Upload
danganh
View
216
Download
0
Embed Size (px)
Citation preview
Malaria immunoepidemiology in low transmission: Correlation of infecting 1
genotype and immune response to domains of Plasmodium falciparum Merozoite 2
Surface Protein-3 3
4
Running title: Anti-PfMSP3 antibody responses in the Peruvian Amazon. 5
6
Stephen J. Jordan1,2, Ana L. Oliveira1, Jean N. Hernandez3, Robert A. Oster4, Debasish 7
Chattopadhyay1, OraLee H. Branch5, Julian C. Rayner*1,6 8
9
1William C Gorgas Center for Geographic Medicine, Division of Infectious Diseases, 10
Department of Medicine, University of Alabama at Birmingham, 845 19th Street South, 11
BBRB 568, Birmingham, AL 35294-2170, USA 12
2Department of Cell Biology, University of Alabama at Birmingham, Birmingham, AL 13
35294, USA 14
3Laboratorio de Investigaciones de Productos Naturales y Antiparasitarios, Universidad 15
Nacional de la Amazonia Peruana, Iquitos, Peru 16
4Division of Preventive Medicine, Department of Medicine, University of Alabama at 17
Birmingham, Birmingham, AL 35294, USA 18
5Department of Medical Parasitology, New York University, 341 East 25th Street, Old 19
Public Health Building Rm 210, 606, New York, NY 10010-2533, USA 20
6 Current address: Malaria Programme, Wellcome Trust Sanger Institute, Wellcome 21
Trust Genome Campus, Hinxton, Cambridge CB10 1SA, UK. 22
23
Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Infect. Immun. doi:10.1128/IAI.01332-10 IAI Accepts, published online ahead of print on 7 March 2011
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Corresponding Author Contact Information 24
Dr. Julian Rayner, Malaria Programme, Wellcome Trust Sanger Institute, Wellcome 25
Trust Genome Campus, Hinxton, Cambridge CB10 1SA, United Kingdom 26
([email protected], +44 1223 492327 (phone), +44 1223 494919 (fax)) 27
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
ABSTRACT 28
Malaria caused by Plasmodium falciparum is a major cause of global infant mortality, 29
and no effective vaccine currently exists. Multiple potential vaccine targets have been 30
identified and immunoepidemiology studies have played a major part in assessing those 31
candidates. When such studies are carried out in high transmission settings, individuals 32
are often super-infected with complex mixtures of genetically distinct P. falciparum 33
types, making it impossible to directly correlate the genotype of the infecting antigen 34
with the antibody response. By contrast in regions of low transmission P. falciparum 35
infections are often genetically simple, and direct comparison of infecting genotype and 36
antigen-specific immune responses is possible. As a test of the utility of this approach, 37
responses against several domains and allelic variants of the vaccine candidate P. 38
falciparum Merozoite Surface Protein 3 (PfMSP3) were tested in serum samples 39
collected near Iquitos, Peru. Antibodies recognizing both the conserved C-terminal and 40
the more variable N-terminal domain were identified, but anti-N-terminal responses 41
were more prevalent, of higher titers, and primarily of cytophilic subclasses. Comparing 42
antibody responses to different PfMSP3 variants with the PfMSP3 genotype present at 43
the time of infection showed that anti-N-terminal responses were largely allele class-44
specific, but there was some evidence for responses that cross-reacted across allele 45
classes. Evidence for cross-reactive responses was much stronger when variants within 46
one allele class were tested, which has implications for the rational development of 47
genotype-transcending PfMSP3-based vaccines.48
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
INTRODUCTION 49
The effort to develop a vaccine targeting blood stage Plasmodium falciparum 50
parasites, which are responsible for virtually all malaria-related deaths world-wide, has 51
been notably impacted by two recent Phase IIb trials which did not result in detectable 52
protection (21, 27). While disappointing, these results have had the beneficial impact of 53
triggering extensive discussion of how vaccine candidates are selected and what data is 54
necessary to rationally advance them along the vaccine development pipeline (3, 7, 10). 55
These analyses clearly identify genetic diversity as one of the most significant problems 56
in P. falciparum vaccine development. Blood stage vaccine candidates are of particular 57
concern on this score, as they are exposed to the adaptive immune system, a strong 58
selective pressure which can drive genetic diversity (36). Indeed, many blood stage 59
antigens appear to be under balancing selective pressure, suggesting immune 60
responses to them are largely allele specific, and that multiple allelic variants co-61
circulate within a given parasite population (18, 38). 62
Immunoepidemiology studies have been an extremely useful tool in the malaria 63
vaccine development process. However, as the vaccine development process moves 64
forward, there is an urgent need for these studies to tackle the question of genetic 65
diversity and allele-specific immune responses head on. Allele-specific responses are 66
frequently detected using antibody depletion experiments, where antibodies that 67
recognize one antigen are depleted from a serum sample by multiple incubations with 68
that antigen before the presence of antibodies that recognize a different antigen variant 69
are measured. Such studies have been extremely successful, with important 70
implications for vaccine candidates such as AMA1 (23, 24), MSP1 (14, 34) and MSP3 71
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
(4, 22, 25). However, they are not always possible in all studies because of sample 72
volume limitations, particularly when multiple different variants of each antigen are used 73
in separate competition experiments on the same serum sample. 74
An alternative and simple method to detect allele-specific immune responses 75
would be to directly compare the immune response to multiple antigen genotypes with 76
the antigen genotype present in the P. falciparum infection from which the sample has 77
been taken. If an individual serum sample contained antibodies that only recognized the 78
infecting allele type, this would be a strong argument for allele-specificity. Such an 79
approach is clearly difficult in hyperendemic transmission environments, where 80
individuals are routinely infected with multiple overlapping P. falciparum genotypes. By 81
contrast, in hypoendemic environments, where P. falciparum infections are genetically 82
simple and often spaced by several months, the response against both the infecting and 83
non-infecting genotype could be reasonably compared, and a direct correlation between 84
genetic variation and the immune response inferred. In the context of a longitudinal 85
study, where the infection history of each individual is known for an extended period of 86
time, and hence the length of time since they had been exposed to other allelic types is 87
established, that comparison would be even more powerful. 88
To test the validity of this approach we used samples from a longitudinal 89
epidemiological cohort near Iquitos, Peru (1), and investigated responses against P. 90
falciparum Merozoite Surface Protein 3 (PfMSP3). PfMSP3 is encoded by one member 91
of a multi-gene family (30), is expressed on the surface of merozoites (16, 19), and 92
consists of two major domains, a polymorphic N-terminal domain and a relatively 93
conserved C-terminal domain (11, 15). Genetic diversity within the N-terminal domain 94
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
consists of sequence polymorphisms and multiple indel mutations, which define two 95
allele-classes termed 3D7 and K1(6, 11). Antibodies targeting PfMSP3 are associated 96
with long-term clinical protection, and full-length PfMSP3 provides strong protection 97
against homologous challenge in an Aotus monkey model (8, 26). To date, PfMSP3 98
vaccine efforts have so far focused almost exclusively on the C-terminal domain, both 99
because it is highly conserved and because specific sub-regions of the C-terminal 100
domain can generate protective immune responses in vitro (5, 13, 17, 29, 32). However 101
anti-PfMSP3 N-terminal domain antibodies are also able to elicit protective responses 102
(29). 103
As a proof of concept study to test the approach of using sera from genotyped 104
infections in a hypoendemic environment to identify allele-specific immune responses, 105
we tested anti-PfMSP3 antibody responses in samples that had previously been 106
genotyped for their infecting PfMSP3 allele. Responses against both variants of the 107
PfMSP3 N-terminal domain in circulation at the study site were tested, as well as the 108
more conserved C-terminal domain and two other N-terminal variants not found at the 109
study site. The magnitude and isotype distribution of each response was measured, and 110
correlations between responses to the infecting and non-infecting antigens compared. 111
The results confirm that the majority of anti-PfMSP3 responses are against the N-112
terminus, rather than the C-terminal domain targeted by current vaccines. These 113
responses were largely allele-specific, as others have shown in hyperendemic samples 114
(22, 25), and this validates the approach of using genotyped samples from 115
hypoendemic transmission environments as an approach to identify allele-specific 116
responses. The comparison of responses across multiple N-terminal variants, which has 117
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
not previously been reported, provided no evidence for allele-specificity within one allele 118
class, which has important implications for the development of any PfMSP3-based 119
vaccine that includes the highly immunogenic N-terminal domain. 120
121
Materials and Methods 122
Study Site, Subjects, and Sample Collection. A detailed description of the 123
MIGIA cohort study has been previously described (1). Briefly, the study involves the 124
residents of the Zungarococha community, a cluster of 4 villages located south of 125
Iquitos in the Peruvian Amazon. The village residents have homogenous housing 126
construction, income levels, and access to healthcare, provided by the MIGIA cohort 127
physicians at a community health post. Travel outside the community is rare, with the 128
most frequent travel being to the city of Iquitos, where malaria transmission is 129
nonexistent. The Zungarococha community was chosen as the focus of the MIGIA 130
cohort because of the presence of continuing stable hypo-endemic transmission of both 131
P. vivax and P. falciparum, with frequency of infection rates for P. falciparum being < 0.5 132
infections/person/year. 133
Cases of P. falciparum were detected by both active and passive means. Active 134
cases involved symptomatic individuals presenting at a local health post located in 135
Zungarococha village, where they were tested for malaria parasites by Geimsa-stained 136
microscopy and underwent a comprehensive medical evaluation. PCR verification of the 137
microscopy result was subsequently performed using species-specific primers. Active 138
case detection involved random sampling of villagers over the course of the malaria 139
transmission season. All confirmed cases of Plasmodium infection were treated with 140
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
appropriate anti-malarial medication. Blood samples from confirmed P. falciparum 141
infections were separated into a serum and packed RBC fraction by centrifugation and 142
each was cataloged and stored at -80°C until needed. 143
Antigen Construction and Purification. Domain-specific PfMSP3 recombinant 144
proteins were amplified from HB3 (HB3 N-terminal domain, C-terminal domain), Dd2 145
(K1 N-terminal domain), or 3D7 (3D7 and Nig80 N-terminal domains) genomic DNA. 146
The forward and reverse primers used were 5’-147
CCGGCTCGAGGATTTTAGTGGTGGAGAATTTTCGTGGCC-3’ and 5’-148
CGGGATCCTTATTCCCAACCTAAAATATAATC-3’, 5’-149
CCGGCTCGAGTCTATGGAATTCGGAGGTTTTAC-3’ and 5’-150
CGGGATCCTTATTCCCAACCTAAAATATAATC-3’, and 5’-151
CCGGCTCGAGGATTATATTTTAGGTTGGGAATTTGGAGG-3’ and 5’-152
CGGGATCCTTAATGATTTTTAAAATATTTGGATAATTC-3’ for the HB3 and 3D7 N-153
terminal domains, K1 N-terminal domain, and Conserved domain, respectively. The 154
Nig80 N-terminal fragment was created using PCR overlap extension (9) with 5’-155
ATGCGGATCCGATTTTAGTGGTGGAGAATTTTTGTGGCCTGG-3’ 156
and 5’- 157
CTGCTTCTTTAGCAGCTTCTTCTGCCTCTTTAGAAGCATTTTCAGCATCTTCGGAAG158
C -3’ primers for the 5’ fragment, 5’-159
GCTGCTAATGATGCTGAAAATGCTTCAAAAGAGGC-3’ and 5’-160
AATTCTGCAGTTATTCCCAACCTAAAATATAATC-3’ 161
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
for the 3’ fragment, and 5’-162
ATGCGGATCCGATTTTAGTGGTGGAGAATTTTTGTGGCCTGG-3’ and 5’-163
AATTCTGCAGTTATTCCCAACCTAAAATATAATC-3’ 164
for the splicing reaction. Antigens were expressed as hexa-his tagged fusion proteins 165
from pET15b (Novagen) or pRSETA (Invitrogen) vectors in the E. coli BL21(DE3)pLysS 166
“Rosetta” strain (Novagen), and purified using affinity and anion exchange 167
chromatography, as previously described (2). 168
Circular Dichroism. To confirm correct folding of each recombinant antigen, 169
circular Dichroism (CD) spectra were obtained on an Aviv model 400 CD spectrometer 170
(Lakewood, NJ). Data were collected from 260 nm to 185 nm in 0.5 nm increments with 171
a 10 sec averaging time per point. Spectra were baseline corrected and smoothed, and 172
converted to mean residue ellipticity for plotting and analysis. Secondary structural 173
calculations were performed with PROSEC. 174
ELISA Assays and Competition Assays. 50ng of purified PfMSP3 antigen was 175
coated to each well and a 1:100 dilution of patient sera was used for each assay. Bound 176
antibodies were detected by the addition of HRP-conjugated anti-IgG (Chemicon) at a 177
dilution of 1:5,000, or HRP-conjugated IgG-isotype-specific (Southern Biotech) and IgM-178
specific (Fisher Scientific) secondary antibodies at a dilution of 1:1000. ChromoPure 179
human IgG (Jackson ImmunoResearch Laboratories) was used to standardize total IgG 180
antibody responses. IgG isotype antibody responses are presented as optical density of 181
1:100 sera dilution due the unavailability of isotype-specific standards. All plates were 182
read at 450nm using a Uniread 800 ELISA plate reader (GeneMate, Kaysville, UT). 183
Serially-diluted positive pools were run concurrently with each set of ELISAs to ensure 184
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
all OD450 measurements remained within the linear range and to facilitate ELISA 185
normalization. Responses were scored as ELISA-positive if they were three standard 186
deviations above the mean of a negative control pool of serum obtained from Peruvian 187
residents in Iquitos who have never been infected with P. falciparum. Serum samples 188
from 11 individuals were used in a pool for all negative controls. Negative cut-off values 189
for HB3 N-terminus, K1 N-terminus, and C-terminus antigens were 0.888 µg/ml, 1.026 190
µg/ml, and 0.979 µg/ml , respectively. Competition assays were performed as 191
previously described (22). Titrating K1 or HB3 N-terminus antigens were added at 1ng, 192
100ng, or 1000ng concentrations to compete for anti-HB3 or anti-K1 antibody binding, 193
respectively. As a control, homologous antigen was used to out-compete antibody 194
binding to the ELISA plate. 195
Statistical Analysis. Comparisons between proportions of ELISA antigens and 196
allele infections were performed using the two-group chi-square test or Fisher’s exact 197
test when the assumptions of the chi-square were not tenable. Comparisons between 198
mean IgG levels for ELISA antigens, separately for allele infections (Fig. 3,4,5) were 199
performed using the Kruskal-Wallis test since IgG levels and antibody responses were 200
determined to not be normally distributed. When a statistically significant overall result 201
was obtained, the Dunn multiple comparisons procedure was used to determine which 202
specific pairs of means were significantly different. Spearman correlation analyses 203
were performed to examine the relationships between IgG levels of the ELISA antigens 204
(Fig. 5C, 5D, and Fig. 6A). All statistical tests were two-sided and were performed using 205
a 5% significance level (i.e. alpha = 0.05). SAS software (version 9.1.3; SAS Institute, 206
Inc., Cary, NC) was used to perform all statistical analyses. 207
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Ethics committee approval. This study was approved by review boards of the 208
University of Alabama at Birmingham, New York University, Universidad Peruana 209
Cayetano Heredia, and the Peruvian Ministerio de Salud, Instituto Naccional de Salud. 210
Written consent was obtained from all participants prior to study enrollment. 211
212
Results 213
Production of PfMSP3 domain antigens. Our previous genotyping study 214
established that both PfMSP3 allele classes, 3D7-like and K1-like, were in circulation at 215
the MIGIA study site, and were identical in sequence to the previously published HB3 216
and K1 sequences, respectively (12). Three recombinant antigens were generated to 217
represent the PfMSP3 domains in circulation at the study site; two N-terminal domain 218
antigens, HB3 and K1, and one C-terminal domain antigen corresponding to the C-219
terminal sequence shared by both alleles (Fig. 1A). Purification of these antigens 220
yielded milligram quantities of >95% pure protein (Fig. 1B), and far-UV circular 221
dichroism (CD) spectroscopy readings (Fig. 1C) were consistent with previous 222
biophysical studies (2), indicating that all three antigens have native secondary 223
structures. 224
Comparison of antibody responses to infecting and non-infecting antigens. 225
The three antigens were used to detect anti-PfMSP3 responses in time-of-infection sera 226
samples from 369 distinct P. falciparum infections collected between 2003 and 2006, all 227
of which had previously been genotyped for the infecting PfMSP3 allele (12). More than 228
90% of P. falciparum of infections at this study site are of the PfMSP3 3D7-like alleles 229
class, so samples were selected to reflect these observed allele frequencies; 335 from 230
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
HB3 infections and 34 from K1 infections. No samples were from individuals co-infected 231
with more than one allele, which happens in less than 0.5% of infections because of the 232
low transmission rates (12). Sera samples were tested against all three antigens, and 233
ELISA results were normalized and converted into absolute concentration of anti-234
PfMSP3 IgG. 235
Approximately 90% of individuals had positive responses against the HB3 N-236
terminal antigen, compared to 75-85% that had positive responses against the C-237
terminal antigens (Fig 2A). When responses were compared to the infecting PfMSP3 238
genotype there was evidence of a skew towards a response to the infecting allele: a 239
significantly higher percentage of HB3-infected individuals had positive responses 240
against the HB3 N-terminal domain than either the K1 N-terminal domain or the C-241
terminal domain (Fig. 2A, p < 0.0001), and there was a significant increase in anti-K1 242
responses in K1-infected individuals relative to HB3-infected individuals (p = 0.016). 243
Interestingly, although anti-N-terminal domain responses were skewed towards the 244
infecting genotype, many individuals responded to both the infecting and non-infecting 245
genotype; 57% of HB3-infected individuals generated positive responses against the 246
non-infecting K1 N-terminal domain. When considering the distribution of antibody 247
responses, more than twice as many HB3-infected individuals had anti-HB3 N-terminal 248
domain antibody levels greater than 10µg/ml compared to C-terminal domain antibody 249
responses, and more than three times as many had anti-HB3 antibody levels above 250
20µg/ml (p < 0.0001) (Fig. 2B). We did not detect a significant difference comparing N-251
terminal and C-terminal responses in K1-infected individuals, which is likely due to the 252
small sample size of K1-infected individuals (Fig. 2C). 253
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Anti-PfMSP3 responses are primarily anti-N-terminal domain allele specific 254
responses. Direct comparison of the antibody response against each antigen [µg/ml] 255
within each infecting allele class was then performed to characterize the strength of 256
anti-PfMSP3 responses. In HB3 infected individuals, mean antibody levels reacting with 257
the HB3 N-terminal domain were 2.2-fold higher than mean antibody levels that reacted 258
with the C-terminal domain (p < 0.05), and also 3.1-fold higher than mean antibody 259
levels that reacted with the K1 N-terminal domain (Fig. 3A). In K1-infected individuals, 260
there was no significant difference in antibody levels to the K1 N-terminal domain and 261
C-terminal domain antibodies, but mean levels recognizing the K1 N-terminal domain 262
were 2.8-fold higher than levels recognizing the HB3 N-terminal domain (this difference 263
did not reach statistical significance, presumably because of the low numbers of K1-264
infected individuals) (Fig. 3B). The N-terminal domain therefore appears to be the 265
immunodominant PfMSP3 domain in this study site, and is largely targeted by allele-266
specific antibodies, in keeping with previous results from The Gambia (22, 25). 267
Anti-PfMSP3 N-terminal domain antibodies are primarily cytophilic 268
subclasses. Because cytophilic IgG subclasses, IgG1 and IgG3, have been 269
previously associated with protection against malaria (20, 33, 37), each antiserum 270
sample that scored as positive by total IgG ELISA was tested for isotype class 271
distribution using isotype-specific secondary antibodies and presented as optical density 272
at 1:100 dilution, because a lack of isotype-specific standards for normalization 273
precluded conversion to absolute isotype-specific antibody levels. Because of sample 274
volumes, isotype distribution was established only for the antigens present in the 275
infection, namely the infecting N-terminal domain and the conserved C-terminal domain. 276
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
34 serum samples that were typed for antigen specificity (Fig 3) had insufficient volume 277
remaining to carry out isotype experiments, leaving 304 samples from HB3-infected 278
individuals and 21 samples from K1-infected individuals to be typed. Anti-N-terminal 279
domain antibodies were primarily of the IgG1 and IgG3 cytophilic subclasses; in HB3-280
infected individuals mean anti-HB3 N-terminal domain IgG3 levels were higher than 281
mean IgG1 levels (p < 0.05) whereas in K1-infected individuals, mean IgG1 and IgG3 282
responses against the K1 N-terminal domain were identical (Fig 4). By contrast, 283
antibodies recognizing the C-terminal domain were significantly enriched for IgM 284
responses regardless of the infecting allele (p < 0.05). 285
Anti PfMSP3 N-terminal domain responses across variants within the 3D7 286
allele class. Although this data and others have shown that anti-N-terminal domain 287
responses are primarily allele-specific, no previous study has tested reactivity across 288
variants within a given allele class. To test for allele-specificity across such variants, N-289
terminal domain antigens for two other naturally occurring 3D7-class alleles were 290
generated. One antigen was identical to the 3D7 allele, which differs from the HB3 291
sequence used in the initial studies at only a single non-synonymous single nucleotide 292
polymorphism (SNP). This SNP is the most prevalent polymorphism in the 3D7-class 293
alleles globally(6) and has been detected at the MIGIA study site, being found in 10/630 294
previously genotyped 3D7-class alleles (12). None of these infections were included in 295
this study, but, although unlikely, it is possible that some individuals in this study had 296
previously been infected with this allele. As a more extreme difference, a previously 297
published 3D7-class PfMSP3 sequence from Nigeria (Nig80) was chosen, which 298
possesses a heptad indel mutation in addition to the 3D7 SNP (25). No similar Nig80 299
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
sequence has been reported across more than 600 infections at this study site, or 300
elsewhere in South America, making it is extremely unlikely that any of the individuals at 301
the MIGIA study site have been previously exposed to this allele. 302
242 antiserum samples from HB3-infected individuals with sufficient serum 303
volume remaining were used to test responses to both the 3D7 and Nig80 N-terminal 304
antigens. 71% of individuals had positive responses to the 3D7 antigen, and 61% to the 305
Nig80 antigen, compared to 75% to the HB3 antigen (Fig 5A). There was no significant 306
difference in mean IgG levels between 3D7 and HB3, but a 0.3-fold reduction in 307
responses against the Nig80 antigen (p=0.001) (Fig 5B). To compare responses at an 308
individual, rather than population level, the response to either the 3D7 or Nig80 antigen 309
was compared with the response to the HB3 antigen in the same individual. Responses 310
to the HB3 antigen correlated strongly with responses to both the 3D7 (Fig. 5C; 311
Spearman’s r = 0.8985, p < 0.0001) and Nig80 antigens (Fig. 5D; Spearman’s r = 312
0.8685, p < 0.0001) antigens. There is therefore little evidence of allele-specific 313
responses between these three variants of the 3D7-allele class. 314
Anti PfMSP3 N-terminal domain responses across allele classes. Although 315
responses against the PfMSP3 N-terminal domain were primarily against the infecting 316
allele class, suggesting allele-specificity (Figs 2, 3), it was notable that detectable 317
responses against the K1 N-terminal domain antigen were present in 57% of HB3-318
infected individuals, suggesting that some anti-N-terminal domain responses are not 319
allele specific. To investigate this more closely, responses against the infecting and 320
non-infecting allele class were compared for each individual infection. The strength of 321
responses was clearly skewed toward the infecting N-terminal allele (Fig. 6A), but there 322
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
was a statistically significant positive correlation between the strength of response 323
against both the infecting and non-infecting N-terminal domains (Spearman’s r = 324
0.5645, p < 0.0001 for HB3-infected, Spearman’s r = 0.4780, p = 0.0043 for K1-325
infected). 326
To establish whether these represent true inter-allele cross-reactive responses, 327
competition ELISAs were performed on the few serum samples where sufficient volume 328
was present for such tests. Of the samples that had both strongly positive anti-HB3 and 329
anti-K1 responses (upper right quadrant of Fig 6A, above 10µg/ml for both antigens), 11 330
samples had sufficient volume of serum for the multiple rounds of depletion with 331
different concentrations of antigens needed for competition assays. Of these 11 332
samples, in 6 cases responses against one antigen could be competed by pre-333
incubating with the heterologous antigen, denoting clear cross-reactive responses (Fig. 334
6B, Left panel). In the other 5 cases responses were present to both antigens, but could 335
only be competed with the homologous antigen, suggesting the simultaneous presence 336
of allele-specific responses to both antigens (Fig. 6B, Right panel). Both correlation and 337
competition ELISA analyses therefore suggest that some antibody responses generated 338
by the PfMSP3 N-terminal domain can cross-react across allele classes. 339
340
Discussion 341
This manuscript investigated the antibody responses against a leading vaccine 342
candidate, P. falciparum Merozoite Surface Protein-3 (PfMSP3), in a hypoendemic 343
transmission environment, in order to test the approach of using genotyped samples 344
from such environments can be used to rapidly identify allele-specific and allele-345
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
transcending antibody responses. As seen in other studies, responses to PfMSP3 were 346
widespread, with approximately 90% of individuals responding positively against the 347
HB3 N-terminal antigen, and 75% responding to the C-terminal antigen. The PfMSP3 N-348
terminal domain was significantly more immunogenic than the C-terminal domain, 349
eliciting, in HB3 infected individuals, a 2.3-fold increase in mean IgG antibody levels and 350
a 3.6-fold increase in “high responder” individuals- those who exhibited IgG antibody 351
levels greater than 20µg/ml, compared to the C-terminal domain. These results are in 352
line with data from The Gambia, which demonstrated significantly higher N-terminal 353
domain antibody responses, especially in young children (22, 25). Additionally, anti-N-354
terminal domain antibodies were largely comprised of cytophilic IgG1 and IgG3 355
subclasses, which have previously been associated with protection against malaria (20, 356
33, 37). 357
The fact that the samples in this study had previously been genotyped for 358
infecting PfMSP3 allele type, and came from individuals who had on average not had a 359
previous P. falciparum infection for at least one year, allowed the extent of allele-360
specificity to be tested directly. When comparing responses within the 3D7-allele class, 361
there was little evidence for allele-specificity, with responses against two non-infecting 362
3D7-class allele mutants exhibiting strong pair-wise correlation with responses to the 363
infecting HB3 N-terminal domain (p < 0.0001). These antigens differed only at a handful 364
of amino acids, so presumably the majority of responses are recognizing epitopes that 365
are conserved across the variants, perhaps the residues responsible for stabilizing the 366
coiled-coil domains that are almost exclusively conserved within each allele class. The 367
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
existence of responses against such conserved regions is not necessarily surprising, 368
but is important and has not been previously shown. 369
Comparing responses across N-terminal domain allele classes confirms previous 370
findings that demonstrated anti-N-terminal domain immune responses are weighted 371
toward being allele-specific (22, 25), However this study also provides clear evidence 372
that some anti-N-terminal domain responses target epitopes shared across allele 373
classes. At a population level, 57% of HB3-infected individuals elicited positive 374
responses against the K1 N-terminal domain, and there was a significant positive 375
correlation between individual responses to the 3D7- and K1-class domains, although 376
not as strong as the correlation between responses to variants within the 3D7-allele 377
class. Competition ELISAs confirmed that at least some of these responses were truly 378
cross-reactive, as they could be competed away with both the HB3 and K1 N-terminal 379
domain antigens. In theory, these apparent cross-reactive responses could be 380
explained by recent infections with a K1 class allele that were undetected in the cohort 381
study. However using available frequency-of-infection and allele frequency data for this 382
study site, there is only a 0.84% probability of an undetected K1 infection occurring in 383
any one individual within the past 2 years, clearly not enough to explain 57% of HB3 384
infected individuals containing antiserum that can cross-react with K1 antigens. The 385
most parsimonious explanation of the data is therefore that infection with HB3 allele 386
PfMSP3 antigen generates a response against epitopes that are conserved across both 387
allele classes, although at the expense of significant immunogenicity. 388
The P. falciparum genome presents a large number of potential vaccine 389
candidates and it is therefore critical that go/no-go decisions based on solid evidence be 390
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
applied to limit the number of candidates entering expensive later stage vaccine trials 391
(3, 7, 10). The PfMSP3 N-terminal domain had previously been largely ignored from 392
consideration based on concerns about sequence diversity, and because the C-terminal 393
domain has been extensively studied in the context of antibody dependent cellular 394
immunity assays (ADCI), the mechanism by which PfMSP3 is thought to induce 395
protection in vivo (19, 29, 39). Long peptides based on the C-terminal domain can 396
induce potent antibody responses in vivo that are capable of killing P. falciparum 397
parasites, have good safety profiles in initial trials, and clearly warrant further 398
investigation as candidate antigens (5, 13, 17, 26, 31, 32). However, the PfMSP3 N-399
terminal domain is also capable of inducing ADCI-mediated killing in vitro (29), data 400
from both Peru (this paper) and The Gambia (25) suggests that the PfMSP3 N-terminal 401
domain is a more potent immunogen than the C-terminal domain in vivo, and in The 402
Gambia, responses against the N-terminal domain correlated with protection against 403
clinical malaria (25). The totality of this data suggests that the PfMSP3 N-terminal 404
domain could be reconsidered as a potential vaccine antigen, if the problems of genetic 405
diversity can be addressed. The findings reported here that anti-N-terminal domain 406
responses include responses to epitopes conserved within an allele class, and also to a 407
lesser extent to epitopes conserved across allele classes, raise the possibility that 408
regions of the N-terminal domain could be identified that may overcome this problem. 409
Mapping those conserved epitopes within the N-terminal domain, as well as testing for 410
functional cross-protection in in vitro assays, are therefore high priorities for further 411
research. 412
413
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
Acknowledgements 414
The authors wish to thank Patrick Sutton and Eva Clark for help with sample 415
processing and Mike Jablonsky for his help with the circular dichroism. We would like to 416
thank all residents in the Zungarococha community who participate so willingly in the 417
MIGIA cohort study. We thank all the staff of the MIGIA project, which is a strong 418
collaboration with the Universidad Nacional de la Amazonia Peruana. We thank all for 419
sample collection, clinic visits and management, and laboratory sample processing and 420
care. 421
422
Conflict of Interest 423
The authors declare no conflict of interest. 424
425
Financial Support 426
This work was supported by the National Institute of Health grants R21 AI072421 and 427
R01 AI064849, and the UAB Sparkman Center for Global Health. 428
429
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
References 430
1. Branch, O., W. M. Casapia, D. V. Gamboa, J. N. Hernandez, F. F. Alava, N. Roncal, 431
E. Alvarez, E. J. Perez, and E. Gotuzzo. 2005. Clustered local transmission and 432
asymptomatic Plasmodium falciparum and Plasmodium vivax malaria infections in a 433
recently emerged, hypoendemic Peruvian Amazon community. Malar J 4:27. 434
2. Burgess, B. R., P. Schuck, and D. N. Garboczi. 2005. Dissection of merozoite surface 435
protein 3, a representative of a family of Plasmodium falciparum surface proteins, 436
reveals an oligomeric and highly elongated molecule. J Biol Chem 280:37236-37245. 437
3. Coppel, R. L. 2009. Vaccinating with the genome: a Sisyphean task? Trends Parasitol 438
25:205-212. 439
4. Demanga, C. G., L. J. Daher, E. Prieur, C. Blanc, J. L. Perignon, H. Bouharoun-440
Tayoun, and P. Druilhe. 2010. Toward the rational design of a malaria vaccine 441
construct using the MSP3 family as an example: contribution of antigenicity studies in 442
humans. Infect Immun 78:486-494. 443
5. Druilhe, P., F. Spertini, D. Soesoe, G. Corradin, P. Mejia, S. Singh, R. Audran, A. 444
Bouzidi, C. Oeuvray, and C. Roussilhon. 2005. A malaria vaccine that elicits in 445
humans antibodies able to kill Plasmodium falciparum. PLoS Med 2:e344. 446
6. Escalante, A. A., A. A. Lal, and F. J. Ayala. 1998. Genetic polymorphism and natural 447
selection in the malaria parasite Plasmodium falciparum. Genetics 149:189-202. 448
7. Greenwood, B., and G. Targett. 2009. Do we still need a malaria vaccine? Parasite 449
Immunol 31:582-586. 450
8. Hisaeda, H., A. Saul, J. J. Reece, M. C. Kennedy, C. A. Long, L. H. Miller, and A. W. 451
Stowers. 2002. Merozoite surface protein 3 and protection against malaria in Aotus 452
nancymai monkeys. J Infect Dis 185:657-664. 453
9. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989. Site-directed 454
mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51-59. 455
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
10. Holder, A. A. 2009. Malaria vaccines: where next? PLoS Pathog 5:e1000638. 456
11. Huber, W., I. Felger, H. Matile, H. J. Lipps, S. Steiger, and H. P. Beck. 1997. Limited 457
sequence polymorphism in the Plasmodium falciparum merozoite surface protein 3. Mol 458
Biochem Parasitol 87:231-234. 459
12. Jordan, S. J., O. H. Branch, J. C. Castro, R. A. Oster, and J. C. Rayner. 2009. 460
Genetic diversity of the malaria vaccine candidate Plasmodium falciparum merozoite 461
surface protein-3 in a hypoendemic transmission environment. Am J Trop Med Hyg 462
80:479-486. 463
13. Lusingu, J. P., S. Gesase, S. Msham, F. Francis, M. Lemnge, M. Seth, S. 464
Sembuche, A. Rutta, D. Minja, M. D. Segeja, S. Bosomprah, S. Cousens, R. Noor, 465
R. Chilengi, and P. Druilhe. 2009. Satisfactory safety and immunogenicity of MSP3 466
malaria vaccine candidate in Tanzanian children aged 12-24 months. Malar J 8:163. 467
14. Mamillapalli, A., S. Sunil, S. S. Diwan, S. K. Sharma, P. K. Tyagi, T. Adak, H. Joshi, 468
and P. Malhotra. 2007. Polymorphism and epitope sharing between the alleles of 469
merozoite surface protein-1 of Plasmodium falciparum among Indian isolates. Malar J 470
6:95. 471
15. McColl, D. J., and R. F. Anders. 1997. Conservation of structural motifs and antigenic 472
diversity in the Plasmodium falciparum merozoite surface protein-3 (MSP-3). Mol 473
Biochem Parasitol 90:21-31. 474
16. McColl, D. J., A. Silva, M. Foley, J. F. Kun, J. M. Favaloro, J. K. Thompson, V. M. 475
Marshall, R. L. Coppel, D. J. Kemp, and R. F. Anders. 1994. Molecular variation in a 476
novel polymorphic antigen associated with Plasmodium falciparum merozoites. Mol 477
Biochem Parasitol 68:53-67. 478
17. Nebie, I., A. Diarra, A. Ouedraogo, A. B. Tiono, A. T. Konate, A. Gansane, I. 479
Soulama, S. Cousens, O. Leroy, and S. B. Sirima. 2009. Humoral and cell-mediated 480
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
immunity to MSP3 peptides in adults immunized with MSP3 in malaria endemic area, 481
Burkina Faso. Parasite Immunol 31:474-480. 482
18. Ochola, L. I., K. K. Tetteh, L. B. Stewart, V. Riitho, K. Marsh, and D. J. Conway. 483
2010. Allele frequency-based and polymorphism-versus-divergence indices of balancing 484
selection in a new filtered set of polymorphic genes in Plasmodium falciparum. Mol Biol 485
Evol 27:2344-2351. 486
19. Oeuvray, C., H. Bouharoun-Tayoun, H. Grass-Masse, J. P. Lepers, L. 487
Ralamboranto, A. Tartar, and P. Druilhe. 1994. A novel merozoite surface antigen of 488
Plasmodium falciparum (MSP-3) identified by cellular-antibody cooperative mechanism 489
antigenicity and biological activity of antibodies. Mem Inst Oswaldo Cruz 89 Suppl 2:77-490
80. 491
20. Oeuvray, C., M. Theisen, C. Rogier, J. F. Trape, S. Jepsen, and P. Druilhe. 2000. 492
Cytophilic immunoglobulin responses to Plasmodium falciparum glutamate-rich protein 493
are correlated with protection against clinical malaria in Dielmo, Senegal. Infect Immun 494
68:2617-2620. 495
21. Ogutu, B. R., O. J. Apollo, D. McKinney, W. Okoth, J. Siangla, F. Dubovsky, K. 496
Tucker, J. N. Waitumbi, C. Diggs, J. Wittes, E. Malkin, A. Leach, L. A. Soisson, J. B. 497
Milman, L. Otieno, C. A. Holland, M. Polhemus, S. A. Remich, C. F. Ockenhouse, J. 498
Cohen, W. R. Ballou, S. K. Martin, E. Angov, V. A. Stewart, J. A. Lyon, D. G. 499
Heppner, and M. R. Withers. 2009. Blood stage malaria vaccine eliciting high antigen-500
specific antibody concentrations confers no protection to young children in Western 501
Kenya. PLoS One 4:e4708. 502
22. Osier, F. H., S. D. Polley, T. Mwangi, B. Lowe, D. J. Conway, and K. Marsh. 2007. 503
Naturally acquired antibodies to polymorphic and conserved epitopes of Plasmodium 504
falciparum merozoite surface protein 3. Parasite Immunol 29:387-394. 505
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
23. Osier, F. H., G. D. Weedall, F. Verra, L. Murungi, K. K. Tetteh, P. Bull, B. W. Faber, 506
E. Remarque, A. Thomas, K. Marsh, and D. J. Conway. 2010. Allelic diversity and 507
naturally acquired allele-specific antibody responses to Plasmodium falciparum apical 508
membrane antigen 1 in Kenya. Infect Immun 78:4625-4633. 509
24. Polley, S. D., T. Mwangi, C. H. Kocken, A. W. Thomas, S. Dutta, D. E. Lanar, E. 510
Remarque, A. Ross, T. N. Williams, G. Mwambingu, B. Lowe, D. J. Conway, and K. 511
Marsh. 2004. Human antibodies to recombinant protein constructs of Plasmodium 512
falciparum Apical Membrane Antigen 1 (AMA1) and their associations with protection 513
from malaria. Vaccine 23:718-728. 514
25. Polley, S. D., K. K. Tetteh, J. M. Lloyd, O. J. Akpogheneta, B. M. Greenwood, K. A. 515
Bojang, and D. J. Conway. 2007. Plasmodium falciparum merozoite surface protein 3 516
is a target of allele-specific immunity and alleles are maintained by natural selection. J 517
Infect Dis 195:279-287. 518
26. Roussilhon, C., C. Oeuvray, C. Muller-Graf, A. Tall, C. Rogier, J. F. Trape, M. 519
Theisen, A. Balde, J. L. Perignon, and P. Druilhe. 2007. Long-term clinical protection 520
from falciparum malaria is strongly associated with IgG3 antibodies to merozoite surface 521
protein 3. PLoS Med 4:e320. 522
27. Sagara, I., A. Dicko, R. D. Ellis, M. P. Fay, S. I. Diawara, M. H. Assadou, M. S. 523
Sissoko, M. Kone, A. I. Diallo, R. Saye, M. A. Guindo, O. Kante, M. B. Niambele, K. 524
Miura, G. E. Mullen, M. Pierce, L. B. Martin, A. Dolo, D. A. Diallo, O. K. Doumbo, L. 525
H. Miller, and A. Saul. 2009. A randomized controlled phase 2 trial of the blood stage 526
AMA1-C1/Alhydrogel malaria vaccine in children in Mali. Vaccine 27:3090-3098. 527
28. Saul, A. 2007. Malaria vaccines based on the Plasmodium falciparum merozoite surface 528
protein 3--should we avoid amino acid sequence polymorphisms or embrace them? J 529
Infect Dis 195:171-173. 530
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
29. Singh, S., S. Soe, J. P. Mejia, C. Roussilhon, M. Theisen, G. Corradin, and P. 531
Druilhe. 2004. Identification of a conserved region of Plasmodium falciparum MSP3 532
targeted by biologically active antibodies to improve vaccine design. J Infect Dis 533
190:1010-1018. 534
30. Singh, S., S. Soe, S. Weisman, J. W. Barnwell, J. L. Perignon, and P. Druilhe. 2009. 535
A conserved multi-gene family induces cross-reactive antibodies effective in defense 536
against Plasmodium falciparum. PLoS One 4:e5410. 537
31. Sirima, S. B., I. Nebie, A. Ouedraogo, A. B. Tiono, A. T. Konate, A. Gansane, A. I. 538
Derme, A. Diarra, I. Soulama, N. Cuzzin-Ouattara, S. Cousens, and O. Leroy. 2007. 539
Safety and immunogenicity of the Plasmodium falciparum merozoite surface protein-3 540
long synthetic peptide (MSP3-LSP) malaria vaccine in healthy, semi-immune adult 541
males in Burkina Faso, West Africa. Vaccine 25:2723-2732. 542
32. Sirima, S. B., A. B. Tiono, A. Ouedraogo, A. Diarra, A. L. Ouedraogo, J. B. Yaro, E. 543
Ouedraogo, A. Gansane, E. C. Bougouma, A. T. Konate, Y. Kabore, A. Traore, C. 544
Roma, I. Soulama, A. J. Luty, S. Cousens, and I. Nebie. 2009. Safety and 545
immunogenicity of the malaria vaccine candidate MSP3 long synthetic peptide in 12-24 546
months-old Burkinabe children. PLoS One 4:e7549. 547
33. Stanisic, D. I., J. S. Richards, F. J. McCallum, P. Michon, C. L. King, S. Schoepflin, 548
P. R. Gilson, V. J. Murphy, R. F. Anders, I. Mueller, and J. G. Beeson. 2009. 549
Immunoglobulin G subclass-specific responses against Plasmodium falciparum 550
merozoite antigens are associated with control of parasitemia and protection from 551
symptomatic illness. Infect Immun 77:1165-1174. 552
34. Sutton, P. L., E. H. Clark, C. Silva, and O. H. Branch. 2010. The Plasmodium 553
falciparum merozoite surface protein-1 19 KD antibody response in the Peruvian 554
Amazon predominantly targets the non-allele specific, shared sites of this antigen. Malar 555
J 9:3. 556
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
35. Sutton, P. L., V. Neyra, J. N. Hernandez, and O. H. Branch. 2009. Plasmodium 557
falciparum and Plasmodium vivax infections in the Peruvian Amazon: propagation of 558
complex, multiple allele-type infections without super-infection. Am J Trop Med Hyg 559
81:950-960. 560
36. Takala, S. L., and C. V. Plowe. 2009. Genetic diversity and malaria vaccine design, 561
testing and efficacy: preventing and overcoming 'vaccine resistant malaria'. Parasite 562
Immunol 31:560-573. 563
37. Taylor, R. R., S. J. Allen, B. M. Greenwood, and E. M. Riley. 1998. IgG3 antibodies to 564
Plasmodium falciparum merozoite surface protein 2 (MSP2): increasing prevalence with 565
age and association with clinical immunity to malaria. Am J Trop Med Hyg 58:406-413. 566
38. Tetteh, K. K., L. B. Stewart, L. I. Ochola, A. Amambua-Ngwa, A. W. Thomas, K. 567
Marsh, G. D. Weedall, and D. J. Conway. 2009. Prospective identification of malaria 568
parasite genes under balancing selection. PLoS One 4:e5568. 569
39. Trucco, C., D. Fernandez-Reyes, S. Howell, W. H. Stafford, T. J. Scott-Finnigan, M. 570
Grainger, S. A. Ogun, W. R. Taylor, and A. A. Holder. 2001. The merozoite surface 571
protein 6 gene codes for a 36 kDa protein associated with the Plasmodium falciparum 572
merozoite surface protein-1 complex. Mol Biochem Parasitol 112:91-101. 573
574
575
576
577
578
579
580
581
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
582
583
Figure Legends 584
585
Figure 1. Purity and folding of PfMSP3 domain antigens. (A) Three PfMSP3 586
constructs were generated to test antibody responses by ELISA: HB3 and K1 allele N-587
terminal domains and the conserved C-terminal domain. The N-terminal domains began 588
at the proteolytic cleavage site and included all 3 heptad repeats. The C-terminal 589
domain began just C-terminal to the last heptad repeat. (B) Coomassie-blue stained 590
SDS-PAGE demonstrates PfMSP3 construct antigens are > 95% pure as measured by 591
scanning densitometry. (C) Circular dichroism spectroscopy reveals signature peaks at 592
215nm and 190nm indicative of constructs being comprised largely of alpha-helical 593
structures, consistent with published data for full-length PfMSP3. 594
595
Figure 2. Distribution of anti-PfMSP3 responses in HB3- and K1-infected 596
individuals (A) Percent positive responses, by infected allele, either HB3 (N = 335) or 597
K1 (N = 34) for each PfMSP3 domain antigen. Responses were scored positive if they 598
were three standard deviations above the mean of a negative control pool of serum 599
from individuals who had never been infected with P. falciparum. Negative cut-off values 600
for each antigen are listed in Materials and Methods. The double and triple asterisks 601
denote p=0.016 and p < 0.0001, respectively. (B,C) Number of individuals who exhibit 602
given IgG antibody levels [µg/ml] against each PfMSP3 domain antigen in HB3- (B) and 603
K1-infected (C) individuals. Neg shows number of samples below the negative cut-off 604
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
values, which are listed in Materials and Methods. Neg-4 are samples up to 4µg/ml 605
higher than the negative cut-off, 5-9 are samples from 5-9µg/ml above the negative cut-606
off, and so on. 607
608
Figure 3. Anti-PfMSP3 responses are primarily anti-N-terminal domain allele 609
specific responses. IgG antibody levels [µg/ml] against each PfMSP3 domain antigen 610
in HB3-infected (Fig. 3A, N = 335) and K1-infected (Fig. 3B, N = 34) individuals. 611
Whiskers represent upper and lower quartiles, and mean values are indicated by the 612
hashed line. 613
614
Figure 4. Responses against the PfMSP3 N-terminal domain are largely of 615
cytophilic subclasses. PfMSP3 isotype antibody levels (OD450 1:100 sera dilution) for 616
IgG1-4 and IgM responses against N-terminal and C-terminal domains. Only 617
homologous N-terminal domain responses were assessed. The whiskers denote the 618
upper and lower quartiles. The mean is denoted by the hashed line. 619
620
Figure 5. Anti PfMSP3 N-terminal domain responses across variants within the 621
3D7 allele class. (A) Percent positive responses of ELISA positive HB3-infected 622
individuals (N = 242) against 3D7-class mutants 3D7 and Nig80. (B) IgG antibody 623
levels [µg/ml] against 3D7-class mutants. The whiskers denote the upper and lower 624
quartiles. The mean is denoted by the hashed line. (C,D) Pair-wise correlation between 625
anti-HB3 responses and either anti-3D7 (C) or anti-Nig80 (D) antibody responses; the 626
black line indicates a best-fit exponential line. 627
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from
628
Figure 6. Anti PfMSP3 N-terminal domain responses across allele-classes 629
(A) Pair-wise correlation between anti-HB3 and anti-K1 antibody responses separated 630
on the basis of their infecting PfMSP3 allele; the black line indicates a best-fit 631
exponential line. N = 369 (B) Competition ELISAs were performed using titrating 632
amounts of competing antigen (0-1000ng) to assess cross-reaction; some samples 633
showed evidence of cross-reactivity (left panel), while others showed only allele-specific 634
responses (right panel). 635
636
on October 29, 2018 by guest
http://iai.asm.org/
Dow
nloaded from