factor IIIA has a non-B-form structure

The EMBO Journal vol.8 no.6 pp. 1 809 - 1817, 1989

The DNA binding site of the Xenopus transcriptionfactor IIIA has a non-B-form structure

Louise Fairall, Stephen Martin' andDaniela Rhodes

MRC Laboratory of Molecular Biology, Hills Road, CambridgeCB2 2QH and 'National Institute for Medical Research, TheRidgeway, Mill Hill, London NW7 IAA, UK

Communicated by A.Klug

On the basis of nuclease digestion studies we proposedthat the DNA binding site of transcription factor lIA(TFIIHA) may have an overall structure with A-typerather than B-type characteristics. This proposal was

substantiated by the crystal structure of a part of theTFlA binding site. Recently, however, it has beenreported that the binding site for TUEIA is B-form insolution, thus implying that the conformation present incrystals is not the structure in solution. We have carriedout a study using comparative circular dichroism (CD)spectroscopy of a number of double stranded deoxyoligo-nucleotides of different sequence, and known crystalstructure. The correlation we have found between CDcharacteristics and certain structural parametersindicates that the solution and crystal structures of theTFIIIA binding site are closely related. This structuremay be classed as an intermediate type, between A-formand B-form DNA.Key words: comparative CD analysis/DNA crystalstructures/intermediate helix conformations/TFIIIA/sequencespecific recognition

Introduction

What are the structural features of the DNA double helixthat allow a sequence-specific DNA binding protein todiscriminate between its binding site and other regions ofthe genome? The information at atomic resolution obtainedfrom X-ray diffraction studies of single crystals of shortDNA fragments has established that the structure of the DNAdouble helix varies from base pair to base pair and is highlydependent on nucleotide sequence, as distinct from thearchetypal and regularly repeating global forms, A andB, derived from X-ray fibre studies of mixed sequenceDNA (reviewed in Drew et al., 1988; Kennard and Hunter,1988). Solution studies using nucleases to probe DNAstructure (Lomonossoff et al., 1981; Drew and Travers,1984) and measurements of the helical periodicity (Peckand Wang, 1981; Rhodes and Klug, 1981) also demonstratethat the structure of DNA is dependent on its sequence.Consequently, different sequences will tend to producedifferent local and global structural characteristics thatare likely to be primary determinants of sequence specificrecognition by a protein, rather than recognition of the basesthemselves. The importance of sequence on the shape of theDNA helix required for sequence specific recognition has

been beautifully revealed by X-ray analysis of severalprotein -DNA co-crystals: EcoRI (Frederick et al., 1984),434 repressor (Aggarwal et al., 1988), X-repressor (Jordanand Pabo, 1988) and trp repressor (Otwinowski et al., 1988).This paper focuses on the characterization of the structureof the DNA binding site for the Xenopus transcription factormIA (TFHIA).TFIIA is required for the correct initiation of transcription

of 5S RNA genes by RNA polymerase HI. Its binding siteis -50 bp long and located within the gene, betweenpositions 43 and 96 (Brown, 1982). In addition, TFiIIAinteracts with the gene product, 5S RNA, to form a 7Sstorage particle (Picard and Wegnez, 1979). We proposedon the basis of solution studies and because of the dualrecognition of DNA and RNA, that the TFiIA binding siteon the DNA may have an overall or global structure withcharacteristics of A-type rather than B-type DNA (Rhodesand Klug, 1986). The DNase I cutting pattern of the TFIIIAbinding site reveals two important structural features. Firstly,the binding site contains a structural repeat of about halfa double helical turn (5.6 bp) which originates in theoccurrence in the non-coding strand of short runs ofguanines, also located five or six nucleotides apart. Therepetition in DNA structure corresponds to the repetitivestructure of the protein TFIIA, which contains nine tandemzinc-finger domains that appear to make repeated contactswith about the same periodicity in the major groove of theDNA double helix (Miller et al., 1985; Fairall et al., 1986;reviewed in Klug and Rhodes, 1987). Secondly, the locationof DNase I cuts on the two strands across the minor groovecorrelate with an average stagger of about only onenucleotide, rather than the two or three usually seen formixed sequence DNA, indicating the presence of an unusualconformation consistent with A-type DNA.

This proposal of an A-type global structure wassubstantiated by the determination of the three-dimensionalstructure of a part of the TFLIIA binding site, the doublestranded nonamer sequence d(8"GGATGGGAG89) by singlecrystal X-ray diffraction analysis. This fragment, which isparticularly important for TFIIIA binding (reviewed inBrown, 1982), corresponds to almost two of the 5 bp repeatdescribed above, and has a crystal structure most similar todouble helical A'-RNA (McCall et al., 1986). The presenceof an RNA-like structure in the DNA binding site offers asimple explanation for how TFIIIA recognizes both.

Recently the results of solution and crystallographic studiesdescribed above have been challenged by two solutionstudies. Gottesfeld et al. (1987) have used circular dichroism(CD) spectroscopy to study the 54 bp TFHIA binding siteand interpreted the resulting spectrum to be showing B-formDNA. Aboul-ela et al. (1988), from their study using bothnuclear magnetic resonance (NMR) and CD to analyse afragment containing two tandem copies of the nonamerd(GGATGGGAG) part of the TFIIA binding site, have alsoconcluded it is B-form, thus implying that the A-type

1809

L.Fairall, S.Martin and D.Rhodes

WavelengthFig. 1. The nonamer d(GGATGGGAG) and the 54 bp TFIHA bindingsite d(ATCTCGGGAAGCCAAGCAGGGTCGGGCCTGGTTAGT-ACTTGGATGGGAGACCGAT) have the same global structure. CDspectra were recorded in the same low salt buffer at 4°C for thenonamer fragment (-*-) and the TFIIIA binding site (-*-).Spectra recorded at 24°C were indistinguishable.

4.00

E

3.00220 Wavelength 320

Fig. 2. The crystallization buffer containing 40% MPD does not causechanges in the structure of the nonamer d(GGATGGGAG). CDspectra were recorded at 24°C in low salt buffer (-*-);4 x crystallization buffer including 40% MPD (- *) and inTris-EDTA buffer (-O-). Also shown are the spectra recorded inbinding buffer and crystallization buffer.

conformation determined by McCall et al. (1986) is inducedin the crystal and is not the structure present in solution.

In order to resolve this disagreement and extend ourprevious study (Rhodes and Klug, 1986) we have carriedout a comparative CD study of the whole TFIIIA bindingsite (54 bp), the nonamer d(GGATGGGAG) part of the bind-ing site and several other double stranded deoxyoligonucleo-tides of known crystal structures. Our data show that theTFIIIA binding site in solution has a CD spectrum that isan intermediate between that of B-form and A-form DNA.Analysis of the mean structural parameters of d(GGATGGGAG) in the crystal classes this structure as an intermediatebetween the archetypal B-form and A-form of DNA fibres(McCall et al., 1986). Thus, there is consistency betweenthe results of crystal and solution structural analyses.

What can CD spectroscopy reveal about theconformation of the DNA double helix?The assignment of the B-form and A-form reference spectrawas achieved almost 20 years ago by carrying out CD andX-ray analyses of DNA gels at high humidity (in low saltbuffer) or at low humidity (in 80-85 % ethanol) respectively(Tunis-Schneider and Maestre, 1970; Ivanov et al., 1973).The dramatically different characteristics shown by theB-form and A-form reference spectra (for an example seeFigure 3) can be related to the very different base stackinginteractions in the two DNA forms (Johnson et al., 1981).Consequently, CD measurements are very sensitive tochanges or differences in the geometrical relationshipbetween adjacent bases and may be used to obtaininformation about the type of global conformation a DNAsample has in solution.The use of CD in this study is aimed at detecting the

broader or global sequence dependent effects on the structureof short stretches of DNA (10-50 bp) in the order of sizerecognized by DNA binding proteins. For a short doublestranded DNA fragment the local sequence determinedbase-stacking interactions should add up to a distinct helixtype or structure and hence produce a characteristic CDspectrum for each sequence. Indeed this assumption is borneout by the results. To enable us to relate the effects ofdifferent helix types to the shape of the CD spectrum, wehave analysed several short DNA fragments whose precisethree-dimensional structure is known from single crystalX-ray analysis. First, simple comparison of CD spectraallowed us to ask if the structures of different sequences aresimilar or different. Then we compare the known structuralparameters of a sequence with the characteristics of its CDspectrum, in order to answer the question of how similarthe structure in solution is to that in the crystal.

ResultsThe nonamer d(GGATGGGAG) part of the TFLIA bindingsite as well as other short DNA fragments used in this studywere synthesized, purified and the double stranded formprepared as described in Materials and methods. Thereforenote that a sequence always refers to its double strandedform. The 54 bp TFIIIA binding site was produced inEscherichia coli. Because we are interested in understandingthe effects of sequence on the conformation of the DNAdouble helix, the CD spectrum of each sample was recordedin the same low salt buffer conditions (20 mM Tris-HCI,pH 7.5, 70 mM KCI, 2 mM MgCl2) and temperature (4and 24°C) so that spectra are directly comparable. Possibleeffects of organic solvent used for crystallization, such as2-methyl-2,4-pentanediol (MPD), on the conformation ofthese short fragments have also been investigated.

The structure of d(GGATGGGAG) is representative ofthe whole TFIIIA binding siteThe first aim of this study is to ask whether the structure ofthe nonamer d(81GGATGGGAG 89) crystallized by McCallet al. (1986) is representative of the whole of the 54 bpTFIIIA binding site: d(ATCTCGGGAAGCCAAGCAGGGTCGGGCCTGGTTAGTACTT8"GGATGGGAG89ACCGAT). Guanines have been underlined to show theperiodic occurrence of this base at about every five nucleo-tides of the non-coding strand. This periodicity gives rise

1810

iw ..

Structure of the DNA binding site of Xenopus TFIIIA

220 Wavelength 320

Fig. 3. Assignment of B-form and A-form reference spectra. CDspectra of the Drew-Dickerson d(CGCGAATTCGCG) (- * -);d(CGCAAAAAAGCG) (-O-); d(CGTAGATCTACG) (-A-); calfthymus DNA (-*-) and 5S RNA (-EL-), all recorded in low saltbuffer at 4°C, and the spectrum of calf thymus DNA (-V-) in 80%ethanol and Tris-EDTA at 24°C. We take the CD spectrum of theDrew-Dickerson fragment to represent B-form DNA and that of calfthymus mixed sequence DNA in 80% ethanol, A-form DNA.

to a corresponding structural repeat (Rhodes and Klug,1986). Figure 1 shows the CD spectrum of d(GGATGGGAG) and the 54 bp fragment of the TFIIIA binding sitemeasured in the same low salt buffer. The strong similaritybetween the spectra of the two fragments is consistent withthe nonamer d(GGATGGGAG) fragment having a globalhelix structure that is representative of the whole of theTFIIIA binding site. This is not unexpected if we considerthe repeated nature of the TFIIIA binding site (Rhodes andKlug, 1986).

Salt stabilizes the solution conformation of DNAIn an attempt to resolve the question of whether theglobal structure of the nonamer d(GGATGGGAG) partof the TFHIA binding site is the same in solution asthe one determined in the crystal, we have tested if thecrystallization buffer used by McCall et al. (1986)[10-40 mM MgCl2, 0.8-3.2 mM spermine-HCl, 10-40 mM sodium cacodylate (pH 6.5) and 10-50% MPD]causes dehydration and hence may induce the transition toA in analogy with classical DNA fibre studies. Theoccurrence of such a transition would explain both thepresence of an A-type conformation in crystals and thedisagreement with NMR and previous CD measurements thathave been interpreted as showing B-form in solution(Gottesfeld et al., 1987; Aboul-ela et al., 1988).

Figure 2 shows the CD spectrum of the nonamerd(GGATGGGAG) in crystallization buffer, together withmeasurements in several other buffers including bindingbuffer, which is the zinc-containing buffer used for bindingof TFIIIA to the 5S RNA gene (Miller et al., 1985) andin transcription (Hanas et al., 1983). The resulting CDspectra appear identical, which we take to indicate thatthe helix structure of d(GGATGGGAG) is essentially thesame in all buffers containing monovalent (K+ or Na+)and divalent (Mg2+) ions. These spectra were recordedat 24°C and are essentially the same as the one recorded

at 4°C (Figure 1). Even the rather extreme buffer conditionsapproximating those of crystallization, and containing upto 40% MPD, failed to cause a detectable structuralchange. Increasing the concentration of MPD to 50%causes precipitation of the DNA and consequently CDmeasurements could not be carried out. Only the removalof divalent ions through extensive dialysis against EDTAresults in a small but significant change in both CD intensityand lobe shape, suggesting that a structural change has takenplace.

Firstly, this set of measurements shows that the bufferconditions used in the crystallization of d(GGATGGGAG)do not cause a structural transition per se, in agreement withrecent results of Aboul-ela et al. (1988). This observationis not surprising if we consider that crystal structures,including those in the so-called A-type conformation, arehighly hydrated (McCall et al., 1986; Kennard and Hunter,1988). We have however no way of directly testing if, orhow, crystal packing forces affect the global conformationof short DNA fragments such as d(GGATGGGAG)(Rhodes, 1982; Dickerson et al., 1987). Nevertheless, fromthe good correlation we have found between solution CDmeasurements of a number of short DNA fragments ofdifferent sequence and their crystal structure (discussedbelow), it would appear that in many cases crystal packingforces do not significantly alter the global helix conformation.

Secondly, the observed change in CD upon removal ofK+ and Mg2+ often present together with spermine inbuffers used in crystallization, binding and transcriptionexperiments, suggests that these ions play a role (Diekmann,1987) in holding a sequence in a favourable helix con-formation for sequence specific recognition. This observationquestions the almost ubiquitous use of EDTA containingbuffers in the study of DNA structure in solution by CD,NMR and Raman spectroscopy (Thomas and Wang, 1988;Nilsson et al., 1986).

Assignment of A-form and B-form reference spectraFrom the CD analysis described above we have concludedthat d(GGATGGGAG) and the whole of the TFIIIA bindingsite have very similar global structure. If we wish to identifythe CD spectrum with a particular or specific helix type itis first necessary to assign reference spectra to the twoextreme helical conformations B-form and A-form DNA.Shown in Figure 3 are the CD spectra (recorded in the

same low salt buffer) of d(CGCGAATTCGCG) (Drew etal., 1981), d(CGCAAAAAAGCG) (Nelson et al., 1987) andd(CGTAGATCTACG) (Hunter et al., 1988). These threeDNA fragments have very similar crystal structures withmean parameters of B-form DNA and show spectra that arevery similar to each other. The positive maxima are locatedbetween 275 and 283 nm, the crossover points at - 270 nmand the ratios of positive to negative lobes (the positiveintensity divided by the negative intensity) are 0.26, 0.43and 0.57. For one of these fragments, d(CGCGAATTCGCG),there is reliable evidence from both a DNase I digestion study(Lomonossoff et al., 1981) and an NMR study (Patel et al.,1982) that the structure in solution is essentially the sameas that in the crystal, thus providing the link between CDanalysis and precise structural information. We will thereforeuse the CD spectrum of the Drew -Dickerson dodecamerd(CGCGAATTCGCG) as our reference spectrum for B-form DNA.

1811


6.00

'E

-5.00220 Wavelength 32

Fig. 4. The TFIIIA binding site shows a CD spectrum intermediate tothat of B-form and A-form DNA. CD spectra of the TFIIIA bindingsite (-*-) shown together with the B-form reference spectrum ofthe Drew-Dickerson d(CGCGAATTCGCG) (-* -), both recordedin low salt buffer at 4°C and the A-form reference spectrum of calfthymus DNA (-V-) and the TFIIIA binding site (-O-), bothrecorded in 80% ethanol at 24°C. The transition to the CD spectrumrepresenting A-form DNA takes place at 75% ethanol for both calfthymus DNA and TFIIIA binding site samples and did not showfurther changes in CD with increased ethanol concentration to 80%.

The CD spectrum of mixed sequence DNA recorded inlow salt buffer (Figure 3) shows a crossover point at 258 nmand a peak ratio of 0.76 and consequently is somewhatdifferent from that of the B-form d(CGCGAATTCGCG)(Figure 3). In previous studies, including that of Gottesfeldet al. (1987), the CD spectrum of mixed sequence DNA(recorded in EDTA) has been identified with the B-formmodel deduced from X-ray studies of DNA fibres or gels(Tunis-Schneider and Maestre, 1970). B-form DNA, asoriginally defined in fibres, has a helical repeat of 10.0 bp,whereas the measured helical repeat of mixed sequence DNAin solution is 10.56 bp (Rhodes and Klug, 1980; Peck andWang, 1981). This difference in helical repeat clearlyindicates that the conformation of DNA in fibres at highhumidity is not the same as in solution. We therefore believe,for the reasons given above, that the CD spectrum of theDrew -Dickerson dodecamer provides a better referencespectrum for strictly B-form conformation than does mixedsequence DNA. A misassignment of reference spectra clearlyaffects subsequent identification of a CD spectrum with oneor other particular helix type.

Figure 3 also shows the CD spectrum of 5S RNA togetherwith the spectrum of mixed sequence DNA in 80% ethanol.The positions of the positive maxima have shifted to lowerwavelengths, and the peak ratios are 2.1 to 5.7 and areconsequently considerably larger than the 0.43 value of theB-form reference spectrum. Following previous assignments(Tunis-Schneider and Maestre, 1970; Sprecher et al., 1989)and because mixed sequence DNA in 80% ethanol has aspectrum most similar to that of 5S RNA, which has aconformation restricted to A-form (Saenger, 1984), we takethis spectrum to represent A-form DNA.

Interestingly it was difficult to induce the transition to Aof both mixed sequence DNA and the 54 bp TFIIA bindingsite (Figure 4) and was not at all possible for the nonamerd(GGATGGGAG) fragment. The transition occurred at the

I500 I1

228 Wavelength 320Fig. 5. Sequence dependent effects on the characteristics of CDspectra. Spectra of d(CTCTAGAG) (- O -); d(GGTATACC)(-O-); d(GTGTACAC) (-A-) shown together with the B-formDrew-Dickerson d(CGCGAATTCGCG) (-* -) and the A-formcalf thymus DNA in 80% ethanol (-V-). All spectra were recordedin low salt buffer at 4°C except calf thymus DNA in 80% ethanolwhich was recorded at 24°C.

same ethanol concentration, 75 %, for both DNA samples,but only after extensive dialysis against EDTA to removeall Mg2+ (and other salts) prior to addition of ethanol.Again this suggests that the presence of Mg2+ and othersalts used in crystallization experiments stabilize the favouredsolution structure, even in the presence of organic solventssuch as MPD or ethanol (Gray et al., 1979).

The structure of the TFIIIA binding site is anintermediate between the archetypal B-form andA-form modelsShown in Figure 4 is the low salt CD spectrum of the 54 bpTFIIIA binding site together with the ascribed A-form andB-form reference spectra. Also shown is the CD spectrumof the TFIIIA binding site in 80% ethanol. Comparison ofthese spectra clearly shows that the TFIIIA binding site (inlow salt buffer) has a CD spectrum that is distinctly differentfrom that of B-form DNA, and has characteristics betweenthose of A-form and B-form DNA. The spectrum of theTFIIIA binding site is also considerably different from thatof mixed sequence DNA (Figure 3). In the CD spectrumof the TFIIIA binding sequence both the location of thepositive lobe and the crossover point are the same as in thespectrum representing A-form DNA. The ratio of positiveto negative lobe is 1.2 versus 0.43 for B-form DNA and2.1 for A-form DNA in 80% ethanol. Consistent with thepresence of an intermediate structure is the observation thaton going from low salt conditions to the similar spectra in80% ethanol, the change in CD is considerably smaller forthe TFIIA binding site than it is for mixed sequence DNA(Figures 3 and 4).

In order to better understand the effects of sequence onthe characteristics of a CD spectrum we have analyzed threeoctanucleotides of different sequence, but the same basecomposition and known crystal structure: d(GGTATACC)(Shakked et al., 1983), d(GTGTACAC) (Jain et al., 1987)and d(CTCTAGAG) (Hunter et al., 1989) (Figure 5). Thedifferences in CD demonstrate further that the characteristicsof a CD spectrum are determined by sequence as is helix

1812


-6.1220 Wavelength 320

Fig. 6. There is a range of sequence dependent helix structures insolution. CD spectra of: (1) d(CGCAAAAAAGCG) (-O-); (2)d(CGCGAATTCGCG) (-* -); (4) d(GTGTACAC) (-A-); (5)d(CTCTAGAG) (- O -); (6) the TFIIIA binding site (-*-); (7)d(GGTATACC) (-O-); and the Spl recognition sequenced(ATGGGCGGAGT) (-*-). These spectra were recorded in lowsalt buffer at 4°C. The range of spectra is flanked on one side by theB-form reference spectrum of d(CGCGAATTCGCG) (- * -) and onthe other by the A-form reference spectrum of calf thymus DNA in80% ethanol (-V-). The spectra of sequences that have knowncrystal structures are numbered in accordance with the numbering usedin Figures 7 and 8 to permit easy comparison. The crystal structure ofthe Spl binding site is not known.

structure. This is in agreement with the conclusions drawnfrom the pioneering CD and X-ray fibre studies of simplerepeating polymers (Wells et al., 1970; Leslie et al., 1980).

Figure 6 summarizes the CD measurements. The spectraof a number of sequences (from Figures 1, 3, 4 and 5)have been plotted together to facilitate comparison of CDcharacteristics. On going from right to left, we can see aprogression. The position of the positive maximum changesgradually from - 280 nm to lower wavelengths (260 nm)which is accompanied by a reduction in the depth of theminimum giving rise to an increase in peak ratio from -0.3to 1.2 to 2.1. In other words these fragments show a rangeof spectra stretching from the extreme B-form to the A-formreference spectra.Also shown in Figure 6 is the CD spectrum of

d(ATGGGCGGAGT) which is the consensus sequence forthe binding site of transcription factor SpI (Kadonaga et al.,1986; Rhodes and Klug, 1986). Interestingly, the CDspectrum of the Spl binding site is almost identical to thatof the TFLHA binding site, suggesting a structural similarityof these two binding sites, both of which are recognized byzinc-finger proteins (Kadonaga et al., 1987; Klug andRhodes, 1987).

In summary, the range of CD spectra of the fragmentsanalysed in this study is likely to reflect a range of differentsequence dependent helix structures. In particular, thesemeasurements indicate that the nonamer d(GGATGGGAT)part of the TFIHA binding site, as well as the whole of theTFIIIA binding site have a global structure in solution thatis an intermediate between the B-form and A-form modelsof DNA.

-c0<

._.

0

e..

[El

a..01

.SA=

.0

0 10 20Base pair tilt (0)

Fig. 7. The crystal structure of the d(GGATGGGAG) part of theTFIIIA binding site is an intermediate type between B-form andA-form DNA. The plot reveals a range of sequence dependent helixconformations present in crystal structures. The plot shows the meanstructural parameters of several crystal structures: (1)d(CGCAAAAAAGCG); (2) d(CGCGAATTGCCG); (3)d(GCCCGGGC) (Heinemann et al., 1987); (4) d(GTGTACAC)(M.Sundaralingam, personal communication); (5) d(CTCTAGAG); (6)d(GGATGGGAG) part of TFIIIA binding site; (7) d(GGTATACC);(8) d(GGGGCCCC) (McCall et al., 1985); (9) r(GCG)d(TATACGC)(Wang et al., 1982) together with the structural parameters of thearchetypal B-form and A-form fibre models. The same numbering ofsequences is used in Figures 6 and 8. For each structure the mean riseper base pair and major groove width have been plotted against basepair tilt angle. The mean structural parameters were calculated fromthe individual parameters of each base step (Kennard and Hunter,1988). References to crystal structures are given in the text. The plotis adapted from Heinemann et al. (1987). Note that the only crystalstructure that approximates to the archetypal A-form is that of theRNA-DNA hybrid (9).

DiscussionCorrelation of CD measurements and structuralparameters determined in crystals: a range of helixconformationsComparison of the CD spectra of several fragmentscontaining different sequences gives us an empirical measureof similarities and differences in their global helix structuresrelative to each other, and to the B-form and A-formreference spectra. Here we ask how similar or different toeach other are the crystal structures of the DNA fragmentswe have studied by CD, and further, is there a relationshipwith the characteristics of their CD spectra?

In Figure 3, as the intensity of the positive maximumincreases and shifts from 285 nm to 265 nm, the helicalrepeat increases from 10 bp (=36° helix winding angle)for the reference B-form d(CGCGAATTCGCG) fragment(Drew et al., 1981) to 10.56 bp (=340 helix winding angle)for mixed sequence DNA (Rhodes and Klug, 1980; Peckand Wang, 1981) to 11 and 12 bp (=33° and 300 helixwinding angle) of A-form DNA or RNA (Saenger, 1984).Thus there is an approximate correlation between helixwinding angle and the size and position of the positivemaximum (Ivanov et al., 1973; Baase and Johnson, 1979).Measurements of the helical repeat of the TFIIIA bindingsite in solution have shown it to be the same as that of mixed

1813


sequence DNA (Gottesfeld, 1987). However, the accuracyof these measurements appears to be too low for detectingthe small decrease in helix winding angle indicated by theCD measurements. The value given for the helical repeatin the crystal structure of the d(GGATGGGAG) part of theTFIIIA binding site is 11.5 bp (McCall et al., 1986).Because this value is calculated from a very short piece ofDNA and relies on the assignment of the global helix axis,it is likely to be inaccurate and cannot be compared directlywith the experimentally measured value for a long lengthof DNA. In addition, small structural movements in the orderof a few A in the crystal could affect this value considerably(Fratini et al., 1982; McCall et al., 1985).To permit simple comparison between the global helix

conformations seen in crystal structures of the variousfragments analysed in this study and the B-form and A-formDNA models, that is, to place the crystal structure ofd(GGATGGGAG) in the context of the structure of othersequences, in Figure 7 we have plotted the mean values forbase pair tilt against major groove width and rise per basepair of each oligonucleotide. At one extreme of the plot wefind the archetypal B-form model deduced from fibres witha base pair tilt angle relative to the imaginary helix axis of-2°, a rise per base pair of 3.4 A and a major groove widthof 11.4 A. At the other extreme of the plot are the parametersfor the archetypal A-form model with a base pair tilt of 220,a rise per base pair of - 2.6 A and a major groove widthof 2.5 A (Saenger, 1984). It is evident that the structuralparameters plotted are approximately correlated: a decreasein base pair tilt results in an increase in rise per base pairand the concomitant opening of the major groove. The plotin Figure 7 reveals a range of distinct, sequence determinedstructures: from those with essentially B-form parametersto a group of structures that have parameters intermediateto those of the B-form and A-form models. It should be notedthat, as none of these crystal structures have parameters closeto those of the archetypal A-form model derived from X-rayfibre studies, the customary classification of many of thesecrystal structures as A-form appears to us to be misleading.The plot also illustrates very clearly that the conformationof the DNA helix is not restricted to A or B but that acontinuum of global conformations are possible (Lauble etal., 1988). Thus, the range of helix conformation indicatedby our CD measurements (Figure 6) is also found in thecorresponding crystal structures.

If we now compare the position of the structure of anoligonucleotide in the plot shown in Figure 7 (eacholigonucleotide is represented by a number) with thecharacteristics of its CD spectrum in Figure 6 (spectra arenumbered with the oligonucleotide number used in Figure7) we can see that (1) d(CGCAAAAAAGCG) (Nelsonet al., 1987) and (2) the Drew-Dickerson dodecamerd(CGCGAATTCGCG) (Drew et al., 1981) have similarmean structural parameters and very similar B-type CDspectra. The octamer d(CTCTAGAG) (5) has intermediatestructural parameters (Hunter et al., 1989) and a non-B-formCD spectrum. Significantly, oligonucleotide (6), the nonamerd(GGATGGGAG) part of the TFIIIA binding site has in thecrystal mean structural parameters intermediate to those ofthe B-form and A-form models (McCall et al., 1986), inagreement with the intermediate character of its CD spec-trum in solution (Figures 4 and 6).We note however that for two of the three octamer

sequences used in this study, (4) d(GTGTACAC) (Jain etal., 1987) and (7) d(GGTATACC) (Shakked et al., 1983)there is disagreement between CD characteristics andstructural parameters. Both of these fragments show CDspectra (Figure 5) that indicate solution conformationssomewhat more B-like than their crystal structures. Both ofthese sequences contain bistable pyrimidine/purine steps, inparticular the TpA step (Klug et al., 1979; Calladine andDrew, 1984). The TpA step is also the least stable of basesteps (Gotoh and Tagashira, 1981) and consequently mayadopt a different conformation in the crystal environmentto the one favoured in solution (but see Yoon et al., 1988).Presumably this instability is related to the role of TATAboxes in promoter function (Drew et al., 1985).A parameter often used to distinguish A-form from

B-form, and that may affect the CD of DNA, is the locationof the base pairs relative to the global helix axis (Moore andWagner, 1973). In the B-form model the helix axis passesapproximately through the centre of the base pairs whereasin A-form the base pairs are displaced from the axis by 4.5A. In Figure 8 we have plotted displacement against tilt anglefor each base pair in the crystal structure of some of theoligonucleotides shown in Figure 7. The mean displacementappears to be approximately correlated with the mean tiltangle (Jain et al., 1987). This type of plot reveals boththe considerable sequence dependent variations found withinan oligonucleotide, and between oligonucleotides. Againthe values range between those of the extreme B-formand A-form models. Inspection of the plot (Figure 8) alsoshows that by this correlation the crystal structure ofd(GGATGGGAG) is an intermediate, but the displacementof the base pairs from the helix axis by 3.8 -4.5 A classesit closer to an A-type than B-type DNA.

In summary, for the majority of sequences we havestudied, the similarities and differences revealed by CDanalysis persist in the corresponding crystal structures. Thus,the empirical correlation we have found indicates that theglobal and dominant conformation of d(GGATGGGAG) insolution is closely related to the structure observed in highlyhydrated crystals and is an intermediate type between thearchetypal B-form and A-form fibre models. It follows thatmixed sequence DNA in solution is not strictly B-form, butwill contain a variety of sequence dictated structures in therange indicated by our CD measurements.

Relationship to other studiesThe assignment by Gottesfeld et al. (1987) of the CDspectrum of the TFIIIA binding site to the B-form relieson two measurements: one in binding buffer, the otherin 80% ethanol. Reference spectra for B-form and A-formDNA were not measured but taken from published work.Furthermore, their spectrum of the TFIIIA binding sitein 80% ethanol shows evidence of light scattering thatsuggests aggregation of the DNA. It has been suggested thataggregation causes an increase in CD and hence themagnitude of the difference in CD due to the transition toA-form may have been over-estimated (Hillen and Wells,1980). Similarly Aboul-ela et al. (1988) have concluded thatan 18 bp fragment consisting of two repeats of the nonamerd(GGATGGGAG) is B-form in solution. In this case the CDspectrum was compared to that of RNA and no referencespectrum for B-form DNA was included. On transition tothe presumed A-form the observed increase in CD for this

1814


AA

A®A

16 18 20 22 24Base pair tilt (0)

Fig. 8. Sequence dependent effects on the structure of the DNA helix.This plot shows both sequence dependent effects within a sequence andbetween DNA fragments of different sequence. The plot shows thedisplacement of the base pairs from the helix axis plotted against basepair tilt for each base step: (2) Drew-Dickersond(CGCGAATTCGCG) (-); (3) d(GCCCGGGC) (Heinemann et al.,1987) (0); (4) d(GTGTACAC) (A); (6) d(GGATGGGAG) part of theTFIIIA binding site (0); (8) d(GGGGCCCC) (McCall et al., 1985)(0); (9) r(GCG)d(TATACGC) (Wang et al., 1982) (A). Also shownare the parameters for B-form and A-form DNA fibre models. Thesame numbering of sequences as in Figures 6 and 7 is used. Structuralparameters were taken from Hunter and Kennard (1988) andreferences to crystal structure are given in the text. The parameters ofthe terminal base pair were omitted because of possible distortions.For some of the fragments only half the number of data points are

shown because of symmetry in their structures. The plot is adaptedfrom Jain et al. (1987).

fragment is small, in agreement with our own observations(Figure 5). Evidently, the lack of essential control referencespectra in these two studies gives rise to the differencein interpretation of CD characteristics. As clearly shownby our study, only analysis of several different fragments,together with comparison to their crystal structures permitssubtle but significant sequence dependent helix types to bedetected and identified.From an NMR study of the 18 bp fragment containing

two repeats of d(GGATGGGAG) Aboul-ela et al. (1988)have derived local distance parameters that are closer to thoseof the B-form than A-form DNA of fibres. The importantquestion about the extent of similarity between the structurederived from the NMR analysis and the one determined inthe crystal by McCall et al. (1986) was not addressed. Never-theless, even given the limitations ofNMR spectroscopy indistinguishing between the intermediate global conformationsfound in crystals (Nilsson et al., 1986; Kaptein and Boelens,1988), the difference observed between the dominantbackbone conformation in solution and that in the crystal,raises some important and general questions about solutionversus crystal structure.

In both NMR and Raman spectroscopy, although verydifferent techniques, the assignment of helix conformationrelies heavily on measurements from within the ribose-phosphate backbone, and its relationship to the bases. If theribose is primarily observed in the C2'-endo conformation(the conformation found most frequently in solution andB-type crystal structures), then the conformation is assignedto B-form. If the observed ribose conformation is C3'-endo(the dominant conformation in A-type crystal structures)then the conformation is assigned to A-form. Firstly, thefact that the DNA helix takes up a variety of conformations,predominantly determined by the sequence dependent waybases stack on top of each other (Drew et al., 1988),

demonstrates the elasticity of the DNA backbone. Energycalculations also show that a large variety of sugar-phosphateconformations can be fitted to a given stacking geometry ofadjacent base pairs (Srinvasan and Olson, 1987). Secondly,NMR and Raman measurements are in general carried outin the absence of divalent metals such as Mg2+, that bindto phosphate groups and hence may be expected to influencebackbone geometry, and perhaps the equilibrium distribu-tion of the ribose conformations in solution. The resultspresented in Figure 2 give some indication of the impor-tance of Mg2+ in stabilizing the solution structure. Onestudy, in which Raman measurements were carried out indifferent buffer conditions, shows clearly that the ribose con-formation is dependent on both the concentration of salt andtemperature (Nishimura et al., 1986). Consequently, anyassignment of helix conformation based chiefly on that ofthe ribose phosphate backbone appears to be inadequate.

What determines the structure of the TFIIIA bindingsite?Our finding, that the structure of the TFIIIA binding sitein solution is likely to be closely related to the structuredetermined from highly hydrated crystals, permits a directinsight into the structural details that are likely to beimportant for sequence specific recognition by TFIIIA.As proposed by McCall et al. (1985, 1986), the single

most important determinant of the helix conformation of theTFHIA binding site is likely to be the preferred geometryof base stacking at GpG steps that occur repeatedly in thenon-coding strand of this binding site (Rhodes and Klug,1986). GpG steps have been observed in the crystal struc-ture of several different oligonucleotides [including thed(GGATGGGAG) part of the TFIIA binding site] andshow the same characteristic base stacking. In all cases thefive-membered ring of one guanine base stacks on thesix-membered ring of its neighbour. In order to achieve thisstacking the base pairs slide over each other along their longaxis resulting in the displacement of the base pairs outwardsfrom the imaginary helix axis (Calladine and Drew, 1984).The geometry of the GpG base stacking is for instance verydifferent to the one observed at ApA steps (Nelson etal., 1987), or TpA steps (Yoon et al., 1988). Anotherrecognition sequence that contains a large number of GpGsteps in the non-coding strand is the Spl binding sited(ATGGGCGGAGT) and consequently is expected to havea very similar overall structure to that of the TFIIIA bindingsite, as indeed is suggested by the similarity of their spectra(Figure 5). In fact, the global conformation of the DNAbinding sites for both TFIIIA and Spl is likely to be mostsimilar to that of poly(dG)-poly(dC), which in solution hasa radius of gyration larger than mixed sequence DNAindicating that the base pairs lie some distance from the helixaxis (Bram, 1971).The displacement of the base pairs seen in the crystal

structure of d(GGATGGGAG) is 3.8-4.5 A (Figure 8).This gives rise to a deep major groove and a very shallowminor groove that are characteristic of A-type DNA, but,unlike in A-form DNA, the major groove is wide (meansize 9 A ), almost the width it has in B-form DNA (11 A).Thus, as a consequence of sequence dependent base stackinginteractions the shape of the DNA helix presented to theprotein TFIIIA deviates considerably from the uniform fibremodel of B-form DNA.

1815

c -

0<

E4,5

'&4U)

j53

1.U.

-8 -6 -4.-2- 1

(a) oo*m*o *c 8A AA o

* U.

[BJ4 6E 8 0 12 14


Materials and methods

DNA samplesSeveral of the short DNA fragments used in this study were from the batchesthat produced crystals and are therefore believed to be both pure and doublestranded. They were kind gifts: d(GGATGGGAG) from Maxine McCall(McCall et al., 1986); d(CGCAAAAAAGCG) from Hillary Nelson (Nelsonet al., 1987); d(CGTAGATCTACG) and d(CTCTAGAG) from BeatriceD'Estaintot (Hunter et al., 1988, 1989 respectively). Other oligonucleotidesused in this study were chemically synthesized on an Applied Biosystems380B DNA synthesizer and purified on 20% denaturing polyacrylamide gelsfollowed by elution with 20 mM Tris-HCI, pH 7.5, 1 mM EDTA,extraction with phenol/chloroform and de-salting through a Sephadex G-25superfine (Pharmacia) column. For self-complementary sequences such asthe Drew-Dickerson d(CGCGAATTCGCG), the double stranded formwas obtained by annealing at 60°C for 15 min in 0.1 M NaCl, 20 mMTris-HCI, pH 7.5, and 0.2 mM EDTA. For fragments such as the Splbinding site, in which the two strands have different sequences, the molarityof each fragment was calculated from the molar absorptivities (E260) of thefour nucleotides (Sproat and Gait, 1984) and the two strands mixed inequimolar amounts and annealed.The 54 bp TFIIIA binding site was produced in E. coli. The plasmid was

constructed with the synthetic TFIIIA binding site inserted at the SmaI siteof pUC 9 and subsequently releaesd from the plasmid with EcoRV restrictionenzyme (kindly given by S.Halford). To purify the 54 bp fragment thecleaved vector was precipitated using 6% PEG 6000, 0.5 M NaCl. Thesupematant containing the 54 bp fragment was extracted with chloroform/isoamyl alcohol and the 54 bp fragment precipitated with ethanol. ADEAE-Sephacel (Pharmacia) column buffered in 20mM Tris-HCI, pH7.4, 1 mM EDTA with a gradient of NaCI from 0.03 to 1 M was thenused to purify the fragment further. Sheared calf thymus DNA and SS RNA(prepared from 7S particles) (Miller et al., 1985) were extracted with severalchanges of phenol/chloroform/SDS and re-precipitated several times withethanol to ensure purity.

All nucleic acid samples, including the ones not prepared in our laboratory,were dialysed at a concentration of -5 A260/ml against 10 mM Tris-HCl,pH 7.4, 1 mM EDTA and two changes 10 mM Tris-HCI, pH 7.4, 0.1 mMEDTA.

Buffers

Different buffer conditions were obtained by addition of concentrated buffersto stock DNA samples and dilution to 1 A260/ml (50 jg/mli).

Low salt buffer. 20 mM Tris-HCI, pH 7.4, 70 mM KCI, 2 mM MgCl2.

Binding buffer. [The buffer used for binding TFIIIA to the SS RNA gene(Rhodes,1985)]: 20 mM Tris-HCI, pH 7.4, 70 mM KCI, 2 mM MgCI2,6% glycerol, 10 AM Zn (OAc)2, 0.2 mM dithiothreitol.

Crystallization buffer. 12 mM Mg (OAc)2, 12 mM sodium cacodylate, pH6.5, 0.8 mM spermine/HCl, 10% MPD (McCall et al., 1986).

4 x crystallization buffer: 4 x the above buffer including 40% MPD.

Transition to A-form DNAStock solutions of calf thymus DNA and 54 bp TFIIIA binding site, thathad been dialyzed extensively against Tris-EDTA buffer, were diluted to

1.0 A260/ml, 10 mM Tris-HCI, 0.1 mM EDTA and 60% absoluteethanol at room temperature. The ethanol concentration was increased bystepwise addition. The absorbance was monitored throughout and there wasno evidence of light scattering. Spectra were recorded at 240C. For bothcalf thymus DNA and the TFIA binding site the transition to the presumedA-form occurred between 71 and 75% ethanol. No further change in CDintensity was observed on increasing the ethanol concentration to 80% forcalf thymus DNA and 82% for the TFIIIA binding site.

CD spectroscopyCD spectra were recorded digitally from 320 to 220 nm using a Jasco J41-Cor J600 spectropolarimeter with an instrumental time constant of 4S.Semi-micro cuvettes of path length 10 mm were used. Reported spectrawere recorded at 4 and/or 240C at a DNA concentration of 50 tg/mland represent the average of at least two scans. The spectra are presentedas plots of molar circular dichroic extinction coefficient per nucleotide (AE).To calculate this value an accurate estimate of nucleotide concentration ineach sample is required.

In order to correct for the different base composition of the different

oligonucleotides, for each oligonucleotide the average molar absorptivity

(260) per nucleotide was calculated from the different E26 of thenucleotides present. This value was related to the measured absorbance at260 nm and consequently the concentration of nucleotides per litre, bydividing the average nucleotide E26 by the hypochromicity of mixedsequence DNA. Given the inaccuracy of determining the hypochromicityexperimentally we take the hypochromicity of a specific sequence to averageout to approximately the same value for any base step and thus be verysimilar to that of mixed sequence DNA and 5S RNA (Wells et al., 1970).For calf thymus DNA (57.5%, A,T and 52.5%, G,C) the average baseE260 iS 11 X 103 and the extinction coefficient at 260 nm is 6.7 x 103(Wells et al., 1970). The hypochromicity 'correction' factor we have usedis thus 11/6.7 = 1.65.Data processing involved base-line substraction and smoothing over a

running interval of 40 points using the quadratic-cube function of Savitzkyand Golay (1964).

AcknowledgementsWe thank Terry Smith for oligonucleotide synthesis, Peter Bayley and ErnestLaue for participating in early CD measurements. We thank A.Galat forcommunicating the results of his study of the nonamer d(GGATGGGAG)structure. We thank John Finch, Bill Hunter, Aaron Klug, Peter Molloy,Hillary Nelson and Andrew Travers for comments on the manuscript. Inparticular, we would like to thank Horace Drew and Maxine McCall forencouragement and much advice.

References

Aboul-ela,F., Varani,G., Walker,G.T. and Tinoco,I. (1988) Nucleic AcidsRes., 16, 3559-3572.

Aggarwal,A.K., Rodgers,D., Drottar,M., Ptashne,M. and Harrison,S.C.(1988) Science, 242, 899-909.

Baase,W.A. and Johnson,W.C. (1979) Nucleic Acids Res., 6, 797-814.Bram,S. (1971) Nature, 223, 161-164.Brown,D.D. (1982) Harvey Lectures, 76, 27-44.Calladine,C.R. and Drew,H.R. (1984) J. Mol. Biol., 178, 773-782.Dickerson,R.E., Goodsell,D.S., Kopka,M.L. and Pjura,P.E. (1987) J.

Biomol. Struct. Dynam., 5, 557-579.Diekmann,S. (1987) Nucleic Acids Res., 15, 247-265.Drew,H.R. and Travers,A.A. (1984) Cell, 37, 491-502.Drew,H.R., Wing,R.M., Takano,T., Broka,C., Tanaka,S., Itakura,K. and

Dickerson,R.E. (1981) Proc. Natl. Acad. Sci. USA, 78, 2179-2183.Drew,H.R., Weeks,J.R. and Travers,A.A. (1985) EMBO J., 4,

1025-1032.Drew,H.R., McCall,M.J. and Calladine,C.R. (1988) Annu. Rev. Cell. Biol.,

4, 1-20.Fairall,L., Rhodes,D. and Klug,A. (1986) J. Mo. Biol., 192, 577-591.Fratini,A.V., Kopka,M.L., Drew,H.R. and Dickerson,R.E. (1982) J. Bio.

Chem., 257, 14686-14707.Frederick,C.A., Grable,J., Melia,M., Samudzi,C., Jen-Jacobson,L.,

Wang,B.-C., Greene,P., Boyer,H.W. and Rosenburg,J.M. (1984) Nature,309, 327-331.

Gotoh,O. and Tagashira,Y. (1981) Biopolymers, 20, 1033-1042.Gottesfeld,J.M. (1987) Mol. Cell. Biol., 7, 1612-1622.Gottesfeld,J.M., Blanco,J. and Tennant,L.L. (1987) Nature, 329, 460-462.Gray,D.M., Edmondson,S.P., Lang,D. and Vaughan,M. (1979) Nucleic

Acids Res., 6, 2089-2107.Hanas,J.S., Hazuda,D.J., Bogenhagen,D.F., Wu,F.Y.H. and Wu,C.W.

(1983) J. Bio. Chem., 258, 14120-14125.Heinemann,U., Hanspeter,L., Frank,R. and Blocker,H. (1987) NucleicAcids

Res., 15, 9531-9550.Hillen,W. and Wells,R.D. (1980) Nucleic Acids Res., 8, 5427-5444.Hunter,W.N., D'Estaintot,B.L. and Kennard,O. (1988) J. Mol. Biol., 202,921-922.

Hunter,W.N., D'Estaintot,B.L. and Kennard,O. (1989) Biochemistry, inpress.

Ivanov,V.I., Michenkova,L.E., Schyolkina,A.K. and Poletayev,A.I. (1973)Biopolymers, 12, 89-110.

Jain,S., Zon,G. and Sundaralingam,M. (1987) J. Mol. Biol., 197, 141-145.Johnson,B.B., Dahl,K.S., Tinoco,I., Ivanov,V.1. and Zhurkin,V.B. (1981)

Biochemistry, 20, 73-78.Jordan,S.R. and Pabo,C.O. (1988) Science, 242, 893-899.Kadonaga,J.T., Jones,K.A. and Tjian,R. (1986) Trends Biochem. Sci., 11,20-23.

Kaptein,R. and Boelens,R. (1988) In Eckstein,F. and Lilley,D.M.J. (eds),

1816


Nucleic Acids and Molecular Biology. Springer-Verlag, Berlin, Vol. 2,pp. 167-187.

Kennard,O. and Hunter,W. (1988) Landolt-Bornstein Data New SeriesGroup VII, Vol la. Springer-Verlag, Berlin, 255 -360.

Klug,A. and Rhodes,D. (1987) Trends Biochem. Sci., 12, 464-469.Klug,A., Jack,A., Viswamitra,M.A., Kennard,O., Shakked,Z. and

Steiz,T.A. (1979) J. Mol. Biol., 131, 669-680.Lauble,H., Frank,R., Blocker,H. and Heinemann,U. (1988) Nucleic Acids

Res., 16, 7799-7816.Leslie,A.G.W., Arnott,S., Chandrasekaran,R. and Ratliff,R.L. (1980) J.

Mol. Biol., 143, 49-72.Lomonossoff,G.P., Butler,P.J.G. and Klug,A. (1981) J. Mol. Biol., 149,745-760.

McCall,M., Brown,T. and Kennard,O. (1985) J. Mol. Biol., 183, 385-396.McCall,M., Brown,T., Hunter,W.N. and Kennard,O. (1986) Nature, 322,661-664.

Miller,J., McLachlan,A.D. and Klug,A. (1985) EMBO J., 4, 1609-1614.Moore,D.S. and Wagner,T.E. (1973) Biopolymers, 12, 201-221.Nelson,H.C.M., Finch,J.T., Luisi,B.F. and Klug,A. (1987) Nature, 330,221-226.

Nilsson,L., Clore,G.M., Gronenborn,A.M., Brunger,A.T. and Karplus,M.(1986) J. Mol. Biol., 188, 455-476.

Nishimura,Y., Torigoe,C. and Tsuboi,M. (1986) Nucleic Acids Res., 14,2737-2748.

Otwinowski,Z., Schevitz,R.W., Zhang,R.-G., Lawson,C.L., Joachimiak,A., Marmorstein,R.Q., Luisi,B.F. and Sigler,P.B. (1988) Nature, 355,321 -329.

Patel,D.J., Kozlowski,S.A., Rice,J.A., Marky,L.A., Breslauer,K.J.,Broka,C. and Itakura,K. (1982) In Neidle,S. (ed.), Topics in NucleicAcid Structure. Part 2. The Macmillan Press Ltd, London, pp. 81 - 136.

Peck,L.J. and Wang,J.C. (1981) Nature, 292, 375-377.Picard,B. and Wegnez,M. (1979) Proc. Natl. Acad. Sci. USA, 76, 241-245.Rhodes,D. (1982) In Neidle,S. (ed.), Topics in Nucleic Acid Structure. Part

2. The Macmillan Press Ltd, London, pp. 287-304.Rhodes,D. (1985) EMBO J., 4, 3473-3482.Rhodes,D. and Klug,A. (1980) Nature, 286, 573-578.Rhodes,D. and Klug,A. (1981) Nature, 292, 378-380.Rhodes,D. and Klug,A. (1986) Cell, 46, 123-132.Saenger,W. (1984) Principles ofNucleic Acid Structure. Springer-Verlag,

Berlin.Savitzky,A. and Golay,M.J.E. (1964) Anal. Chem., 36, 1627-1639.Shakked,Z., Rabinovich,D., Kennard,O., Cruse,W.B.T., Salisbury,S.A.

and Viswamika,M.A. (1983) J. Mol. Biol., 166, 183-201.Sprecher,C.A., Baase,W.A. and Curtis Johnson,W. (1979) Biopolymers,

18, 1009-1019.Sproat,B.S. and Gait,M.J. (1984) In Gait,M.J. (ed.), Oligonucleotide

Synthesis-A Practical Approach. IRL Press, Oxford, pp. 83-115.Srinvasan,A.R. and Olson,W.K. (1987) J. Biomol. Struct. Dyn., 4,

895-938.Thomas,G.J., Jr and Wang,A.H.-J. (1988) In Eckstein,F. and Lilley,D.M.J.

(eds), Nucleic Acids and Molecular Biology. Springer-Verlag, Berlin,Vol. 2, pp. 1-30.

Tunis-Schneider,M.J.B. and Maestre,M.F. (1970) J. Mol. Biol., 52,521-541.

Wang,A.H.-J., Fujii,S., Van Boom,H.J., Van der Marel,G.A., VanBoeckel,S.A.A. and Rich,A. (1982) Nature, 299, 601-604.

Wells,R.D., Larson,J.E., Grant,R.C., Shortle,B.E. and Cantor,C.R. (1970)J. Mol. Biol., 54, 465-497.

Yoon,C., Prive,G.G., Goodsell,D.S. and Dickerson,R.E. (1988) Proc. Natl.Acad. Sci. USA, 85, 6332-6336.

Received on January 23, 1989; revised on March 9, 1989

1817

Documents

factor IIIA has a non-B-form structure