gy 565 (2007) 190–201www.elsevier.com/locate/ejphar

European Journal of Pharmacolo

Effect of silymarin on pyrogallol- and rifampicin-inducedhepatotoxicity in mouse

Ghanshyam Upadhyay, Abhai Kumar, Mahendra Pratap Singh⁎

Industrial Toxicology Research Centre (ITRC), Mahatma Gandhi Marg, Post Box – 80, Lucknow – 226 001, UP, India

Received 11 December 2006; received in revised form 28 February 2007; accepted 6 March 2007Available online 19 March 2007

Abstract

Rifampicin and pyrogallol, besides beneficial effects, elicit hepatotoxicity in experimental animals and humans. The present investigation wasundertaken to elucidate the role of drug/toxicant-metabolizing enzymes in rifampicin- and pyrogallol-induced hepatotoxicity and the effect ofsilymarin, a herbal antioxidant, on rifampicin- and pyrogallol-induced alterations in mouse liver. Male Swiss albino mice were treatedintraperitoneally with and without rifampicin (20 mg/kg) and/or pyrogallol (40 mg/kg) for 1, 2, 3 and 4 weeks. In some experiments, animals weretreated with silymarin (40 mg/kg), 2 h prior to rifampicin and/or pyrogallol. The differential expression and catalytic activity of cytochrome P-450(CYP) 1A1, CYP1A2 and CYP2E1, the activity of glutathione-S-transferase, glutathione peroxidase and glutathione reductase, and lipidperoxidation were measured in the liver of control and treated groups. CYP1A1 expression and catalytic activity were not altered followingindividual or combinational treatment. A significant augmentation in the expression and activity of CYP1A2 and CYP2E1 was observed followingpyrogallol and rifampicin+pyrogallol treatment; however, rifampicin exhibited a significant induction of CYP2E1 only. Attenuation ofglutathione-S-transferase, glutathione reductase and glutathione peroxidase activities and augmentation of lipid peroxidation were observedfollowing rifampicin and/or pyrogallol treatment and a cumulative effect was seen when the two drugs were administered in combination.Silymarin restored the rifampicin- and/or pyrogallol-induced alterations in the expression and activity of CYP1A2 and CYP2E1, the activity ofglutathione-S-transferase, glutathione reductase, and glutathione peroxidase, and lipid peroxidation. The results demonstrate the role of CYP1A2,CYP2E1, glutathione-S-transferase, glutathione reductase and glutathione peroxidase in rifampicin- and pyrogallol-induced hepatotoxicity andprovide evidence for the involvement of silymarin in attenuation of drug-induced hepatotoxicity.© 2007 Elsevier B.V. All rights reserved.

Keywords: Rifampicin; Pyrogallol; Silymarin; Cytochrome P-450; Glutathione; Hepatotoxicity

1. Introduction

Hepatotoxicity, a common adverse effect, is produced by theanti-tuberculosis drug rifampicin and the anti-psoriasis drugpyrogallol (Rana et al., 2006; Gupta et al., 2002). Both rifampicinand pyrogallol induce liver damage, release of specific serumprotein biomarkers, oxidative stress, and inappropriate perme-ability transition in mitochondria (Rana et al., 2006; Chowdhuryet al., 2006; Gupta et al., 2002, 2004;Muzes et al., 1990). Patientswith tuberculosis and psoriasis are continuously exposed torifampicin and pyrogallol, during therapeutic interventions.

⁎ Corresponding author. Tel.: +91 522 2613618x337; fax: +91 522 2628227.E-mail address: singhmahendrapratap@rediffmail.com (M.P. Singh).

0014-2999/$ - see front matter © 2007 Elsevier B.V. All rights reserved.doi:10.1016/j.ejphar.2007.03.004

Although the probability of combinational exposure is limited,it is of significant clinical relevance in individuals suffering fromtuberculosis and residing/working in a pyrogallol-exposedenvironment, particularly in geographic regions rich in organicmatter such as coals and shales.

Pyrogallol and rifampicin are used as models to evaluate thehepatoprotective potential of drugs with antioxidant properties(Gupta et al., 2002; Tasduq et al., 2005). Silymarin providessignificant protection against rifampicin- or pyrogallol-inducedalterations of hepatic markers involved in normal function,oxidative stress and liver histology (Gupta et al., 2002, 2004;Tasduq et al., 2005; Victorrajmohan et al., 2005). Silymarin isselected over other hepatoprotective agents because of its plantorigin, antioxidant property, easy availability and most impor-tantly lack of toxicity and side effects even at high doses (Gupta

191G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

et al., 2002, 2004; Davila et al., 1989; Thabrew et al., 1997;Shear et al., 1995; Roy et al., 2006; Ferenci et al., 1989).

The role of the detoxification enzymes, cytochrome P-450(CYP) and glutathione-S-transferase, involved in the metabo-lism of drugs and toxins are not clearly known in rifampicin-and pyrogallol-induced hepatotoxicity (Backman et al., 2006;Graham et al., 2006; Tasduq et al., 2005; Liu et al., 2005).Various forms of CYP, such as CYP1A1, CYP1A2 andCYP2E1, are involved in free radical generation and rifampicin-and or pyrogallol-mediated free radical generation may beassociated with alterations in the expression of CYPs. Despiteextensive research on biochemical and molecular parameters,the underlying mechanism of rifampicin- and pyrogallol-induced toxicity and the hepatoprotective potential of herbalantioxidants, such as silymarin, against pyrogallol and orrifampicin are not yet clearly understood. The presentinvestigation was therefore undertaken to investigate the effectof rifampicin and pyrogallol on drug/toxicant-metabolizingenzymes either alone or in combination and to understand howsilymarin counteracts drug-induced hepatotoxicity.

2. Material and methods

2.1. Chemicals

Alkaline phosphatase staining kit [mixture of BCIP (5-bromo-4-chloro-3′-indolyphosphate p-toluidine) and NBT(nitro-blue tetrazolium chloride)], Bradford reagent, sodiumpyrophosphate, sodium dodecyl sulphate (SDS), thiobarbituricacid (TBA), glutathione (oxidized), glutathione (reduced), 1-chloro-2, 4-dinitrobenzene (CDNB), hydrogen peroxide, nico-tinamide adenine dinucleotide phosphate (NADPH), bromo-phenol blue, Tris–base, ethylene-diamine-tetra-acetic acid(EDTA), ethidium bromide, perchloric acid, resorufin ethylether (ERF), resorufin methyl ether (MRF), resorufin tetra-sodium salt, glucose-6-phosphate dehydrogenase, p-nitrophe-nol, 4-nitrocatechol, dithiothreitol (DTT), rifampicin andmonoclonal anti-rabbit immunoglobulin alkaline phosphataseconjugate clone RG-16 antibody were purchased from Sigma-Aldrich, USA. Silymarin and pyrogallol were procured fromICN biomedical and RT–PCR kits were purchased from MBIFermentas, USA. Taq polymerase, Taq buffer, dNTPs, 100 bpladder, forward and reverse primers for CYP1A1, CYP1A2,CYP2E1 and GAPDH were procured from Bangalore Genei,India. Rabbit anti-rat cytochrome P450 1A1, 1A2 and 2E1antibodies were procured from Chemicon International, USA.

2.2. Animal treatment

Swiss albino male mice (20–25 g) were obtained from theanimal colony of the Industrial Toxicology Research Centre(ITRC), Lucknow. The institutional ethics committee for the useof laboratory animals approved the study. The animals were keptin the animal house under standard conditions of temperatureand humidity (temperature: 22±2 °C; humidity: 45–55%; lightintensity: 300–400 lx). The animals were supplied proper pelletdiet and water ad libitum. The optimal dose and timing of

rifampicin and pyrogallol were selected as having a maximumeffect on the level of markers of hepatic damage without causingdeath. The dose of silymarin was selected based on it causing asignificant reversal of the augmented level of markers of hepaticdamage. The drugs were dissolved in DMSO and diluted innormal saline. Diluted drugs (100 μl containing 0.1% finalconcentration of DMSO) were injected in drug-treated animalsand 100 μl of 0.1% final concentration of DMSO was injectedinto control animals (vehicle). The animals were treatedintraperitoneally (i.p.) with rifampicin (20 mg/kg) and/orpyrogallol (40 mg/kg), daily for 1, 2, 3 or 4 weeks along withcontrols (vehicle). In some sets of experiments, animals werepretreated with silymarin (40 mg/kg, i.p.) 2 h prior to rifampicin(20 mg/kg) and/or pyrogallol (40 mg/kg) treatment, daily for 1,2, 3 or 4 weeks. At least ten animals were studied per group inthree to five separate experiments. Animals were killed bycervical dislocation; the liver was taken out after perfusion withnormal saline and frozen in liquid nitrogen.

2.3. Determination of serum aminotransferase activity,bilirubin content and histological analysis

Alanine aminotransaminase, aspartate aminotransaminaseand bilirubin contents, markers of hepatotoxicity, weremeasured with commercial kits available from Merck, India.Microscopic examination was performed of preparations fromthe liver fixed in 10% neutral formaldehyde, embedded inparaffin, sectioned (4–5 μm) and stained with hematoxylin–eosin.

2.4. Preparation of microsomes

Perfused liver was homogenized in homogenization buffer(0.1 M phosphate buffer, 0.125 M KCl, 1 mM EDTA, and0.25 M sucrose). The homogenate was centrifuged at 10,000×gfor 20 min at 4 °C, the supernatant was removed and centrifugedat 40,000×g for 1 h at 4 °C to pellet microsomes. Microsomeswere suspended in 0.1 M Tris–Cl buffer (pH 7.4) containing0.125 M potassium chloride. Microsomal and cytosolicfractions were stored at −80 °C until further use.

2.5. Protein estimation

The protein content was measured in microsomal andcytosolic fractions (Bradford, 1976) using bovine serumalbumin as standard.

2.6. Reverse transcriptase–polymerase chain reaction(RT–PCR) analysis

Total RNA was isolated from mouse liver using TRIZOLreagent and was reverse transcribed for 1 h at 42 °C in the presenceof oligo-dTand Revert Aid™HminusMul V-reverse transcriptaseaccording to the manufacturer's instructions. Forward and reverseprimers for CYP1A1, CYP1A2, CYP2E1 and GAPDH weresynthesized as described elsewhere (Choudhary et al., 2005;Seree et al., 1996; Fan et al., 2004). In brief, primers used to amplify

192 G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

296, 400, 550 and 201 bp fragments specific toCYP1A1,CYP1A2,CYP2E1 andGAPDHwere 5′GGCCAGACCTCTACAGCTTC3′(forward) and 5′GCCAAAGCATATGGCACAG3′ (reverse)(GenBank Accession No. NM_009992); 5′GACGTCAG-CATCCTCTTGCT3′ (forward) and 5′GGCACTTGT-GATGTCTTGGA3′ (reverse) (GenBank Accession No.NM_009993); 5′ CGGTTCTTGGCATCACCGT3′ (forward)and 5′GCAGGTGCACAGCCAATCA3′ (reverse) (GenBankAccession No. NM_021282); and 5′CTCATGACCACAGTC-CATGC3′ (forward) and 5′CACATTGGGGGTAGGAACAC3′(reverse) (GenBank Accession No. NM_008084), respectively.Thirty cycles of denaturation, annealing and elongation at 94 °C for30 s, 55 °C for 30 s and 72 °C for 60 s, respectively, were performedforCYP1A1 andCYP1A2, and 29 cycles of denaturation, annealingand elongation at 91 °C for 60 s, 48 °C for 60 s, and 70 °C for 60 sfor CYP2E1 (Choudhary et al., 2005; Seree et al., 1996). GAPDHamplification was performed concurrently with CYP1A1, CYP1A2or CYP2E1. PCR products were visualized in 2% agarose gelcontaining 1 μg/ml ethidium bromide under an UV transillumi-nator. The band density of CYP1A1, CYP1A2 or CYP2E1 wascalculated using computerized densitometry system and valueswere normalized with GAPDH band density.

2.7. Measurement of CYP1A1 and CYP1A2 activity

Catalytic activity of CYP1A1 (7-ethoxyresorufin O-deethy-lase) and CYP1A2 (7-methoxyresorufin O-demethylase) wasmeasured following protocols reported in the literature (Pohland Fouts, 1980) with slight modifications. In brief, 50–250 μgof microsomal protein was mixed with 0.1 M phosphate buffer(pH 7.4) containing 5 mM glucose-6-phosphate, 2 units ofglucose-6-phosphate dehydrogenase, 5 mM magnesium sul-phate, 1.6 mg/ml BSA, 1.5 μM 7-ethoxy resorufin (forCYP1A1)/7-methoxy resorufin (for CYP1A2). NADPH(0.6 nmol) was added to the reaction mixture to initiate thereaction and the mixture was incubated at 37 °C for 20 min. Thereaction was stopped by the addition of 2.5 ml methanol andkeeping the reaction mixture on ice. The reaction mixture wascentrifuged at 825×g for 10 min and the supernatant wascollected. Fluorescence was measured at 550 nm excitation and585 nm emission wavelengths. The enzymatic activity wascalculated in pmol/min/mg protein.

2.8. Measurement of CYP2E1 activity

CYP2E1 activity was determined by measuring the hydro-xylation of 4-nitrophenol to 4-nitrocatechol (Koop, 1986). Inbrief, 0.2 mM 4-nitrophenol was mixed with 50 mM Tris–HCl(pH 7.4) containing 25 mM MgCl2 and 250 μg microsomalprotein was added to the reaction mixture, which was incubatedfor 5 min at 37 °C. The reaction was initiated by the addition of20 μl of 50 mM NADPH; the reaction mixture was furtherincubated for 10 min and 500 μl of 0.6 N perchloric acid wasused to terminate the reaction. After centrifugation at 825×g for20 min, the supernatant was obtained and 10 N sodiumhydroxide was added (9:1 ratio). Optical density was read at510 nm. CYP2E1 activity is expressed in nmol/min/mg protein.

2.9. Western blot analysis

Samples (50 μg proteins) were electrophoresed onto 10%SDS–polyacrylamide gel and transferred to polyvinyl difluor-ide membranes. The membranes were blocked with 5% of non-fat milk in Tris–buffer saline containing 50 mM Tris–HCl,135 mM NaCl and 0.1% Tween-20 (pH 7.5) for 2 h at roomtemperature. The blot was incubated with rabbit anti-ratCYP1A1, CYP1A2 or CYP2E1 antibody (1:1000 dilutions)overnight at 4 °C. Membranes were washed, incubated withmonoclonal anti-rabbit immunoglobulin alkaline phosphataseconjugate clone RG-16 antibody at room temperature for 3 h,washed with Tris–buffer saline, and then the color reaction wasperformed using alkaline phosphatase staining kits. Equalprotein loading was checked by quantifying β-actin in theWestern blots. The band densities were captured and quantifiedusing Alpha Imager-2200.

2.10. Measurement of glutathione-S-transferase activity

Glutathione-S-transferase activity was determined in thecytosolic fraction according to the procedure described in theliterature (Habig et al., 1974). A mixture of glutathione (9 mM),CDNB (150 mM) and 20 μg cytosolic protein in phosphatebuffer (0.2 M, pH 6.5) was used to measure the increase inabsorption at 340 nm for 3 min at 30-s intervals. Enzymeactivity was calculated in nmol/min/mg protein.

2.11. Measurement of glutathione reductase activity

Glutathione reductase activity was determined in thecytosolic fraction by measuring the decrease in absorbance at340 nm for 3 min at 30-s intervals (Carlberg and Mannervik,1985). NADPH (2 mM), GSSG (20 mM) and 20 μg cytosolicproteins in 0.2 M phosphate buffer (pH 7.0) were mixedvigorously before absorbance was measured. Enzyme activity isexpressed in nmol/min/mg protein.

2.12. Measurement of glutathione peroxidase activity

Glutathione peroxidase activity was determined in thecytosolic fraction as described elsewhere (Wendel, 1980). Thereaction mixture containing 48 mM sodium phosphate,0.38 mM EDTA, 0.12 mM NADPH, 0.95 mM sodium azide,3.2 units glutathione reductase, 1 mM glutathione, 0.02 mMDTT, and 0.0007% (w/w) hydrogen peroxide was used tomonitor the enzyme activity. Enzyme activity was determinedby measuring the decrease in absorbance at 340 nm for 3 min at30-s interval and expressed in units/ml.

2.13. Lipid peroxidation

Lipid peroxidation was estimated by using the method ofOhkawa et al. (1979) with slight modifications (Ohkawa et al.,1979). A 10% microsomal fraction in SDS (10% w/v) wasincubated for 5 min; glacial acetic acid (20%) was added and themixture was further incubated for 2 min. TBA (0.8%) was

193G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

added to the reaction mixture, which was incubated in a boilingwater bath for 1 h. After centrifugation at 10,000×g for 5 min at4 °C, the supernatant was collected; absorbance was recorded at532 nm against the control blank.

2.14. Statistical analysis

Two-way analysis of variance (ANOVA) was used forcomparisons between different groups with Bonferroni post-hoctest. The data are expressed as means±S.E.M. and differenceswere considered statistically significant when the “P” value wasless than 0.05.

3. Results

3.1. Serum aminotransferase activity, bilirubin content andhistological analysis

Doses of rifampicin and pyrogallol were optimized bytreating animals with varying doses of rifampicin (10–30 mg/kgbody weight; i.p., per day for 2 weeks) and pyrogallol (10–50 mg/kg body weight; i.p., per day for 2 weeks) and estimatingthe level of markers of hepatic damage in peripheral bloodserum. Maximum effects on these markers were observed at20 mg/kg for rifampicin and 40 mg/kg for pyrogallol (Fig. 1Aand B) without any mortality in the treated animals. Higher

Fig. 1. Effect of rifampicin and pyrogallol on alanine aminotransaminase,aspartate aminotransaminase, and total bilirubin content in peripheral bloodserum. Rifampicin induced alanine aminotransaminase and aspartate amino-transaminase activity and increased the bilirubin level in a dose-dependent mannerup to 20 mg/kg (i.p., daily) for 2 weeks (A) without any mortality. Pyrogallolinduced similar effects at the dose of 40 mg/kg (i.p., daily) for 2 weeks (B).

doses led to more hepatic damage (Fig. 1A and B) but animalsdied (data not shown).

Pyrogallol and rifampicin increased alanine aminotransa-minase and aspartate aminotransaminase activity and bilirubincontent in an exposure time-dependent manner. Pyrogalloland rifampicin in combination had a more pronounced effecton enzyme activity and bilirubin content as compared withindividual treatments; however, silymarin attenuated thepyrogallol- and/or rifampicin-induced increase in serumalanine aminotransaminase and aspartate aminotransaminaseactivity and bilirubin content (Table 1). Histological examina-tion showed membrane disintegration and vacuolation withcytoplasmic rarification and in some cases necrosis andinflammation after exposure to rifampicin and pyrogallol;however, silymarin abolished these abnormalities (data notshown).

3.2. CYP1A1 activity and its mRNA expression

Rifampicin, pyrogallol and silymarin alone or in combinationdid not alter CYP1A1 mRNA expression as compared with res-pective controls (Fig. 2A and B). There was no significant changeobserved in 7-ethoxyresorufin O-deethylase activity in the liver ofrifampicin-, pyrogallol-, pyrogallol+rifampicin-, rifampicin+silymarin-, pyrogallol+silymarin- and rifampicin+pyrogallol+silymarin-treated animals following 1, 2, 3 or 4 weeks of treatmentas compared with controls (P>0.05) (Fig. 2C).

3.3. CYP1A2 activity and its mRNA expression

Rifampicin did not significantly alter CYP1A2 mRNAexpression; however, pyrogallol alone and in combinationwith rifampicin augmented CYP1A2 mRNA expression after 2,3 or 4 weeks of exposure (P<0.01, 0.01, 0.001 for 2, 3 and4 weeks of pyrogallol treatment and P<0.01, 0.001, 0.001,0.001 for 1, 2, 3 and 4 weeks of rifampicin+pyrogallol treat-ment) (Fig. 3A and B). Silymarin attenuated the pyrogallol andrifampicin+pyrogallol-induced increase in CYP1A2 mRNAexpression (Fig. 3A and B). Pyrogallol increased methoxyr-esorufin O-demethylase activity following 2, 3 or 4 weeks oftreatment as compared with controls (P<0.001); however,rifampicin alone did not cause significant alterations inmethoxyresorufin O-demethylase activity during the study(P>0.05) (Fig. 3C). Rifampicin and pyrogallol co-treatmentincreased methoxyresorufin O-demethylase activity to a greaterextent than the pyrogallol alone after 1, 2, 3 or 4 weeks oftreatment as compared with respective controls (P<0.01,0.001, 0.001 and 0.001 respectively) (Fig. 3C). Silymarinpretreatment significantly attenuated the pyrogallol- and/orrifampicin+pyrogallol-mediated increase in methoxyresorufinO-demethylase activity (Fig. 3C).

3.4. CYP2E1 activity and its mRNA expression

A consistent and significant increase in CYP2E1 expressionwas evident in rifampicin- and/or pyrogallol-treated groups ascompared with respective controls (P<0.01 for 1 week and

Table 1Alanine aminotransaminase, aspartate aminotransaminase and bilirubin content in controls and mice treated with rifampicin, pyrogallol and silymarin either alone or incombination

Treatment groups 1 week 2 weeks 3 weeks 4 weeks

Alanine aminotransaminase (units/l)Control 33.99±2.51 33.28±4.67 28.87±0.28 32.05±1.92Rifampicin 54.09±2.75 61.74±1.27b 68.85±6.29c 85.59±3.26c

Rifampicin+Silymarin 33.13±3.42 35.65±4.33j 35.52±4.30k 43.11±8.65l

Pyrogallol 51.47±3.70 59.04±2.63a 59.30±8.99b 80.55±3.21c

Pyrogallol+Silymarin 38.99±2.51 32.57±1.92j 34.58±3.47j 49.57±8.26k

Rifampicin+Pyrogallol 63.49±5.18b 78.88±10.72c 80.39±17.25c 106.3±12.7c

Rifampicin+Pyrogallol+Silymarin 45.70±4.15 40.54±2.89l 40.72±3.92l 50.00±1.74l

Aspartate aminotransaminase (units/l)Treatment groupsControl 88.77±8.30 76.75±3.75 75.54±7.50 86.22±4.07Rifampicin 118.06±12.87 120.9±8.36b 137.0±19.84c 151.6±10.05c

Rifampicin+Silymarin 72.98±12.21k 83.54±5.98j 92.18±8.99k 104.5±8.12l

Pyrogallol 120.35±17.22a 118.9±5.11b 125.9±2.25c 153.1±6.23c

Pyrogallol+Silymarin 88.12±8.30j 86.94±3.36j 83.65±5.44k 84.51±3.70l

Rifampicin+Pyrogallol 135.83±8.74c,g 132.9±7.09c 162.6±6.77c,g 220.8±2.03c,f,i

Rifampicin+Pyrogallol+Silymarin 99.01±4.26j 95.83±2.85j 85.92±8.51l 121.4±2.45l

Total bilirubin (mg/dl)Treatment groupsControl 0.466±0.030 0.531±0.057 0.509±0.032 0.474±0.018Rifampicin 0.740±0.058b 0.849±0.060c 0.934±0.031c 1.114±0.039c

Rifampicin+Silymarin 0.480±0.080k 0.463±0.047l 0.514±0.059l 0.577±0.095l

Pyrogallol 0.661±0.070a 0.871±0.107c 0.905±0.053c 1.092±0.037c

Pyrogallol+Silymarin 0.435±0.019j 0.503±0.050l 0.469±0.023l 0.502±0.033l

Rifampicin+Pyrogallol 1.012±0.039c,e,i 1.313±0.044c,f,i 1.471±0.058c,f,i 1.603±0.097c,f,i

Rifampicin+Pyrogallol+Silymarin 0.667±0.014l 0.763±0.058l 0.865±0.025l 0.865±0.051l

Significant changes= treated vs. respective controls [a(P<0.05), b(P<0.01), c(P<0.001)], rifampicin+pyrogallol vs. rifampicin [d(P<0.05), e(P<0.01),f(P<0.001)]; rifampicin+pyrogallol treated vs. pyrogallol [g(P<0.05), h(P<0.01), i(P<0.001)] and silymarin vs. respective rifampicin and or pyrogallol[j(P<0.05), k(P<0.01), l(P<0.001)].

194 G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

P<0.001 for 2, 3 or 4 weeks of rifampicin treatment; P<0.05for 3 and 4 weeks of pyrogallol treatment; P<0.01, 0.01,0.001, 0.001 for 1, 2, 3 or 4 weeks of rifampicin+pyrogalloltreatment) (Fig. 4A and B). Silymarin significantly attenuatedthe rifampicin- and/or pyrogallol-mediated increase in CYP2E1expression (Fig. 4A and B). Rifampicin and pyrogallol eitheralone or in combination increased p-nitrophenol hydroxylationactivity as compared with controls following 1, 2, 3 or 4 weeksof treatment (P<0.001) (Fig. 4C). Rifampicin and pyrogallolco-exposure caused a cumulative increase in p-nitrophenolhydroxylation activity as compared with controls following 1,2, 3 or 4 weeks of treatment. Silymarin pretreatment caused asignificant attenuation of p-nitrophenol hydroxylation activityinduced by rifampicin and or pyrogallol (Fig. 4C).

3.5. Western blotting

Rifampicin and pyrogallol did not alter CYP1A1 expression(Fig. 2D and E); however, a significant increase in theexpression of CYP1A2 and CYP2E1 was observed followingrifampicin and/or pyrogallol exposure (Figs. 3D, E, 4D and E).Rifampicin alone did not alter CYP1A2 protein expression, asobserved from mRNA expression (Fig. 3A and B). Combina-tional treatment augmented the pronounced expression of

CYP1A2 and CYP2E1 as compared with either treatment alone.Silymarin attenuated the rifampicin- and/or pyrogallol-mediated increase in the expression of CYP1A2 and CYP2E1(Figs. 3D, E and 4D and E).

3.6. Glutathione-S-transferase activity

Rifampicin treatment decreased glutathione-S-transferaseactivity significantly during the entire course of the study;however, the pyrogallol-mediated decrease was evident after1 week of treatment (P<0.01, 0.01, 0.001 and 0.001 for 1,2, 3 or 4 weeks rifampicin treatment; P<0.01, 0.001 and0.001 for 2, 3 or 4 weeks pyrogallol treatment) (Fig. 5).The effect was more pronounced when rifampicin andpyrogallol were given in combination (P<0.001 for 1, 2, 3or 4 weeks of treatment). Silymarin pretreatment reversedthe change in glutathione-S-transferase activity in rifampicin-and/or pyrogallol-treated groups up to the level of controls(Fig. 5).

3.7. Glutathione reductase activity

Rifampicin and pyrogallol alone or in combination attenu-ated glutathione reductase activity as compared with controls. A

Fig. 2. Effect of rifampicin, pyrogallol, and silymarin on CYP1A1 expression and activity. CYP1A1mRNA expression (A), bar diagrams showing band density ratio ofCYP1A1/GAPDH mRNA (B), bar diagrams showing CYP1A1 catalytic activity (C), Western blots of CYP1A1 expression (D) and bar diagrams showing relativeCYP1A1 expression (E). Lanes 1, 8, 15 and 22 – controls (C), lanes 2, 9, 16 and 23 – rifampicin (R); lanes 3, 10, 17 and 24 – rifampicin (R)+silymarin (S);lanes 4, 11, 18 and 25 – pyrogallol (P); lanes 5, 12, 19 and 26 – pyrogallol (P)+silymarin (S); lanes 6, 13, 20 and 27 – rifampicin (R)+pyrogallol (P) and lanes 7, 14,21 and 28 – rifampicin (R)+pyrogallol (P)+silymarin (S) respectively in (b) and (d) represent groups treated for 1, 2, 3 or 4 weeks. The data are expressed as means±S.E.M. (n=3–5 separate experiments).

195G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

significant decrease in glutathione reductase activity followingrifampicin and pyrogallol treatment was observed only after4 weeks of treatment (P<0.01 for rifampicin; P<0.05 forpyrogallol) (Fig. 6). Rifampicin and pyrogallol in combinationdecreased glutathione reductase activity even after 1 week oftreatment (P<0.05, 0.05, 0.01 and 0.001 for 1, 2, 3 or 4 weeksof treatment, respectively). Silymarin pretreatment attenuatedthe reduction in glutathione reductase activity in the above-mentioned treated groups (Fig. 6).

3.8. Glutathione peroxidase activity

Rifampicin and pyrogallol administration significantlyattenuated glutathione peroxidase activity after 2, 3 or4 weeks of treatment (P<0.001 for 2, 3 and 4 weeks ofrifampicin treatment; P<0.05, 0.01 and 0.001 respectively for2, 3 and 4 weeks of pyrogallol treatment) (Fig. 7). A synergisticeffect on glutathione peroxidase activity was observed from thesecond to fourth week in the cotreated groups (P<0.001).

Fig. 3. Effect of rifampicin, pyrogallol, and silymarin on CYP1A2 expression and activity. CYP1A2 mRNA expression (A), band density ratios of CYP1A2/GAPDHmRNA (B), CYP1A2 catalytic activity (C), Western blots of CYP1A2 (D) and relative CYP1A2 protein expression (E). Lanes 1, 8, 15 and 22 – controls, lanes 2, 9, 16and 23 – rifampicin (R); lanes 3, 10, 17 and 24 – rifampicin (R)+silymarin (S); lanes 4, 11, 18 and 25 – pyrogallol (P); lanes 5, 12, 19 and 26 – pyrogallol (P)+silymarin (S); lanes 6, 13, 20 and 27 – rifampicin (R)+pyrogallol (P) and lanes 7, 14, 21 and 28 – rifampicin (R)+pyrogallol (P)+silymarin (S) respectively in (b)and (d) represent groups treated for 1, 2, 3 or 4 weeks. The data are expressed as means±S.E.M. (n=3–5 separate experiments) and significant changes are expressedas treated versus respective controls (C) [⁎⁎(P<0.01), ⁎⁎⁎(P<0.001)], rifampicin (R)+pyrogallol (P) versus rifampicin (R) [#(P<0.05), ##(P<0.01), ###(P<0.001)]and silymarin (S) versus respective rifampicin (R) and/or pyrogallol (P) [$(P<0.05), $$(P<0.01), $$$(P<0.001)].

196 G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

Silymarin pretreatment reversed the reduction in glutathioneperoxidase activity in the treatment groups (Fig. 7).

3.9. Lipid peroxidation

Lipid peroxidation was significantly increased in therifampicin- and pyrogallol co-treated groups following 1, 2, 3

or 4 weeks of treatment as compared with controls (P<0.001).Rifampicin significantly increased lipid peroxidation after4 weeks of treatment (P<0.001), whereas pyrogallol enhancedlipid peroxidation after 2, 3 or 4 weeks of treatment (P<0.001,0.01 and 0.001) (Fig. 8). Silymarin pretreatment attenuated therifampicin- and/or pyrogallol-induced augmentation of lipidperoxidation (Fig. 8).

197G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

4. Discussion

The increase in markers of hepatic injury, such as serumtransaminase activity, bilirubin content (Table 1) and histolo-gical damage (data not shown), following pyrogallol and

Fig. 4. Effect of rifampicin, pyrogallol, and silymarin on CYP2E1 expression and acmRNA (B), CYP2E1 catalytic activity (C), Western blots of CYP2E1 (D) and relativeand 23 – rifampicin (R); lanes 3, 10, 17 and 24 – rifampicin (R)+silymarin (S); la+silymarin (S); lanes 6, 13, 20 and 27 – rifampicin (R)+pyrogallol (P) and lanes 7, 1and (d) represent groups treated for 1, 2, 3 or 4 weeks. The data are expressed as meaas treated versus respective controls (C) [⁎(P<0.05), ⁎⁎(P<0.01),⁎⁎⁎(P<0.001)],###(P<0.001)]; rifampicin (R)+pyrogallol (P) versus pyrogallol (P) [τ(P<0.05), ττ(Por pyrogallol (P) [$(P<0.05), $$(P<0.01), $$$(P<0.001)].

rifampicin exposure clearly demonstrated that rifampicin andpyrogallol induce hepatotoxicity. The increase in hepaticmarkers was more pronounced in pyrogallol+ rifampicin-treated animals than in animals treated with either drug alone,showing that these agents share a common mechanism of

tivity. CYP2E1 mRNA expression (A), band density ratios of CYP2E1/GAPDHCYP2E1 protein expression (E). Lanes 1, 8, 15 and 22 – controls, lanes 2, 9, 16nes 4, 11, 18 and 25 – pyrogallol (P); lanes 5, 12, 19 and 26 – pyrogallol (P)4, 21 and 28 – rifampicin (R)+pyrogallol (P)+silymarin (S) respectively in (b)ns±S.E.M. (n=3–5 separate experiments) and significant changes are expressedrifampicin (R)+pyrogallol (P) versus rifampicin (R) [#(P<0.05), ##(P<0.01),<0.01), τττ(P<0.001)] and silymarin (S) versus respective rifampicin (R) and/

Fig. 5. Alteration in glutathione-S-transferase activity (n=3–5 separate experiments). The data are expressed as means±S.E.M. and significant changes are expressedas treated versus respective controls (C) [⁎⁎(P<0.01), ⁎⁎⁎(P<0.001)], rifampicin (R)+pyrogallol (P) versus rifampicin (R) [#(P<0.05), ###(P<0.001)]; rifampicinversus (R)+pyrogallol (P) versus pyrogallol (P) [τττ(P<0.001)] and silymarin (S) versus respective rifampicin (R) and or pyrogallol (P) [$(P<0.05), $$(P<0.01),$$$(P<0.001)].

198 G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

hepatotoxicity. Silymarin attenuated the pyrogallol- and rifam-picin-induced increase in serum transaminase activity, bilirubincontent and histological aberrations, showing that silymarin hashepatoprotective potential against these hepatotoxins. Sinceexogenous and endogenous substances covalently bind withdrugs and their intermediary metabolites and alter the level ofhepatic proteins, including CYP1A1, CYP1A2, CYP2E1 andglutathione-S-transferase (Ahmed and Pawar, 1997; Pond,1984; Kumar et al., 2006; Guengerich and Shimada, 1991),the effect of rifampicin and pyrogallol on the expression andcatalytic activity of these enzymes were measured in order toassess their involvement in hepatotoxicity. The lack of asignificant alteration in CYP1A1 expression and activity clearlyshowed that CYP1A1 probably does not participate in themetabolism of rifampicin and/or pyrogallol. This finding is alsoin accordance with the fact that CYP1A1 is usually involved inthe hydroxylation of carcinogens such as polyaromatic hydro-carbons and estrogens (Masson et al., 2005). Rifampicin alonedid not alter the level of CYP1A2; however, pyrogallol andpyrogallol+ rifampicin induced its expression. The co-treat-ment-induced increase in CYP1A2 expression may be becausepyrogallol probably initiated CYP1A2 over-expression andrifampicin may have had an additional effect on CYP1A2expression when administered in combination with pyrogallol.The results showed the involvement of CYP1A2 in themetabolism of these agents and of pyrogallol in particular. Asignificant increase in CYP2E1 expression and activity was

Fig. 6. Alteration in glutathione reductase activity (n=3–5 separate experiments). Thetreated versus respective controls (C) [⁎(P<0.05), ⁎⁎(P<0.01), ⁎⁎⁎(P<0.001)], rif+pyrogallol (P) versus pyrogallol (P) [τ(P<0.05)] and silymarin (S) versus respectiv

observed and co-treatment elicited a greater effect thantreatment with individual agents, indicating the involvementof CYP2E1 in both rifampicin and pyrogallol metabolism. Theincrease in the expression and catalytic activity of CYP2E1suggested that rifampicin and pyrogallol share some commonmetabolic pathway leading to free radical generation andthereby oxidative stress. Free radical generation could beexplained on the basis of earlier reports implicating theinvolvement of CYP2E1 in the metabolic regulation ofxenobiotics by inducing the synthesis of aldehydes from lipidhydroperoxides and ketone bodies, the metabolism of exogen-ous fatty acids and the generation of nucleophiles (Patel et al.,2006; Mari and Cederbaum, 2001; Montoliu et al., 1995;Lieber, 1997).

The significant and consistent increase in lipid peroxidationfollowing rifampicin and pyrogallol exposure alone or incombination could be due to free radicals generated by CYP2E1and CYP1A2. The increase in lipid peroxidation followingpyrogallol exposure is in accordance with previous reports(Joharapurkar et al., 2004). The increase in lipid peroxidationcould be correlated with the increase in CYP2E1 and CYP1A2in general and with the increase in CYP2E1 in particular.CYP2E1 is known to mediate reactions resulting in a significantrelease of free radicals, which, in turn, diminishes reducedglutathione and increases lipid peroxidation (Mari and Ceder-baum, 2001; Lieber, 1997, 2004). Silymarin prevents the freeradical generation and oxidative damage induced by a variety of

results are expressed as means±S.E.M. and significant changes are expressed asampicin (R)+pyrogallol (P) versus rifampicin (R) [#(P<0.05)]; rifampicin (R)e rifampicin (R) and or pyrogallol (P) [$(P<0.05), $$(P<0.01), $$$(P<0.001)].

Fig. 7. Alteration in glutathione peroxidase activity (n=3–5 separate experiments). The data are expressed as means±S.E.M. and significant changes are expressed astreated versus respective controls (C) [⁎(P<0.05), ⁎⁎(P<0.01), ⁎⁎⁎(P<0.001)], rifampicin (R)+pyrogallol (P) versus rifampicin (R) [#(P<0.05)]; rifampicin (R)+pyrogallol (P) versus pyrogallol (P) [ττ(P<0.01), τττ(P<0.001)] and silymarin (S) versus respective rifampicin (R) and or pyrogallol (P) [$(P<0.05),$$(P<0.01), $$$(P<0.001)].

199G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

compounds (Thabrew et al., 1997; Shear et al., 1995; Roy et al.,2006). Glutathione peroxidase activity was significantly andprogressively decreased in an exposure time-dependent mannerthat could lead to insufficient protection against cytotoxic lipidperoxides and might be responsible for hepatic cell damage.Glutathione-S-transferase and glutathione peroxidase are alsoinvolved in lipid peroxidation, and glutathione reductase plays acentral role in detoxification of lipid peroxides (Hubatsch et al.,1998; Mirault et al., 1991; Geiger et al., 1993; Reinke et al.,1990). The decrease in glutathione-S-transferase activityfollowing rifampicin and/or pyrogallol exposure is probablydue to increased lipid peroxidation since lipid peroxidationbyproducts cause covalent modification of glutathione-S-transferase (Harris and Stone, 1988).

Alternatively, the decreased activity of glutathione-S-trans-ferase, glutathione reductase and glutathione peroxidase couldbe due CYP2E1-mediated free radical generation duringrifampicin and pyrogallol metabolism, which diminishes theglutathione level. It is also possible that CYP2E1 mediated thegeneration of reactive oxygen species (ROS) in rifampicin- andpyrogallol-induced hepatotoxicity since CYP2E1 is an impor-tant contributor to oxygen free radicals due to its unusually highNADH oxidase activity and low levels of GSH activity (Mari etal., 2002; Micu et al., 2003). CYP1A2 is also an importantcontributor to free radical generation (Schlezinger et al., 1999)and an increase in CYP1A2 expression could lead to ROSgeneration. CYP2E1- and CYP1A2-mediated ROS generation

Fig. 8. Alteration in lipid peroxidation activity (n=3–5 separate experiments). Thetreated versus respective controls (C) [⁎⁎(P<0.01), ⁎⁎⁎(P<0.001)], rifampicin (R)rifampicin (R)+pyrogallol (P) versus pyrogallol (P) [τττ(P<0.001)] and silymarin (S$$$(P<0.001)].

following rifampicin and/or pyrogallol exposure could beresponsible for the hepatotoxicity, and silymarin modulatedthe effect of individual and combined exposure to rifampicinand/or pyrogallol by preventing CYP2E1- and CYP1A2-mediated free radical generation and by scavenging free radicalssince silymarin also restored glutathione-S-transferase, glu-tathione reductase and glutathione peroxidase levels inpyrogallol- and/or rifampicin-induced hepatotoxicity. Theinhibition of the antioxidant defense system shown in thisstudy further suggested how inhibition of the antioxidantdefense could be responsible for rifampicin- and pyrogallol-induced hepatotoxicity. The hepatic injury produced bypyrogallol or rifampicin could be due to membrane damage,as indicated by increased serum markers, suppression of theantioxidant defense system by increased lipid peroxidation, ormetabolic activation by CYP1A2 and CYP2E1 (Schlezingeret al., 1999; Tasduq et al., 2005). The hepatoprotective potentialof silymarin could be due to its antioxidant property andinhibitory potential on liver enzymes or mitochondria function(Gupta et al., 2002, 2004; Davila et al., 1989; Rolo et al., 2003).Silymarin restored the rifampicin- and/or pyrogallol-inducedalterations, which indicates that herbal products could be usedto avoid individual or combined drug-induced toxicity, animportant clinical concern in modern medical science. Thestudy also highlighted that despite structural and functionaldissimilarities, rifampicin and pyrogallol possess a commonmechanism of hepatotoxicity and that silymarin is almost

data are expressed as means±S.E.M. and significant changes are expressed as+pyrogallol (P) versus rifampicin (R) [#(P<0.05), ##(P<0.01), ###(P<0.001)];) versus respective rifampicin (R) and or pyrogallol (P) [$(P<0.05), $$(P<0.01),

200 G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

equally powerful in modulating the hepatotoxicity generated bypyrogallol and/or rifampicin.

Acknowledgements

The authors sincerely thank the Council of Scientific andIndustrial Research (CSIR), New Delhi, India for providingresearch fellowship to Ghanshyam Upadhyay and AbhaiKumar.

References

Ahmed, R.S., Pawar, S.S., 1997. Effect of inducers on hepatic microsomalmixed function oxidase system of male rats during food restriction. Indian J.Exp. Biol. 35, 46–49.

Backman, J.T., Granfors, M.T., Neuvonen, P.J., 2006. Rifampicin is only a weakinducer of CYP1A2-mediated presystemic and systemic metabolism: studieswith tizanidine and caffeine. Eur. J. Clin. Pharmacol. 62, 451–461.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein–dyebinding. Anal. Biochem. 72, 248–254.

Carlberg, I., Mannervik, B., 1985. Glutathione reductase. Methods Enzymol.113, 484–490.

Choudhary, D., Jansson, I., Stoilov, I., Sarfarazi, M., Schenkman, J.B., 2005.Expression patterns of mouse and human CYP orthologs (families 1–4)during development and in different adult tissues. Arch. Biochem. Biophys.436, 50–61.

Chowdhury, A., Santra, A., Bhattacharjee, K., Ghatak, S., Saha, D.R., Dhali, G.K.,2006. Mitochondrial oxidative stress and permeability transition in isoniazidand rifampicin induced liver injury in mice. J. Hepatol. 45, 117–126.

Davila, J.C., Lenherr, A., Acosta, D., 1989. Protective effect of flavonoids ondrug-induced hepatotoxicity in vitro. Toxicology 57, 267–286.

Fan, Q., Ding, J., Zhang, J., Guan, N., Deng, J., 2004. Effect of the knockdownof podocin mRNA on nephrin and alpha-actinin in mouse podocyte. Exp.Biol. Med. 229, 964–970.

Ferenci, P., Dragosics, B., Dittrich, H., Frank, H., Benda, L., Lochs, H., Meryn,S., Base, W., Schneider, B., 1989. Randomized controlled trial of silymarintreatment in patients with cirrhosis of the liver. J. Hepatol. 9, 105–113.

Geiger, P.G., Lin, F., Girotti, A.W., 1993. Selenoperoxidase-mediatedcytoprotection against the damaging effects of tert-butyl hydroperoxide onleukemia cells. Free Radic. Biol. Med. 14, 251–266.

Graham, R.A., Tyler, L.O., Krol, W.L., Silver, I.S., Webster, L.O., Clark, P.,Chen, L., Banks, T., LeCluyse, E.L., 2006. Temporal kinetics andconcentration–response relationships for induction of CYP1A, CYP2B,and CYP3A in primary cultures of beagle dog hepatocytes. J. Biochem. Mol.Toxicol. 20, 69–78.

Guengerich, F.P., Shimada, T., 1991. Oxidation of toxic and carcinogenicchemicals by human cytochrome P-450 enzymes. Chem. Res. Toxicol. 4,391–407.

Gupta, Y.K., Sharma, M., Chaudhary, G., 2002. Pyrogallol-induced hepato-toxicity in rats: a model to evaluate antioxidant hepatoprotective agents.Methods Find. Exp. Clin. Pharmacol. 24, 497–500.

Gupta, Y.K., Sharma, M., Chaudhary, G., Katiyar, C.K., 2004. Hepatoprotectiveeffect of New Livfit, a polyherbal formulation, is mediated through its freeradical scavenging activity. Phytother. Res. 18, 362–364.

Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferase. Thefirst enzymatic step in mercapturic acid formation. J. Biol. Chem. 249,7130–7139.

Harris, C.M., Stone, W.L., 1988. The effect of in vitro lipid peroxidation on theactivity of rat liver microsomal glutathione S-transferase from ratssupplemented or deficient in antioxidants. Life Sci. 42, 415–420.

Hubatsch, I., Ridderstrom, M., Mannervik, B., 1998. Human glutathionetransferase A4-4: an alpha class enzyme with high catalytic efficiency in theconjugation of 4-hydroxynonenal and other genotoxic products of lipidperoxidation. Biochem. J. 330, 175–179.

Joharapurkar, A.A., Wanjari, M.M., Dixit, P.V., Zambad, S.P., Umathe, S.N.,2004. Pyrogallol: a novel tool for screening immunomodulators. Indian J.Pharmacol. 36, 355–359.

Koop, D.R., 1986. Hydroxylation of p-nitrophenol by rabbit ethanol-induciblecytochrome-P450 isozyme 3a. Mol. Pharmacol. 29, 399–404.

Kumar, A., Patel, S., Gupta, Y.K., Singh, M.P., 2006. Involvement ofendogenous nitric oxide in myeloperoxidase mediated benzo(a)pyreneinduced polymorphonuclear leukocytes injury. Mol. Cell. Biochem. 286,43–51.

Lieber, C.S., 1997. Cytochrome P-4502E1: its physiological and pathologicalrole. Physiol. Rev. 77, 517–544.

Lieber, C.S., 2004. The discovery of the microsomal ethanol oxidizing systemand its physiologic and pathologic role. Drug Metab. Rev. 36, 511–529.

Liu, Z.W., Hu, Z.H., Cai, Y.Y., 2005. The combined effect of isoniazid andrifampicin on the activities of CYP4501A2 and CYP4503A4 in primaryhepatocytes from healthy human adults. Zhonghua Jiehe He Huxi Zazhi 28,785–788.

Mari, M., Cederbaum, A.I., 2001. Induction of catalase, alpha, and microsomalglutathione S-transferase in CYP2E1 overexpressing HepG2 cells andprotection against short-term oxidative stress. Hepatology 33, 652–661.

Mari, M., Bai, J., Cederbaum, A.I., 2002. Adenovirus-mediated over-expressionof catalase in the cytosolic or mitochondrial compartment protects againsttoxicity caused by glutathione depletion in HepG2 cells expressingCYP2E1. J. Pharmacol. Exp. Ther. 301, 111–118.

Masson, L.F., Sharp, L., Cotton, S.C., Little, J., 2005. Cytochrome P-4501A1gene polymorphisms and risk of breast cancer: a HuGE review. Am. J.Epidemiol. 161, 901–915.

Micu, A.L., Miksys, S., Sellers, E., Koop, D.R., Tyndale, R.F., 2003. HepaticCYP2E1 is induced by very low nicotine doses: an investigation ofinduction, time course, dose response and mechanism. J. Pharmacol. Exp.Ther. 306, 941–947.

Mirault, M.E., Tremblay, A., Beaudoin, N., Tremblay, M., 1991. Over-expression of seleno-glutathione peroxidase by gene transfer enhances theresistance of T47D human breast cells to clastogenic oxidants. J. Biol.Chem. 266, 20752–20760.

Montoliu, C., Sancho-Tello, M., Azorin, I., Burgal, M., Valles, S., Renau-Piqueras, J., Guerri, C., 1995. Ethanol increases cytochrome P4502E1 andinduces oxidative stress in astrocytes. J. Neurochem. 65, 2561–2570.

Muzes, G., Deak, G., Lang, I., Nekam, K., Niederland, V., Feher, J., 1990. Effectof silimarin (Legalon) therapy on the antioxidant defense mechanism andlipid peroxidation in alcoholic liver disease (double blind protocol). Orv.Hetil. 131, 863–866.

Ohkawa, H., Ohishi, N., Yagi, K., 1979. Assay for lipid peroxides in animaltissues by thiobarbituric acid reaction. Anal. Biochem. 95, 351–358.

Patel, S., Singh, V., Kumar, A., Gupta, Y.K., Singh, M.P., 2006. Status ofantioxidant defense system and expression of toxicant responsive genes instriatum of maneb- and paraquat-induced Parkinson's disease phenotype inmouse: mechanism of neurodegeneration. Brain Res. 1081, 9–18.

Pohl, R.J., Fouts, J.R., 1980. A rapid method for assaying the metabolism of 7-ethoxyresorufin by microsomal subcellular fractions. Anal. Biochem. 107,150–155.

Pond, S.M., 1984. Pharmacokinetic drug interactions. In: Bebet, L.Z., Massoud,N., Gambertoglio, J.G. (Eds.), Pharmacokinetic Basis for Drug Treatment.Raven Press, New York, pp. 195–220.

Rana, S.V., Attri, S., Vaiphei, K., Pal, R., Attri, A., Singh, K., 2006. Role of N-acetylcysteine in rifampicin-induced hepatic injury of young rats. World J.Gastroenterol. 12, 287–291.

Reinke, L.A., Rau, J.M., McCay, P.B., 1990. Possible roles of free radicals inalcoholic tissue damage. Free Radic. Res. Commun. 9, 205–211.

Rolo, P.A., Oliveira, P.J., Moreno, A.J.M., Palmeira, C.M., 2003. Protectionagainst post-ischemic mitochondrial injury in rat liver by silymarin orTUDC. Hepatol. Res. 26, 217–224.

Roy, C.K., Kamath, J.V., Asad, M., 2006. Hepatoprotective activity of Psidiumguajava Linn. leaf extract. Indian J. Exp. Biol. 44, 305–311.

Schlezinger, J.J., White, R.D., Stegeman, J.J., 1999. Oxidative inactivation ofcytochrome P-450 1A (CYP1A) stimulated by 3,3′,4,4′-tetrachlorobiphenyl:production of reactive oxygen by vertebrate CYP1As. Mol. Pharmacol. 56,588–597.

201G. Upadhyay et al. / European Journal of Pharmacology 565 (2007) 190–201

Seree, E.M., Villard, P.H., Re, J.L., De Meo, M., Lacarelle, B., Attolini, L.,Dumenil, G., Catalin, J., Durand, A., Barra, Y., 1996. High inducibility ofmouse renal CYP2E1 gene by tobacco smoke and its possible effect onDNA single strand breaks. Biochem. Biophys. Res. Commun. 219,429–434.

Shear, N.H., Malkiewicz, I.M., Klein, D., Koren, G., Randor, S., Neuman, M.G.,1995. Acetaminophen-induced toxicity to human epidermoid cell line A431and hepatoblastoma cell line Hep G2, in vitro, is diminished by silymarin.Skin Pharmacol. 8, 279–291.

Tasduq, S.A., Peerzada, K., Koul, S., Bhat, R., Johri, R.K., 2005. Biochemicalmanifestations of anti-tuberculosis drugs induced hepatotoxicity and theeffect of silymarin. Hepatol. Res. 31, 132–135.

Thabrew, M.I., Hughes, R.D., McFarlane, I.G., 1997. Screening of hepatopro-tective plant components using a HepG2 cell cytotoxicity assay. J. Pharm.Pharmacol. 49, 1132–1135.

Victorrajmohan, C., Pradeep, K., Karthikeyan, S., 2005. Influence of silymarinadministration on hepatic glutathione-conjugating enzyme system in ratstreated with antitubercular drugs. Drugs R&D 6, 395–400.

Wendel, A., 1980. Glutathione peroxidase. In: Jakoby, W.B. (Ed.), EnzymaticBasis of Detoxication. Academic Press, New York, pp. 333–348.