HYALURONIDASE GENE PROFILING AND ROLE OF HYAL-1OVEREXPRESSION IN AN ORTHOTOPIC MODEL OF PROSTATE CANCERSonal PATEL

1, Paul R. TURNER1, Colin STUBBERFIELD

1, Eleanor BARRY1, Christian R. ROHLFF

1, Alasdair STAMPS1, Kerry TYSON

1,Jon TERRETT

1, Gary BOX2, Suzanne ECCLES

2 and Martin J. PAGE1*

1Oxford GlycoSciences, Abingdon Science Park, Abingdon, Oxfordshire, United Kingdom2Tumour Biology and Metastasis, McElwain Laboratories, Cancer Research Campaign Centre for Cancer Therapeutics, Institute ofCancer Research, Belmont, Sutton, United Kingdom

The mRNA levels of hyal-1, hyal-2, LUCA3 and PH20, the4 hyaluronidases with demonstrated endoglucosaminidaseactivity, were extensively profiled in normal and tumor tis-sues and cell lines, using dot blot analysis and quantitativePCR. In normal tissues, hyal-1, hyal-2 and LUCA3 all showedunique patterns of mRNA expression, but were generally ofwidespread distribution, whereas PH20 mRNA was re-stricted to testes. In a small set of breast tumor samples, noelevations in hyal-1, hyal-2 or LUCA3 mRNA were seen.Hyaluronidase activity measured by a novel assay or zymog-raphy was also not elevated in sera from a number of breastcancer patients, compared to sera from normal volunteers.In ex vivo xenograft tumor cell lines, however, hyal-1 orhyal-2 mRNA levels were frequently elevated, whereasLUCA3 was only infrequently elevated and PH20 not at all.Two cell lines were engineered to overexpress hyal-1: abreast cancer line (CAL51) and a prostate cancer line(PC3M). Although the in vitro properties of the hyal-1 over-expressing cell lines were indistinguishable from the parentalcells, the orthotopic growth of hyal-1 expressing PC3M cellsin nu/nu mice resulted in significantly increased numbers ofmetastases, supportive of a role for hyal-1 in extravasationand metastatic tumor formation in this model of prostatecancer.© 2002 Wiley-Liss, Inc.

Key words: hyaluronidase; hyaluronan/HA; cancer; prostate; breast

The hyaluronidases are a family of degradative endoglu-cosaminidase enzymes1 whose substrate, hyaluronic acid (HA), isa major constituent of the extracellular matrix (ECM).2 Cellularinteractions with the underlying ECM are crucial in development,3for the maintenance of normal cellular functions and in response toinjury and infection. In situations where malignant cell growth andsubsequent metastasis occur, the degradation of the ECM is re-quired. HA, a large polysaccharide of approximately ten thousanddisaccharide repeats, is known to inhibit cell differentiation, pro-mote proliferation, regulate cell motility and HA synthesis occursbefore mitosis.1 Increased serum or tissue associated levels of HAhave been correlated with tumor progression2 and metastatic be-havior.4 In some types of cancer such as bladder, breast andcolorectal, the serum levels of HA have been found to be ofprognostic value,5–8 although conflicting results have been ob-tained from patients with breast cancer.9

The hyaluronidases that degrade HA have also been implicatedin tumor progression and metastasis, as well as angiogenesis.10

Hyaluronidase-1 (hyal-1) was originally isolated from humanplasma, has a pH optimum of 3.8 and cleaves HA to small (�20kDa) MW fragments.11 Hyaluronidase-2 (hyal-2) is also an acid-active enzyme that digests HA polymers down to 20 kDa sizes.12

Hyal-2 has been shown to be located in lysosomes12 but is alsoreported to be a GPI-anchored cell surface protein.13 PH20 wasidentified as a GPI linked sperm acrosomal enzyme with a neutralpH optimum and cleaves HA to smaller (�20 kDa) MW frag-ments.1 More recently, the hyaluronidase LUCA3 (Barry et al., inpreparation) and meningioma expressed antigen 5 (MGEA5, chro-mosome 10) have also been shown to have activity at neutral pH.14

Hyal-4 and the pseudogene Hyal-P1, both of which co-localize tochromosome 7q31.3 with PH20,15 have not yet been demonstratedto possess enzymatic activities.

Elevated mRNA levels or increased hyaluronidase enzymaticactivity have been associated with invasion and metastasis forovarian and endometrial cancers,16 progression of prostate can-cer,17 bladder cancer,18 colorectal carcinoma,19 laryngeal cancer20

and salivary gland tumors.21 In breast cancer, a correlation hasbeen observed between hyaluronidase expression/activity and me-tastasis,22 as well as invasiveness23 in both animal models andclinical material.

The mechanism(s) by which hyaluronidase activity might leadto biological responses such as tumor cell migration is becomingapparent. Hyaluronidase activity results in cleavage of HA andassociated matrix molecules such as hyalectins,2 and induces an-giogenesis.19 The small MW fragments generated from the break-down of HA are known to be highly angiogenic,10 and activatesignaling pathways that result in increased motility and tumor cellmigration.24 CD44, the HA binding receptor,25,26 plays a majorrole in HA endocytosis and binding of HA to CD44 results inactivation of Rac1 GTPase.24 This can lead to a rapid re-organi-zation of the actin cytoskeleton and induction of lamellipodia. HAcan also activate other receptors,27 and HA fragments of �2 � 105

are able to activate NF-�B in human and mouse cell lines, whereaslarger HA fragments �1 � 106 may have inhibitory effects.28

Hyaluronidase is also known to antagonize TGF-mediated inhibi-tion of cell growth.29

Other studies have found little or no correlation between in-creased hyaluronidase activity and cancer. Hyaluronidase has, forexample, been used as an additive to increase the efficacy ofchemotherapy.30 Hyaluronidase treated mice exposed to carcino-gens had fewer and smaller tumors than controls,31 and higherlevels of serum hyaluronidase activity were found to enhanceresistance to tumor growth.32 Finally, some hyaluronidase genessuch as hyal-1 are found within candidate tumor suppressor loci,33

and the inactivation of hyal-1 has been reported in some head andneck squamous cell carcinoma cell lines.34

Since the contribution of hyaluronidases to tumor growth andmetastasis remains unclear, we have undertaken a survey of theexpression levels of four known enzymatically active hyaluroni-dases (hyal-1, hyal-2, LUCA3 and PH20) across a range of normalhuman tissues, a focussed set of human tumor xenografts and asmall set of clinical material including breast cancer sera samples.Based on these profiles, we have engineered a breast cancer and aprostate cancer cell line to overexpress hyal-1 and have evaluatedtheir phenotypes using in vitro and in vivo models of tumorgrowth, invasion and metastasis.

The first two authors contributed equally to this study.

*Correspondence to: Oxford GlycoSciences, 10 The Quadrant, Abing-don Science Park, Abingdon, Oxfordshire,OX14 3YS, UK.Fax: �44-1235-207-670. E-mail: martin.page@ogs.co.uk

Received 9 May 2001; Revised 27 July 2001; Accepted 6 August 2001

Published online 23 October 2001; DOI 10.1002/ijc.1638

Int. J. Cancer: 97, 416–424 (2002)© 2002 Wiley-Liss, Inc.

Publication of the International Union Against Cancer

MATERIAL AND METHODS

Dot blot hybridizationcDNA probes corresponding to full length hyal-1, hyal-2, PH20

and LUCA3 were labeled with 32P-dCTP using a random primerlabeling kit (Pharmacia-Biotech, Gaithersburg, MD). Commer-cially available RNA master dot blots comprising 50 normalhuman tissues or a 2nd edition RNA Master dot blot comprising 68normal tissues and 8 cell lines (Clontech, Palo Alto, CA) werehybridized with labeled cDNA probe in Express-Hyb solution(Clontech) according to the manufacturer’s protocol. Blots werewashed and then exposed to X-ray film at �80°C for up to 1 week.

Normal tissue and tumor samplesFlash frozen CAL51 tumor xenografts were obtained from in

vivo studies (see below). Normal breast from reduction mammo-plasty and tumor breast samples were kindly provided by R. Harrisand M. O’Hare (Ludwig Institute for Cancer Research, London,UK). Serum from normal and breast cancer patients were kindlyprovided by C. Coombes, (Hammersmith Hospital, London, UK).All clinical samples were obtained with informed patient consent.

Cell linesThe breast cancer lines CAL51 and GI101 were kindly provided

by M. O’Hare, Ludwig Institute for Cancer Research, London,UK. The other breast cancer lines MDA468 and BT20 wereobtained from the American Type Culture Collection.

RNA and cDNA samplesNormal human tissue RNAs were obtained from Clontech. The

following cDNAs from human tumor xenografts, propagated inathymic nude mice, were also purchased from Clontech: breastcarcinoma GI-101, lung carcinoma LX-1, lung carcinoma GI-117,colon adenocarcinoma CX-1, colon adenocarcinoma GI-112, pros-tatic adenocarcinoma PC3, ovarian carcinoma GI-102 and pancre-atic adenocarcinoma GI-103.

GenBank accession numbersGenBank accession numbers used included: Hyal-1: U96078,

gi2314820; Hyal-2: AJ000099, gi2314820; LUCA3: AF040710,gi2935328; PH20: S67798, gi459386.

Taqman analysis (quantitative mRNA profiling)Real time RT-PCR35 was used to quantitatively measure hyal-1,

hyal-2, LUCA3 and PH20 expression in normal and tumor humantissue. cDNAs were synthesized from 5 �g total RNA using anoligo dT primer and SuperscriptII reverse transcriptase (Life Tech-nologies, Bethesda, MD). The primers used for PCR were asfollows: Hyal-1 sense, 5 CAGGCGTGAGCTGGATGGAGA 3;Hyal-1 antisense, 5 GTATGTGCAACACCGTGTGGC 3;Hyal-2 sense, 5 CCATGCACTCCCAGTCTACGTC 3; Hyal-2antisense, 5 TCACCCCAGAGGATGACACCAG 3; LUCA3sense: 5 GATCCAGGACAGATGGAAGC 3; LUCA3 antisense,5 CCTGGCTTTATACTGCTTCTTTAGGC 3; PH20 sense, 5AATCAACGTCACACTAGCAGCC 3; PH20 antisense, 5TGCTCCAGGTCTTCAAGTGTCG 3. The accumulation of PCRproduct was monitored using the ds DNA intercalating dye SYBRGreen I (Sigma, St. Louis, MO), except for the hyal-1 assay thatused a probe specific to hyal-1 (5 CATATACTCCTTGATGGC-CTGACA 3) fluorescently labeled at the 5 end with reporter dye6-FAM and at the 3 end with the quencher dye TAMRA. Reac-tions contained 10 ng cDNA, sense and antisense primers andreagents for PCR (PE Biosystems, North Warrington, Cheshire,UK) and were run on an ABI7700 sequence detection system (PEBiosystems). The PCR conditions were 1 cycle at 50°C for 2 min,1 cycle at 95°C for 10 min, followed by 40 cycles of 95°C for 15sec, X°C for 1 min, where X 65°C for hyal-1, hyal-2 andLUCA3 and 60°C for PH20. The accumulation of PCR productwas measured in real time as increasing reporter dye fluores-cence,36 and the data were analyzed using the Sequence Detectorprogram v1.6.3 (PE Biosystems). Standard curves relating initial

template copy number to fluorescence and amplification cyclenumber were generated using the amplified PCR product as atemplate and were used to calculate hyal-1, hyal-2, LUCA3 andPH20 mRNA copy number in each sample.

Aggrecan assayThe aggrecan assay was performed according to the method

described by Barry et al. (in preparation). Briefly, 96-well micro-titer plates were coated overnight with HA (0.01 mg/ml) at roomtemperature. Excess unbound HA was removed by washing andthe plates were blocked with 0.05% Tween and 1% BSA. Plateswere then incubated for 1 hr at 37°C with patient serum samples(100 �l of 1:50 dilution in sodium acetate buffer pH 4) or recom-binant human hyal-1 produced in an insect baculovirus expressionsystem as a standard, in 200 mM sodium acetate buffer at pH 4.Intact undigested HA remaining on the plate was detected usingbiotinylated aggrecan made in-house (100 �l of 0.01 mg/ml bio-tinylated aggrecan in PBS) followed by Streptavidin-HRP (Sigma,1:100 dilution of 0.1 mg/ml solution in PBS). Tetramethylbenzi-dine (100 �l) was added to develop the assay and the reaction wasstopped by the addition of 1 M sulfuric acid (100 �l). Opticaldensity of the reaction was read on a plate reader at 450 nm.

ZymographyZymography was carried out as described previously,22,37 with

some modifications: 0.2 mg/ml HA was added to 12% polyacryl-amide SDS-PAGE gels and cell extracts were run at 125 V inrunning buffer at pH 3.8. Gels were washed with 3% Triton X-100for 1 hr at room temperature to remove SDS. They were thenstained with 0.5% Alcian Blue for 1 hr before destaining for 2 hrwith 7% acetic acid.

EGFP-taggingThe full-length cDNAs encoding hyal-1 and hyal-2 were gen-

erated using RT-PCR. After confirmation by sequencing, the fulllength cDNA inserts encoding hyal-1 and hyal-2 were subclonedinto the 5 multiple cloning site of the pEGFP-N1 vector (Clon-tech), resulting in a construct encoding a fusion protein of eitherhyal-1 or hyal-2 with EGFP at the C-terminus. DNA was tran-siently transfected using Lipofectamine (Gibco, Gaithersburg,MD), into CAL51 or PC3M cells, plated at low confluence onglass coverslips. After 24, 48 or 72 hr, cells were either fixed using70% ice cold ethanol, or incubated with 50 nM MitoTrackerOrange (Clontech) for 15 min before fixation. Alternatively cellswere incubated at 37°C for 30 min with 50 nM LysoTracker RedDND99 (Clontech) and viewed live after washing with PBS andaddition of fresh media. Fixed cells on coverslips were mounted onglass slides and photographed using bright field (BF), phase orfluorescence (FITC/TRITC filters) microscopy.

Stable cell linesThe full-length hyal-1 cDNA was subcloned into the multiple

cloning site of the pCEP4 vector (Invitrogen). This construct,confirmed by sequencing, was transfected into parental PC3Mcells using Lipofectamine (Gibco) and standard calcium phosphateprecipitation for CAL51 cells. Stable lines were selected after 4–8weeks of growth with hygromycin B (Gibco) at 200 �g/ml. ThepCEP4 vector alone was also used in separate transfections togenerate appropriate control cell lines. Overexpression of hyal-1was confirmed using zymography (protein) and PCR (mRNA).

In vivo studiesThe breast cancer cell line CAL51 is reported to be metastatic

when injected i.p. into athymic mice.38 Fifteen million CAL51cells engineered to overexpress hyal-1 (see above), or the vectorcontrol, were injected i.p. into female Cbi O/nu mice. The exper-iment was terminated after 80 days, tumor incidence and distribu-tion scored and representative samples were fixed or used togenerate explant tumor cell cultures. For the prostate cancer cellline PC3M an orthotopic route of administration was used. Thehyal-1 overexpressing PC3M cells, control vector and parental

417HYAL-1 OVEREXPRESSION IN PROSTATE CANCER

FIGURE 1 – RNA dot blots, showing the relative tissuedistributions of mRNA for hyal-1 (middle panel) andLUCA3 (bottom panel) (a) and hyal-2 (middle panel) andPH20 (bottom panel) (b). 32P radiolabeled probes werehybridized to the dot blots in ExpressHyb solution (Clon-tech) at 65°C for 4 hr or overnight (LUCA3) and thenwashed according to manufacturer’s protocol. Blots wereexposed to X-ray film at �80°C for up to 1 week. For eachgroup of blots, the key for the samples is shown in the toppanel.

418 PATEL ET AL.

FIGURE 1 – CONTINUED.

419HYAL-1 OVEREXPRESSION IN PROSTATE CANCER

PC3M cell lines were injected using a 30 g needle at 3 � 104 cellsin 30 �l RPMI 1640 medium into the ventral prostate of groups of8 nu/nu mice under halothane (3%) anesthesia. The wounds wereclosed with 4/0 silk and a Michel clip and the animals given ananalgesic and allowed to recover. Mice were sacrificed when anysymptoms became apparent. Primary tumors in the prostate werethen weighed and gross metastases scored.

RESULTS

mRNA levels of hyaluronidases in normal tissuesThe relative mRNA expression levels of hyal-1, hyal-2, LUCA3

and PH20 were determined by hybridization of full-length cDNAprobes on commercial dot blots containing RNA from a range ofnormal tissues (Clontech). Hyal-1 and LUCA3 were probed onRNA master dot blots comprising 50 normal tissues (Fig. 1a)whereas hyal-2 and PH20 were probed on 2nd edition RNA masterdot blots comprising of 68 normal tissues and 8 cell lines (Fig. 1b).The dot blots were normalized for RNA loading and incorporatedseveral housekeeping genes for determination of relative intensi-ties. For all hybridizations, the 4 separate cDNA probes did notcross-hybridize to control yeast or human DNA.

Hyal-1 mRNA was present in most organs although higherrelative levels were detected in heart, stomach, adrenal gland,kidney, liver, small intestine, spleen, lung, fetal liver and fetalspleen (Fig. 1a). LUCA3 mRNA was also widely distributed, withthe highest expression seen in the testis (Fig. 1a). Hyal-2 mRNAwas widely expressed, with lower relative mRNA expression seenin most tissues including brain regions (Fig. 1b). We used Taqmananalysis to confirm the presence of low levels of hyal-2 mRNA incDNA from normal whole brain (data not shown). Highest relativelevels were detected in adult and fetal spleen, lung, liver and heart.PH20 mRNA was only observed in normal testis and not in any ofthe other 67 normal tissues evaluated (Fig. 1b). Quantitative Taq-man PCR analysis of cDNA from normal tissues provided similarresults (data not shown).

Expression of hyaluronidases in human cancer cell lines andhuman tumor xenografts

To extend these findings, we examined the expression profiles ofthese four hyaluronidases in a range of tumor xenografts and celllines. The small amounts of RNA available from tumors precludeddot blot or northern blot analysis, but were sufficient for quanti-tative Taqman RT-PCR studies. Hyal-1 mRNA was detected in allfour breast cancer cell lines tested (GI101, BT20, MDA468 andCAL51), but only at levels comparable to that seen in normalbreast cDNA (Fig. 2a). CAL51 tumors derived from i.p. xeno-grafts (see below) were also examined to assess human hyaluron-idase mRNA levels. The hyal-1 primers were designed to ensurethat they did not amplify endogenous murine hyaluronidase se-quence. The CAL51 tumor xenografts showed significantly in-creased hyal-1 mRNA compared to the parental CAL51 cell line inculture. Increased hyal-1 mRNA levels were also seen for mostother tumor xenograft materials relative to their correspondingnormal human tissues e.g., colon, lung and prostate (PC3) tumors(Fig. 2a).

Hyal-2 mRNA was also increased in the CAL51 xenograftmaterial, but not the PC3 xenograft material. The colon xe-nografted GI112 and CX1 (Fig. 2a) showed elevated hyal-2mRNA compared to normal colon, as did the xenografted pancre-atic line GI103 compared to normal pancreas. Hyal-2 mRNA wasalso grossly elevated in the ovarian cancer line GI102 (Fig. 2a)compared to the other samples; however no control normal ovariansample was available.

LUCA3 was readily detectable in 2 of the 4 (BT20 andMDA468) human breast tumor cell lines, the 2 CAL51 tumorxenografts and in the prostate cancer cell line PC3 and the meta-static variant PC3M (Fig. 2a). Although the mRNA copy numbersobtained were not as high as seen for hyal-1 and hyal-2 (Fig. 2a),LUCA3 was detected in most tissues. Comparisons between re-

sults from different gene primer sets, however, are probably notmeaningful. PH20 was undetectable across all cancer cell lines andtumor xenografts (data not shown).

Hyaluronidase mRNA expression in clinical tumorsThe survey of hyaluronidase expression profiles was subse-

quently extended to a small set of human clinical breast tumor (T)and normal breast (N) samples (Fig. 2b). No consistent changeswere observed. Hyal-1, hyal-2 and LUCA3 were detected in all ofthe breast samples (Fig. 2b); hyal-2 showed the highest mRNAexpression in 1 (478T) out of 5 tumors. The relatively high levelsof hyal-1 and hyal-2 mRNA seen with the in vivo CAL51 xenograftswas not reflected in the clinical breast tumor examples examined.Again, PH20 mRNA was not detectable (data not shown).

Measurement of hyaluronidase activity in the serum of breastcancer patients

Reports are conflicting on whether breast cancer patients haveelevated hyaluronidase activity.9,22 Hyaluronidase activity wastherefore measured in serum samples from breast cancer patientswith primary tumors (n 16), metastatic breast cancer (n 17)and control patients with nonmalignant conditions (n 16). Thehyaluronidase activity was assessed using a novel aggrecan assay(Table I) and some samples were also tested using HA substrategel zymography. These assays were carried out at pH 3.5, optimalfor hyal-1 and hyal-2, but not for measurement of LUCA3 orPH20.39 The aggrecan assay showed no significant differencesacross the sample sets (Table I). In the zymograms, each sampleshowed 2 clear bands on the gels, against the blue background,which were indicative of hyaluronidase activity. Again, no signif-icant differences in band intensities were seen in sera from patientswith primary or metastatic breast cancer compared to normalcontrols (data not shown).

Cellular localization of hyal-1 and hyal-2 proteinsIf either hyal-1 or hyal-2 were confirmed to play a role in tumor

extravasation and metastasis, then they could become suitabletargets for therapeutic intervention. A secreted or cell surfacelocation would be more amenable to such an approach. Hyal-1 isreported to be secreted,40 to have a cell surface and possibly alsoa lysosomal localization.41 Hyal-2 is thought to be lysosomal,12 ora GPI surface-membrane anchored protein.13 We therefore exam-ined the intracellular distributions of EGFP tagged hyal-1 andhyal-2 in breast cancer (CAL51) and prostate cancer (PC3M) celllines. EGFP alone was used as a control and transfection condi-tions were adjusted to keep transfection efficiency low (�10%).Hyal-1 EGFP was expressed initially (12–24 hr) in a peri-nuclearregion (data not shown) and subsequently more prominently andevenly over the PC3M cell surface plasma membrane (Fig. 3,FITC/TRITC). The hyal-1 EGFP expression pattern in the CAL51cells was different; although surface expression was seen, some ofthe visible fluorescence was punctate (intracellular compartmentsor protein aggregation). Fluorescence was also clearly visible inthe regions surrounding the cell, suggesting that hyal-1 EGFP wassecreted by CAL51 cells (Fig. 3, FITC/TRITC). This was mosteasily seen in cells in which mitochondria had also been stainedwith MitoTracker Orange (Fig. 3, TRITC). In contrast, hyal-2EGFP expression was weaker and largely limited to punctateintracellular compartments in both cell lines (Fig. 3). This punctatestaining did not consistently colocalize with the lysosomal stainLysoTracker Red (Fig. 3, TRITC). As a control, EGFP alone wasfound to be expressed throughout the cytosol in both cell types(data not shown).

Stable overexpression of hyal-1 in cancer cell linesBased on the more restricted intracellular localization of hyal-2

and the consistent increases in hyal-1 but not hyal-2 mRNA seenin xenografted CAL51 and PC3M cells (Fig. 2b), stable cell linesoverexpressing recombinant hyal-1 were generated for furtherstudies. The pCEP4 vector was used because this is episomal-based and obviates the need to isolate individual cell clones. The

420 PATEL ET AL.

CAL51 and PC3M recipient cell lines both expressed low levels ofendogenous mRNA for hyal-1 in vitro (Fig. 2). Overexpression ofactive recombinant hyal-1 enzyme was confirmed in both engi-neered cancer cell lines by zymography (Fig. 4), where highlysignificant increases in enzymatic activity were observed com-pared to parent and vector control cell lines. It was of interest tonote that the zymograms from the PC3M cells exhibited 1 strongband of hyaluronidase activity whereas the CAL51 cells exhibited2. This could be indicative perhaps of different processing of theenzyme between the 2 cell lines (Fig. 4). A smaller proteolyticallyprocessed form of hyal-1 has previously been described in humanurine.39

In vitro and in vivo studies with hyal-1 overexpressing cell linesIn an attempt to assign some notable change in phenotype for

the hyal-1 overexpressing CAL51 and PC3M cells, they werecharacterized extensively in vitro using clonogenicity and inva-sion/motility assays. It became apparent, however, that despite thehuge increase in hyal-1 activity in these lines, there was noobservable gain-of-function as assessed by these particular assays.These results prompted us to evaluate the properties of these celllines in an in vivo setting. CAL51 control (empty vector) andCAL51 hyal-1 overexpressing cells were injected i.p. into femaleO/nu mice. No increase was seen in the incidence, number, or sizeof tumor nodules across a range of sites after 80 days for the hyal-1overexpressing cell line (data not shown). Interestingly, Victor etal.42 showed metastasis in nude mice after i.p. CAL51 adminis-tration and in addition the transition of these cells from the primaryto the metastatic state was characterized by increased HA andhyaluronidase production.

For the PC3M parental and hyal-1 overexpressing cells, we wereable to explore an orthotopic route via injection of the cells directlyinto the prostate gland of nu/nu animals. Animals were sacrificedwhen the tumors became palpable. Primary tumors were thenweighed and the number and sites of metastases determined (seeTable II). In this model, significantly larger numbers of metastaseswere derived from the hyal-1 overexpressing PC3M cells com-pared to vector control and parental cells, despite the formerproducing slightly smaller primary tumors (Table II). Metastases

FIGURE 2 – Quantitative RT-PCR Taqman analysis, showing the mRNA copy number for hyal-1, hyal-2 and LUCA3. (a) Range of cDNAsfrom normal human tissues, cancer cell lines and subsequent tumor xenografts (denoted by *), (b) Clinical breast tumor (T) versus normal breast(N) material. Data are expressed as copy number per ng cDNA.

TABLE I – HYALURONIDASE ACTIVITY IN SERUM FROM BREAST CANCERPATIENTS AS MEASURED BY THE AGGRECAN ASSAY1

Group HAse activity(arb. units)

HAse activity(�g protein)

Control (n 16) 1.00 � 0.32 0.0188 � 0.0053Primary (n 16) 0.85 � 0.15 0.0171 � 0.0039Metastatic (n 17) 1.02 � 0.33 0.0184 � 0.00631Results are expressed as relative arbitrary units for each group, and

as activity per microgram of protein, � S.E.M. Activities in theprimary and metastatic groups were not significantly different fromthose of the control groups (p � 0.1, t-test).

421HYAL-1 OVEREXPRESSION IN PROSTATE CANCER

were found primarily in the para-aortic lymph node chain and alsoin mesenteric nodes and diaphragm. A single animal from theparental cell line and vector control cell line groups (1/16) devel-

oped ascites, whereas 3/8 mice receiving the hyal-1 overexpressingcell line developed ascites and 2/8 developed metastases in lymphnodes within the thoracic cavity.

DISCUSSION

The involvement of the hyaluronidase family of enzymes innormal and disease processes is complex. Studies to date showcontrasting data, ranging from a contributory role of hyaluroni-

FIGURE 3 – Cellular hyal-1 EGFP (left) and hyal-2 EGFP (right) localizations in PC3M cells (top) and CAL51 cells (bottom), 48 hrpost-transfection. Images are matched bright-field (upper rows) with fluorescent (FITC) images (middle rows). The EGFP tagged proteins appeargreen in color. The rows of images marked TRITC show additional hyal-1 EGFP or hyal-2 EGFP expressing cells, which have been co-stainedwith MitoTracker Orange (left image: nuclei appear blue/green after counterstaining with DAPI, Gibco), or LysoTracker Red (right image, nonuclear staining, cells are alive in these images). Both mitochondria and lysosomes appear red, whereas the EGFP-tagged hyaluronidases appeargreen.

FIGURE 4 – HA substrate zymography of engineered cell lines.Whole cell extracts were run on HA substrate gels that were thenincubated overnight at 37°C at pH3.8. Gels were washed with 3%Triton X-100 then stained with 0.5% Alcian Blue and destained with7% acetic acid. Lanes: MW markers, parent cells, vector control,hyal-1 overexpressing PC3M (left) and CAL 51 cell lines (right).

TABLE II – NUMBERS OF METASTASES, AND THE GROWTH RATE OFPRIMARY TUMOURS, CALCULATED FROM WEIGHT AT TERMINATION

DIVIDED BY GROWTH PERIOD OF THE PARENT, VECTOR CONTROL ANDHYAL-1 EXPRESSING PC3M CELL LINES, FOLLOWING ORTHOTOPIC

INOCULATION IN NU/NU MICE

PC3M Group Mean number ofmetastases/animal

Primary tumorweight g/day

growth

Meangrowthperiod

Parental (n 8) 2.13 � 0.23 0.039 � 0.009 30.3Vector (n 8) 2.22 � 0.39 0.032 � 0.005 32.6Hyal-1 (n 8) 3.13 � 0.411 0.028 � 0.003 35.01The numbers of metastases per animal were significantly higher for

the hyal-1 expressing PC3M group (p � 0.05, t-test) compared to thevector and parental groups.

422 PATEL ET AL.

dases in cancer, to no significant role. In some instances, aninactivation of a hyaluronidase family member is associated withcancer. In an attempt to gain further insight into the cancer biologyof the hyaluronidase family, we have now provided extensiveglobal profiling of the four individual hyaluronidase genes innormal tissues and cancer cell lines and have extended theseobservations to the evaluation of hyal-1 in vitro and in vivo.

Our studies showed that in normal human tissues, hyal-1 geneexpression was generally widespread, although relatively higherlevels were usually found in the organs known to be major sites forthe degradation of circulating HA (e.g., kidney and liver). Theidentification of hyal-1 in fetal tissues such as lung, liver andspleen, however, has not been reported previously. Expression ofhyal-2 was observable in all normal tissues examined, but perhapsof more significance was the detection of hyal-2 in the 19 specificbrain regions examined. For the other 2 active hyaluronidasemembers, LUCA3 gene expression was generally very low acrossall normal and tumor tissue, whereas PH20 was only identified innormal testes. An association for PH20 in cancer cannot be ex-cluded, however, because recently an association of PH20 withlaryngeal cancer has been cited.20

The subcellular localization of the hyaluronidase enzymes mayalso provide useful indications to their biological role. Our EGFP-tagging experiments provided support for a secretory or cell sur-face location for hyal-1. It is of interest to note that the phenotypeof a patient with mutations in hyal-1 is that of a lysosomal storagedisease with accumulation of HA in lysosomes.41,43 Our data withCAL51 cells suggests that hyal-1 may also be localized withinother specific sub-cellular regions and zymography suggested thatdifferent cell/tissue types may process hyal-1 differently.40 Thesesuggestions are strengthened by our zymogram studies with thebreast CAL51 and prostate PC3M cell lines engineered to over-express hyal-1, where an additional band indicative of hyaluroni-dase activity was identified only with the CAL51 cells. Our EGFP-tagging studies were supportive of a more restricted intracellularlocalization for the hyal-2 protein: not obviously lysosomal(Fig. 3).

Increased hyaluronidase activity has also been previously dem-onstrated in serum samples from breast cancer patients. In our(albeit limited) studies, however, where 2 independent assays wereused, no differences in activity between the sera from patients withmetastatic breast cancer, or primary breast cancer, were seen whencompared to control samples. Serum inhibitors of hyaluronidaseactivity have recently been identified, but remain largely unchar-acterized.44 These may complicate the interpretations based onactivity data, although it is likely that the conditions used forzymography should remove such inhibitors.

Despite engineering the breast cancer CAL51 and prostate can-cer PC3M cell lines to considerably overexpress hyal-1, we wereunable to demonstrate any measurable gain-of function propertiesusing in vitro assays. During our RNA expression studies, how-ever, it was observed that there were often marked differences in

the hyal-1 levels between cell lines grown in an in vitro and an invivo (xenograft) setting. In these situations, hyal-1 expression wasfrequently upregulated in the xenografts. This has been previouslyobserved with the CAL51 cell line,42 where it is suggested that theincrease in hyal-1 expression plays a role in extravasation andmetastasis. In addition it was recently shown by immunohisto-chemistry that hyal-1 has a stromal and epithelial pattern of stain-ing that increased with prostate cancer grade and metastasis.45

Taken together, the xenograft and localization data derived forhyal-1 suggested that there may be significant upregulation oftumor cell hyal-1 in vivo, which was either secreted or on the cellsurface and thus in contact with the extracellular matrix. In view ofthese findings, it was decided to evaluate the tumor forming andmetastatic potential of the hyal-1 overexpressing cancer cell linesin an in vivo environment. In our first series of these experiments,the CAL51 breast cancer cell line and its engineered derivativeoverexpressing hyal-1 were inoculated intraperitoneally (i.p.) intomice. No difference was seen, however, in either the tumor burden,or numbers of lesions produced between the 2 lines. This resultsuggested that either the control cells upregulate hyal-1 in vivo tocomparable levels seen for the hyal-1 engineered CAL51 cells, orthat hyal-1 alone may not be important for metastasis formation inthis i.p model of breast cancer. In contrast to the CAL51 i.p.model, however, the metastatic prostate PC3M cell line offered theopportunity to evaluate an orthotopic route of tumor cell inocula-tion.. In this situation, comparison of the parental PC3M cell lineand its hyal-1 overexpressing counterpart in vivo showed that therewas a significant increase in the number of metastases for thehyal-1 overexpressing PC3M cells (Table II). This suggested thatthe tumor cell type or the in vivo site of administration areimportant facets to consider when studying enzymes, such ashyaluronidases, which are involved in cell associated extracellularmatrix interactions. Our findings are also strengthened by therecent report in which hyal-2 overexpression in astrocytoma cellssignificantly increased intracerebral, but not subcutaneous tumorgrowth.46 Collectively, these data highlight the complex biology ofthe hyaluronidase family of carbohydrate-processing enzymes andthe important role that the tumor and matrix environment can play.This is perhaps not surprising when one considers the naturalphysiological role of the hyaluronidases in the architectural remod-eling of the ECM and the specific, maybe differing, micro-envi-ronments around individual tissues and organs.

In summary, our studies have indicated that the hyaluronidases,particularly hyal-1, may exert subtle but nevertheless importantroles in cancer biology. These events can be cell type- and envi-ronment-dependent. Further studies should use specific antibodiesto broadly assess the individual hyaluronidase proteins in normaland diseased tissues. In addition, the use of in vivo regulatablehyaluronidase expression systems, coupled to appropriate in vivomodels that create the correct environment, may enable us tofurther determine if this family of enzymes has a causative or amaintenance role in cancer formation and metastasis.

REFERENCES

1. Frost G, Csoka T, Stern R. The hyaluronidases: a chemical, biologicaland clinical overview. TIGG 1996;8:419–34.

2. Lee JY, Spicer AP. Hyaluronan: a multifunctional, megadalton stealthmolecule. Curr Opin Cell Biol 2000;12:581–6.

3. Hyde CE, Old RW. Expression pattern of a novel hyaluronidaseduring Xenopus embryogenesis. Mech Dev 1999;82:213–7.

4. Zhang L, Underhill CB, Chen L. Hyaluronan on the surface of tumorcells is correlated with metastatic behavior. Cancer Res 1995;55:428–33.

5. Delpech B, Chevallier B, Reinhardt N, et al. Serum hyaluronan(hyaluronic acid) in breast cancer patients. Int J Cancer 1990;46:388–90.

6. Cooper EH, Forbes MA. Serum hyaluronic acid levels in cancer. Br JCancer 1988;58:668–9.

7. Lokeshwar VB, Obek C, Pham HT, et al. Urinary hyaluronic acid andhyaluronidase: markers for bladder cancer detection and evaluation ofgrade. J Urol 2000;163:348–56.

8. Ropponen K, Tammi M, Parkkinen J, et al. Tumor cell-associated

hyaluronan as an unfavorable prognostic factor in colorectal cancer.Cancer Res 1998;58:342–7.

9. Ponting J, Howell A, Pye D, et al. Prognostic relevance of serumhyaluronan levels in patients with breast cancer. Int J Cancer 1992;52:873–6.

10. Slevin M, Krupinski J, Kumar S, et al. Angiogenic oligosaccharides ofhyaluronan induce protein tyrosine kinase activity in endothelial cellsand activate a cytoplasmic signal transduction pathway resulting inproliferation. Lab Invest 1998;78:987–1003.

11. Frost GI, Csoka TB, Wong T, et al. Purification, cloning and expres-sion of human plasma hyaluronidase. Biochem Biophys Res Commun1997;236:10–5.

12. Lepperdinger G, Strobl B, Kreil G. HYAL2, a human gene expressedin many cells, encodes a lysosomal hyaluronidase with a novel type ofspecificity. J Biol Chem 1998;273:22466–70.

13. Rai SK, Duh FM, Vigdorovich V, et al. Candidate tumor suppressorHYAL2 is a glycosylphosphatidylinositol (GPI)-anchored cell-surface

423HYAL-1 OVEREXPRESSION IN PROSTATE CANCER

receptor for jaagsiekte sheep retrovirus, the envelope protein of whichmediates oncogenic transformation. Proc Natl Acad Sci USA 2001;98:4443–8.

14. Heckel D, Comtesse N, Brass N, et al. Novel immunogenic antigenhomologous to hyaluronidase in meningioma. Hum Mol Genet 1998;12:1859–72.

15. Csoka AB, Scherer SW, Stern R. Expression analysis of six paralo-gous human hyaluronidase genes clustered on chromosomes 3p21 and7q31. Genomics 1999;60:356–61.

16. Tamakoshi K, Kikkawa F, Maeda O, et al. Hyaluronidase activity ingynecological cancer tissues with different metastatic forms. Br JCancer 1997;75:1807–11.

17. Madan AK, Pang Y, Wilkiemeyer MB, et al. Increased hyaluronidaseexpression in more aggressive prostate adenocarcinoma. Oncol Rep1999;6:1431–3.

18. Lokeshwar VB, Soloway MS, Block NL. Secretion of bladder tumor-derived hyaluronidase activity by invasive bladder tumor cells. CancerLett 1998;131:21–7.

19. Liu D, Pearlman E, Diaconu E, et al. Expression of hyaluronidase bytumor cells induces angiogenesis in vivo. Proc Natl Acad Sci USA1996;93:7832–7.

20. Godin DA, Fitzpatrick PC, Scandurro AB, et al. PH20: a novel tumormarker for laryngeal cancer. Arch Otolaryngol Head Neck Surg2000;126:402–4.

21. Xing R, Regezi JA, Stern M, et al. Hyaluronan and CD44 expressionin minor salivary gland tumors. Oral Dis 1998;4:241–7.

22. Bertrand P, Girard N, Duval C, et al. Increased hyaluronidase levelsin breast tumor metastases. Int J Cancer 1997;73:327–31.

23. Madan AK, Yu K, Dhurandhar N, et al. Association of hyaluronidaseand breast adenocarcinoma invasiveness. Oncol Rep 1999;6:607–9.

24. Bourguignon LY, Zhu H, Shao L, et al. CD44 interaction with TIAM1promotes Rac1 signaling and hyaluronic acid mediated breast tumormigration. J Biol Chem 2000;275:1829–38.

25. Knupfer MM, Poppenborg H, Hotfilder M, et al. CD44 expression andhyaluronic acid binding of malignant glioma cells. Clin Exp Metas-tasis 1999;17:71–6.

26. Lessan K, Aguiar DJ, Oegema T, et al. CD44 and beta1 integrinmediate ovarian carcinoma cell adhesion to peritoneal mesothelialcells. Am J Pathol 1999;154:1525–37.

27. Khaldoyanidi S, Moll J, Karakhanova S, et al. Hyaluronate-enhancedhematopoiesis: two different receptors trigger the release of interleu-kin-1� and interleukin-6 from bone marrow macrophages. Blood1999;94:940–9.

28. Noble PW, McKee CM, Cowman M, et al. Hyaluronan fragmentsactivate an NF-�B/I-�B autoregulatory loop in murine macro-phages. J Exp Med 1996;183:2373–8.

29. Chang NS. Transforming growth factor-� protection of cancer cellsagainst tumor necrosis factor cytotoxicity is counteracted by hyal-uronidase (review). Int J Mol Med 1998;2:653–9.

30. Csoka TB, Frost GI, Stern R. Hyaluronidases in tissue invasion.Invasion Metastasis 1997;17:297–311.

31. Pawlowski A, Haberman HF, Menon IA. The effects of hyaluronidaseupon tumor formation in BALB/c mice painted with 7,12-dimethyl-benz-(a)anthracene. Int J Cancer 1979;23:105–9.

32. De Maeyer E, De Maeyer-Guignard J. The growth rate of two trans-plantable murine tumors, 3LL lung carcinoma and B16F10 mela-noma, is influenced by Hyal-1, a locus determining hyaluronidaselevels and polymorphism. Int J Cancer 1992;51:657–60.

33. Csoka TB, Frost GI, Heng HH, et al. The hyaluronidase gene HYAL1maps to chromosome 3p21.2–p21.3 in human and 9F1–F2 in mouse,a conserved candidate tumor suppressor locus. Genomics 1998;48:63–70.

34. Frost GI, Mohapatra G, Wong TM, et al. HYAL1 LUCA-1, a candi-date tumor suppressor gene on chromosome 3p21.3, is inactivated inhead and neck squamous cell carcinomas by aberrant splicing ofpre-mRNA. Oncogene 2000;19:870–7.

35. Heid CA, Stevens J, Livak KJ, et al. Real time quantitative PCR.Genome Res 1996;6:986–94.

36. Morrison TB, Weis JJ, Wittwer CT. Quantification of low-copy tran-scripts by continuous SYBR Green I monitoring during amplification.Biotechniques 1998;24:954–62.

37. Podyma KA, Yamagata S, Sakata K, et al. Difference of hyaluroni-dase produced by human tumor cell lines with hyaluronidase presentin human serum as revealed by zymography. Biochem Biophys ResCommun 1997;241:446–52.

38. Gioanni J, Le Francois D, Zanghellini E, et al. Establishment andcharacterization of a new tumorigenic cell line with a normal karyo-type derived from a human breast adenocarcinoma. Br J Cancer1990;62:8–13.

39. Csoka TB, Frost GI, Wong T, et al. Purification and microsequencingof hyaluronidase isozymes from human urine. FEBS Lett 1997;417:307–10.

40. Fiszer-Szafarz B, Litynska A, Zou L. Human hyaluronidases: elec-trophoretic multiple forms in somatic tissues and body fluids. Evi-dence for conserved hyaluronidase potential N-glycosylation sites indifferent mammalian species. J Biochem Biophys Meth 2000;45:103–16.

41. Triggs-Raine B, Salo TJ, Zhang H, et al. Mutations in HYAL1, amember of a tandemly distributed multigene family encoding dispar-ate hyaluronidase activities, cause a newly described lysosomal dis-order, mucopolysaccharidosis IX. Proc Natl Acad Sci USA 1999;96:6296–300.

42. Victor R, Chauzy C, Girard N, et al. Human breast-cancer metastasisformation in a nude-mouse model: studies of hyaluronidase, hyaluro-nan and hyaluronan-binding sites in metastatic cells. Int J Cancer1999;82:77–83.

43. Natowicz MR, Short MP, Wang Y, et al. Clinical and biochemicalmanifestations of hyaluronidase deficiency. N Engl J Med 1996;335:1029–33.

44. Mio K, Carrette O, Maibach HI, et al. Evidence that the seruminhibitor of hyaluronidase may be a member of the inter-alpha -in-hibitor family. J Biol Chem 2000;275:32413–21.

45. Lokeshwar VB, Rubinowicz D, Schroeder GL, et al. Stromal andepithelial expression of tumor markers hyaluronic acid and HYAL1hyaluronidase in prostate cancer. J Biol Chem 2001;276:11922–32.

46. Novak U, Stylli SS, Kaye AH, et al. Hyaluronidase-2 overexpressionaccelerates intracerebral but not subcutaneous tumor formation ofmurine astrocytoma cells. Cancer Res 1999;59:6246–50.

424 PATEL ET AL.