswere placed in a polystyrene box and stored at −80°Covernight. The ampoules were then placed on aluminumstorage can for cryotubes (Nunc, Roskilde, Denmark) andtransferred into cryocans (IBP, Nashik, India, 22 l) contain-ing liquid nitrogen (−196°C). Frozen cells were recoveredafter 6 mo by removing an ampoule from the aluminumstorage can for cryotubes and thawing in circulating water at37°C for 2 min. The ampoule exterior was then cleaned with70% ethanol and its cap unscrewed. The contents of theampoule were transferred to L-15-10 medium in a T-25 flaskand incubated at 28°C. The medium was decanted from theflask 24 h after incubation and replaced with 10-ml fresh L-15-10 medium. The flask was incubated at 28°C until thecells reached confluence.

Cell lines in passages 10 and 30 were used to determine theplating efficiencies of PSF. Cell densities of 200, 500, and1,000 cells flask–1 were seeded in duplicate in 25-cm2 tissueculture flasks at 28°C in L-15 medium with 10% FBS. After12 d, the medium was discarded, and the cells were fixed with5 ml of crystal violet–formalin stain–fixative for 15 min,rinsed with tap water, and air-dried. The stained colonies werethen counted under the microscope, and plating efficiency wascalculated as described by Freshney (2005).

The cytotoxicity of bacterial extracellular products fromVibrio cholerae MTCC 3904 to PSF cells was tested. Thecellophane plate technique of Liu (1957) was used. Briefly,sterilized cellophane sheets were placed on the surface ofbrain heart infusion agar plates and inoculated by spreading0.5 ml of a 24-h old broth culture of V. cholerae with asterile swab and incubated at 37°C. After incubation for48 h, cells were washed off the cellophane with a minimumvolume of PBS. All the cell suspensions were centrifuged atl0,000g for 30 min at 4°C. The supernatants were filteredthrough a 0.22-µm pore-size membrane (Millipore, Bill-erica, MA), freeze-dried, and reconstituted in PBS to a finalvolume of 10 ml. All ECP samples were stored at −30°Cuntil use. The cells were grown as a monolayer in 24-well

plates at 28°C using L-15 medium supplemented with 5%FBS. For the toxicity test, the cell line was inoculated with0.1 ml serial dilutions of ECP. For negative controls, plateswere inoculated with sterile saline. Plates were incubated at28°C, and the effects of ECP on the cells were observedafter 24 and 48 h.

The PSF cell line was used in an attempt to isolate thevirus from pearlspot. For this suspected pearlspot, animalswere collected from different farms and backwater lakes inKerala, India, and transported live to the laboratory for testingthe presence of any virus. Visceral organs viz., head kidney,liver, spleen, etc., from suspected animal were dissectedaseptically and pooled and homogenized in Leibovitz L-15medium with 100 IU/ml penicillin, 100 μg/ml streptomycin,and 2.5 μg/ml Fungizone and without FBS. After centrifuga-tion, the supernatant was filtered by a 0.22-μmmembrane andthen inoculated into PSF cell line. After 1 h of adsorption atroom temperature, the supernatant was discarded, and the cellswere washed with phosphate buffer three times. Next, L-15medium with 10% FBS was added to the cells and incubatedat 28°C and examined daily for 2 wk for the appearance ofcytopathic effect (CPE).

To test the susceptibility of the cell line to a virus,marine fish virus, i.e., nodavirus was used (no freshwaterfish viruses have been reported from India yet). Cells wereinoculated in wells of a 24-well plate to give a confluenceof 70–80% and incubated for 12–24 h at 28°C. Afterremoval of the medium, 0.1 or 1 mL of virus suspension ata dilution of 10-1 to 10-3 was added and allowed to adsorbfor 1 h. Then, 0.5 or 5 mL maintenance medium containing5% FBS was added. The cells were incubated at 28°C andexamined daily for 2 wk for the appearance of CPE(Tables 1 and 2).

The origin of the PSF cell line was authenticated bypartial amplification and sequencing of 16S rRNA andCytochrome Oxidase I (COI) region of the pearlspot.Briefly, the samples were homogenized separately in NTEbuffer (0.2 m NaCl, 0.02 m Tris–HCl, 0.02 m EDTA, pH7.4) and centrifuged at 3,000g at 4°C, after which thesupernatant fluids were placed in fresh centrifuge tubestogether with an appropriate amount of digestion buffer(100 mm NaCl, 10 mm Tris–HCl, pH 8.0, 50 mM EDTA,pH 8.0, 0.5% sodium dodecyl sulfate, 0.1 mg/mL, andproteinase K. After incubation at 65°C for 2 h, the digestswere deproteinized by successive phenol/chloroform/iso-amyl alcohol extraction, and DNA was recovered byethanol precipitation, drying, and resuspension in TEbuffer. The primer pair sequences of the 16S rRNA andCOI are given in Table 3. PCR was carried out in a Vetri™96-well thermal cycler (Applied Biosystems, Foster City,CA, USA). Each PCR reaction was in a 25-µL volumecontaining both forward and reverse primers (10 µm,0.5 µL each), MgCl2 (25 mm, 1.5 µL) dNTPs (2 mm,

CELL LINE FROM ETROPLUS SURATENSIS

2.0 µL), PCR buffer (10×, 2.5 µL), Taq DNA polymerase(1U, 0.5 µL), template DNA (0.3–0.4 µg), and nucleic acid-free water. PCR cycling conditions included an initialdenaturation at 95°C for 5 min, followed by 30 cycles of95°C for 45 s, annealing temperature of 50°C (for CO1)and 58°C (for 16S rRNA) for 30 s, 72°C for 45 s and a finalextension of 5 min at 72°C. The PCR products werevisualized on 1.2% agarose gels, and the amplified productswere selected for sequencing. The cleaned-up PCR prod-ucts were sequenced in Applied Biosystems AB 3730 XLcapillary sequencer following manufacturer’s instructions atthe sequencing facility. The raw DNA sequences werealigned against known sequences from the National Centerfor Biotechnology Information (NCBI, Bethesda, Maryland,USA) database and edited using BIOEDIT sequencealignment editor version 7.0.5.2.

Results and Discussion

Cell cultures were initiated from 72 explants of pearlspotincluding 20 heart, seven kidney, five ovary, and 40 caudalfin tissues (Table 1). The cells migrated from the heart,

ovary, kidney, and fin tissue fragments and grew well andformed a monolayer during the first mo. However, onlythe cells from the fin tissue grew continuously, and thesewere subcultured at intervals of 5–7 d. The cells were split at aratio of 1:2 or 1:3. The cells from heart and kidney consistedof long and short fibroblastic cells, respectively, whereas thecells from ovary explant showed fibroblastic cells. We couldnot maintain the heart, ovary, and kidney cells after 15th, 12th,and 12th passage, respectively. In the initial passages, PSFcultures were composed of a heterogeneous mixture offibroblastic-like and epithelial-like cells. After ten subcultures,PSF cultures were predominantly epithelial-like cells. Asimilar morphological change has also been observed inorange spotted grouper, Epinephelus coicoides fin (GF-1)cells (Chi et al. 1999), and yellow grouper, Epinephelusawoara fin (GF), and heart (GH) cells (Lai et al. 2003),Asian seabass fry, L. calcarifer (Bloch), (SF) cells (Chang etal. 2001), L. calcarifer (Parameswaran et al. 2006a; b), andcatla and rohu (Ahmed et al. 2009a). The change could bedue to a common serum-derived factor present in all sera,which has strong mitogenic effect on epithelial cells therebyinhibiting the fibroblast proliferation as reported in otheranimal cells (Freshney 2005).

Table 2. Effect of fetal bovine serum and newborn calf serum on growth of PSF cells at 30th passage

S. no. Animal sera Concentration Number ofcells seeded

Monolayerformation (days)

Health statusof the cells

Number of cells after10days (×105 cells/ml)

1. Fetal bovine serum (FBS) 5 1×105/ml 10 +++ 1.3

10 1×105/ml 8 ++++ 4.5

15 1×105/ml 5 +++++ 6.8

2. Newborn calf serum (NBCS) 5 1×105/ml 14 ++ 1

10 1×105/ml 12 +++ 2.5

15 1×105/ml 10 +++ 4.4

3. Equal mixture of FBS and NBCS 5 1×105/ml 12 ++ 1.4

10 1×105/ml 10 ++ 3.2

15 1×105/ml 8 +++ 6.0

S. no. serial number

Details of explants cultures Organs/tissues

Heart Fin Kidney Ovary

Number of explant 20 40 7 5

Contamination of the explant 3 28 2 2

Radiation of the explant 7 18 2 3

No radiation of the explant 10 4 3 0

Formation of monolayer 2 8 0 1

Contamination of the monolayer 0 2 0 0

Number of cultures capable of subculturing 2a 3b 0 1c

Number of cultures still being cultured 0 1d 0 0

Table 1. Details of cell linedevelopment from the differenttissues of E. suratensis

a One of the two cell lines couldnot be subcultured after 15th pas-sage and the other after 12thpassageb Two cell lines could not besubcultured after tenth passagec Cell line could not besubcultured after 12th passaged Current passage level is 35


The fin cell has been subcultured more than 35 timessince initiation and is designated as PSF cell line.Morphologically, PSF cell line is composed of epithelial-like cells. The different morphologies of the cells fromheart, kidney, ovary, and fin were shown in Fig. 1. Majorityof PSF cells were fairly homogenous in size and reachedconfluency on the third day of culture.

PSF cells exhibited different growth rates at differentincubation temperatures between 26°C and 28°C. However,maximum growth was obtained at 28°C. The growth rate of

PSF cells increased as the FBS proportion increased from 2%to 20% at 28°C. Cells exhibited poor growth at 5%concentrations of FBS, relatively good growth at 7.5%; but,maximum growth occurred with the concentrations of 10–20% FBS. It was concluded that PSF cells grew best with 10%FBS supplementation and at 28°C (Fig. 2A, B). At 32°C, aslight increase in cell number occurred; cells remained attachedto the culture wells for at least 7 d. At the both extremeincubation temperatures, PSF cell morphology changed(Fig. 3D–F) with high incubation temperatures; monolayer

Table 3. List of mtDNA primers

Sl. no. Primers Sequence 5′-3′ No. of bases Reference

1 16S rRNA L CGCCTGTTTATCAAAAACAT 20 Palumbi et al 1991H CCGGTCTGAACTCAGATCACGT 22

2 COI F TCAACCAACCACAAAGACATTGGCAC 26 Ward et al 2005R TAGACTTCTGGGTGGCCAAAGAATCA 26

Figure 1. Photomicrographs of pearlspot cells derived from differenttissues. A, Fin explant (200X); B, Heart explant (200×); C, Ovary explant(200×); D, Kidney explant (200×); E, Monolayer of heart cells at third

passage (200×); F, Monolayer of ovary cells at second passage (200×); G,Monolayer of PSF cells at fifth passage; H, Monolayer of PSF cells at20th passage; I, Monolayer of PSF cells at 30th passage (100×).


of PSF cells rounded and floated in the medium after week’sincubation. The PSF cell line was well-adapted to grow inLeibovitz’s L-15 supplemented with 10% FBS at 28°C. Thegrowth temperature ranged from 28–32°C with the optimumgrowth at 28°C as reported for cell lines other warm waterfish (Tong et al.1997; 1998; Kang et al. 2003). The growthrate of the PSF cells improved as the FBS concentrationincreased from 2% to 20%. However, a 10% concentration ofFBS also provided relatively good growth, and this is anadvantage for low-cost maintenance of PSF cell lines.

The details of the formation of the monolayer of PSFcells at varying concentrations of FBS, NBCS, and equalmixture of FBS and NBCS has been given in Table 2.When the concentration of the sera increased from 5% to15%, the monolayer formation was quicker, and in the threetreatments, it was 5, 8, and 10 d, respectively, at 15% ofsera. The cell count (×105 cells per milliliter) was highest6.8, 4.4, and 6.0 at 15% FBS, NBCS, and equal mixture ofFBS and NBCS, respectively. The period of monolayerformation varied with respect to serum concentration. At

15% FBS, monolayer formation was observed within 5 d,while it was 10 d in the case of 15% NBCS and 8 d in thecase of equal mixture of FBS and NBCS. There wasdeterioration of the health status of the PSF cells when thesupply of serum changed to 15% NBCS and equal mixtureof FBS and NBCS (Fig 3A–C). The effects of FBS, NBCS,and equal mixture of FBS and NBCS at three differentconcentrations (5%, 10%, and 15%) significantly affectedthe attachment, proliferation, and growth of explant culture.Nanda et al. (2009) found that the goat serum at 10%concentration can be used as effectively as newborn calfserum for routine culture of fish cells. Many times, high serumconcentration results in poor cell growth and is reported to betoxic to cells (Cheng et al. 1993). In our study, we found thatno significant difference in the number of viable cells couldbe recorded for FBS and equal mixture of FBS and NBCS at15% serum concentration. In order to reduce the cost factor,15% equal mixture of FBS and NBCS could be used for thenormal maintenance of the PSF cells in vitro.

The PSF cells were cryopreserved at tenth, 25th, and35th passages. The cells recovered from liquid nitrogenstorage after 6 mo or 1 yr showed 85–90% viability andgrew to confluency within 5 d. There was no significantmorphological alteration or changes in growth rate/dou-bling times after freezing and thawing. Cryopreservation ofcell lines was done to minimize genetic change incontinuous cell lines, long-term storage, and to avoid agingand transformation in cell lines (Freshney 2005). Thefeasibility of cryopreservation of PSF cell line wasdemonstrated, with appreciable recovery after thawing upto 85–90%, was comparable with that of other fish cell linessuch as SISK and SISS cell lines (90%; Parameswaran et al.2006a; b), SAF-1, GF-1, and SF cell lines (50%, 73%, and80% to 85%, respectively; Bejar et al. 1997; Chi et al.1999; Chang et al. 2001).

Plating efficiency for each cell line was determined atseeding concentrations of 200, 500, and 1,000 cells.Moderately low plating efficiencies were observed, withPSF cells at 30th passage (6%, 9.4%, and 15.7%,respectively) growing marginally better than cells at tenthpassage (4%, 7%, and 12.1%, respectively), with nosignificant differences between replicates (data not shown).These low percentages coincided with observations of low-seeded flasks, in which cells were widely separated, andhad difficulties replicating and achieving a sub-confluentmonolayer within the 7 d after initial seeding.

The results of chromosome counts of 100 metaphaseplates revealed that the number of chromosomes in PSFcells (at 20th passage) ranged from 42–50. Aneuploidy wasobserved in the cell line though they were small inproportion. Nevertheless, the modal number of chromo-somes for all the PSF cell lines was 48 (Fig. 4). Karyotypeanalysis revealed that over 72.57% (SD±1.42) of the

Growth of PSF cells at different temperatures

00.5

11.5

22.5

33.5

44.5

5

1 2 3 4 5

Days

No

. of

cells

X 1

05 p

er m

l

18ºC 22ºC 26ºC 28ºC 32ºC 38ºC

A

Growth of PSF cells at different concerntration of FBS at 28ºC

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

1 2 3 54

Days

No

. of

cells

X 1

05 p

er m

l

5% 7.50% 10% 15% 20%

B

Figure 2. Growth response of the PSF cell line at the 20th passage toA selected temperature and B selected fetal bovine serum (FBS)concentrations.


pearlspot cell lines possessed a diploid chromosome numberof 2 N=48, which was identical to the modal chromosomenumber of pearlspot reported earlier (Natarajan andSubrahmanyam 1974). The diploid number was also noticedin grouper cell lines (Chi et al. 1999; Lai et al. 2003; Qin etal. 2006; Wen et al. 2008). Loss of chromosomes oradditions from nearby cells during karyotype preparationcould be the possible reason for the abnormal chromosomenumber in a low percentage PSF cells.

The ECP from V. cholerae was cytotoxic for the PSF cellline. Cytotoxic effects were observed within 12 h afterinoculation of ECP. PSF cells became rounded, shrunken,detached, and leading to the destruction of the monolayer(Fig. 3G–I). The susceptibility of cell lines to viral infectionis the basis for isolating and characterizing fish viruses.Nodavirus, a marine fish virus (the only fish virus reportedfrom India), was tested on the PSF cell line but was notsusceptible to the virus. No significant CPE was observedin the PSF cells after 2 wk even after ten blind passages of

the samples. No virus could be isolated from the pearlspotsamples tested during the study. In earlier studies, attemptsto isolate pilchard herpesvirus on various poikilothermiccell lines have not been successful, and the inability toisolate and grow this virus has severely limited the progressof research on this virus (Hyatt et al. 1997). In addition,some pathogenic viruses are known to be organ- and tissue-specific, which makes the establishment of additional celllines from different organs and tissues of a host speciesessential for proper monitoring of viral diseases. In theabsence of susceptible cell culture systems, other methodsand techniques, such as electron microscopy and bioassays,may be relied upon for the diagnosis of viruses which are notas simple and easily reproducible as in vitro cell cultures.

Many fish cells have proven suitable for demonstratingthe cytotoxic effects of fish pathogenic bacteria, such asmembers of the genus Vibrio (Bejar et al. 1997). In thepresent study, ECPs of V. cholerae MTCC 3904 was testedon this cell line and proved to be much more potent. Thus,

Figure 3. PSF cellular morphology at different animal serum, growingtemperatures, and cytotoxic effects of ECP of V. cholerae MTCC 3904.A, PSF cells at 28°C and 10% FBS (200×), B, PSF cells at 28°C and7.5% NBCS and 7.5% FBS (200×), C, PSF cells at 28°C and 15%

NBCS (200X), D, PSF cells at 18°C (100×), E, PSF cells at 32°C(200×), F, PSF cells at 38°C (200×), G, PSF cells at 1 d post-inoculationof V. cholerae ECP, H, PSF cells at 2 d post-inoculation of V. choleraeECP, and I, PSF cells at 3 d post-inoculation of V. cholerae ECP.


PSF is suitable for testing the cytotoxic factors of fishvibriosis. The PSF cell line was very sensitive to the ECPof V. cholerae MTCC 3904, and the morphological changesdue to ECPs of V. cholerae were similar to those describedby Bejar et al. (1997) in the SAF cell line and by SahulHameed et al. (2006) in the SISK cell line.

Amplification of the 16S rRNA and COI gene from thecell lines and pearlspot muscle tissue gave products of ∼600and 700 bp (Fig. 5), respectively. A BLAST searchindicated greater than 99% sequence identity among the16S rRNA and COI genes from PSF and pearlspot muscletissue and a 99% identity with the known pearlspotmitochondrial DNA sequences in NCBI Genebank. Thesequences have been submitted to NCBI GenBank(GenBank accession number: GU566027 and GU566028).The mitochondrial 16S rRNA, 12S rRNA, and COI genesequence alignment has been used as reliable molecularmethods to accurately identify the origin of cell lines ofmany fish species such as grouper (Ding et al. 2006), red seabream (Maki et al. 2005), and other animals (Tsai et al.2007). Therefore, based on the DNA sequence data, theorigin of PSF cell lines was confirmed as from thepearlspot, E. suratensis.

Although the PSF cells remained viable following liquidnitrogen storage, their plating efficiency was rather low(<16%). Since general characteristics for transformed cellcultures include serum-independent growth, high contactinhibition, and high plating efficiency (Freshney 2005), ourfindings suggest that PSF cells were not transformed in thepassages for which they were tested. The non-transformationstatus of these cell line was further evidenced by theirchromosomal typing, showing a diploid chromosomal countof 48 in majority of cells, which has been documented in the

16S rRNACCCGCCTGCCTGTGACCATGAGTTTAACGGCCGCGGTATTTTGACCGTGCAAAGGTAGCGCAATCACTTGTCTTTTAAATGAAGACCCGTATGAATGGCATAACGAGGGCTTAACTGTCTCCCTTTTCCAGTCAATGAAATTGATCTCCCCGTGCAGAAGCGGGGATCCCCACATAAGACGAGAAGACCCTATGGAGCTTTAGACAAAAGACAGCCCATGTCAAACACCCCTAAACAAAGGACAAAACTAATTGGCCCCTGTCCTAATGTCTTTGGTTGGGGCGACCGCGGGGAAACAAAAAACCCCCATGTGGACTGAAGGCACCCTTCTTCACAACCAAGAGCCACAGCTCTAAGTAACAGAACATCTGACCAACAAGATCCGGAATAATAACCGATCAACGGACCGAGTTACCCTAGGGATAACAGCGCAATCTCCTTCTAGAGCCCATATCGACAAGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCCGCTATTAAGGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGAGCO1GCTGGAATAGTAGGCACTGCTTTAAGCCTACTTATCCGAGCAGAACTAAGCCAACCAGGCTCTCTCCTTGGAGACGACCAGATTTACAATGTTATCGTAACTGCGCACGCCTTCGTTATAATTTTCTTCATGGTTATGCCAATCATAATTGGCGGCTTCGGAAACTGACTAGTTCCCTTAATAATTGGTGCCCCCGATATAGCCTTCCCCCGAATAAACAACATGAGCTTCTGACTCCTTCCTCCCTCATTCTTGCTCCTTTTAGCATCCTCTGGTGTAGAGGCAGGGGCAGGAACAGGGTGAACCGTATACCCTCCTCTAGCAGGCAACCTTGCCCATGCAGGGGCCTCTGTTGATTTAACCATCTTTTCCCTACATCTAGCAGGTGTTTCATCTATTCTTGGGGCAATCAACTTTATCACCACAATCATTAATATGAAACCTCCCGCTATTTCACAATATCAAACCCCCTTATTTGTCTGAGCTGTTCTTATTACGGCCGTCCTTCTTCTTCTCTCTCTCCCCGTACTAGCAGCCGGCATCACAATGCTTCTAACAGATCGAAATTTAAATACGACCTTTTTCGATCCCGCAGGGGGAGGAGACCCCCTCTTATACCAGCACCT

Figure 5. (Left panel) PCR amplification of 600-bp and 700-bpsequences of the pearlspot genome using universal oligonucleotideprimers of the 16S rRNA and CO1 genes, respectively. Two hundredto 300 ng DNA isolated from pearlspot was amplified and thensubjected to 2.0% gel electrophoresis. mtDNA profile with 16S rRNA

primer (lane 1 and 2 PSF cells; lane 3 and 4 pearlspot tissue); withCO1 primer (lane 5 and 6 PSF cells; lane 7 and 8 pearlspot tissue); Mmarker (100 bp DNA ladder). (Right panel) Nucleotide sequences ofthe 558 bp and 626 bp fragments amplified using oligonucleotideprimers of the 16S and CO1 genes of pearlspot.

Figure 4. Chromosome analysis of PSF cells. A, Karyotype of PSFcells (passage 20) indicates all 24 pairs of telocentric chromosomes. B,Metaphase chromosome of PSF cells (passage 20).


literature for this aquatic species (Natarajan and Subrahma-nyam 1974).

With no permanent cell line available from pearlspot (E.suratensis), our research sought to establish a first cell linefrom this fish species which has very high potential forculture. Since the first fish cell line reported by Wolf andQuimby (1962), about 268 cell lines have been established(unpublished data), but only a few of them are availablefrom international cell culture repositories (ATCC orECACC) for scientific research. In India, till recently, verylittle work was carried out on fish cell lines. Most of theworks were mainly concentrated on the development ofprimary cell culture from freshwater fish (Sathe et al. 1995;Lakra and Bhonde 1996; Rao et al. 1997; Rathore et al.2001; Lakra et al. 2006a; Rathore et al. 2007). Recently,continuous fish cell lines were developed from fin of L.calcarifer (Lakra et al. 2006b), eye muscle (Ahmed et al.2008), heart (Ahmed et al. 2009b), brain (Ahmed et al.2009a) of catla and eye of rohu (Ahmed et al. 2009a). ThePSF cell line has been submitted to the fish cell linerepository at the National Bureau of Fish Genetic Resour-ces, Lucknow, India, which is the official agency for storingthe characterized fish cell lines in India.

Although a cell line from a fish species that is not ofdirect interest can be a useful surrogate, having lines fromthe species of interest is superior for many purposes(Dewitte-orr et al. 2006). For example, susceptibility tosome viruses can be species-specific and some physiolog-ical processes can vary between species, leading to differentsensitivities to stimuli. Thus, additional cell lines from E.suratensis would be valuable for studying species-specificresponses at the cellular level.

We plan to carry out further research on the newlyestablished PSF cell line regarding their biological proper-ties and functions, so that the cell lines can be madeavailable to scientists all over the world for the advance-ment of in vitro research in aquatic science.

Acknowledgement The authors are thankful to Dr. S. Ayyappan,Director General, ICAR, New Delhi, India, for the encouragement andguidance. Thanks are due to the Head, FishHealthManagement Division,National Bureau of Fish Genetic resources, Lucknow, for the support.

Reference

Ahmed V. P. I.; Chandra V.; Parameswaran V.; Venkatesan C.; ShuklaR.; Bhonde R. R.; Sahul Hameed A. S. A new epithelial-like cellline from eye muscle of catla (Catla catla): development andcharacterization. J. Fish Biol. 72: 2026–2038; 2008.

Ahmed V. P. I.; Chandra V.; Sudhakaran R.; Rajesh Kumar S.; SarathiM.; Sarath Babu V.; Bhonde R. R.; Sahul Hameed A. S.Development and characterization of cell lines derived fromrohu, Labeo rohita (Hamilton); and catla; Catla catla (Hamilton).J. Fish Dis. 32: 211–218; 2009a.

Ahmed V. P. I.; Sarath Babu V.; Chandra V.; Nambi K. S.; ThomasJ.; Bhonde R. R.; Sahul Hameed A. S. A new fibroblastic-likecell line from heart muscle of the Indian major carp (Catlacatla): development and characterization. Aquaculture 293:180–186; 2009b.

Bejar J.; Borrego J. J.; Alvarez M. C. A continuous cell line from thecultured marine fish gilt-head sea bream (Sparus aurata).Aquaculture 150: 143–153; 1997.

Bindu L. Captive breeding protocols of two potential cultivable fishes,Etroplus suratensis (Bloch) and Horabagrus brachysoma (Gun-ther) endemic to the Western Ghat region, Kerala. PhD thesissubmitted to Mahatma Gandhi University, Kottyam; 2006: pp 215.

Bols N. C.; Brubacher J. L.; Ganassin R. C.; Lee L. E. J. Ecotoxicologyand innate immunity in fish. Dev. Comp. Immunol. 25: 853–873;2001.

Chang S. F.; Ngoh G. H.; Kueh L. F. S.; Qin Q. M.; Che C. L.; Lam T.J.; Sin Y. M. Development of a tropical marine fish cell line fromAsian seabass (Lates calcarifer) for virus isolation. Aquaculture192: 133–145; 2001.

Cheng L. L.; Browser P. R.; Spitsbergen J. M. Development of cellcultures derived from lake trout liver and kidney in a hormonesupplemented; serum-reduced medium. J. Aquat. Anim. Health 5:119–126; 1993.

Chi S. C.; Hu W. W.; Lo B. J. Establishment and characterization of acontinuous cell line (GF-1) derived from grouper; Epinepheluscoioides: a cell line susceptible to grouper nervous necrosis virus(GNNV). J. Fish Dis. 22: 173–182; 1999.

Dewitte-orr S. J.; Lepic K.; Bryson S. P.; Walsh S. K.; Lee L. E. J.;Bols N. C. Development of a continuous cell line; PBLE; froman American eel peripheral blood leukocyte preparation. In VitroCell Dev. Biol. Anim. 42: 263–272; 2006.

Ding S.; Zhuang X.; Guo F.; Wang J.; Su Y.; Zhang Q.; Li Q.Molecular phylogenetic relationships of China Seas groupersbased on cytochrome b gene fragment sequences. Sci. China C.Life Sci. 49: 235–242; 2006.

Freshney R. I. Culture of animal cells—a manual of basic techniques.Wiley-Liss, New York; 2005.

Fryer J. L.; Lannan C. N. Three decades of fish cell culture: a currentlisting of cell lines derived from fish. J. Tissue Cult. Methods 16:87–94; 1994.

Hornell J. Administrative report for the year 1921-1922. Madras FishBulletin Madras 17: 44; 1923.

Hyatt A. D.; Hine P. M.; Jones B.; Whittington R.; Kearns C.; Wise T.G.; Crane M. S.; Williams L. M. Epizootic mortality in thepilchard Sardinops sagax neopilchardus in Australia and NewZealand in 1995. II. Identification of a herpesvirus within the gillepithelium. Dis. Aquat. Org. 28: 17–29; 1997.

Jhingran V. G.; Natarajan A. V. Role of Chilka lake fisheries in thedevelopment of coastal aquaculture in Eastern India. In: Pillay T.V. R. (ed) Coastal aquaculture in the Indo-Pacific Region.Fishing News (Books) Ltd, London, pp 109–115; 1973.

Kang M. S.; Oh M. J.; Kim Y. J.; Kawai K.; Jung S. J. Establishmentand characterization of two cell lines derived from flounder;Paralichthys olivaceus (Temminck & Schlegel). J. Fish Dis. 26:657–665; 2003.

Lai Y. S.; John J. A. C.; Lin C. H.; Guo I. C.; Chen S. C.; Fang F.; LinC. H.; Chang C. Y. Establishment of cell lines from a tropicalgrouper; Epinephelus awoara (Temminck and Schlegel); andtheir susceptibility to grouper irido and nodaviruses. J. Fish Dis.26: 31–42; 2003.

Lakra W. S.; Bhonde R. R. Development of primary cell culture fromthe caudal fin of an Indian major carp; Labeo rohita (Ham).Asian Fish Sci. 9: 149–152; 1996.

Lakra W. S.; Bhonde R. R.; Sivakumar N.; Ayyappan S. A newfibroblast like cell line from the fry of golden mahseer Torputitora (Ham). Aquaculture 253: 238–243; 2006a.


Lakra W. S.; Sivakumar N.; Goswami M.; Bhonde R. R. Developmentof two cell culture systems from Asian seabass Lates calcarifer(Bloch). Aquaculture Res. 37: 18–24; 2006b.

Liu P. V. Survey of haemolysin production among species ofPseudomonas. J. Bacteriol. 74: 718–727; 1957.

Maki T.; Koiwa T.; Imada K.; Toyoda M.; Sugimura T.; Ikeda T. M.;Yano H. Species identification of ‘seabream’ (Pagrus major;Evynis japonica and Dentex tumifrons) by PCR-based DNAanalysis using the mitochondrial cytochrome b gene. J. Jpn. So.Food Sci. Technol. 52: 366–372; 2005.

Nanda P. K.; Swain P.; Nayak S. K.; Dash S.; Routray P.; Swain S. K.;Patra B. C. Goat serum as an alternative to establish cell culturefrom Indian major carp; Cirrhinus mrigala. In Vitro Cell Dev.Biol. Anim. 45: 148–151; 2009.

Natarajan R.; Subrahmanyam K. A karyotype study of some teleostsfrom Portonovo waters. P. Plant Sci. 79: 173–196; 1974.

Padmakumar K. G.; Krishnan A.; Joetreson S.; Reynold K.; Bindu L.Potentials of open water fish culture in net cages in Vembenadlake; Kerala. In: Ambat B. (ed) Proceedings of 3rd IndianEnvironmental Congress 2004. Centre for Environmental andDevelopment, Kerala, pp 155–165; 2004.

Palumbi S.; Martin A.; Romano S.; McMillan W. O.; Stice L.;Grabowski G. The simple fool’s guide to PCR. University ofHawaii, Honolulu; 1991.

Parameswaran V.; Shukla R.; Bhonde R. R.; Sahul Hameed A. S.Establishment of embryonic cell line from sea bass (Lates calcarifer)for virus isolation. J. Virol. Methods 137: 309–316; 2006a.

Parameswaran V.; Shukla R.; Bhonde R. R.; Sahul Hameed A. S.Splenic cell line from sea bass; Lates calcarifer: establishmentand characterization. Aquaculture 261: 43–53; 2006b.

Qin Q. W.; Wu T. H.; Jia T. L.; Hegde A.; Zhang R. Q. Developmentand characterization of a new tropical marine fish cell line fromgrouper; Epinephelus coioides susceptible to iridovirus andnodavirus. J. Virol. Methods 131: 58–64; 2006.

Rao K. S.; Joseph M. A.; Shankar K. M.; Mohan C. V. Primary cellculture from explants of heart tissue of Indian major carps. Curr.Sci. 73: 374–375; 1997.

Rathore G.; Kumar G.; Swaminathan T. R.; Sood N.; Singh V.; AbidiR.; Lakra W. S. Primary cell culture from fin explants of Labeorohita (Ham). Indian J. Fish 541: 93–97; 2007.

Rathore G.; Sood N.; Swaminathan T. R. Primary cell culture fromfish gills and kidney using fish serum. Indian J. Exp. Biol. 39:936–938; 2001.

Sahul Hameed A. S.; Parameswaran V.; Shukla R.; Singh I. B.;Thirunavukkarasu A. R.; Bhonde R. R. Establishment andcharacterization of India’s first marine fish cell line from kidneyof sea bass; Lates calcarifer. Aquaculture 257: 92–103; 2006.

Sathe P. S.; Basu A.; Mourya D. T.; Marathe B. A.; Gogate S. S.;Banerjee K. A cell line from the gill tissues of Indian cyprinoidLabeo rohita. In Vitro Cell Dev. Biol. Anim. 33: 425–427; 1997.

Sathe P. S.; Maurya D. T.; Basu A.; Gogate S. S.; Banerjee K.Establishment and characterization of a new fish cell line; MG-3;from the gills of mrigal Cirrhinus mrigala. Indian J. Exp. Biol.33: 589–594; 1995.

Tong S. L.; Lee H.; Miao H. Z. The establishment and partialcharacterization of a continuous fish cell line FG-9307 from thegill of flounder; Paralichthys olivaceus. Aquaculture 156: 327–333; 1997.

Tong S. L.; Miao H. Z.; Li H. Three new continuous fish cell lines ofSPH; SPS and RSBF derived from sea perch (Lateolabraxjapaonicus) and red sea bream (Pagrosomus major). Aquaculture169: 143–151; 1998.

Tsai L. C.; Huang M. T.; Hsiao C. T.; Lin C. Y.; Chen S. Z.; Lee C. I.;Hsieh H. M. Species identification of animal specimens bycytochrome b gene. Forensic Sci. J. 6: 63–65; 2007.

Vijayaraghavan S.; Krishnakumari L.; Gopinath V. J.; Dhawan R. M.Aquaculture of pearlspot Etroplus suratensis in an esturine pond:environmental characteristics; primary production; growth andcost benefit ratio. Indian J. Mar. Sci. 10: 82–89; 1981.

Ward R. D.; Zemlak T. S.; Innes B. H.; Last P. R.; Hebert P. D. N.DNA barcoding Australia’s fish species. Philos Trans.-R. Soc.Lond., Phys. Sci. Eng. 360: 1847–1857; 2005.

Wen C. M.; Lee C. W.; Wang C. S.; Cheng Y. H.; Huang H. Y.Development of two cell lines from Epinephelus coioides braintissue for characterization of betanodavirus and megalocytivirusinfectivity and propagation. Aquaculture 278: 14–21; 2008.

Wise Sr. J. P.; Winn R. N.; Renfro J. L. Generating new marine celllines and transgenic species. J. Exp. Zool. 15: 292–295; 2002.

Wolf K.; Quimby M. C. Established eurythermic line of fish cells invitro. Science 135: 1065–1066; 1962.


Documents

Etroplus Suratansis Cell Line