39
Human Evolution Chapter 16

Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

  • Upload
    lenhi

  • View
    216

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human Evolution

Chapter 16

Page 2: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

EvolutionEvolution simply means change over time• Geneticists define evolution as:Changing allele frequencies• Most scientist’s agree with Darwin’s

mechanism of how evolution happens:Survival of the fittest – those with the best

alleles have the most offspring survive• “Natural Selection”

Page 3: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Evolution

The origin and changing of groups or organisms over time caused by their interactions with the natural world

Page 4: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Evolution:Evolution is both:A scientific fact:

- Repeatedly tested and not been refuted- “Confirmed to such a degree that it would be

perverse to withhold provisional consent" - Stephen J. Gould

And a scientific theory:- A hypothesis that simply and elegantly

explains the observations, that predicts phenomena, and that withstands many potential falsifications

Page 5: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Evolution:Evolution is a fact in the sense that life

changing through time has been proven:In nature today, the characteristics of species are

changing, and new species are arising. The fossil record is the primary factual evidence

for evolution in times pastEvolution is well documented by further evidence

from many scientific disciplines:Comparative anatomy, geology, genetics,

molecular biology, zoology and studies of viral and bacterial diseases.

Page 6: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Evolution:

Evolution is also a theory:An explanation for the observed changes in

life through Earth historyHas been tested numerous times without

being refutedandPredicts something about the natural world

that can be measured/checked

Page 7: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

How Evolution Happens?

Theory is derived from Charles Darwin• Process of “Natural Selection”• Natural Selection:

– Survival of the Fittest (alleles)– Whatever adaptations are better suited to

the environment then go on to become the most prevalent adaptations

– Decent with modification (of allele freq’s)

Page 8: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Process of Natural Selection:1. Organisms are always varied2. When the environment that organisms

live in changes some organisms are better “adapted” to handle the change

3. Better adapted animals are more successful

4. More successful means having more offspring survive

5. More offspring then pass down beneficial adaptations (increase allele frequency)

Page 9: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Changing Allele FrequencyMore offspring then pass down more of the

beneficial alleles:• Increase or decrease in allele frequency• Effect is seen in a change in the

phenotype frequencies– Since phenotypes are encoded by alleles

• Eventually may lead to speciation:– When organisms become so different that

they actually form a new species

Page 10: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

SpeciationThree main ways that speciation can occur:1. Allopatric

• Geographical isolation• Differences in alleles that are selected• Different alleles due to genetic drift

2. Sympatric• No geographical isolation

3. Parapatric• Two diverging species geographically touch

but do not overlap

Page 11: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Speciation DebateThere are some interesting debates about

some of the details of evolution:• Some believe that speciation events

happen at a steady rate over time• Others believe that species remain

unchanged over long periods of time –then speciation happens suddenly

• Punctuated Equilibrium

Page 12: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Examples – Changing Alleles

• Moths

• Diversity of finch beak shapesand sizes

• Changes in hominids (our ancestors and us)

Page 13: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human Origins• Evidence is combined from• Fossils:

– Whatever is fossilized– Uranium dating

• Molecular evolution:– Comparing genomic differences/similarities– Chromosome patterns– DNA or Protein sequences

Page 14: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human OriginsHumans started diverging from apes about 5

or 6 Million Years Ago (MYA)• Hominids separated from other primates

– Ancestors of humans only• Genus Australopithecus first:

– Around 4 MYA• Genus Homo came last:

– Around 2 MYA

Page 15: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human OriginsGenus Homo came last:

– Around 2 MYA1. Homo habilis

– First used tools, cave dwellers2. Homo erectus

– Used advanced tools, fire, complex society– Had skull shaped for possibility of speech

3. Neanderthals and Cro-Magnons diverge along two separate paths

Page 16: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human OriginsNeanderthals and Cro-Magnons diverge

along two separate paths:• Common ancestor between two lived

around 600 to 700 thousand years ago• Neanderthals:

– Prominent brow, shorter compact body– Evidence suggests most likely different

species• Cro-Magnon:

– Homo sapiens’ direct ancestor

Page 17: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Human Origins – Summary:Know the types of evidence:

– Fossils– Molecular

Know in general the differences between:• Australopithecus vs. Homo• Homo habilis vs. Homo erectus• Neanderthals vs. Cro-MagnonBasic timeline in MYA

Page 18: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Molecular EvolutionUsing molecular biology to provide

information about evolutionary historyComparing:1. Genomes2. Chromosome banding patterns3. SequencesMore that is shared, more closely related• Build evolutionary tree

Page 19: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing GenomesAlign the entire genome between different

organisms• Or align pieces of genome• Either way; some areas are “conserved”• There must be some selective pressure on

these regions of the genome to remain constant over time and evolution

• Usually genes and regulatory sequences

Page 20: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Genomes

Zoom in closer…

Page 21: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing ChromosomesLooking at similarities in chromosome

banding pattern

Page 22: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Chromosomes• Finding synteny between different

organisms• Synteny = whole regions of chromosomes

that are completely identical between two different species:– Order of the genes exact– Regulatory regions positions exact– However, non coding regions may be varied

(no selective pressures)

Page 23: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Chromosomes

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X

Human Chromosomes

Mouse Chr. 17 large stretches

of synteny

Mouse Chr. 8small regions

of synteny

Page 24: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Chromosomes

Human chromosomeswith mouse pieces

labeled

Page 25: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing SequencesAnalyze the exact sequence of either DNA or

proteins between species• Most proteins are very similar even in very

diverse organisms• Protein function has been conserved during

evolution• Certain genes don’t exist in lower

organisms – can you think of some?• You would be surprised how many do…

Page 26: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Sequences• Between Humans and Chimps proteins

share average of 99 percent of the exact same amino acids

• Mice and humans have the same number of genes and are often in the same order –fair amount of synteny

• 2/3rd of all human genes exist as the same gene in fruit flies

• Why are we so different then?– Gene Expression, Alternative Splicing, etc

Page 27: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Animal Models• Because so many of the genes have

remained constant between different species…

• What sort of experiments can we do?– Use animals as genetic models to discover

genes and gene function– Test out drugs on animals first– Even use animal parts or proteins ex – Insulin

Page 28: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Sequences• Known as “alignment” – when you try to

line up two sequences of DNA

Alignment 1 of 131 in window Human July 2005 (hg17) chr7:127471196-127471526, strand +, size 331 Chimp Nov. 2003 (panTro1) chr6:129885077-129885407, strand +, size 331 Mouse May 2004 (mm5) chr6:28904572-28904928, strand +, size 357 Rat Jun. 2003 (rn3) chr4:56178192-56178473, strand +, size 282

hg17.chr7 aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaa-tttttcat panTro1.chr6 aatctaggtgatgggtatattgtagttcactatagtattgcacacttttctgtatgtttaaaattttcat mm5.chr6 catatgggtaataagta-----taactcactatattatttttcacta-t----tg--tgtttgaaattttcat rn3.chr4 catatgggtaataagta-----taattcgt-tatattatt------------tttct-ta-----gaa-tttttcat

Page 29: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Comparing Sequences• Also can compare protein’s amino acid

sequence

• Bright pink are different amino acids than human sequence

Page 30: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Hybridization• Closer the

sequences are, the better two strands will “hybridize”

• Attach via complementary base pairing

Page 31: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Molecular Clocks• Because the mutation rate is fairly

constant:– Around 1 % per 1 Million Years for coding

regions• Amount of differences between two

species can give an estimate of how closely related they are

• Compare sequences and calculate an estimate of evolution between them

Page 32: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Molecular Clocks• Calculated on Autosomes – gives

information about conservation and relationship in general

• Calculated on mitochondria – gives information about maternal lineage:– Find “Eve”

• Calculated on Y chromosome – gives information about paternal lineage– Find “Adam”

Page 33: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Parsimony Analysis• Parsimony is the idea that the simplest

explanation of a phenomenon is the most likely.

In building an evolutionary tree:• Each mutation is a rare event• Less mutations it takes – more likely that

tree is to be correct• More mutations it takes – less likely

Page 34: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Parsimony Analysis

Page 35: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

EugenicsControlling human reproductive choices for

societal goals• Basically – it’s artificial selection:

– Same as we do to cows, tomatoes, dogs

• What do you know about eugenics?

• What are the pros and cons?

Page 36: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Eugenics• Been around for thousands of years,

perhaps even since the dawn of civilization• Sir Francis Galton – 1883 coined the term“Good in birth”• Positive Eugenics – trying to select and

breed superior attributes• Negative Eugenics – trying to stop

(sterilize) individuals with inferior attributes

Page 37: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

EugenicsExamples:• Caste system in India• Nazi Germany• USA:

– Begins around 1890’s with laws against breeding with certain individuals

– 1956 – Sterilization laws repealed– 1967 – Laws banning marriages between

different races repealed

Page 38: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Summary• Be able to define evolution and describe

mechanism of Natural Selection• Know basics of human origins and

evolution• Know different methods for using

Molecular Biology to interpret evolutionary relationships

• Humans can change our own evolution –through Eugenics

Page 39: Human Evolution - University of Vermontbiology/Classes/past-classes/295C/pdf/16_Humanev… · Human Evolution Chapter 16. ... some of the details of evolution: • Some believe that

Next Class:• Read Chapter Seventeen

• Homework – Chapter Sixteen Problems;– Review: 6, 7, 8, 15, 16, 17, 18– Applied: 1, 15