Human mesenchymal stromal cells express CD14 cross-reactive epitopes

Human Mesenchymal Stromal Cells Express CD14

Cross-Reactive Epitopes

Gregor A. Pilz,1 Julian Braun,1 Christine Ulrich,1 Tino Felka,1 Katrin Warstat,1 Manuel Ruh,1

Bernhard Schewe,2 Harald Abele,3 Anis Larbi,4 Wilhelm K. Aicher1,5*

� AbstractMesenchymal stromal cells (MSCs) do not express a unique definite epitope or markergene. As such, minimal criteria were recently established for defining multipotent MSC.These criteria include expression of CD73, CD90, CD105, and a lack of hematopoieticmarker expression. However, we detected binding of a CD14 antibody on bone marrow-and placenta-derived MSC and investigated the staining of CD14 antibodies on theseMSC in more detail. The MSC were isolated from human bone marrow and placenta tis-sue, expanded, characterized by quantitative RT-PCR, flow cytometry, and immunocyto-chemistry and differentiated to generate osteoblasts, chondrocytes, and adipocytes. TheCD14-cross-reactive MSCs were enriched by cell sorting. Human peripheral blood mono-nuclear cells, fibroblasts, and hematopoietic cell lines served as controls. Utilizing fourdifferent clones of CD14 monoclonal antibodies, we found that three CD14 reagentsstained the MSC. Two CD14 antibodies (HCD14 and M5E2) clearly marked the CD901

MSC population with distinct intensities, clone 134 620 generated a shift in flow cytome-try histograms, but clone MFP9 did not stain MSC. Transcripts encoding CD14 or theCD14 protein were not detected in MSC. We confirm that bone marrow- and placenta-derived MSC do not express CD14 and that the CD14 antibody MFP9 discriminatesbetween monocytes and MSC more efficiently than the other antibodies employed here.This investigation does not contradict previous work but provides a more accurate char-acterization of MSC. ' 2011 International Society for Advancement of Cytometry

� Key termsmesenchymal stromal cells; cell surface antigen; CD14; monocytes

BONE marrow (bm) contains hematopoietic precursor cells (HSCs). These CD34

expressing cells give rise to all blood cells, which in turn are defined by distinct cell

surface antigens, such as CD3, CD11b, CD14, CD19, CD20, and CD45. Bone marrow

also contains mesenchymal stromal cells (bmMSCs). Markers used to at least par-

tially characterize human bmMSC include STRO-1, CD73, CD90, CD105, and

CD164, in addition, a concomitant lack of hematopoietic markers such as CD34 and

CD45 (1,2). Bone marrow also contains additional precursors such as endothelial

precursor cells that express CD146 and CD133 (3). CD133 is not expressed by

bmMSC, but it is found on other progenitor cells such as HSC (4), and it may dwin-

dle on bone marrow-derived precursor cells during in vitro cell culture (5).

On the basis of a plethora of publications and intensive research in this field,

consensus conferences initiated by the International Society for Cellular Therapy

(ISCT) defined criteria for the characterization of human bmMSC and clarified MSC

nomenclature (6,7). According to these criteria, bmMSC are defined by (i) plastic

adherent growth, (ii) expression of CD73, CD90, and CD105, (iii) differentiation

capacity into osteoblasts, chondrocytes, and adipocytes, (iv) lack of expression of the

lineage marker for HSC, CD34, as well as lack of expression of the lymphocytic

marker CD45, and (v) lack of expression of B cell-associated antigens CD19 or

CD79b as well as HLA-DR, a member of the class II major histocompatibility anti-

1Center for Regenerative Medicine(ZRM), UKT, Eberhard-Karls University,Tubingen, Germany2Department of Traumatology, BGHospital, Tubingen, Germany3Department of Obstetrics andGynaecology, UKT, Eberhard-KarlsUniversity, Tubingen, Germany4Singapore Immunology Network (SIgN),Biopolis, A*STAR, Singapore5Center for Medical Research (ZMF),Department Orthopaedic Surgery, UKT,Eberhard-Karls University, Tubingen,Germany

Additional Supporting Information may befound in the online version of this article.FCS files are available from the authorsupon request.

Received 19 February 2010; RevisionReceived 21 March 2011; Accepted 4April 2011

Grant sponsor: BMBF; Grant number:313755; Grant sponsor: DFG; Grant num-ber: Ai16/10-3;

Gregor A. Pilz, Julian Braun, and Chris-tine Ulrich contributed equally and there-fore share first authorship.

*Correspondence to: Wilhelm K. Aicher,ZMF Center forMedical Research,Department of Orthopaedic Surgery,University of TubingenMedical School,Waldhornlstr. 22, 72072 Tubingen, Germany

Email: [email protected]

Published online 6 July 2011 in WileyOnline Library (wileyonlinelibrary.com)

DOI: 10.1002/cyto.a.21073

© 2011 International Society forAdvancement of Cytometry

Original Article

Cytometry Part A � 79A: 635�645, 2011

gens. A lack of expression of CD11b or of CD14 by bmMSC

was also listed in the consensus criteria (6) and confirmed for

placenta-derived MSC (pMSC) (8).

However, during the characterization of early passage

bmMSC and pMSC, we observed a positive signal for CD14

expression by flow cytometry within the cells expressing

CD105, CD90, or CD73. The CD14 glycoprotein is a GPI-

linked receptor for endotoxin (LPS), which is expressed on

certain cell types such as monocytes and macrophages and is a

key regulator of inflammatory responses to gram-negative

bacteria, oxidative burst, and septic shock (9). In contrast to

human bmMSC, expression of CD14 was observed on human

adipose tissue-derived MSC (atMSC) ex vivo (10) and on

equine atMSC (11). CD14 is also expressed by endothelial cells

but may escape detection because of in vitro culture conditions

(12). MSC express the toll-like receptors TLR1, TLR2, and

TLR6, which serve as receptors of bacterial lipoproteins, and

importantly, TLR4, which is part of the LPS receptor complex

(13). Full LPS responses are elicited when CD11b/CD18 and

CD14 cooperate with TLR4 (14), but TLR4 has been associated

with immunosuppressive properties of MSC (13).

At least three hypotheses can explain the CD14 signals

observed on MSC. (i) Since both MSC and macrophages

adhere to cell culture flasks, macrophages could have contami-

nated our MSC preparations. This would be especially worri-

some wherever MSC are destined for clinical applications. (ii)

Our preparations of bmMSC or pMSC contain an MSC popu-

lation related to atMSC. This seems very unlikely as expression

of CD14 is lost on atMSC in vitro (10). However, we detected

CD14 signals by flow cytometry on passaged MSC. (iii) Some

CD14 monoclonal antibodies detect a CD14 cross-reactive

epitope on MSC. We therefore investigated the reactivity of

this and three additional CD14 monoclonal antibodies on

MSC in more detail by flow cytometry and immunoblotting.

Peripheral blood mononuclear cells (PBMCs), monocytes, and

fibroblasts served as controls. The molecular and functional

data demonstrated that the CD14 staining observed was not

caused by a contamination of our MSC preparations with

monocytes or other similar cells.

MATERIALS AND METHODS

Isolation of MSC from Bone Marrow and Placenta

Human bone marrow was obtained from the BG hospital

from femurs of patients undergoing endoprosthesis surgery

(n 5 22). The bmMSCs were separated from debris by density

gradient centrifugation (q 5 1.084 mg/mL, Ficoll Paque, GE

Healthcare, Uppsala, Sweden), and the plastic adherent cell

fraction was expanded as described recently (15,16). The cells

were cultured in Dulbecco’s modified Eagle Medium (Lonza,

Basel, Switzerland) supplemented with 5% human plasma and

5% human platelet concentrate (IKET at University of Tubin-

gen Medical Center), 100 U/mL penicillin-streptomycin

(Gibco-Invitrogen, Carlsbad, CA) and 1,000 U heparin (Roth,

Karlsruhe, FRG) as described (17).

Human term placenta was obtained after Cesarean sections

from the Department of Obstetrics at UKT (n 5 17 donors).

The chorionic mesoderm (fetal origin) was dissected from the

remaining tissue (maternal origin) and washed in Hank’s

balanced salt solution (PAA, Pasching, Austria). The tissue was

mechanically minced and enzymatically digested with collage-

nase XI (750 U/mL; Sigma, Hamburg, FRG) and Dispase II

(250 lg/mL; Roche, Mannheim, FRG) for 1 h at 378C. Digestedtissue was filtered with 100-lm cell strainers (BD Falcon) to

remove undigested tissue fragments. MSCs from human term

placenta (pMSC) were cultured in the same medium as

bmMSC in a humidified incubator (378C and 5% CO2) (15).

After expansion and prior to reaching confluence, MSCs

were detached with the aid of a mild protease (Accutase1,

PAA). The MSCs were washed, and viability and yield were

determined (Trypan Blue method). The cells were then either

split for further expansion or prepared for analyses. All human

specimens were obtained from informed volunteers or patients.

The experiments were performed between mid 2007 and early

2011. The study was approved by the local ethics committee.

Isolation of Peripheral Blood Mononuclear

Cells and Monocytes

The PBMCs from healthy volunteers (n 5 5) were aspi-

rated from 25 mL of venous blood, separated by density gradi-

ent separation (Ficoll Paque), and washed and cultured in

X-Vivo-15 medium (Lonza). The monocytic cell line Mono-

Mac 6 (MM6, American Type & Culture Collection ATCC,

Rockville, MA), the hematopoietic cell line KG1a (ATCC), and

normal human diploid fibroblasts were employed for control

experiments. These cells were cultured in DMEM enriched

with 10% FCS and antibiotics (100 U/mL penicillin-strepto-

mycin, Gibco-Invitrogen).

Flow Cytometry

Samples were labeled with ethidium monoazide (EMA)

to discriminate false positive signals from dead cells according

to standardized procedures (18). To prevent unspecific bind-

ing of antibodies to the cell surface, the cells were incubated

with Gamunex1 serum (Talecris Biotherapeutics, Frankfurt,

FRG) for 20 min at 48C (19). Surface marker staining was per-

formed for 20 min at 48C using a mixture of directly conju-

gated antibodies diluted in PBS containing 2% fetal calf

serum, 2 mM EDTA, and 0.01% sodium azide (PFEA buffer).

For flow cytometry, the following monoclonal antibody

(mAb) was employed according to the supplier’s recommen-

dations: anti-CD11b-APC (clone 238 446, R&D Systems, Min-

neapolis, MN), anti-CD14-PE (clone 134 620, R&D Systems),

anti-CD14-APC (clone HCD14, Biolegend, San Diego, CA),

anti-CD14-PE (clone M5E2, Biolegend), anti-CD14-FITC

(clone MFP9, BD Bioscience), anti-CD29 (4B4, Beckman

Coulter, Krefeld, Germany), anti-CD34-PE (clone 4H11, Bio-

legend), anti-CD45-APC (clone 2D1, R&D Systems), anti-

CD73-PE (clone: AD2, BD Biosciences), anti-CD90-PE (clone:

Thy-1A1, R&D Systems), anti-CD105-FITC (clone: SN6,

AdDSerotec, Martinsried, FRG), and anti-CD146-PE (MCAM,

clone 128012, R&D Systems). T-lymphocytes were detected inGregor A. Pilz, Julian Braun, and Christine Ulrich contributed equallyand therefore share first authorship.

ORIGINAL ARTICLE

636 Cross-Reactive CD14 Antibodies and MSC

PBMCs by unconjugated anti-CD3 antibody (clone SK7, BD

Bioscience). After incubation for 30 min on ice, the cells were

washed three times with cold PFEA buffer, and binding of

unlabeled primary antibodies was then detected by FITC or

PE labeled goat anti-mouse IgG (1:100, Jackson Immuno

Research), or with APC labeled streptavidin (1:100, Biole-

gend), when required. Staining of cells with corresponding

conjugated secondary antibody served to control the specific-

ity of binding of the primary antibodies.

In some experiments, apoptotic cells were detected by stain-

ing the samples with FITC labeled annexin-V (Apoptosis Detec-

tion Kit I, BD Pharmingen, San Jose, CA) (20) and dead cells by

staining the chromatin with 7-AAD (BP Pharmingen) (21).

The samples were analyzed on an LSRII cytometer

equipped with three lasers (405, 488, and 633 nm) using the

following excitation and emission settings and filters: 405 nm:

450/50 nm (DAPI); 488 nm: 530/30 nm (FITC), 575/25 nm

(PE), 610/20 nm (EMA), 695/40 nm (7-AAD); 633 nm: 660/

20 nm (APC). The detector voltage settings were: FSC: 445;

SSC: 258; APC: 420; DAPI: 295; EMA: 400; PE/FITC: 370. For

each experiment, mouse or hamster/rat j-chain CompBeads

(BD Biosciences) were stained with the corresponding fluoro-

chrome-labeled antibodies and incubated for 20 min at room

temperature in the dark. Negative CompBeads were used as an

unstained negative control (BD Biosciences). After washing

with PFEA, the beads were resuspended in 200-lL PFEA for

automatic compensation with the BD FACS Diva acquisition

software. Data were processed and analyzed using FACS Diva

and FlowJo 7.2.2 (Treestar, Ashland, OR) following recently

updated guidelines (22). Flow cytometry data were computed

as geometric means of fluorescence intensity (MFI).

Magnetic-Activated Cell Sorting

The MSCs were detached by Accutase as described earlier

and washed in MACS1 running buffer (0.5% BSA, 2 mM

EDTA in PBS; Miltenyi Biotech, Bergisch Gladbach, FRG) and

107 MSC were blocked by incubating the cells in Gamunex1

(50 lL, 48C, 20 min; Talecris). The MSCs were rinsed in

MACS1 running buffer (Miltenyi) and allowed to react with

the PE-labeled CD14 mABs clones M5E2 or 134620. After

washing, 107 MSCs were incubated with 20-lL anti-PE mag-

netic beads, rinsed again, resuspended in MACS1 running

buffer, and separated in an autoMACS1 separator (Miltenyi) as

described by the supplier, using the program possel and pos-

sel_s for enrichment of the CD14 cross-reative MSC. After mag-

netic separation, the MSCs were seeded in complete medium

and expanded in separate cultures for further characterization.

Differentiation of Mesenchymal Stromal Cells

The differentiation capacity of both bmMSC and pMSC

was investigated after expansion of MSC using specific differen-

tiation media as described recently (15,16). Briefly, adipogenic

differentiation of MSC was induced by the addition of medium

supplemented with 10-lg/mL insulin, 100 lM indomethacine,

0.5 mM isobutyl xanthine, and 1 lM dexamethasone. Osteo-

genic differentiation was achieved with a differentiation medium

containing 0.1 lM dexamethasone, 10 mM b-glycerospho-

sphate, and 50 lM ascorbic acid. Chondrogenic differentiation

was performed in micromass pellet culture with medium

containing 50 mM ascorbic acid, 0.1 M L-proline, 1 mM dexa-

methasone, and 10 ng/mL TGF-b3. The cells were incubated in

differentiation media for four weeks. Differentiation was moni-

tored as described (15,16). Briefly, adipocytes were stained using

the Oil Red O method, mineralization by osteoblasts was

detected by Alizarin Red staining, and generation of proteogly-

cans by chondrocytes was documented by Alcian Blue dye.

Enumeration of Transcripts by Quantitative

Polymerase Chain Reaction

Quantitative RT-PCR was carried out to determine the

mRNA expression of CD14 and to monitor the expression of

lineage specific marker genes after adipogenic (PPARc2), osteo-genic (osteopontin, RunX2), and chondrogenic (type II col-

lagen, CD-RAP) differentiation of MSC. To this end, RNA was

extracted from the cells and purified by the RNeasy reagents

(Qiagen Hilden, Germany). Contaminating DNA was removed

by enzymatic degradation (RNeasy, Qiagen). cDNA was gener-

ated by reverse transcriptase and poly-(A) priming from 500 ng

of total RNA (Advantage RT for PCR kit, Clontech, Palo Alto,

CA). Aliquots representing 1 ng RNA equivalent were amplified

and analyzed by quantitative PCR (LightCycler1 1.5, Roche,

Mannheim, Germany). Amplification of the target DNA was

achieved after a so-called hot start (10 min 948C), followed by

34 reaction cycles (30 sec denaturation at 948C, 30 sec anneal-

ing with an initial annealing temperature of 678C and a drop of

0.58C per cycle to 558C annealing temperature, and 60 sec

extension at 728C), followed by melting point analysis.

To detect CD14 encoding mRNA by qRT-PCR, we gener-

ated novel PCR primers (forward: 50 GACTTATCGACCATGGAGCG; reverse: 50 CCAGTAGCTGAGCAGGAACC) bindingto the exon1 to exon2 splice site (pos. 343) and in exon2 (pos.

673) of transcript variant 1 (product 330 pb, NM_000591);

and to the exon2 to exon3 splice site (pos. 264) and in exon

3 (pos. 594) of transcript variant 2 (product 311 bp,

NM_001040021) to specifically amplify mature transcripts

only. Commercially available PCR primers (Search LC Heidel-

berg, FRG) were employed for all other genes as well as for the

controls (23). Amounts of target cDNA were normalized to

GAPDH and to serial dilutions of recombinant controls in

each PCR (5DDct method) (24). Product quality was moni-

tored by melting point analysis after each PCR, and purity and

size of PCR products were confirmed in selected samples by

electrophoresis as described elsewhere (25).

Immunoblot Analysis

To investigate protein expression, immunoblot analyses

were performed (26). 2 3 106 cells were lysed in 60 lL RIPA

buffer with PMSF (c-c-pro, Oberdorla, Germany). The yield

of protein in the extracts was determined by a colorimetric

method (DC protein Assay, BioRad, Hercules, CA) and spec-

trophotometry (k 5 650 nm, EL800, BioTec Instruments

Winooski, VT) following the instructions of the suppliers.

100-lg of each lysate was mixed with loading buffer contain-

ing b-mercaptoethanol for reducing conditions, heated to

ORIGINAL ARTICLE

Cytometry Part A � 79A: 635�645, 2011 637

958C for 10 min, quenched on ice, and loaded on a 10% SDS-

PAGE gel (26). After separation of the proteins by electrophor-

esis and blotting, the nitrocellulose membrane was blocked

with 5% milk powder/PBS/1% Tween-20 (blocking buffer).

For detection of CD14 or CD14 cross-reactive proteins, the

blots were incubated overnight at 48C with the anti-CD14

mAbs clones 134 620, M5E2, HCD14, or MFP9 (1:100 in 5%

milk powder/PBS). Unbound primary antibodies were

removed by rinsing the blots three times for 10 min on a shaker

with PBS/1 % Tween-20). HRP-labeled goat anti-mouse immu-

noglobulin (Ig) antibody (Jackson Immunoresearch, 1:1,000 in

blocking buffer) was added to detect binding of the anti-CD14

mABs. Unbound antibodies were removed by washing the

membranes as described earlier. Binding of antibodies was

visualized by enhanced chemiluminescence (ECL, GE Health-

care, Freiburg, FRG, 3–5 min exposure to Kodak X-ray film).

To document sufficient loading in all lanes, blot was stripped

(1% SDS, 0.5%, b-mercaptoethanol in TBS) and regenerated by

washing the membranes twice in 1% Tween-20/PBS, followed

by blocking, probing with anti b-actin mABs (clone 13E5, Cell

Signaling, 1:1,000 in 5% milk powder/PBS), and followed by

goat anti-rabbit Ig as described earlier.

Statistical Analysis

The mean values of replicate experiments, the corre-

sponding standard deviations, and the statistical significance

between groups of data were assessed with a two-sided paired

Student’s t-tests. Probability values (P) equal to or less than

0.05 (*), 0.01 (**), or 0.001 (***) were considered to be statis-

tically significant and marked in the figures accordingly.

RESULTS

Characterization of Early Passage MSC

MSCs isolated from human bone marrow or placenta tis-

sue were expanded in primary culture and displayed the typi-

cal fibroblast-like morphology (see Supporting Information,

Fig. S8). The expression of the cell surface antigens on MSC

was investigated by flow cytometry in more detail. The pMSC

Figure 1. Immunophenotype of term placenta-derived MSC. Analysis of expression of cell surface antigens on pMSC in the third passage.

Detection of positive markers CD73, CD90, and CD105, and analysis of expression of negative markers CD11b, CD34, and CD45. The pMSC

displayed a strong signal with CD14 mAB (clone: 134 620) and expressed CD146. The y-axes display the number of events (% of maxi-

mum), whereas the x-axes display signal intensities as indicated. Green histograms display the staining of cells with antibodies while redhistograms the controls. The lower right panel presents the SSC/FCS gating of the total MSC population.

ORIGINAL ARTICLE


expressed CD73, CD90, CD105, and CD146. Expression of

CD11b, CD34, and CD45 was not detected (Fig. 1). We were

able to reproduce this finding with bmMSC (Supporting In-

formation Fig. S8C). To our surprise, pMSC displayed a con-

siderable fluorescence intensity when stained with the CD14

mAb clone 134 620 (Fig. 1). In contrast, bmMSC failed to

bind CD14 mAB clone MFP9 (Supporting Information Fig.

S8C). These apparently conflicting results prompted us to first

investigate the differentiation potential of early passage MSC

toward the mesenchymal lineages. Upon activation with

appropriate stimuli, both bmMSC and pMSC generated chon-

drocytes, osteoblasts, and adipocytes (Fig. 2) and expressed

chondrogenic and adipogenic factors (Supporting Informa-

tion Fig. S9), confirming that both populations contained

MSC meeting the ISCT criteria (6).

Comparison of the Staining Patterns of CD14

Reactive Antibodies on MSC

Next, we tested four different CD14 mAb clones in

bmMSC (Figs. 3A–3D) and pMSC (Figs. 3E–3H). With CD14

mAb HCD14, the bulk of the bmMSC (60%) was stained with

moderate signal intensity (MFI\ 500) and a smaller CD14high

subset (�5%) with bright signal intensity (MFI[ 10,000, Fig.

3A). Similarly, clone M5E2 revealed a CD14-positive (MFI[

500, 40%) and a CD14high subpopulation (MFI [ 2,500,

�5%, Fig. 3B). The CD14 mAb 134 620 displayed only a single

CD14pos bmMSC population (MFI � 300, 30%, Fig. 3C). In

contrast, the fourth CD14 mAb (clone MFP9) did not react

with bmMSC (MFI: ø, � 1.12%, Fig. 3D). Furthermore, with

CD14 mAb HCD14, half of the pMSC was stained with mod-

erate fluorescence intensity (MFI � 900) and a small CD14high

subset (9 %) with bright signal intensity (MFI: 15,000, Fig.

3E). The clone M5E2 revealed 30% CD14pos (MFI � 650) and

Figure 2. Differentiation of MSC. The differentiation of bmMSC

(A—C) and pMSC (D—F) was induced in second passage cells.

Success of in vitro differentiation was investigated after four

weeks of induction by cytochemical staining. (A, D): Chondro-

genic differentiation of MSC in micromass pellet culture visua-

lized by Alcian Blue staining. (B, E): Osteogenically differentiated

cells were stained with Alizarin Red. (C, F): Detection of adipogen-

esis specific lipid vesicles stained with Oil Red O. Bars indicate

200 lm.

Figure 3. Investigation of reactivity of CD14 mABs on bmMSC

and pMSC. Second passage bmMSC (A—D) or pMSC (E—H) was

stained with four CD14 mAb to compare the binding of these anti-

bodies. Monoclonal antibodies clone HCD14 (A, E), and M5E2 (B,

F) stained the bulk of the MSC with a moderate signal and a sub-

set with bright signal intensity, clone 134 620 stained the MSC

with a moderate signal only (C, G), whereas mAB MFP9 did notbind to MSC (D, H). The x-axes display signal intensities whereasthe y-axes the number of events (% of maximum) as indicated.

Green histograms display the staining of cells with antibodies

while red histograms the controls.

ORIGINAL ARTICLE


Figure 4.

ORIGINAL ARTICLE


a small CD14high subpopulation (MFI: 3,500, �7%, Fig. 3F).

The CD14 mAb 134 620 showed only a CD14pos pMSC popu-

lation (MFI: 455, 26%, Fig. 3G). Again, the fourth CD14 mAb

(clone MFP9) did not react with pMSC (MFI: ø, �1.14 %,

Fig. 3H). Moreover, binding of CD14 mAB clones HCD14,

M5E2, and 134 620 was observed on MSC up to the sixth pas-

sage of in vitro culture, whereas mAb MFP9 did not stain

MSC, while all these cells were positive for CD73 and CD90

(Supporting Information Fig. S10).

To confirm the specificity of the CD14 reagents

employed, PBMC was stained with these CD14 mAB and CD3

mAb (Supporting Information Fig. S11). As expected, two dis-

tinct populations, i.e., the CD14posCD3neg monocytic cells and

the CD3posCD14neg T-lymphocytes were detected by all four

antibodies in PBMCs. There was no significant difference in

brightness or percentage of CD14 staining on PBMC between

the four CD14 mAB used in this experiment (Supporting In-

formation Figs. S11A–S11D). Furthermore, to determine

whether the CD14 staining was sensitive to enzymatic detach-

ment of cells prior to flow cytometry, macrophages were

enriched from PBMC preparations by attachment to plastic,

then detached by Accutase, and stained with the four CD14

mABs (Supporting Information Figs. S11E–S11H). All four

CD14 reagents displayed high-intensity staining.

Expression of CD14 in Putative MSC Subsets

To investigate if the CD14 antibodies employed in our stu-

dies were binding to monocytes within the MSC population,

the CD14pos cells were counterstained with CD90 mAb (Fig.

4A). The CD90pos or CD105pos MSC displayed CD14 fluores-

cence with the three CD14 cross-reactive mAbs HCD14, M5E2,

or 134 620, respectively. The relatively small CD90pos live MSC

exhibited a bright CD14 signal with mAb clone HCD14,

whereas the larger CD90pos live subset yielded a moderate

CD14 signal (Fig. 4A, top right panel). The other CD14-reactive

mAbs clone M5E2 and clone 134 620 failed to show a difference

in CD14 signal brightness between the larger and smaller cells

within the CD90pos and CD105pos populations (blue versus

green histograms in Fig. 4A). As demonstrated earlier (Figs. 3C

and 3G), the intensity of fluorescence generated by CD14 mAb

134 620 on CD105pos MSC was less than that observed with ei-

ther of the other two CD14 mABs, clone HCD14 and M5E2,

and clone MFP9 completely failed to stain the MSC (Fig. 4A).

To confirm that the MSC preparations did not contain

monocytes or macrophages, we tested for CD14 mRNA

expression in these cells in vitro. Transcripts encoding one of

the two known splice variants of CD14 were not detected by

qRT-PCR in pMSC or bmMSC in our in vitro cultures (Fig.

4B). The cDNAs generated from peripheral blood monocytes,

the hematopoietic progenitor cell line KG1a, and normal

diploid fibroblasts served as controls (Fig. 4B). In addition, we

searched for TNF-a, a cytokine typically expressed by mono-

cytes and macrophages (Fig. 4C). In MonoMac 6, the normal-

ized TNF-a transcript index (3.6 3 1024) was 80 times higher

than in MSC (mean 4.73 1026, �3.5 3 1026, P\ 0.001).

To further rule out the possibility that dead cells, debris, or

other particle generating artifacts were associated with the

observed CD14 staining, the CD14pos subset was gated and

plotted for forward (FSC) and side scatter (SSC). Dead cells

were excluded by EMA counterstaining. We confirmed that

CD14pos cells are localized in the live MSC population (Fig.

5A). Within the MSC population, the CD14mid MSC subset was

located to the lower right of the SSC-FSC plot, indicating a

greater size but a lower internal complexity, whereas the

CD14high subset was located on the upper left of the SSC-FSC

plot, indicating a smaller size but a higher internal complexity

of the cells (Fig. 5A). To determine whether MSC in the

CD14high subset of smaller cells represented apoptotic cells,

MSCs were stained with mAB to CD105, CD14 mAb clone 134

620 and counterstained with Annexin-V and 7-AAD to detect

apoptotic or dead cells in the CD105pos and CD14 cross-reactive

MSCs. Neither the CD14low CD105pos nor the CD14pos

CD105pos displayed signs of apoptosis or necrosis (Fig. 5B).

Expansion and Differentiation of CD14

Cross-Reactive MSCs

To acquire information on proliferation and differentia-

tion capacities of CD14 cross-reactive MSC, the cells were

separated by cell sorting using the mABs M5E2 or 134 620 and

expanded in individual cultures. Both the CD14pos and the

CD14low population generated cells typical for the osteoblastic

or adipocytic lineages (Fig. 6). This confirmed that the frac-

Figure 4. Search for monocytic cells in the MSC preparation by flow cytometry and quantitative RT-PCR. (A) MSC were double-stained

with CD90 or CD105 and the CD14 antibodies of clones HCD14 (top right), M5E2 (middle left), MFP9 (middle right), and 134620 (bottom) asindicated. Smaller CD901 or CD1051 MSCs were depicted separately (cells in the upper left quadrants in SSC/FCS, displayed in green)

from the larger cells (cells in the upper right quadrant in SSC/FSC, displayed in blue). Both sets of CD901MSC, the larger (blue histograms)

as well as the smaller (green histograms), were investigated for binding of three of the four CD14 antibodies. Only mAB HCD14 resolved a

CD14high (green histogram, top right) and a CD14mid (blue histogram, top right) set of CD901 MSC, whereas mAB M5E2 yielded no differ-

ences in CD14 straining within the small (green histograms) or larger (blue histograms) CD901MSC (middle/bottom panels). Comparably,

sets of CD1051MSC, the larger (blue histogram) as well as the smaller (green histogram), stained with mAb clone 134 620 but with moder-

ate intensity (bottom panels). Binding of mAB MFP9 was not detected on either larger or smaller CD901MSC. The red histograms displaythe controls. (B) Complementary DNA was generated from mRNA of monocytes (n 5 1), KG1a (n 5 1), diploid fibroblasts (n 5 1), pMSC

(passages 2, 4; n � 4 each), and bmMSC (passages 2, 4; n � 4 each), and the expression of CD14 quantified by qRT-PCR. The graph displaysthe mean � standard deviation of normalized CD14 transcript levels in the cells as indicated. In monocytes, a robust expression of CD14

transcripts was measured, whereas in pMSC very little CD14 mRNA was detected. The KG1a and fibroblasts served as controls and no

expression of CD14 mRNA was observed. (C) Complementary DNA was generated from mRNA from monocytes (MonoMac 6, MM6, n 52) and from MSC (n 5 6). Transcripts encoding TNF-a were quantified by qRT-PCR. The graph displays the mean � standard deviation of

normalized TNF-a transcript levels in the cells as indicated. In MonoMac 6, TNF-a transcripts were detected. In the MSC, a very low expres-sion of TNF-amRNA was observed (P\0.001).

ORIGINAL ARTICLE


tion enriched by two different CD14 cross-reactive antibodies

contained live, proliferation- and differentiation-competent

MSC as defined recently by a consensus conference (6).

Detection of CD14 Protein by Immunoblot

To further explore the binding characteristics of the

mABs 134 620, M5E2, and HCD14 in comparison to mAB

MFP9, immunoblot experiments were performed. PBMC and

MonoMac 6 cells served as controls (Fig. 7). In protein

extracts from PBMC, mAB 134 620 detected a protein just

above 50 kDa. In extracts from MM6, a 53 kDa and 48 kDa

protein were detected, respectively (Fig. 7). This corresponds

to the expected molecular weight (MW) of 53 to 55 kDa

reported for the endotoxin receptor CD14 and a MW of 48

Figure 5. Investigation of the CD141, CD901, and CD1051 MSC for apoptosis and cell death. (A) MSCs were incubated with CD14 mAb

(clone HCD14), counterstained with EMA gated (FSC-SSC, left plot), and the EMAneg live MSC were investigated for CD14 staining (histo-

gram, middle). Two CD901 populations, CD14mid (blue) and CD14high (red), were detected by clone HCD14 and back-localized in the FSC-

SSC dot plot to corroborate differences in size and granularity of the respective subsets (right plot). The CD14high cells (red dots) localize

on the upper-left side of the gated MSC population, the larger CD14mid on the lower-right side in the dot plot. This localization suggested

that the CD14 signal observed was not due to cellular debris. (B) Staining of CD105posCD14pos cells with Annexin-V and 7-AAD to detect

MSC in early stages of apoptosis (lower right quadrant), late stages of apoptosis (upper right quadrant), or dead cells (upper left quadrant)

as marked in the figure. The dot plot displays the double-staining of MSC for CD105 and CD14 as indicated (top panel). The CD1051CD142

fraction (grey, top panel) and the CD1051CD141 (orange, top panel) fractions were individually investigated for early stages of apoptosis

(bottom panels). All CD1051CD142 cells (bottom left panel) and CD1051CD141 cells (bottom right panel) appear in the lower left quadrant

of the dot plot (i.e., 7-AADneg/Annexing-Vneg), confirming that they are live cells.


ORIGINAL ARTICLE

kDa for its soluble form (27,28). In extracts of bmMSC (n5 3),

a very faint band was observed in this range; in pMSC (n 5 3)

no protein was detected. In contrast to mAB 134 620, mAbs

MFP9, M5E2, and HCD14 did not bind to extracts of PBMC

and MM6 or MSC on immunoblots (not shown). Reprobing the

blots with anti-b-actin served as control (Fig. 7). Taken together,

our data suggest that bmMSC or pMSC do not express CD14.

DISCUSSION

Recent research has indicated that the

CD731CD901CD1051 and differentiation-competent adher-

ent MSC contain several subgroups of cells that may differ

among themselves with respect to their physiological func-

tions. For instance, bmMSC express MSC markers concomi-

tantly with high-CD63 expression. They contain transcripts of

early osteoblasts and can organize a hematopoietic microen-

vironment (29). In contrast, periosteal cells share the expres-

sion of the earlier mentioned surface markers but fail to

express CD63 and do not generate a hematopoietic microen-

vironment (29). In other studies, a significantly higher poten-

tial for chondrogenic differentiation was found in the

CD2711CD561 population of bmMSC, and this fraction at

the same time failed to differentiate toward adipocytes in vitro

(30). Several subsets of MSC have been defined according to

their expression of CD56, CD271, W8B2, W8C3, and W12D1

antigens but not yet functionally investigated in great detail

(4,31). In addition to the differences in expression of antigens

on MSC of different origins (1,31–38), temporal changes in

the expression patterns of cell surface antigens have been

found on MSC (10). The loss of CD14 expressing cells in adi-

pose tissue-derived stromal cells ex vivo (10% CD141) com-

pared with primary cultures (2.3% CD141) or passaged adi-

pose-derived MSC (�1% CD141) can be explained by in vitro

culture conditions (39). Culture media also influence the

expression of cell surface antigens on MSC (19).

Our findings on the staining patterns observed with

some but not all of the CD14-specific mAbs are more com-

plex. Monocytes (CD902, CD11b1, and CD141) were not

detected in our MSC preparations. This is consistent with

the fact that the CD14 mAb clone MFP9 failed to bind the

MSC, but it stained MonoMac 6, and MFP9 recognized the

monocytic population in PBMC. Our data indicate that

MFP9 was the most specific among the CD14 antibodies

employed here as it reacted with monocytes only. In contrast,

Figure 6. Differentiation of CD14pos and CD14low MSC after MACS

sorting. MSCs were separated by CD14 mABs clone M5E2 (A—D)

or 134 620 (E—H). After further expansion, osteogenic (A, B, E, F)

and adipogenic (C, D, G, H) differentiation was induced in the

CD14pos (left) and CD14low fractions (right), respectively. Dark pre-

cipitates (von Kossa staining, A,B,E,F) and red vesicles (Oil Red

O staining, C, D, G, H) confirm osteogenic and adipogenic

differentiation.

Figure 7. Detection of CD14 protein in monocytic cells. (A)

Extracts of PBMC, MonoMac 6, and MSC were generated to inves-

tigate the expression of CD14 by immunoblot using mAB 134 620

as primary antibody. Extracts from PBMC (lane1), MM6 (lane 2),

bmMSC (lanes 3—5), and pMSC (lanes 6—8) were separated by

electrophoresis, blotted, incubated with mAB 134 620, followed

by peroxidase-labeled detection antibody, and ECL substrate to

visualize antibody binding. A signal at about 50 kDa indicated

expression of CD14 in PBMC and MM6 (lanes 1,2). In extracts of

bmMSC, a very weak signal was detected in this range. (B) After

developing the anti-CD14 immunoblot, the membrane was

stripped of proteins, reacted with anti-b-actin mAB clone 13E5

(ba) to document sufficient loading of protein in each lane. Inlanes 1 and 2, the residual signals from the previous incubation

with anti-CD14 reagents at 50, 53, and 48 kDa remained partially

visible.

ORIGINAL ARTICLE


by flow cytometry, the CD14 mAb clone 134 620 produced a

moderate staining of bmMSC and pMSC in addition to

staining monocytes. Therefore, we conclude that this anti-

body specifically binds to its orthodox CD14 epitope on

monocytes but in addition cross-reacts with an epitope that

is expressed on MSC.

Interestingly, CD14 mAbs HCD14 and M5E2 displayed

different binding patterns compared with clone 134 620. They

both stained the bulk of bmMSC and pMSC with moderate

intensity but in addition stained a small fraction of MSCs with

high intensity. Note that only CD14 mAB clone HCD14

stained the smaller CD901 MSC with a distinctly higher inten-

sity than the larger size CD901 MSC, whereas the CD14 clones

M5E2 and 134 620 did not resolve subsets within the CD901

MSC population. By EMA dye exclusion and a detailed search

for apoptotic or dead cells employing Annexin-V and 7-AAD

staining, we confirmed that the CD901CD141 and the

CD1051CD141 MSC are live cells. Therefore, the CD14 stain-

ing, including the signals observed on the subset of smaller

cells, appears not to be an artifact caused by apoptotic or dead

MSC. We hypothesized that the smaller CD901HCD141

MSCs represent more immature small rapid cycling (RS-)

cells, whereas the larger CD901HCD142 MSCs are more

mature mMSCs (40). However, we were not able to enrich the

CD901CD141 MSC by extended culture in FFPP medium

and therefore did not obtain experimental evidence to support

this hypothesis.

The CD14 cross-reactive MSC and the CD14low MSC

were enriched by MACS technology and further expanded in

separate cultures. Because of the fact that the bulk of MSC did

not display a bright CD14 signal, we did not expect to separate

the MSC into two distinct subsets. However, both the

CD14high and the CD14low MSC adhered to cell culture flasks

with a fibroblast-like appearance and yielded cells with osteo-

genic and adipogenic differentiation capacities. However,

within the CD14-enriched population, a higher proportion of

CD90dim MSCs were observed. In contrast, in the CD14low,

the majority of MSCs were CD90high (not shown). This sup-

ports the hypothesis that the CD14 cross-reactive MSC may

contain a higher proportion of immature cells. However,

resolving this apparent discrepancy is beyond the focus of this

study.

Differences in reactivity of the anti-CD14 reagents

employed here might also result from differences in generation

of the funding B-cell clone. Clone MFP9 was generated by im-

munization of BALB/c mice with human monocytes (41),

whereas clone 134 620 by immunization of mice with a CHO

cell-derived human recombinant CD14 molecule. This may

explain the good reactivity of clone 134 620 with extracts of

PBMC or MM6 on immunoblots. Immunization of mice with

the full-size protein yielded clones M5E2 and HCD14, respec-

tively. However, they failed to stain CD14 on immunoblots.

Because of the different immunization strategies applied

for generation of the anti-CD14 antibodies investigated, it is

possible that they bind to different epitopes of the CD14 mol-

ecule. However, at present, we formally cannot rule out that

mABs 134 620, HCD14, and M5E2 bind to the same or a

homologous protein on MSC. Unforeseeable binding to cross-

reactive epitopes has been observed with other mABs on cell

surfaces (30,42). Although all four mAbs bound with high

specificity to CD14 on monocytes, it is likely that the CD14

cross-reactive epitope is present on the MSC surface beyond

the context of this LPS receptor. The latter notion is supported

by the fact that mRNA encoding CD14 was detected in mono-

cytes but remained very low (103- to 104-fold less signal) in

bmMSC or pMSC in the second or fourth passage of in vitro

culture. The low levels of CD14 detected by a very sensitive

qRT-PCR in passaged pMSC seem insufficient for translation

of CD14 to generate a bright signal in flow cytometry as

detected by mAbs HCD14 or M5E2, for example. Transcripts

encoding TNF-a, a characteristic product of monocytes, were

detected in MSC in minute amounts, even after activation of

these cells. As chondrocytes can express TNF-a (43), the low

levels of TNF-a mRNA detected in our cells may result from a

spontaneous chondrogenic differentiation of some MSCs in

vitro. Therefore, our molecular and functional data make

monocytic cells in our MSC preparation a very unlikely source

of CD14 positive contamination.

Lack of orthodox CD14 on MSC was confirmed by

immunoblot. The mAB 134 620 reacted with extracts of

monocytes but not with MSC. The signals at about 50, 53, and

48 kDa indicated bona fide expression of CD14 in PBMC and

MM6 cells. In contrast, mABs MFP9, M5E2, and HCD14

failed to detect CD14 in extracts of PBMS and MM6, and they

did not react with proteins from any MSC investigated. This

confirms our hypothesis that the CD14 reagents employed in

this study differ in their target reactivity or specificity.

Expression of hematopoietic antigens has been observed

on CD901 adipose tissue-derived vascular stromal cells

(10,39), a population of cells closely related to the bmMSC

and pMSC investigated here. A mixed phenotype could

explain the reports of blood-derived monocytes as progenitors

for mesenchymal differentiation, called MOMP (44). These

MOMP, however, differ from bmMSC and pMSC because they

expressed CD14, CD34, and CD45, whereas the MSCs investi-

gated here lack expression of these antigens. A subset of

MOMP has been observed to generate cardiomyocytes in

vitro, confirming their mesenchymal differentiation capacity

(45). In addition, the CD141 MOMP displayed a neurogenic

potential (46). The CD1051 chondrogenic human blood

acquired mesenchymal progenitor cells (BMPC) expressed

CD14 as well (47). The cross-reactive epitope on MSC

described here could be related to the CD14 antigen detected

on BMPC. Taken together, the published work does not

exclude the possibility that cells other than monocytes or mac-

rophages may express CD14 or may display a CD14 cross-

reactive epitope. Among them progenitor cells such as MOMP

or BMPC have been reported (46,47).

In summary, we demonstrate that the CD14-specific

mAb MFP9 is not cross-reactive with human bmMSC and

pMSC and is therefore specific for monocytic cells, whereas

the other CD14 specific mAbs stain these MSCs to some

extent. The differences observed in the fluorescence signal

intensities, referred to as ‘‘CD14high’’ and ‘‘CD14mid’’ cells in

ORIGINAL ARTICLE


this study, do not seem to be associated with functional differ-

ences, since we found no differences in cellular appearance,

growth, or differentiation capacities in these populations.

We conclude that human bmMSC and pMSC do not

express CD14, but they express an epitope that is cross-reac-

tive with some CD14 antibodies. As a result, the CD14 mAB

MFP9 is best suited for the detection of monocytic cells con-

taminating MSC preparations.

ACKNOWLEDGMENTS

The authors thank R. Schafer, M.D., for providing me-

dium components, K. Weise, M.D., for bone marrow aspirates,

Tanja Abruzzese and Stephanie Zug for their excellent techni-

cal assistance, and Christopher Shipp, B.Sc., for his expert

help in the preparation of this manuscript.

LITERATURE CITED

1. Jones E, McGonagle D. Human bone marrow mesenchymal stem cells in vivo. Rheu-matology 2008;47:126–131.

2. Phinney DG, Prockop DJ. Concise review: Mesenchymal stem/multipotent stromalcells: The state of transdifferentiation and modes of tissue repair–Current views.Stem Cells 2007;25:2896–2902.

3. Hristov M, Erl W, Weber PC. Endothelial progenitor cells: Mobilization, differentia-tion, and homing. Arterioscler Thromb Vasc Biol 2003;23:1185–1189.

4. Vogel W, Grunebach F, Messam CA, Kanz L, Brugger W, Buhring HJ. Heterogeneityamong human bone marrow-derived mesenchymal stem cells and neural progenitorcells. Haematologica 2003;88:126–133.

5. Pozzobon M, Piccoli M, Ditadi A, Bollini S, Destro R, Andre-Schmutz I, Masiero L,Lenzini E, Zanesco L, Petrelli L, Cavazzana-Calvo M, Gazzola MV, De Coppi P.Mesenchymal stromal cells can be derived from bone marrow CD1331 cells: Implica-tions for therapy. Stem Cells Dev 2009;18:497–510.

6. Dominici M, Le Blanc K, Muller I, Slaper-Cortenbach I, Marini FC, Krause DS,Deans RJ, Keating A, Prockop DJ, Horwitz EM. Minimal criteria for defining multi-potent mesenchymal stromal cells. The International Society for Cellular Therapyposition statement. Cytotherapy 2006;8:315–317.

7. Horwitz EM, Le Blanc K, Dominici M, Muller I, Slaper-Cortenbach I, Marini FC,Deans RJ, Krause DS, Keating A. Clarification of the nomenclature for MSC: TheInternational Society for Cellular Therapy position statement. Cytotherapy2005;7:393–395.

8. Parolini O, Alviano F, Bagnara GP, Bilic G, Buhring HJ, Evangelista M, HennerbichlerS, Liu B, Magatti M, Mao N, et al. Concise review: Isolation and characterization ofcells from human term placenta: Outcome of the First International Workshop onPlacenta Derived Stem Cells. Stem Cells 2008;26:300–311.

9. Guha M, Mackman N. LPS induction of gene expression in human monocytes. CellSignal 2001;13:85–94.

10. Mitchell JB, McIntosh K, Zvonic S, Garrett S, Floyd ZE, Kloster A, Di Halvorsen Y,Storms RW, Goh B, Kilroy G, et al. Immunophenotype of human adipose-derivedcells: Temporal changes in stromal-associated and stem cell-associated markers. StemCells 2006;24:376–385.

11. Braun J, Hack A, Weis-Klemm M, Conrad S, Treml S, Kohler K, Walliser U, SkutellaT, Aicher WK. Evaluation of the osteogenic and chondrogenic differentiation capaci-ties of equine adipose tissue-derived mesenchymal stem cells. Am J Vet Res2010;71:1228–1236.

12. Jersmann HPA, Hii CST, Hodge GL, Ferrante A. Synthesis and surface expression ofCD14 by human endothelial cells. Infect Immun 2001;69:479–485.

13. Opitz CA, Litzenburger UM, Lutz C, Lanz T, Tritschler I, Koppel A, Tolosa E, HobergM, Anderl A, Aicher WK, Weller M, Wick W, Platten M. Toll-like receptors enhancethe immunosuppreddive properties of human MSC by inducing indoleamine-2,3-dioxygenase-1 via interferin-b and proteinkinase-R. Stem Cells 2009;27:909–919.

14. Perera PY, Mayadas TN, Takeuchi O, Akira S, Zaks-Zilberman M, Goyert SM, VogelSN. CD11b/CD18 acts in concert with CD14 and Toll-like receptor (TLR) 4 to elicitfull lipopolysaccharide and taxol-inducible gene expression. J Immunology2001;166:574–581.

15. Felka T, Schafer R, deZwart P, Aicher WK. Animal serum-free differentiation ofhuman mesenchymal stem cells. Cytotherapy 2010;12:143–153.

16. Felka T, Schafer R, Schewe B, Benz K, Aicher WK. Hypoxia reduces the inhibitpryeffect of IL-1beta on chondrogenic differentiation of FCS-free expanded MSC.Osteoarthritis Cartilage 2009;17:1368–1376.

17. Muller I, Kordowich S, Holzwarth C, Spano C, Isensee G, Staiber A, Viebahn S, Gie-seke F, Langer H, Gawaz MP, Horwitz EM, Conte P, Handgretinger R, Dominici M.Animal serum-free culture conditions for isolation and expansion of multipotentmesenchymal stromal cells from human BM. Cytotherapy 2006;8:437–444.

18. Perfetto SP, Chattopadhyay PK, Lamoreaux L, Nguyen R, Ambrozak D, Koup RA,Roederer M. Amine reactive dyes: An effective tool to discriminate live and dead cellsin polychromatic flow cytometry. J Immunol Methods 2006;313:199–208.

19. Apel A, Groth A, Schlesinger S, Bruns H, Schemmer P, Buchler MW, Herr I. Suitabil-ity of human mesenchymal stem cells for gene therapy depends on the expansion me-

dium. Exp Cell Res 2009;315:498–507.

20. Vermes I, Haanen C, Steffens-Nakken H, Reutelingsperger C. A novel assay for apo-ptosis. Flow cytometric detection of phosphatidylserine expression on early apoptoticcells using fluorescein labelled Annexin V. J Immunol Methods 1995;184:39–51.

21. Schmid I, Krall WJ, Uittenbogaart CH, Braun J, Giorgi JV. Dead cell discriminationwith 7-amino-actinomycin D in combination with dual color immunofluorescencein single laser flow cytometry. Cytometry 1992;13:204–208.

22. Herzenberg LA, Tung J, Moore WA, Herzenberg LA, Parks DR. Interpreting flowcytometry data: A guide for the perplexed. Nat Immunol 2006;7:681–685.

23. Hoberg M, Rudert M, Pap T, Klein G, Gay S, Aicher WK. Attachment to laminin-111facilitates transforming growth factor beta-induced expression of matrix metallopro-teinase-3 in synovial fibroblasts. Ann Rheum Dis 2007;66:446–451.

24. Rasmussen R, Morrison T, Herrmann M, Wittwer C. Quantitative PCR by continu-ous fluorescence monitoring of a double strand DNA specific binding dye. Biochem-ica 1998;2:8–11.

25. Alexander D, Judex M, Meyringer R, Weis-Klemm M, Gay S, Muller-Ladner U,Aicher WK. Transcription factor Egr-1 activates collagen expression in immortalizedfibroblasts or fibrosarcoma cells. Biol Chem 2002;383:1845–1853.

26. Ausubel F, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, edi-tors. Short Protocols in Molecular Biology, 2nd ed. New York: Wiley; 1992.

27. Goyert SM. Protein reviews on the Web. Available at: http://prow.nci.nih.gov/guide/2131935697_g.htm. 1999.

28. Bazil V, Baudys M, Hilgert I, Stefanov I, Low MG, Zbrozek J, HorejsI VC. Structuralrelationship between the soluble and membrane-bound forms of human monocytesurface glycoprotein CD 14. Mol Immunol 1989;26:657–662.

29. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S, Saggio I, Tagliafico E,Ferrari S, Robey PG, Riminucci M, Bianco P. Self-renewing osteoprogenitors in bonemarrow sinusoids can organize a hematopoietic microenvironment. Cell2007;131:324–336.

30. Battula VL, Treml S, Bareiss PM, Gieseke F, Roelofs H, de Zwart P, Muller I, ScheweB, Skutella T, Fibbe WE, Kanz L, Buhring HJ. Isolation of functionally distinctmesenchymal stem cell subsets using antibodies against CD56, CD271 and mesenchy-mal stem cell antigen-1 (MSCA-1). Haematologica 2009;94:19–30.

31. Buhring HJ, Battula VL, Treml S, Schewe B, Kanz L, Vogel W. Novel markers for theprospective isolation of human MSC. Ann N YAcad Sci 2007;1106:262–271.

32. De Bari C, Dell’Accio F, Tylzanowski P, Luyten FP. Multipotent mesenchymal stemcells from adult synovial membrane. Arthritis Rheum 2001;44:1928–1942.

33. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz AJ, Benhaim P, Lorenz HP,Hedrick MH. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng 2001;7:211–228.

34. Jones EA, Crawford A, English A, Henshaw K, Mundy J, Corscadden D, Chapman T,Emery P, Hatton P, McGonagle D. Synovial fluid mesenchymal stem cells in healthand early osteoarthritis: Detection and functional evaluation at the single-cell level.Arthritis Rheum 2008;58:1731–1740.

35. Tarnok A, Ulrich H, Bocsi J. Phenotypes of stem cells from diverse origin. CytometryPart A 2010;77A:6–10.

36. Zimmerlin L, Donnenberg VS, Pfeifer ME, Meyer ME, Peault B, Rubin PJ, Donnen-berg AD. Stromal vascular progenitors in adult human adipose tissue. CytometryPart A 2010;77A:22–30.

37. Porretti LAC, Colombo F, Lopa R, Rossi G, Mazzaferro V, Battiston C, Svegliati-Bar-oni GFB, Rebulla P, Prati D. Simultaneous characterization of progenitor cell com-partments in adult human liver. Cytometry Part A 2010;77A:31–40.

38. Pilz GA, Abele H, Braun J, Felka T, Warstat K, Buhring HJ, Schafer R, Aicher WK.Human term placenta-derived mesenchymal stromal cells (MSC) are less prone toosteogenic differentiation when compared to bone marrow-derived MSC. Stem CellsDev 2011; 20: 635-646.

39. McIntosh K, Zvonic S, Garrett S, Mitchell JB, Floyd ZE, Hammill L, Kloster A, DiHalvorsen Y, Ting JP, Storms RW, Goh B, Kilroy G, Wu X, Gimble JM. The immuno-genicity of human adipose-derived cells: Temporal changes in vitro. Stem Cells2006;24:1246–1253.

40. Colter DC, Class R, DiGirolamo CM, Prockop DJ. Rapid expansion of recycling stemcells in cultures of plastic-adherent cells from human bone marrow. Proc Natl AcadSci U S A 2000;97:3213–3218.

41. Herrmann F, Komischke B, Odenwald E, Ludwig WD. Use of monoclonal antibodiesas diagnostic tool in human acute leukmia. Blut 1983;47:157–163.

42. Barry F, Boynton R, Murphy M, Zaia J. The SH-3 and SH-4 antibodies recognize dis-tinct epitopes on CD73 from human mesenchymal stem cells. Biochem Biophys ResCommun 2001;289:519–524.

43. Moos V, Fickert S, Muller B, Weber U, Sieper J. Immunohistological analysis of cyto-kine expression in human osteoarthritic and healthy cartilage. J Rheumatol1999;26:870–879.

44. Kuwana M, Okazaki Y, Kodama H, Izumi K, Yasuoka H, Ogawa Y, Kawakami Y, IkedaY. Human circulating CD141 monocytes as a source of progenitors that exhibitmesenchymal cell differentiation. J Leukoc Biol 2003;74:833–845.

45. Kodama H, Inoue T, Watanabe R, Yasuoka H, Kawakami Y, Ogawa S, Ikeda Y,Mikoshiba K, Kuwana M. Cardiomyogenic potential of mesenchymal progenitorsderived from human circulating CD141 monocytes. Stem Cells Dev 2005;14:676–686.

46. Kodama H, Inoue T, Watanabe R, Yasutomi D, Kawakami Y, Ogawa S, Mikoshiba K,Ikeda Y, Kuwana M. Neurogenic potential of progenitors derived from human circu-lating CD141monocytes. Immunol Cell Biol 2006;84:209–217.

47. Raghunath J, Sutherland J, Salih V, Mordan N, Butler PE, Seifalian AM. Chondro-genic potential of blood-acquired mesenchymal progenitor cells. J Plast ReconstrAesthet Surg 2010;63:841–847.

ORIGINAL ARTICLE


Documents

Human mesenchymal stromal cells express CD14 cross-reactive epitopes