Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
저 시-비 리- 경 지 2.0 한민
는 아래 조건 르는 경 에 한하여 게
l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.
다 과 같 조건 라야 합니다:
l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.
l 저 터 허가를 면 러한 조건들 적 되지 않습니다.
저 에 른 리는 내 에 하여 향 지 않습니다.
것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.
Disclaimer
저 시. 하는 원저 를 시하여야 합니다.
비 리. 하는 저 물 리 목적 할 수 없습니다.
경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.
Functional studies of GST2, a
morphogenetic transition regulator on
nitrogen starvation, in Candida albicans
Candida albicans
GST2
2014 8
Thesis for the Degree of Doctor of philosophy
Functional studies of GST2,
a morphogenetic transition regulator on
nitrogen starvation, in Candida albicans
Advisor: Ki-bong Oh
So-Hyoung Lee
August 2014
i
ABSTRACT
SO-HYOUNG LEE
School of Agricultural Biotechnology
The Graduated School
Seoul National University
Candida albicans is a major human fungal pathogen, which undergoes
morphological transition from the budding yeast form to filamentous growth in
response to nitrogen starvation. In this study, C. albicans Gst2p, a new
morphogenetic regulatory gene induced by nitrogen starvation was identified and
characterized. C. albicans Gst2p displayed glutathione transferase (GST) activity
and is required in response to peroxide. Surprisingly, the Δgst2 mutant displayed
predominantly yeast phase growth on solid nitrogen limited media, whereas the wild-
type strain formed pseudohyphae efficiently under the same conditions. Furthermore,
Gst2p is strongly induced by nitrogen starvation. The morphological defect of Δgst2
mutant was not rescued by overexpression of Ras1p, Cph1p, or Efg1p, but was
rescued by either overexpression of a hyperactive RAS1G13V allele or by exogenous
addition of cyclic adenosine monophosphate (cAMP). The artificial expression was
consistent with the Ras1-cAMP pathway as a possible downstream target of Gst2p.
The deletion of GST2 also increased levels of MEP2 and MEP1 transcripts by
ii
elevating GLN3 expression under conditions of nitrogen starvation. These findings
suggest that Gst2p may be one of the regulators of GLN3 transcription, the regulation
of which controls ammonium permease expression, and a significant component of
filamentation under conditions of nitrogen starvation in C. albicans.
Keywords: Candida albicans, nitrogen starvation, GST2, filamentation, signaling
pathway
Student Number : 2009-30310
iii
CONTENTS
ABSTRACT ........................................................................................................ ⅰ
CONTENTS ........................................................................................................ ⅲ
LIST OF FIGURES ........................................................................................... ⅵ
LIST OF TABELS ............................................................................................. ⅷ
LIST OF ABBREVIATIONS ............................................................................ ⅸ
INTRODUTION .....................................................................................................1
1. Dimorphism, an important factor of virulence ................................................7
2. Signaling pathways and transcriptional regulators required for morphogenesis
..........................................................................................................................8
2.1 Mitogen-activated protein kinase pathway ...........................................8
2.2 cAMP-dependent protein kinase A pathway .........................................8
2.3 Ras1p-mediated signaling pathway .................................................... 10
3. Morphogenetic auto-regulatory substances ................................................... 11
4. Nitrogen starvation and morphogenesis ........................................................ 12
4.1 MEP2 is required for filamentous growth of C. albicans under nitrogen
starvation conditions ................................................................................ 12
4.2 Control of MEP2 expression by the GATA transcription factors ........ 13
4.3 TOR controls the GATA transcription factors ...................................... 13
5. Purpose of this study ..................................................................................... 14
MATERIALS AND METHODS ....................................................................... 17
iv
1. C. albicans strains and culture conditions ..................................................... 17
2. Rapid amplification of cDNA ends ............................................................... 18
3. Recombinant protein construction and glutathione transferase activity assay
........................................................................................................................ 18
4. Gene disruption ............................................................................................ 19
5. DNA isolation and Southern blot analysis .................................................... 21
6. Oxidative stress sensitivity assay .................................................................. 21
7. Northern hybridization .................................................................................. 22
8. RT-PCR and real-time quantitative PCR ...................................................... 22
9. Plasmid constructions for morphogenesis ..................................................... 23
10. Rapamycin sensitivity assay ......................................................................... 23
RESULTS ........................................................................................................... 31
1. Identification, characterization and deletion of GST2 ................................... 31
1.1 Identification and characterization of GST2 ....................................... 31
1.2 GST2 of C. albicans has a Gst activity ............................................... 31
1.3 Deletion of GST2 increases oxidative sensitivity ................................ 32
2. Nitrogen starvation-induced filamentous growth depends on the presence of
Gst2p in C. albicans ............................................................................................ 39
2.1 The Δgst2 mutant cells defect their filamentation under nitrogen
starvation condition ............................................................................ 39
2.2 Nitrogen starvation induces GST2 expression .................................... 40
v
2.3 FA do not effect to expression of GST2 under nitrogen starvation
condition ............................................................................................. 41
3. Effects of GST2 disruption on hyphal-inducing signaling pathway .............. 50
3.1 Effects of GST2 disruption on the expression levels of mRNAs related to
the hyphal-inducing signaling pathway .............................................. 50
3.2 A hyperactive RAS1 allele and exogenous addition of cAMP restore
filamentation ....................................................................................... 50
4. Influence of GST2 to transcriptional regulation of GLN3, an ammonium
permease regulatory GATA transcription factor ........................................... 59
4.1 GST2 regulates GLN3 transcription under nitrogen starvation condition
............................................................................................................. 59
4.2 Δgst2 increase sensitivity to rapamycin .............................................. 60
DISCUSSION ............................................................................................................. 65
REFERENCES .......................................................................................................... 71
ABSTRACT IN KOREAN ...................................................................................... 79
CURRICULUM VITAE .......................................................................................... 81
vi
LIST OF FIGURES
Figure 1. Signal transduction pathways leading to
expression of hypha-specific genes in C.
albicans.
3
Figure 2. Morphogenetic auto-regulatory substances
(ARSs).
5
Figure 3. TOR prevents nuclear accumulation of the
nitrogen-regulated transcription activator Gln3p
15
Figure 4. Conserved domains of GST2. 33
Figure 5. Functional identification of GST2. 35
Figure 6. Disruption of C. albicans GST2. 36
Figure 7. Defects in hyphal formation caused by deletion
of GST2.
42
Figure 8. Expression of GST2 under different conditions in
wild-type strain.
44
Figure 9. Northern blot analysis of GST2 expression. 46
vii
Figure 10. Effects of farnesoic acid (FA) on GST2
expression.
48
Figure 11. Northern blot analysis of mRNAs related to the
hyphal-inducing signaling pathway in C.
albicans.
53
Figure 12. Expression of genes related to the hyphal-
inducing signaling pathway in C. albicans.
55
Figure 13. Effects of various expression constructs on the
hyphal response to solid SLAD medium in C.
albicans.
57
Figure 14. Up-regulation of GLN3 in Δgst2. 61
Figure 15. Rapamycin sensitivity assay of Δgst2. 63
Figure 16. Proposed signaling pathway of Gst2p. 69
viii
LIST OF TABLE
Table 1. C. albicans strains used in this study. 25
Table 2. Plasmid list used in this study. 26
Table 3. Primers used in this study. 27
ix
LIST OF ABBREVIATIONS
ADH alcohol dehydrase
ADHpt promoter of alcohol dehydrogenase
ARS autoregulatory substance
cAMP cyclic adenosine monophosphate
FA farnesoic acid
GS glucose salt
SLAD synthetic low ammonium dextrose
MAPK mitogen-activated protein kinase
PKA protein kinase A
GST glutathione S-transferase
TOR target of rapamycin
RT-PCR reverse transcription-polymerase chain reaction
- 1 -
INTRODUCTION
Candida albicans is the most prevalent opportunistic fungal pathogen in humans.
It undergoes reversible morphogenetic transitions between budding yeast and
filamentous hyphal forms triggered by various environmental cues, such as the
presence of serum, neutral pH, high temperature, CO2, N-acetylglucosamine,
nitrogen starvation, and adherence (Biswas et al., 2007; Sudbery, 2011). This yeast-
to-hyphal transition is linked to the expression of virulence factors (Calderone and
Fonzi, 2001) and is therefore strongly associated with disease progression. Most of
the morphogenetic transition signals converge on two parallel signal transduction
pathways (Figure 1), defined by the transcription factors Efg1p and Cph1p (Hall et
al., 2009). Current models place Efg1p in the cyclic AMP (cAMP)-dependent protein
kinase A (PKA) signaling pathway, with several lines of evidence suggesting that
Efg1p functions downstream of PKA (Rocha et al., 2001). Cph1p is a transcription
factor thought to be activated by the mitogen-activated protein kinase (MAPK)
cascade (Liu, 2001). The small GTPase Ras1p initiates both of these pathways,
which can also influence other factors affecting morphology (Chen et al., 2000).
Morphogenetic transition of C. albicans was reported to be under the control of
at least three morphogenetic autoregulatory substances that accumulate in the
medium as cells proliferate: farnesoic acid (FA) (Oh et al., 2001) and farnesol
(Hornby et al., 2001), which inhibit the yeast-to-hyphal transition, and tyrosol (Chen
et al., 2004), which promotes this transition (Figure 2). Treatment of C. albicans
- 2 -
with farnesol reduces the mRNA expression of HST7 and CPH1, both components
of the MAPK cascade, but not that of the MAP kinase CST20 (Sato et al., 2004). In
addition, farnesol and dodecanol were reported to inhibit the Ras1p-mediated cAMP-
dependent PKA pathway (Davis-Hanna et al., 2008). Recently, repression of CPH1,
EFG1, GAP1 and HWP1 mRNA expression was observed in response to FA (Chung
et al., 2010). Nevertheless, how these substances regulate C. albicans hyphal
development is still unknown because the downstream regulatory factors controlled
by these signal molecules have not been identified. In our previous work, several
genes that were upregulated by FA, including GST2 (formerly CA15 induced by FA)
were identified (Chung et al., 2005). This study showed that GST2 was required for
filamentous growth of C. albicans under conditions of nitrogen starvation. GST2
expression was strongly induced when the ammonium sulfate concentration
decreased to 0.1 mM or below.
The Δgst2 mutant displayed predominantly yeast phase growth on solid nitrogen
limited media, whereas the wild-type (WT) strain formed pseudohyphae efficiently
under the same conditions. The deletion of GST2 increased levels of MEP2 and
MEP1 transcripts by elevated GLN3 expression. The results of the present study
indicated that GST2 is required for filamentous growth of C. albicans under
conditions of nitrogen starvation. I propose that Gst2p serves as a regulator of GLN3
involved in the response to nitrogen starvation in C. albicans.
- 3 -
Figure 1. Signal transduction pathways leading to expression of hypha-specific
genes in C. albicans (Sudbery, 2011).
- 4 -
- 5 -
Figure 2. Morphogenetic auto-regulatory substances (ARSs). FA and farnesol
inhibit the filamentation in C. albicans, and tyrosol promotes it.
- 6 -
- 7 -
1. Dimorphism, an important factor of virulence
Candida albicans is the most common human fungal pathogen which cause
opportunistic infection. It was found in the normal gastrointestinal flora and the oral
mucosa of most healthy humans. However, in immunocompromised patients,
bloodstream infections often cause death, despite the use of antifungal therapies
(Biswas et al., 2007).
An important feature of C. albicans is dimorphism between a single cell,
budding yeast form (blastospore) and a filamentous form (including both
pseudohyphae and true hyphae) (Berman, 2006). Typically, C. albicans grows as
single ellipsoidal cells called blastospores (also called blastoconidia). In the presence
of inducing environmental signals, e.g. serum, high temperature (37°C), high ratio
of CO2 to O2, neutral pH, and nutrient poor media, C. albicans can assume
filamentous forms in which cells remain attached to each other after dividing and
thereby form long branched strings of connected cells. The ability of C. albicans to
adopt these different morphologies is thought to contribute to colonization and
dissemination within host tissues, and thereby to promote infection (Lo et al., 1997;
Odds, 1994; Saville et al., 2003). Therefore, the regulation of morphogenesis has
been intensively investigated in the past years.
- 8 -
2. Signaling pathways and transcriptional regulators
required for morphogenesis
2.1 Mitogen-activated protein kinase pathway
A mitogen-activated protein kinase (MAPK) cascade has been shown to be
required for morphological change in C. albicans (Dhillon et al., 2003). MAPK
pathways are cascades of phosphorylation from a MAPK kinase kinase (MAPKKK)
to a MAPK and ultimately result in the activation of transcription factors (Hall et al.,
2009). This MAPK cascade consists of the Cst20p (p21-activated kinase; PAK),
Hst7p (MAP kinase kinase; MEK) and Cek1p (MAPK) (Liu, 2001). The
transcription factor Cph1p functions downstream of the MAPK cascade. Null
mutants of these genes show retarded filamentous growth but no impairment of
serum-induced germ tube and hyphae formation (Kohler and Fink, 1996; Kron and
Gow, 1995). These observations suggest that a kinase signaling cascade plays a part
in stimulating the morphological transition between blastospore and filamentous
forms in C. albicans.
2.2 cAMP-dependent protein kinase A pathway
Cyclic AMP acts as an intracellular regulator and participates in many cellular
processes in both prokaryotic and eukaryotic organisms (Dhillon et al., 2003).
cAMP-dependent protein kinase A (PKA) pathway has been shown to regulate
filamentous growth in C. albicans and other fungi (Lengeler et al., 2000). The
- 9 -
functions of cAMP are determined by its endogenous levels, which are carefully
regulated by adenylate cyclase and phosphodiesterase enzymes. C. albicans has a
sigle adenylate cyclase gene(CDC35/CYR1). Cyr1p integrates environmental signals
from a range of sources and is completely essential for hyphal formation but not
yeast-form growth (Dhillon et al., 2003; Whiteway, 2000). Recently, the adenylate-
cyclase-associated protein (CAP1) has been identified and disrupted in C. albicans.
The Δcap1 mutant is defective in germ tube formation and hyphal development in
all conditions examined, including serum-containing media. The defects are
suppressed by exogenous cAMP or dibutyryl cAMP. Δcap1 are avirulent in a mouse
model for systemic candidiasis (Bahn et al., 2003; Bahn and Sundstrom, 2001; Zou
et al., 2010). There are only two cAMP-dependent PKA catalytic subunits, Tpk1p
and Tpk2p, in C. albicans (Sonneborn et al., 2000). Efg1p, a basic helix-loop-helix
(bHLH) protein, plays a major role in hyphal morphogenesis in response to serum,
CO2, neutral pH and GlcNAc in liquid media, and on solid media such as Spider
medium. Δefg1 null mutant strains do not form hyphae under most hypha-inducing
conditions, including serum, and are defective in the induction of hypha-specific
genes. Efg1p is likely to function downstream of the PKAs (Lo et al., 1997; Stoldt
et al., 1997). TPK2 overexpression cannot suppress the Δefg1 defect in hyphal
development, whearas overexpression of EFG1 can suppress the filamentation
defect in Δtpk2 (Sonneborn et al., 2000).
- 10 -
2.3 Ras1p-mediated signaling pathway
Center to the regulation of C. albicans morphology is the Ras1p interrelated.
Networks Ras proteins are members of the small GTPase superfamily that cycle
between an inactive GDP-bound and an active GTP-bound form (Bourne et al.,
1990). The active form of Ras stimulates two main signaling pathways, cAMP-PKA
pathway and MAPK pathway (Biswas et al., 2007). In C. albicans, Ras1p has been
identified which is not essential for survival (Feng et al., 1999). The Δras1 deletion
mutant cells defect in hyphal growth in response to serum and other conditions. In
addition, while a dominant negative Ras1p variant (Ras1G16Ap) caused a defect in
filamentation, a dominant active Ras1p variant (Ras1G13Vp) enhanced the formation
of hypha (Feng et al., 1999). The constitutive hyphal growth induced by
overexpression of dominant-active Ras1 variant (Ras1G13Vp) was defected in cells
deleted for HST7, CPH1, EFG1, CYR1, or both CPH1 and EFG1 (Leberer et al.,
2001).
- 11 -
3. Morphogenetic auto-regulatory substances
C. albicans, a polymorphic fungus that is well studied for its importance as an
opportunistic human pathogen, was among the first fungi reported to have a quorum-
sensing system (Lim et al., 2012). It has long been documented that C. albicans
hyphal formation is suppressed at high cell densities and by supernatants from
stationary-phase C. albicans cultures, suggesting that hyphal formation was
controlled, at least in part, by a soluble factor (Hogan, 2006).
In Hornby et al., the “quorum-sensing molecule” was identified as farnesol
(Figure 2). This compound is able to block filamentation induced by the
environmental signals for most signaling pathways activating hyphae development
(Hornby et al., 2001). Farnesol was active against a variety of C. albicans strains at
concentrations between 1 and 50 μM (Hogan, 2006). A separate study by Oh et al.
showed that C. albicans strain ATCC10231 produces FA (Figure 2), a compound
closely related to farnesol, and that FA is responsible for the inhibition of hyphal
growth in dense cultures (Oh et al., 2001). Hornby and Nickerson later confirmed
that C. albicans strain 10231 did not produce farnesol (Hornby and Nickerson, 2004).
Kim et al. found that farnesol can inhibit hyphae formation at lower concentrations
than FA but that FA has decreased toxicity at high concentrations (Kim et al., 2001).
Another C. albicans QSM, tyrosol, was found to promote hyphae development by
shortening the lag-time of cells to begin germinating in hyphae-inducing conditions
(Chen et al., 2004).
- 12 -
4. Nitrogen starvation and morphogenesis
4.1 MEP2 is required for filamentous growth of C. albicans under nitrogen
starvation conditions
Nutrient availability also governs developmental processes, like the induction
of pseudohyphal growth of the budding yeast Saccharomyces cerevisiae in response
to nitrogen limitation (Gimeno et al., 1992). C. albicans also undergoes
morphological transition from the budding yeast form to filamentous growth in
response to amino acid starvation or limiting ammonium concentrations
(Morschhäuser, 2011). In many cases, membrane-transporter-related proteins serve
as extracellular nutrient sensors that activate signaling pathways to induce a cellular
response. Examples include the ammonium permease Mep2p, which is sufficient to
enable growth in low ammonium concentrations (Neuhäuser et al., 2011). Under
limiting nitrogen conditions, Mep2p induces the switch from yeast to filamentous
growth through a signaling domain in its C-terminal cytoplasmic tail that induces
morphogenesis in response to ammonium availability (Biswas and Morschhäuser,
2005; Dabas et al., 2009). In the presence of sufficient concentrations of a preferred
nitrogen source, such as ammonium or certain amino acids, the expression of
transporters and enzymes required for the utilization of alternative nitrogen sources
is repressed (Liao et al., 2008).
- 13 -
4.2 Control of MEP2 expression by the GATA transcription factors
The MEP2 expression is controlled by GATA factors, Gln3p and Gat1p (Dabas
and Morschhäuser, 2007; Liao et al., 2008). Gln3p has a broad role in nitrogen
metabolism and in virulence of C. albicans, partially overlapping, but distinct from
that of GAT1. As in liquid SLAD medium and in solid SLAD plates, Δgln3 and Δgat1
reduce MEP2 expression. Δgln3 mutants were seen fewer and shorter filamentous
than wild-type on SLAD plates. Thus this MEP2 reduced expression in strain lacking
GLN3 correlated with their filamentation defect. In contrast, deletion of GAT1 did
not affect filamentation despite reducing MEP2 expression (Dabas and
Morschhäuser, 2007).
4.3 TOR controls the GATA transcription factors
In S. cerevisiae, TOR (target of rapamycin) controls the expression of nutrient-
regulated genes by sequestering several nutrient-responsive transcription factors in
the cytoplasm (Figure 3) (Beck and Hall, 1999). The expression of most of the
nitrogen responsive genes is regulated by the GATA transcription factors Gln3p and
Gat1p and their cytoplasmic repressor Ure2p. Under good nitrogen conditions,
Gln3p is retained in the cytoplasm by Ure2p. The binding of Gln3p to Ure2p requires
TOR-dependent phosphorylation of Gln3p. Rapamycin treatment or nitrogen
starvation causes Gln3p to become dephosphorylated and to dissociate from Ure2p.
Gln3p then translocates into the nucleus to activate its target genes (Beck and Hall,
1999). TOR is conserved in all eukaryotic life forms (Crespo and Hall, 2002). In C.
- 14 -
albicans, a TOR1 homologue has also been identified and characterized (Cruz et al.,
2001).
5. Purpose of this study
In our previous work, the yeast-to-hyphae transition in C. albicans was
suppressed by FA, a morphogenetic autoregulatory substance that accumulates in the
medium as cells proliferate (Oh et al., 2001). Several genes were upregulated by FA
during the yeast-to-hyphae transition (Chung et al., 2010; Chung et al., 2005). In this
study, it is showed that GST2, one of genes induced by FA, is required for
filamentous growth of C. albicans under nitrogen starvation conditions. Gst2p serves
as a regulator of GLN3 involved in nitrogen starvation and functions as part of the
Ras1-cAMP signaling pathway-induced filamentation in C. albicans.
- 15 -
Figure 3. TOR prevents nuclear accumulation of the nitrogen-regulated transcription
activator Gln3p. Under good nitrogen conditions, Gln3p is phosphorylated and
retained in the cytoplasm by Ure2p. Upon nitrogen starvation or rapamycin treatment,
Activated Sit4p dephosphorylates the GATA transcription factor Gln3p.
Dephosphorylated Gln3p dissociates from Ure2p and translocates into the nucleus,
where it activates transcription of target genes. Arrows indicate activation; bars
indicate inhibition (Crespo and Hall, 2002).
- 16 -
- 17 -
MATERIALS AND METHODS
1. C. albicans strains and culture conditions
The C. albicans strains used in this study are listed in Table 1. All strains were
stored as frozen stocks with 15% glycerol at –80°C. For routine growth of most
strains, YPD liquid medium (20 g peptone, 10 g yeast extract, 20 g glucose per liter)
was used. Strains carrying plasmids or disrupted genes were propagated on synthetic
dextrose (SD) agar plates (0.67% yeast nitrogen base without amino acids (BD Difco;
Becton, Dickinson and Co., Sparks, MD), 2% glucose, and 2% agar) (Dabas and
Morschhäuser, 2007). Uracil prototrophic transformants were selected on SD agar
plates containing 0.19% yeast synthetic drop-out medium supplement without uracil
(Sigma Chemical Co., St. Louis, MO). Uracil auxotrophic transformants were
selected on 5-fluoroorotic acid (5-FOA) agar plates, which consisted of SD agar
plates supplemented with 50 μg/ml uracil (Sigma) and 0.1% 5-FOA (Sigma). To
visualize hyphal formation on solid medium, C. albicans was cultured by shaking in
YPD liquid medium at 28°C for 48 h. Yeast cells were harvested and washed three
times with distilled water before use. For specific experiments involving hyphal
growth, different media were used. SD medium containing high ammonium (SHAD),
SD medium containing low ammonium (SLAD) (Csank and Haynes, 2000), Spider
medium (Dabas and Morschhäuser, 2007), glucose salt (GS) medium (Oh et al.,
2001), and Lee’s medium at pH 7 (Lee et al., 1975) were prepared as described
- 18 -
previously. For exogenous cAMP rescue experiments, 10 mM dibutyryl cAMP
(Sigma) was added to SLAD solid medium.
2. Rapid amplification of cDNA ends
The rapid amplification of cDNA-ends (RACE) of GST2 was performed using
the BD SMARTTM RACE cDNA Amplification Kit (BD Biosciences, San Jose, CA)
according to the manufacturer’s instructions. Sequences of primers used in this study
are listed in Table 3. The GST2 cDNA was reverse transcribed from 0.5 μg mRNA
using either 5′-RACE CDS (5′-(T)25VN-3′ ; N = A, C or G ; V = A, G or C) and BD
SMART IITM A oligonucleotide (5′-AAGCAGTGGTATCAACGCAGAGT
ACGCGGG-3′) as primers for 5′-RACE, or using 3′-RACE CDS primer A (5′-
AAGCAGTGGTATCAACGCAGAGTAC(T)30VN-3′) for 3′-RACE. cDNA
amplification was performed using degenerate primers 5′-RACE GSP1 and 3′-
RACE GSP1. Amplified products in both 3′- and 5′-RACE were cloned into the
Litmus28i vector and subjected to automated sequencing.
3. Recombinant protein construction and glutathione
transferase activity assay
For the glutathione transferase (Gst) activity assay, GST2 and GTT11 genes were
generated by PCR amplification using specific primer sets (Table 3) from cDNA of
- 19 -
C. albicans SC5314 obtained after 2 mM tert-butyl hydroperoxide treatment and
cloned into the pET-21a plasmid. The L41S substitution mutagenesis of Gst2p was
performed by using QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla,
CA, U.S.A.). Recombinant proteins were induced in Escherichia coli BL21 cells
with isopropyl-β-D-thiogalactopyranoside and were purified from cell extracts by
affinity chromatography using Ni-NTA-agarose columns (Qiagen, Hilden,
Germany), following the manufacturer’s instructions. The Gst activity was
spectrophotometrically determined by measuring the conjugation of reduced
glutathione (GSH) to 1-chloro-2,4-dinitrobenzene (CDNB). The reaction mixture
contained 0.1 M potassium phosphate buffer, pH 6.5, 1 mM GSH, and 1 mM CDNB.
The reaction mixture was pre-incubated at 25°C (5 min), and the reaction was
initiated by an addition of the enzyme. The increase of A340 nm was recorded, and the
activity was calculated form the difference in A340 nm changes in the reaction mixtures
with and without enzyme (Choi et al., 1998; Garcerá et al., 2010).
4. Gene disruption
Disruption of the two allelic copies of GST2 was achieved by the two-step
replacement method described by Fonzi and Irwin (Fonzi and Irwin, 1993). For
disruption of GST2, a 3.4-kb BamHI fragment containing the hph-URA3-hph cassette
was isolated from pQF86 (Feng et al., 1999) and ligated with BamHI-digested
pUC18, yielding pQF181 (Table 2). The 87-bp 5′-GST2 region was amplified by
- 20 -
PCR using pQGD1-1F and pQGD1-1R as primers and C. albicans SC5314 genomic
DNA as the template. The PCR product was cloned into pQF181 digested with SalI-
AvaI, resulting in plasmid pQGD1-1. The 104-bp 3′-GST2 region was amplified by
PCR using primers pQGD1-2F and pQGD1-2R. The PCR product was cloned into
pQGD1-1 digested with SmaI-SacI, resulting in plasmid pQGD1-2. The SalI-SacI
fragment from pQGD1-2 was the 3.6-kb hph-URA3-hph cassette fragment
containing 87-bp 5′-GST2 and 104-bp 3′-GST2 homologous sequences. For the
construction of the second gene disruption cassette, the 80-bp 5′-GST2 was amplified
by PCR using primers pQGD2-1F and pQGD2-1R and cloned into pQF181 digested
with SacI-SmaI to obtain pQGD2-1. The 268-bp 3′-GST2 region was amplified by
PCR using primers pQGD2-2F and pQGD2-2R, and cloned into pQGD2-1 digested
with SalI-AvaI to obtain pQGD2-2. This final plasmid was digested with SalI and
SacI restriction enzymes to generate the 3.8-kb hph-URA3-hph cassette fragment
containing 80-bp 5′-GST2 and 268-bp 3′-GST2 homologous sequences.
Homologous recombination using the selectable marker URA3 flanked by hph
directed repeats was used for sequential gene disruptions. The heterozygous deletion
strain (GST2/Δgst2) was obtained by transforming spheroplasts (Sanglard et al.,
1996) of CAI4 (wild-type) with the SalI-SacI fragment of pQGD1-2 (Table 2). The
homozygous deletion strain (Δgst2/Δgst2) was obtained by transforming the
heterozygous deletion strain (GST2/Δgst2) with the SalI-SacI fragment of pQGD2-
2. Clones that had lost the URA3 gene by intrachromosomal recombination, mediated
by the hph repeats, were then selected on medium containing 5-FOA. The
- 21 -
replacement of the chromosomal gene with the fragment containing the hph-URA3-
hph cassette in place of the GST2 region was verified by PCR and Southern blot
analysis. (Figure 6).
5. DNA isolation and Southern blot analysis.
GST2 disruption in heterozygous and homozygous strains was verified by
Southern blotting. Genomic DNA from C. albicans was isolated as described
previously (Hoffman and Winston, 1987). Genomic DNA was isolated from wild-
type (CAI4) and mutant strains, digested with BglII and EcoRV, separated in a 1%
agarose gel, transferred onto a nylon membrane, and fixed by UV irradiation. The
hybridization probe was amplified by PCR from pQGD2-2 using pQF62 and
GST2probe-R as primers (Table 3). Labeling of the DNA probe and subsequent
hybridization was carried out using a random primer DNA labeling kit (Takara Bio,
Shiga, Japan) with (α-32P)dCTP (IZOTOP, Budapest, Hungary).
6. Oxidative stress sensitivity assay
Cells from wild-type (CAI4Y), Δgst2 mutant (GST2-1142Y) containing empty
YPB-ADHpt which carries the ADH1 promoter, terminator sequence, and C.
albicans URA3 (Table 2) were grown in YPD broth at 28°C for 48 h. Yeast cells were
harvested, washed, and resuspended to a density of 2×107 cells per ml in sterile
- 22 -
distilled water before use. Sensitivity to oxidative stress was determined by spotting
aliquots (5 μl) of serial ten-fold dilutions strains onto solid YNB media (without
amino acids, with 2% glucose, 2% agar, and 0.1% ammonium sulfate) containing 2
mM hydrogen peroxide (H2O2) after incubation for 3 days at 28°C (Inoue et al.,
1999).
7. Northern hybridization
Aliquots (10 μg) of total RNA were denatured and subjected to 1.2% agarose
electrophoresis in the presence of 1 M formaldehyde. The size-fractionated RNAs
were then transferred onto a nylon membrane and fixed by UV irradiation.
Hybridization probes were generated using a Random Primer DNA Labeling Kit
(Takara Bio) with (α-32P)dCTP (IZOTOP). Radioactivity was detected using a Bio-
Imaging Analyzer System (BAS 2500; FujiFilm, Tokyo, Japan).
8. RT-PCR and real-time quantitative PCR
Cells were grown SLAD media for 2 h at 28°C. Total RNA was extracted using
RNeasy Mini kit (Qiagen, Hilden, Germany), treated with DNase I (Invitrogen,
Carlsbad, California, U.S.A.), and reverse transcribed using the Superscript III First-
Strand Synthesis System (Invitrogen) following the manufacturer’s instructions.
Quantitative PCR was carried out in 8-strip tubes using the SYBR Green-Based
- 23 -
Detection assay with a LightCycler Nano System (Roche Diagnostics, Mannheim,
Germany). Genes investigated were MEP2, RAS1, EFG1, CPH1, HWP1, and GAP1.
The primers used in these experiments are listed on Table 3. Each primer pair was
tested for cross reactivity with epithelial cDNA. Each sample was handled in
triplicate and each experiment was repeated three times. Data analysis was
performed by the LightCycler Nano Software 1.0.
9. Plasmid constructions for morphogenesis.
Plasmids used in this study are listed in Table 2. C. albicans strains were
transformed using the LiAc/SS-DNA/PEG method as described (Bertram et al.,
1996). The plasmid-borne GST2 (pADH-GST2), CPH1 (pADH-CPH1), EFG1
(pADH-EFG1) and RAS1 (pADH-RAS1) genes were generated by PCR
amplification using specific primer sets (Table 3) from genomic DNA of C. albicans
SC5314. PCR products were cloned into the YPB-ADHpt plasmid (Bertram et al.,
1996). Site-directed mutagenesis was performed using oligonucleotides ADH-
RAS1G13V-F and -R to generate the RAS1G13V allele.
10. Rapamycin sensitivity assay
Sensitivity to rapamycin treatment was determined by comparison of growth
with the C. albicans strains on solid YPD media containing 10 ng/ml rapamycin after
- 24 -
incubation for 3 days at 28°C. Stationary phase cells cultured in YPD were washed
and suspended to a density of 2×107 cells per ml. Aliquots (5 μl) of serial ten-fold
dilutions were spotted onto YPD plate containing rapamycin (Liao et al., 2008).
- 25 -
Table 1. C. albicans strains used in this study
Strain Parent strain Relevant genotype or characteristic Reference
SC5314 Prototrophic clinical isolate Fonzi and Irwin,
1993
CAI4 SC5314 ura3Δ::imm434/ura3Δ::imm434 Fonzi and Irwin,
1993
CAI4Y CAI4 CAI4 containing pYPB-ADHpt This work
GST2-1 CAI4 ura3Δ::imm434/ura3Δ::imm434
GST2/gst2Δ::hph-URA3-hph This work
GST2-11 GST2-1 ura3Δ::imm434/ura3Δ::imm434
GST2/gst2Δ::hph This work
GST2-114 GST2-11 ura3Δ::imm434/ura3Δ::imm434 gst2Δ::hph-
URA3-hph /gst2Δ::hph This work
GST2-1142 GST2-114 ura3Δ::imm434/ura3Δ::imm434
gst2Δ::hph /gst2Δ::hph This work
GST2-1142Y GST2-1142 GST2-1142 containing pYPB-ADHpt This work
GST2-1142G GST2-1142 GST2-1142 containing pADHpt-GST2 This work
SCMEP1M4A SCMEP1M3A mep1-1Δ::FRT/mep1-2Δ::FRT Morschhäuser J,
unpublished.
SCMEP2M4A SCMEP2M3A mep2-1Δ::FRT/mep2-2Δ::FRT Dabas and
Morschhäuser, 2007
SCMEP12M4A SCMEP1M3A
mep1-1Δ::FRT/mep1-2Δ::FRT
mep2-1Δ::FRT/mep2-2Δ::FRT Neuhäuser et al.,
2011
GLN3M4A GLN3M3A gln3-1Δ::FRT/gln3-2Δ::FRT Dabas and
Morschhäuser, 2007
GAT1M4A GAT1M3A gat1-1Δ::FRT/gat1-2Δ::FRT Dabas and
Morschhäuser, 2007
Δgln3GAT1M4A Δgln3GAT1M3A gln3-1Δ::FRT/gln3-2Δ::FRT
gat1-1Δ::FRT/gat1-2Δ::FRT
Dabas and
Morschhäuser, 2007
- 26 -
Table 2. Plasmid list used in this study
Plasmid Construct Reference
pQF86 hph-URA3-hph cassette contained
pBluescript II KS(+) Sudbery ,2011
pQF181 hph-URA3-hph cassette contained pUC18 This work
pQGD1-1 5′-GST2(1-87 bp) in pQF181 This work
pQGD1-2 3′-GST2(556-660 bp) in pQGD1-1 This work
pQGD2-1 5′-GST2(40-120 bp) in pQF181 This work
pQGD2-2 3′-GST2(283-551 bp) in pQGD2-1 This work
YPB1-ADHpt CaADH1 promoter URA3 Ca. ARS,
Sc. 2μm plasmid Biswas et al., 2007
pADH-GST2 pYPB1-ADHpt-CaGST2 This work
pADH-CPH1 pYPB1-ADHpt-CaCPH1 This work
pADH-EFG1 pYPB1-ADHpt-CaEFG1 This work
pADH-RAS1 pYPB1-ADHpt-CaRAS1 This work
pADH-RAS1G13V pYPB1-ADHpt-CaRAS1G13V This work
pET21-GST2 pET-21a-CaGST2 This work
pET21-GST2L41S pET-21a-CaGST2 L41S This work
pET21-GTT11 pET-21a-CaGTT11 This work
- 27 -
Table 3. Primers used in this study
Primer Gene Sequence (5′-3′)*
For RACE
5′-GSP1 GST2 CATACGGAACTCCAAACG GTTTCAA
3′-GSP1 GST2 TTGGACCGTTTTCTGAAACTTGGAA
For gene disruption
pQGD1-1F GST2 TAGTCGACATGACTAAACCAATTCAATTCTACACATAC (SalI)
pQGD1-1R GST2 TACTCGAGGTAAGCCAATCCTAAAACTTCTAAGAA (AvaI)
pQGD1-2F GST2 TACCCGGGGTTGGTATTGATATTCATGATTGGCC (SmaI)
pQGD1-2R GST2 TTGAGCTCCTTTTATTTTTTCTCTGGGACATTGACA (SacI)
pQGD2-1F GST2 TTGAGCTCACGGTTTCAAAGTAAGCATTTTCTTAG (SacI)
pQGD2-1R GST2 TACCCGGGCTCGTTTTTAGTGATATCAACAGAAATG (SmaI)
pQGD2-2F GST2 TACTCGAGGGAACAGAAGAATATTACAAGACTTTAG (AvaI)
pQGD2-2R GST2 TAGTCGACTGCAAACTGTAGGCCCATCCAA (SalI)
For Southern blot analysis
pQF62 hph GGATCGATCTATTCCTTTGCCCTCGG
GST2probe-R GST2 ATCCAGGTACTGTTTCTGGTGGTGATTC
For GST assay
GST2-F GST2 CAGGATCCATGACTAAACCAATTCAATTCTACACA
GST2-R GST2 AACTCGAGTTTTTTCTCTGGGACATTGACAC
GTT11-F GTT11 CAGGATCCATGTCTGACACCAAAATTATTGTTC
GTT11-R GTT11 GCCTCGAGAATGTTAGGCTTAACAGTTTC
* The created restriction sites are underlined.
- 28 -
Table 3. (continued)
Primer Gene Sequence (5′-3′)**
For mutagenesis
GST2L41S-F GST2 CATTTCTGTTGATATCACTAAAAACGAGTCTAAATCTGATTGGTTTGTT
AAATTGAATCC
GST2L41S-R GST2 GGATTCAATTTAACAAACCAATCAGATTTAGACTCGTTTTTAGTGATAT
CAACAGAAATG
RAS1G13V-F RAS1 GTTGTTGTTGGAGGAGTTGGTGTTGGTAAATCCGC
RAS1G13V-R RAS1 GCGGATTTACCAACACCAACTCCTCCAACAACAAC
For real-time PCR
MEP2RT-F MEP2 CTGGAAGCAATTGGGGTATCAG
MEP2RT-R MEP2 TGGTTTCAGGATCGTCATCAGC
RAS1RT-F RAS1 GGAGGTGGTGGTGTTGGTAAAT
RAS1RT-R RAS1 CATGGCCAGATATTCTTCTTGTCC
EFG1RT-F EFG1 CCAGGAATCAGACCACGAGTAA
EFG1RT-R EFG1 CACAACGTGTCTCACCTTTTCTG
CPH1RT-F CPH1 TGTATGACGCTTCTGGGTTTCC
CPH1RT-R CPH1 GATATCCCATGGCAATTTGTTGTTG
HWP1RT-F HWP1 CCACTACTACTGAAGCCAAATCAT
HWP1RT-R HWP1 TGGATACTGTACCAGTTGGTGTTT
GAP1RT-F GAP1 TGTTAGACATGCATTACCCAAAGC
GAP1RT-R GAP1 CACCGTTAACAATGGCAATAGTGA
MEP1RT-F MEP1 AACAACAGCCAGAGGTACCTGA
MEP1RT-R MEP1 CCACTGGATCATGTTTCTCTTGTA
** The mutated codons are in boldface.
- 29 -
Table 3. (continued)
Primer Gene Sequence (5′-3′)
For real-time PCR
GLN3RT-F GLN3 ATG ACT ACA TCG AAT AGT CAG TCC
GLN3RT-R GLN3 CAT ACT AAG GGC CTG AGA TTG C
GAT1RT-F GAT1 CAA TGA CAG AGG TAG TTC AGG TG
GAT1RT-R GAT1 GGA TGT TTG ACT GGG GTG GTT A
For Northern blot analysis
MEP2-F MEP2 GTAGATCTCCAATATGTCTGGAAATTTCACTGG
MEP2-R MEP2 AGACTCGAGTTAATTTTTAGCTTCTCCTGAGTC
RAS1-F RAS1 GAAAGATCTATGTTGAGAGAATATAAATTAG
RAS1-R RAS1 GAAGATATCTCAAACAATAACACAACATCC
EFG1-F EFG1 CCGGATCCATGTCAACGTATTCTATACC
EFG1-R EFG1 CCACGCGTCAATGACTGAACTTGGG
CPH1-F CPH1 GAAATGTGGCGCCGATGCAA
CPH1-R CPH1 ACCCGGCATTAGCAGTAGAT
HWP1-F HWP1 GTGACAATCCTCCTCAACCT
HWP1-R HWP1 GAGAGGTTTCACCGGCAGGA
GAP1-F GAP1 TTAAGTACTGGTGGACCAGC
GAP1-R GAP1 CAAACCCCACTTTGAGCAAC
MEP1-F MEP1 ATGTCAGCAGAAGAAGTAATACAATACATTTC
MEP1-R MEP1 ACGATATTCCACTGGATCATGTTTCTCTT
GLN3-F GLN3 ATGACTACATCGAATAGTCAGTCCAAAC
GLN3-R GLN3 CTTGATTACATCTGACTTCAATGAAAGTGG
GAT1-F GAT1 ATGTACTACCGTGCTCGTCACTCAT
GAT1-R GAT1 GTTGGCGATGTTATTGATGCTGACG
- 30 -
Table 3. (continued)
Primer Gene Sequence (5′-3′)*
For overexpression
ADH-GST2-F GST2 GCAGATCTAGCAGCAACAATGACTAAACCA (BglII)
ADH-GST2-R GST2 GCCTCGAGTTTATTTTTTCTCTGGGACATTG (XhoI)
ADH-CPH1-F CPH1 GGCAGATCTCTTTCGCCATGTCAATTACTAAAAC (BglII)
ADH-CPH1-R CPH1 GACTCGAGCTATGTTTGTGACTGTTTTACTTC (XhoI)
ADH-EFG1-F EFG1 CCGGATCCATGTCAACGTATTCTATACC (BamHI)
ADH-EFG1-R EFG1 CCACGCGTCAATGACTGAACTTGGG (MluI)
ADH-RAS1-F RAS1 GAAAGATCTATGTTGAGAGAATATAAATTAG (BglII)
ADH-RAS1-R RAS1 GAAGATATCTCAAACAATAACACAACATCC (EcoRV)
* The created restriction sites are underlined.
- 31 -
RESULTS
1. Identification, characterization and deletion of GST2
1.1 Identification and characterization of GST2
In our previous work, several genes upregulated by FA in C. albicans were
identified (Chung et al., 2005). Of these, CA15 expression was increased by
approximately two-fold by treatment with 40 μM FA for 40 min. CA15 shares 99%
homology with GST2 (1–541 bp) from the Candida Genome Database
(http://candidagenome.org); which is thought to be a putative glutathione S-
transferase. To confirm the full-length cDNA sequence of CA15, 3′- and 5′- rapid
amplification of the cDNA ends (RACE) were performed. Sequencing produced an
open reading frame (ORF) consisting of 660 bp encoding a predicted product of 219
amino acids as expected (GenBank Accession Number HM594683).
Ca19.2693 (Candida albicans orf19.2693) was named GST2 which is predicted
to function as glutathione S-transferase (GST). According to BLAST search results,
GST2 exhibits sequence homology to fungal GSTs, that contains two conserved
domains of GST_N_Ure2p_like family or GST_C_YfcG_like family (Figure 4).
However, a GST activity of this gene is not yet verified.
1.2 GST2 of C. albicans has a GST activity
To determine a GST activity of Gst2p, GST assay was performed with Gst2L41Sp
- 32 -
and Gtt11p. The Gtt11p, which is already known to have activity against standard
GST substrates, was used as a positive control (Garcerá et al., 2010). In C. albicans,
the universal leucine CTG codon is translated both as serine (97%) and leucine (3%)
(Rocha et al., 2011). Hence, the CTG codon of Gst2p at 41st position to TCT was
mutated for codon usage (Lan et al., 2011). Recombinant Gst2p, Gst2L41Sp and
Gtt11p were purified by affinity chromatography from E. coli extracts for the in vitro
assay. As shown in Figure 5A, Gst2L41Sp exhibited higher GST activity than others.
These results indicate that the Gst2p has GST activity and 41st position serine residue
is important for this activity.
1.3 Deletion of GST2 increases oxidative sensitivity
To investigate the role of GST2 in C. albicans, homologous recombination was
used in a multistep procedure to delete both alleles of the gene in the SC5314-derived
C. albicans strain CAI4. These deletions were confirmed by Southern blotting
(Figure 6). In microorganisms, some GST proteins are induced in response to
oxidative stress and lacking these genes are more sensitive to the stress (Garcerá et
al., 2010; Inoue et al., 1999). Whether Gst2p plays the same role in H2O2 induced
oxidative stress responses was also examined. The results indicated that the deletion
mutant was more sensitive to this agent than wild-type (WT) CAI4 strain (Figure
5B).
- 33 -
Figure 4. Conserved domains of GST2. The C. albicans GST2 gene product and
conserved domains, N-terminal S. cerevisiae Ure2p like domain(dotted white) and
C-terminal alpha helical Escherichia coli YfcG like domain (black).
- 34 -
GST_N_Ure2p_like
GST_C_YfcG_like
N C
4 86 98 212
- 35 -
Figure 5. Functional identification of GST2. (A) GST activity of Gst2p was
expressed as mU mg–1 protein. Bars indicate the mean (±SD) of three separated
experiments. (B) Oxidative stress responses of wild-type containing pYPB-ADHpt
empty vector (CAI4Y) and Δgst2 mutant containing pYPB-ADHpt empty vector
(GST2-1142Y) were determined by spotting strains onto YNB agar containing 2 mM
H2O2 after 72 h incubation at 28°C.
- 36 -
0
10
20
30
40
50
60
Sp
ec
ific
ac
tivit
y
(mU
/mg
pro
tein
)
A
Gtt11p Gst2p Gst2L41sp
B
Wild-type / vector
Δgst2
/ vector
Δgst2
/ vector + GST2
105 10
4 10
3 10
2 10
1
Control + 2 mM H2O2
105 10
4 10
3 10
2 10
1
- 37 -
Figure 6. Disruption of C. albicans GST2. Southern blot analysis was performed
with a 32P-labeled 1.3-kb probe amplified by PCR from GST2/Δgst2(GST2-11)
genomic DNA using pQF62 and GST2probe-R as primers. Genomic DNA samples
digested with BglII and EcoRV were prepared from strains CAI4 (wild-type,
GST22/GST2), GST2-11 (heterozygous, GST2/Δgst2), and GST2-1142
(homozygous, Δgst2/Δgst2). The bottom line represents the wild-type (SC5314)
GST2 genomic locus. The middle line represents the first disruption allele and
disruption fragment. The top line represents the second disruption allele and
disruption fragment. B: BglII, E: EcoRV.
- 38 -
GST2
gst2AΔ::hph gst2BΔ::hph 2.4
Kb
2.1
0.8
CA
I4
GS
T2
-11
(G
ST
2/Δ
gst2
)
GS
T2
-11
42 (Δ
gst2
/Δg
st2
)
Probe
B E
hph
B E
hph
B E E
0.5 Kb
GST2
- 39 -
2. Nitrogen starvation-induced filamentous growth depends
on the presence of Gst2p in C. albicans
2.1 The Δgst2 mutant cells defect their filamentation under nitrogen
starvation condition
In C. albicans, FA acts as a quorum-sensing molecule (QSM) to suppress
filamentation (Oh et al., 2001). To investigate whether GST2, the gene induced by
FA, has a role in C. albicans morphogenesis, the ability of the homozygous deletion
mutant Δgst2 to switch from yeast to filamentous growth under a variety of growth
conditions was observed. Morphological switching was induced on GS medium,
Spider medium, Lee’s medium (pH 7), or SHAD (containing 10 mM ammonium
sulfate) at both 28°C and 37°C. Under these incubation conditions, no phenotypic
differences were observed between WT and deletion mutant cells (data not shown).
A defect in filamentous growth (predominantly yeast cells) was observed only on
SLAD agar plates (containing < 0.1 mM ammonium sulfate) at 28°C or 37°C (Figure
7A). This defect was rescued by overexpression of GST2 under the control of the
ADH promoter. As the gene is essential for filamentous growth (predominantly
pseudohyphae) under low-ammonium conditions, I next examined whether Gst2p is
involved in the induction of filamentous growth of C. albicans by other nitrogen
sources. The WT strain formed pseudohyphae efficiently at 28°C when grown on SD
agar containing 0.01 mM urea or amino acids, such as glutamine and proline,
whereas the deletion mutant strain did not (Figure 7B).
- 40 -
2.2 Nitrogen starvation induces GST2 expression
As the first step toward understanding the role of GST2 during filamentation in
C. albicans, the levels of GST2 transcript in the WT strain grown under various
culture conditions were investigated. Northern blot analysis showed that GST2
mRNA was expressed to some extent in all media tested; however, a marked increase
was observed within 2 h of incubation in SLAD (0.01 mM ammonium sulfate) liquid
medium (Figure 8). These results indicated that nitrogen limitation increases GST2
expression in C. albicans.
Next, the regulation of GST2 expression by nitrogen availability was
investigated. The wild-type strain was cultured in the presence of different
concentrations of ammonium or other nitrogen sources, and expression of GST2 was
examined by Northern hybridization. As shown in Figure 9A, GST2 expression was
strongly induced (about five-fold) when the ammonium sulfate concentration
decreased to 0.1 mM or below. In the presence of 0.01 mM ammonium, a marked
increase in GST2 transcript level was observed within 40 min (Figure 9B). Similar
amounts of GST2 mRNA were detected when 0.01 mM of urea or various amino
acids were used as the sole nitrogen source, indicating that the presence of
ammonium is not required for induction of GST2 expression under conditions of
nitrogen starvation (Figure 9C) and the capacity of C. albicans filamentation under
conditions of nitrogen starvation depends on a high level of GST2 expression.
Similar results were observed at 37°C.
- 41 -
2.3 FA does not affect expression of GST2 under nitrogen starvation
condition
The effects of FA on GST2 mRNA expression under conditions of nitrogen
starvation was also investigated. Interestingly, addition of FA (40 µg/ml) did not
affect the expression of GST2 mRNA in SD based media at 28°C, indicating that FA
does not induce GST2 expression and repress filamentous growth of C. albicans
under these test conditions (Figure 10).
- 42 -
Figure 7. Defects in hyphal formation caused by deletion of GST2. (A) C. albicans
wild-type (CAI4) and Δgst2 mutant (GST2-1142) strains were transformed with an
empty control vector (pADH) and a GST2-containing vector (pADH-GST2). The
resulting strains were assayed for filamentous growth on SLAD plates containing
0.01 mM ammonium sulfate. Images were obtained after 11 days of incubation at
28°C or after 5 days of incubation at 37°C (scale bar = 2 mm). (B) Wild-type and
Δgst2 mutant cells were grown on SD agar plates containing 0.01 mM urea or amino
acids as the sole nitrogen source. Images were obtained after 11 days of incubation
at 28°C or after 5 days of incubation at 37°C (scale bar = 2 mm).
- 43 -
A Vector
+ GST2
Vector
+ GST2
5 days,
37°C
11 days,
28°C
Vector Vector
Wild-type Δgst2
B Ammonium
sulfate Glutamine
Wild-type,
28°C
Δgst2,
28°C
Urea Proline
Wild-type,
37°C
Δgst2,
37°C
- 44 -
Figure 8. Expression of GST2 under different conditions in wild-type strain. Pre-
cultured Cells (SC5314) were inoculated into the liquid media indicated and grown
for 2 h in the conditions indicated. RNAs were prepared from each culture, and
Northern analysis was carried out with probe to the GST2 gene.
- 45 -
28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C 28°C 37°C
YPD Spider Lee’s GS SLAD SHAD
GST2
rRNA
- 46 -
Figure 9. Northern blot analysis of GST2 expression. Wild-type cells (CAI4
containing empty pYPB1-ADHpt) were grown at 28°C and 37°C for 2 h in SD liquid
medium containing the indicated concentrations of ammonium sulfate (A), incubated
at 28°C and 37°C for the indicated times in SD containing 0.01 mM ammonium
sulfate as the sole nitrogen source (B), or cultured at 28°C and 37°C for 2 h in SD
containing containing the indicated concentrations of various nitrogen sources (C).
Northern blots were prepared with total RNA from cells. PCR products were
amplified with the appropriate oligonucleotides (see Table 3) and labeled with (α-
32P)dCTP.
- 47 -
C
A
GST2,
28℃
rRNA
100 10 1 0.1 0.01
Ammonium sulfate (mM)
GST2,
37℃
rRNA
B
0 20 40 60 120 240
Ammonium sulfate (0.01mM)
Time
(min)
rRNA
GST2,
28℃
GST2,
37℃
rRNA
- 48 -
Figure 10. Effects of farnesoic acid (FA) on GST2 expression. WT (SC5314) cells
were grown at 28°C for 2 h in SD liquid medium containing the indicated
concentrations of ammonium sulfate with (+) or without (–) 40 μg/ml FA.
- 49 -
(-) FA
GST2
rRNA
100 10 1 0.1 0.01 100 10 1 0.1 0.01 Ammonium sulfate (mM)
(+) FA
- 50 -
3. Effects of GST2 disruption on hyphal-inducing signaling
pathway
3.1 Effects of GST2 disruption on the expression levels of mRNAs related
to the hyphal-inducing signaling pathway
As noted above, filamentous growth of C. albicans is mainly regulated by
MAPK and cAMP-dependent PKA pathways, defined by the transcription factors
Efg1p and Cph1p (Sudbery, 2011). To determine whether GST2 disruption
contributes to either of these pathways during inhibition of hyphal growth, RNAs
were isolated from wild-type and Δgst2 mutant cells growing on SLAD media
following incubation for 2 h at 28°C. Northern blot analysis (Figure 11) and real-
time PCR (Figure 12) about the signaling pathway component genes such as MEP2,
RAS1, EFG1, CPH1, HWP1, and GAP1 were performed for quantification. HWP1
and GAP1, which represent Efg1p- and Cph1p-dependent genes for hyphal induction,
respectively, were expressed at very low levels even in wild-type in this condition.
Transcriptions of MEP2, RAS1 and EFG1 were about 2.3, 0.6, and 1.2-fold higher,
respectively, in Δgst2 cells compared to wild-type cells.
3.2 A hyperactive RAS1 allele and exogenous addition of cAMP restore
filamentation
Based on our finding that the Δgst2 mutant fails to develop extensively
elongated filamentation, Gst2p may play a role in filamentous growth related
- 51 -
nitrogen starvation. As can be known Figure 11, Gst2p expression was influenced
MEP2, RAS1 and EFG1 transcription. According to these results, I suppose that
Gst2p might take part in hyphal-inducing signaling pathways of MEP2. To
investigate this, several elements that regulate MEP2-activating signaling pathways
during filamentation were cloned under the control of either the ADH promoter, and
transformed into wild-type (CAI4) and Δgst2 mutant (GST2-1142) strains. The
modified strains were assessed in terms of their abilities to support hyphal
development when cultured on solid SLAD medium.
In this work, the hyphal defect of the Δgst2 mutant strain was not suppressed by
the overexpression of transcription factors CPH1 or EFG1. Furthermore, an
overexpression of RAS1 was unable to complement the hyphal defect of the Δgst2
mutant strain at the condition tested. Contrary to preceding results, expression of the
hyperactive RAS1G13V allele, which carries a mutation that locks the G protein in the
active state (Feng et al., 1999), in Δgst2 mutant cells suppressed the hyphal-
formation defect on solid SLAD medium. The expression of the Ras1G13Vp in wild-
type cells also enhanced the formation of pseudohyphae.
Biochemical studies of C. albicans implicate cAMP level increases in yeast-
hyphae transitions (Niimi, 1996). Previous reports have shown that exogenous
addition of cAMP or dibutyryl cAMP to C. albicans cells increases the frequency of
yeast-hyphae transitions and is able to suppress a defect in adenylate cyclase activity
(Bahn and Sundstrom, 2001; Rocha et al., 2001). In this study, addition of cAMP to
wild-type cells enhanced the formation of pseudohyphae on solid SLAD medium
- 52 -
and exogenous addition of cAMP to Δgst2 mutant cells suppressed the hyphal-
formation defect in this medium (Figure 13B). Taken together, the present results
indicate that activation of hyphal-inducing signaling pathway by Gst2p occurs
upstream of the Ras1p-cAMP signaling pathway in response to nitrogen starvation.
- 53 -
Figure 11. Northern blot analysis of mRNAs related to the hyphal-inducing
signaling pathway in C. albicans. (A) Wild-type (WT) (CAI4Y) and Δgst2 mutant
(GST2-1142Y) strains were incubated at 28°C for 2 h on SLAD liquid medium
containing 0.01 mM ammonium sulfate, and Northern blots were prepared with total
RNA from cells. PCR products were amplified with the appropriate oligonucleotides
(see Table 3) and labeled with (α-32P)dCTP. (B) The time courses of mRNA
expression of MEP2, RAS1 and GST2. Total RNA was isolated from wild-type
(CAI4Y) and Δgst2 (GST2-1142Y) mutant cells cultured in SLAD liquid medium
for 4 h at 28°C, and transcript levels were determined.
- 54 -
Time
(min)
Wild-type Δgst2
RAS1
MEP2
GST2
rRNA
B
A
0 20 40 60 120 240 0 20 40 60 120 240
10 0.01
Δgst2 Wild-type
Ammonium sulfate (mM) 10 0.01
MEP2
RAS1
HWP1
EFG1
CPH1
GAP1
rRNA
- 55 -
Figure 12. Expression of genes related to the hyphal-inducing signaling pathway in
C. albicans. Wild-type (CAI4Y) and Δgst2 mutant (GST2-1142Y) were incubated at
28°C for 2 h on SLAD liquid medium containing 0.01 mM ammonium sulfate. Upper
panel is result of Northern blot analysis. rRNA was used as loading control. Lower
panel is result of quantitative real-time PCR. All values were normalized by using
18s rRNA as an internal control, according to the 2-ΔΔCt method. 104-fold diluted
cDNA was used for 18s rRNA. Data are derived from the average of three repeated
experiments from three samples. Bars represent the standard deviations.
- 56 -
0
5
10
15
20
MEP2 RAS1 EFG1 CPH1 HWP1 GAP1
No
rma
lize
d t
ran
sc
rip
t a
bu
nd
an
ce
(arb
itra
ry u
nit
s) WT
Δgst2
- 57 -
Figure 13. Effects of various expression constructs on the hyphal response to solid
SLAD medium in C. albicans. (A) Wild-type (WT; CAI4) and ∆gst2 mutant (GST2-
1142) strains containing each plasmid were incubated for 11 days at 28°C on SLAD
plates containing 0.01 mM ammonium sulfate (scale bar = 2 mm). The names of the
plasmids containing the various constructs are given on the left and described in
Table 2. (B) Cells from the WT and ∆gst2 mutant were incubated on SLAD plates
containing 0.01 mM ammonium sulfate with (+cAMP) or without (–cAMP)
dibutyryl cAMP (10 mM final concentration). Photographs were taken after 11 days
of incubation at 28°C in the test medium (scale bar = 2 mm).
- 58 -
Δgst2 Wild-type
pADH
pADH-
RAS1G13V
pADH-
RAS1
pADH-
CPH1
pADH-
EFG1
B Δgst2 Wild-type
-cAMP +cAMP +cAMP -cAMP
A
- 59 -
4. Influence of GST2 to transcriptional regulation of GLN3,
an ammonium permease regulatory GATA transcription
factor
4.1 GST2 regulates GLN3 transcription under nitrogen starvation
condition
Previous studies have shown that the expression of ammonium permease, MEP2,
is controlled by the GATA factors Gln3p and Gat1p under conditions of nitrogen
starvation (Dabas and Morschhäuser, 2007; Liao et al., 2008). As shown in Figure
12, the Δgst2 mutant promoted higher MEP2 mRNA levels than the wild-type under
nitrogen limitation conditions. These results suggested that the upregulation of
MEP2 in Δgst2 mutant is dependent on GATA factors. To investigate this hypothesis,
Northern blot analysis was performed with wild-type (CAI4Y), Δgst2(GST2-1142Y),
Δgln3, Δgat1, Δmep2, and Δmep1 single mutants, and Δgln3/Δgat1 and
Δmep2/Δmep1 double mutants (Figure 14A). All mutants without Δgst2, have URA3
at their own loci. Therefore I investigated SC5314 and Δgst2 (GST2-114) to reduce
effect of URA3 localization. The results indicated that deletion of GLN3 or GAT1
reduced the level of MEP2 transcription. However, Δmep2 and Δmep1 increased a
transcription level of MEP1 and MEP2, respectively. The Δgst2 mutant showed an
approximately 1.6-fold increase (Figure 14B) in GLN3 transcript level but not that
of GAT1, suggesting that Gst2p functions as a negative regulator of GLN3 expression
in response to nitrogen limitation. In addition, gene expression analysis revealed that
- 60 -
deletion of GST2 increased the MEP1, mRNA level similar to MEP2. These findings
led to the hypothesis that Gst2p regulates proper GLN3 expression and consequently
regulates ammonium permeases, MEP2 and MEP1, expression under nitrogen
starvation condition
4.2 Δgst2 increase sensitivity to rapamycin
The TOR (target of rapamycin) pathway is a global nutrient sensing pathway
and is the target of inhibition by the drug rapamycin in C. albicans and other fungi
(Cruz et al., 2001). Cell growth is inhibited in the presence of rapamycin, an inhibitor
of TOR kinases. The sensitivity of C. albicans to rapamycin was greatly decreased
by deletion of either GLN3 or GAT1. Sensitivity was further reduced in Δgln3Δgat1
double mutants. This suggests that Gln3p and Gat1p are subject to TOR kinase
control and function downstream of TOR kinase. Deletion of GST2 was increased
sensitivity to rapamycin (Figure 15). These results indicate that Gst2p is related with
TOR regulon. Taken together, these findings suggest that Gst2p regulates proper
GLN3 expression and consequently regulates the expression of the ammonium
permeases MEP2 and MEP1 under conditions of nitrogen starvation.
- 61 -
Figure 14. Up-regulation of GLN3 in Δgst2. (A) Northern blot analysis of mRNAs
related to ammonium permease regulation in C. albicans. Cells were incubated at
28°C for 2 h on SLAD liquid medium containing 0.01 mM ammonium sulfate. (B)
Quantitative PCR of genes related to ammonium permease regulation in C. albicans.
Wild-type (CAI4Y) and Δgst2 mutant (GST2-1142Y) were incubated at 28°C for 2
h on SLAD liquid medium containing 0.01 mM ammonium sulfate. All data were
normalized by using 18s rRNA as an internal control, according to the ΔΔCt method.
Data are derived from the average of three repeated experiments from three samples.
Bars represent the standard deviations, and the relatevie levels of MEP2, MEP1,
GLN3, GAT1 expression in Δgst2 mutant to that of the wild-type strain presented as
fold changes in y-axis.
- 62 -
0
0.5
1
1.5
2
2.5
3
MEP2 MEP1 GLN3 GAT1
Re
lative
exp
ressio
n
WT
Δgst2
A
B
GLN3
Ammonium sulfate (0.01 mM)
WT
GAT1
MEP2
MEP1
rRNA
(SC5314) (GST2 -114)
(GST2 -1142Y)
CAI4 Δgst2 Δmep2 Δgln3 Δmep1 Δgat1 Δgst2 Δmep2 Δgln3
(CAI4Y) Δmep1 Δgat1
- 63 -
Figure 15. Rapamycin sensitivity assay of Δgst2. Serial dilutions of strains WT
(CAI4Y), Δgst2 GST2-1142Y), the rescued Δgst2 mutant were spotted on YPD
containing 10 ng/ml rapamycin and imaged after incubation 72 h at 28°C.
Additionally, SC5314 (WT), Δgst2 (GST2-114), Δgln3(GLN3M4A),
Δgat1(GAT1M4A) and Δgln3/Δgat1(Δgln3GAT1M4A) double mutant were spotted
on YPD containing 10 ng/ml rapamycin and imaged after incubation 72 h at 28°C.
- 64 -
105 10
4 10
3 10
2 10
1 10
5 10
4 10
3 10
2 10
1
Control + 10 ng/ml Rapamycin
Δgst2 (GST2-114)
Δgln3
Δgat1
Δgln3Δgat1
WT (SC5314)
WT + pADH (CAI4Y)
Δgst2 + pADH (GST2-114Y)
Δgst2 + pADH-GST2
- 65 -
DISCUSSION
The results of this study demonstrate that GST2 is induced in response to
nitrogen limitation and required for nitrogen starvation-induced filamentation of C.
albicans. The present findings indicate that Gst2p has GST activity and is required
for response to oxidative stress. The GST activity relies at least in part on 41st
position serine residue of Gst2p, which is weakly conserved between C. albicans
Gst2p and S. pombe Gst2p. The Ser41 is a neighboring residue of predicted GSH
binding site from the RCSB Protein Data Bank (http://www.rcsb.org), hence the
residue may influence Gst activity. To investigate the possibility that Gst2p affects
yeast-to-hypha transition, phenotype of Δgst2 under various growth conditions was
examined and marked filamentous defect of Δgst2 was detected under conditions of
nitrogen starvation. Strongly induction of GST2 mRNA expression was also found
when the ammonium sulfate concentration decreased to 0.1 mM or below as the sole
nitrogen source. High concentration of ammonium suppresses filamenatation of C.
albicans and retains basal level transcription of GST2. GST2 expression was induced
irrespective of the nature of the limiting nitrogen source in the growth medium.
Expression of GST2 at body temperature (37 °C) was more inducible than that of
28 °C under various culture conditions. Elevated temperature induces filamentation
in C. albicans and increases hypha-specific genes under non-hypha-inducing media
(Kadosh and Johnson, 2005). GST2 was also influenced by high temperature, but the
increase of transcript by temperature was much less than that by nitrogen starvation.
- 66 -
Taken together, these results indicate that GST2 is involved in a wide range of
cellular responses to environmental stresses, including nitrogen starvation.
The morphological conversion from the yeast to filamentous growth forms in C.
albicans is regulated by several conserved signaling pathways, including the Cph1-
mediated MAPK and Efg1-mediated cAMP-PKA cascades (Hall et al., 2009; Liu,
2001; Rocha et al., 2001). Overexpression of either CPH1 or EFG1 results in
enhanced filamentous growth, with Ras1 capable of stimulating both the cAMP and
MAPK pathways (Courchesne and Magasanik, 1988; Sudbery, 2011). Cph1p and its
upstream activating pathway are required only for hyphal formation on solid Spider
medium, but not in liquid media. Consequently, Efg1p is thought to be the major
regulator of hyphal formation under most conditions (Csank et al., 1998; Liu et al.,
1994). C. albicans Mep2p, a high affinity ammonium permease, has been reported
to activate both the MAPK and cAMP-PKA pathways for the induction of
filamentous growth under conditions of nitrogen starvation (Biswas and
Morschhäuser, 2005). In Northern blot analysis, Δgst2 increase MEP2 transcription
and decrease RAS1 transcription markedly. These observations suggest a close
correlation between the Gst2p and Mep2p-regulated signaling pathways. The
resulting overexpression of CPH1 or EFG1 or RAS1 did not rescue the Δgst2
phenotype, whereas EFG1 overexpression in WT cells led to enhanced filamentation
around colonies. In contrast, the hyphal growth defect caused by homozygous
deletion of the GST2 gene was rescued by either overexpression of a hyperactive
RAS1G13V allele or through exogenous addition of cAMP. It means that the defect of
- 67 -
filamentation in Δgst2 was caused by inhibition of Ras1p activation. Based on these
observations, I propose that the Ras1-cAMP signaling pathway is a possible
downstream target of Gst2p in morphogenesis in response to nitrogen starvation.
Mep2p is an ammonium sensor that exists in a signaling component
conformation and induces morphogenesis when ammonium is absent or present at
low concentrations. Under these conditions, Mep2p is expressed at high levels, and
the high expression levels are required to promote morphogenesis (Biswas and
Morschhäuser, 2005). However, Northern blot analysis of cells growing on SLAD
medium indicated that the level of MEP2 transcripts was higher in Δgst2 cells than
wild-type cells despite defective filamentous growth in Δgst2 (Figure 7). In addition,
MEP1, another ammonium permease in C. albicans, transcripts were increased in
Δgst2 under conditions of nitrogen starvation (Figure 14). In C. albicans, the
signaling activity of Mep2p is inhibited by ammonium or its assimilation products.
Because Mep1p is a more efficient ammonium transporter than Mep2p (Biswas and
Morschhäuser, 2005), two-fold increase of MEP1 expression may induce
ammonium assimilation in Δgst2 cells despite nitrogen-starved condition. The
assimilation is possible to inhibit hyphal formation in Δgst2 cells.
The ammonium permeases MEP2 and MEP1 are controlled by the GATA
transcription factors GLN3 and GAT1. GLN3 is also an important regulator of
nitrogen starvation-induced filamentous growth in C. albicans (Dabas and
Morschhäuser, 2007; Liao et al., 2008). To determine whether Gst2p contributes to
the regulation of GATA factors, the transcript levels of GLN3 and GAT1 was
- 68 -
compared between Δgst2 and wild-type cells (Figure 14). Strikingly, the Δgst2
mutant exhibited a greater increase in GLN3 expression than wild-type cells. The
increased ammonium permease transcript level in Δgst2 mutant cells can probably
be attributed to elevated GLN3 expression. These findings suggest that Gst2p may
play a role as a regulator of GLN3 expression in C. albicans under conditions of
nitrogen starvation. Recently, deletion of GLN3, GAT1, or both genes resulted in
resistance to rapamycin, suggesting that the TOR kinase also controls Gln3p and
Gat1p in C. albicans (Dabas and Morschhäuser, 2007). The deletion mutants of
GST2 were more sensitive to rapamycin than wild-type (Figure 15). The result raises
the possibility that ammonium premeases regulation by Gst2p may also occur via
Gln3p in C. albicans.
Based on the results of the present study, I propose that Gst2p may be a
component of the Gln3p-related ammonium permease regulation process (Figure 16).
Gst2p also plays a role in nitrogen starvation-induced filamentation in preference to
induction of Mep2p expression. Although how Gst2p regulate GLN3 expression is
unclear, these findings have important implications for understanding of the
mechanism of filamentation by nitrogen starvation. Gst2p may be a new regulatory
component of filamentation in response to nitrogen starvation.
- 69 -
Figure 16. Proposed pathway of Gst2p during nitrogen starvation in C. albicans. A
MEP2 transcription may be regulated by the Gln3p via Gst2p. GLN3 is repressed by
Gst2p in response to nitrogen limitation. The repressed GLN3 transcription also
decreases Mep2p and Mep1p expression. Grey dashed line indicates a putative
regulation of Gst2p.
- 70 -
Gst2p Gln3p Gat1p
Mep2p
Nitrogen starvation
Filamentous growth
Mep1p
- 71 -
REFERENCES
Bahn, Y.S., Staab, J., and Sundstrom, P. (2003) Increased high-affinity phosphodiesterase
PDE2 gene expression in germ tubes counteracts CAP1-dependent synthesis of cyclic AMP,
limits hypha production and promotes virulence of Candida albicans. Mol Microbiol. 50,
391-409.
Bahn, Y.S., and Sundstrom, P. (2001) CAP1, an adenylate cyclase-associated protein gene,
regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required
for virulence of Candida albicans. J Bacteriol. 183, 3211-3223.
Beck, T., and Hall, M.N. (1999) The TOR signalling pathway controls nuclear localization
of nutrient-regulated transcription factors. Nature. 402, 689-692.
Berman, J. (2006) Morphogenesis and cell cycle progression in Candida albicans. Curr
Opin Microbiol. 9, 595-601.
Bertram, G., Swoboda, R.K., Gooday, G.W., Gow, N.A.R., and Brown, A.J.P. (1996)
Structure and regulation of the Candida albicans ADH1 gene encoding an immunogenic
alcohol dehydrogenase. Yeast. 12, 115-127.
Biswas, K., and Morschhäuser, J. (2005) The Mep2p ammonium permease controls
nitrogen starvation-induced filamentous growth in Candida albicans. Mol Microbiol. 56,
649-669.
Biswas, S., Van Dijck, P., and Datta, A. (2007) Environmental sensing and signal
transduction pathways regulating morphopathogenic determinants of Candida albicans.
Microbiol Mol Biol Rev. 71, 348-376.
- 72 -
Bourne, H.R., Wrischnik, L., and Kenyon, C. (1990) Ras Proteins - Some Signal
Developments. Nature. 348, 678-679.
Calderone, R.A., and Fonzi, W.A. (2001) Virulence factors of Candida albicans. Trends
Microbiol. 9, 327-335.
Chen, H., Fujita, M., Feng, Q.H., Clardy, J., and Fink, G.R. (2004) Tyrosol is a quorum-
sensing molecule in Candida albicans. Proc Natl Acad Sci U S A. 101, 5048-5052.
Chen, J.Y., Zhou, S., Wang, Q., Chen, X., Pan, T., and Liu, H.P. (2000) Crk1, a novel
Cdc2-related protein kinase, is required for hyphal development and virulence in Candida
albicans. Mol Cell Biol. 20, 8696-8708.
Choi, J.H., Lou, W., and Vancura, A. (1998) A novel membrane-bound glutathione S-
transferase functions in the stationary phase of the yeast Saccharomyces cerevisiae. J Biol
Chem. 273, 29915-29922.
Chung, S.C., Kim, T.I., Ahn, C.H., Shin, J., and Oh, K.B. (2010) Candida albicans
PHO81 is required for the inhibition of hyphal development by farnesoic acid. FEBS letters.
584, 4639-4645.
Chung, S.C., Lee, J.Y., and Oh, K.B. (2005) cDNA cloning of farnesoic acid-induced genes
in Candida albicans by differential display analysis. J Microbiol Biotechn. 15, 1146-1151.
Courchesne, W.E., and Magasanik, B. (1988) Regulation of nitrogen assimilation in
Saccharomyces cerevisiae roles of the URE2 and GLN3 Genes. J Bacteriol. 170, 708-713.
Crespo, J.L., and Hall, M.N. (2002) Elucidating TOR signaling and rapamycin action:
lessons from Saccharomyces cerevisiae. Microbiol Mol Biol Rev. 66, 579-591.
- 73 -
Cruz, M.C., Goldstein, A.L., Blankenship, J., Del Poeta, M., Perfect, J.R., McCusker,
J.H., Bennani, Y.L., Cardenas, M.E., and Heitman, J. (2001) Rapamycin and less
immunosuppressive analogs are toxic to Candida albicans and Cryptococcus neoformans via
FKBP12-dependent inhibition of TOR. Antimicrob Agents Chemother. 45, 3162-3170.
Csank, C., and Haynes, K. (2000) Candida glabrata displays pseudohyphal growth. Fems
Microbiol Lett. 189, 115-120.
Csank, C., Schroppel, K., Leberer, E., Harcus, D., Mohamed, O., Meloche, S., Thomas,
D.Y., and Whiteway, M. (1998) Roles of the Candida albicans mitogen-activated protein
kinase homolog, Cek1p, in hyphal development and systemic candidiasis. Infect Immun. 66,
2713-2721.
Cutler, J.E. (1991) Putative virulence factors of Candida albicans. Annu Rev Microbiol. 45,
187-218.
Dabas, N., and Morschhäuser, J. (2007) Control of ammonium permease expression and
filamentous growth by the GATA transcription factors GLN3 and GAT1 in Candida albicans.
Eukaryot Cell. 6, 875-888.
Dabas, N., Schneider, S., and Morschhäuser, J. (2009) Mutational analysis of the Candida
albicans ammonium permease Mep2p reveals residues required for ammonium transport and
signaling. Eukaryot Cell. 8, 147-160.
Davis-Hanna, A., Piispanen, A.E., Stateva, L.I., and Hogan, D.A. (2008) Farnesol and
dodecanol effects on the Candida albicans Ras1-cAMP signalling pathway and the regulation
of morphogenesis. Mol Microbiol. 67, 47-62.
- 74 -
Dhillon, N.K., Sharma, S., and Khuller, G.K. (2003) Signaling through protein kinases and
transcriptional regulators in Candida albicans. Crit Rev Microbiol. 29, 259-275.
Feng, Q.H., Summers, E., Guo, B., and Fink, G. (1999) Ras signaling is required for
serum-induced hyphal differentiation in Candida albicans. J Bacteriol. 181, 6339-6346.
Fonzi, W.A., and Irwin, M.Y. (1993) Isogenic strain construction and gene-mapping in
Candida albicans. Genetics. 134, 717-728.
Garcerá, A., Casas, C., and Herrero, E. (2010) Expression of Candida albicans glutathione
transferases is induced inside phagocytes and upon diverse environmental stresses. Fems
Yeast Res. 10, 422-431.
Gimeno, C.J., Ljungdahl, P.O., Styles, C.A., and Fink, G.R. (1992) Unipolar cell divisions
in the yeast Saccharomyces cerevisiae lead to filamentous growth regulation by starvation
and Ras. Cell. 68, 1077-1090.
Hall, R.A., Cottier, F., and Mühlschlegel, F.A. (2009) Molecular networks in the fungal
pathogen Candida albicans. Adv Appl Microbiol. 67, 191-212.
Hoffman, C.S., and Winston, F. (1987) A 10 minute DNA preparation from yeast efficiently
releases autonomous plasmids for transformation of Escherichia coli. Gene. 57, 267-272.
Hogan, D.A. (2006) Talking to themselves: autoregulation and quorum sensing in fungi.
Eukaryot Cell. 5, 613-619.
Hornby, J.M., Jensen, E.C., Lisec, A.D., Tasto, J.J., Jahnke, B., Shoemaker, R., Dussault,
P., and Nickerson, K.W. (2001) Quorum sensing in the dimorphic fungus Candida albicans
is mediated by farnesol. Appl Environ Microb. 67, 2982-2992.
- 75 -
Hornby, J.M., and Nickerson, K.W. (2004) Enhanced production of farnesol by Candida
albicans treated with four azoles. Antimicrob Agents Chemother. 48, 2305-2307.
Inoue, Y., Matsuda, T., Sugiyama, K., Izawa, S., and Kimura, A. (1999) Genetic analysis
of glutathione peroxidase in oxidative stress response of Saccharomyces cerevisiae. J Biol
Chem. 274, 27002-27009.
Kadosh, D., and Johnson, A.D. (2005) Induction of the Candida albicans filamentous
growth program by relief of transcriptional repression: a genome-wide analysis. Mol Biol
Cell. 16, 2903-2912.
Kim, S.Y., Kim, C., Han, I.S., Lee, S.C., Kim, S.H., Lee, K.S., Choi, Y., and Byun, Y.
(2001) Inhibition effect of new farnesol derivatives on all-trans-retinoic acid metabolism.
Metabolism. 50, 1356-1360.
Kohler, J.R., and Fink, G.R. (1996) Candida albicans strains heterozygous and
homozygous for mutations in mitogen-activated protein kinase signaling components have
defects in hyphal development. Proc Natl Acad Sci U S A. 93, 13223-13228.
Kron, S.J., and Gow, N.A.R. (1995) Budding yeast morphogenesis : signaling, cytoskeleton
and cell cycle. Curr Opin Cell Biol. 7, 845-855.
Lan, D.M., Hou, S.L., Yang, N., Whiteley, C., Yang, B., and Wang, Y.H. (2011) Optimal
production and biochemical properties of a lipase from Candida albicans. Int J Mol Sci. 12,
7216-7237.
Leberer, E., Harcus, D., Dignard, D., Johnson, L., Ushinsky, S., Thomas, D.Y., and
Schroppel, K. (2001) Ras links cellular morphogenesis to virulence by regulation of the
- 76 -
MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol
Microbiol. 42, 673-687.
Lee, K.L., Campbell, C.C., and Buckley, H.R. (1975) Amino acid liquid synthetic medium
for development of mycelial and yeast forms of Candida albicans. Sabouraudia. 13, 148-
153.
Lengeler, K.B., Davidson, R.C., D'Souza, C., Harashima, T., Shen, W.C., Wang, P., Pan,
X., Waugh, M., and Heitman, J. (2000) Signal transduction cascades regulating fungal
development and virulence. Microbiol Molecular Biol Rev. 64, 746-785.
Liao, W.L., Ramon, A.M., and Fonzi, W.A. (2008) GLN3 encodes a global regulator of
nitrogen metabolism and virulence of C. albicans. Fungal Genet Biol. 45, 514-526.
Lim, C.S.Y., Rosli, R., Seow, H.F., and Chong, P.P. (2012) Candida and invasive
candidiasis: back to basics. Eur J Clin Microbiol. 31, 21-31.
Liu, H.P. (2001) Transcriptional control of dimorphism in Candida albicans. Curr Opin
Microbiol. 4, 728-735.
Liu, H.P., Kohler, J., and Fink, G.R. (1994) Suppression of hyphal formation in Candida
albicans by mutation of a STE12 homolog. Science. 266, 1723-1726.
Lo, H.J., Kohler, J.R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., and Fink, G.R.
(1997) Nonfilamentous C. albicans mutants are avirulent. Cell. 90, 939-949.
Morschhäuser, J. (2011) Nitrogen regulation of morphogenresis and protease secretion in
Candida albicans. Int J Med Microbiol. 301, 390-394.
- 77 -
Neuhäuser, B., Dunkel, N., Satheesh, S.V., and Morschhäuser, J. (2011) Role of the Npr1
kinase in ammonium transport and signaling by the ammonium permease Mep2 in Candida
albicans. Eukaryot Cell. 10, 332-342.
Niimi, M. (1996) Dibutyryl cyclic AMP-enhanced germ tube formation in exponentially
growing Candida albicans cells. Fungal Genet Biol. 20, 79-83.
Odds, F.C. (1994) Pathogenesis of Candida infections. J Am Acad Dermatol. 31, S2-5.
Oh, K.B., Miyazawa, H., Naito, T., and Matsuoka, H. (2001) Purification and
characterization of an autoregulatory substance capable of regulating the morphological
transition in Candida albicans. Proc Natl Acad Sci U S A. 98, 4664-4668.
Rocha, C.R.C., Schröppel, K., Harcus, D., Marcil, A., Dignard, D., Taylor, B.N., Thomas,
D.Y., Whiteway, M., and Leberer, E. (2001) Signaling through adenylyl cyclase is essential
for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol Biol Cell.
12, 3631-3643.
Rocha, R., Pereira, P.J.B., Santos, M.A.S., and Macedo-Ribeiro, S. (2011) Unveiling the
structural basis for translational ambiguity tolerance in a human fungal pathogen. Proc Natl
Acad Sci U S A. 108, 14091-14096.
Sanglard, D., Ischer, F., Monod, M., and Bille, J. (1996) Susceptibilities of Candida
albicans multidrug transporter mutants to various antifungal agents and other metabolic
inhibitors. Antimicrob Agents Chemother. 40, 2300-2305.
Sato, T., Watanabe, T., Mikami, T., and Matsumoto, T. (2004) Farnesol, a morphogenetic
autoregulatory substance in the dimorphic fungus Candida albicans, inhibits hyphae growth
- 78 -
through suppression of a mitogen-activated protein kinase cascade. Biol Pharm Bull. 27, 751-
752.
Saville, S.P., Lazzell, A.L., Monteagudo, C., and Lopez-Ribot, J.L. (2003) Engineered
control of cell morphology in vivo reveals distinct roles for yeast and filamentous forms of
Candida albicans during infection. Eukaryot Cell. 2, 1053-1060.
Sonneborn, A., Bockmuhl, D.P., Gerads, M., Kurpanek, K., Sanglard, D., and Ernst,
J.F. (2000) Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans.
Mol Microbiol. 35, 386-396.
Stoldt, V.R., Sonneborn, A., Leuker, C.E., and Ernst, J.F. (1997) Efg1p, an essential
regulator of morphogenesis of the human pathogen Candida albicans, is a member of a
conserved class of bHLH proteins regulating morphogenetic processes in fungi. Embo J. 16,
1982-1991.
Sudbery, P.E. (2011) Growth of Candida albicans hyphae. Nat Rev Microbiol. 9, 737-748.
Whiteway, M. (2000) Transcriptional control of cell type and morphogenesis in Candida
albicans. Curr Opin Microbiol. 3, 582-588.
Zou, H., Fang, H.M., Zhu, Y., and Wang, Y. (2010) Candida albicans Cyr1, Cap1 and G-
actin form a sensor/effector apparatus for activating cAMP synthesis in hyphal growth. Mol
Microbiol. 75, 579-591.
- 79 -
ABSTRACT IN KOREAN
Candida albicans ,
. ( , 37°C,
pH>7.0, ) ,
,
.
GST2 . C.
albicans GST2 gene anotation
Gst2p glutathione S-transferase
.
,
(SLAD)
. GST2 mRNA
Gst2p
- 80 -
.
Δgst2
Ras1p, Cph1p, Efg1p
, Ras1p Ras1G13Vp
cyclic AMP
. Gst2p Ras1-cAMP
. GST2 Ras1p
MEP2 MEP1 .
ammonium permease GLN3
. , Gst2p
GLN3 ammonium
.