NNV 1994 90%
NNV





1.4 kb 1 kb IgM
NNV


II
Abstract
Nervous necrosis virus (NNV) is one of the most serious fish pathogens, which infects sea
water fish fry, causing mortality as high as 90%. The first case of NNV-infection was reported in
Japan in 1990, currently there is no effective method to prevent this virus infection. In Taiwan,
the first case of NNV infection was reported from grouper fishery in 1994, which caused 90%
mortality of fish fry. Therefore, the purpose of this study is to elucidate the pathogenesis
mechanism of NNV and develop an effective method for preventing and control NNV viral
infection.
Immune gene therapy is one of the safety and efficient biotechnological methods to prevent
virus infection. Earlier, only mouse monoclonal was developed, however, that caused immune
system responses in human body. In 1984, humanized antibodies have been developed by
combining the antigen binding site of mouse antibody with the Fc portion of human antibody
through recombinant DNA technology. These chimeric humanized antibodies have no side
effects and eliminate the possible toxicity. Moreover, the immune-related cells would be
activated to strengthen the human immune system that ultimately results in significant specific
protection against infections. In this study try to apply the idea and technology of humanzied
antibody to grouper fish study. Genetic engineering methods we applied to create a fishnized
antibody, by combining the antigen binding site of mouse monoclonal antibody and the Fc
portion of the fish IgM.
In this study, we success in fishnized antibody construction, the total length is 2.4 kb which
combined with the 1.4 kb antigen binding site of mouse monoclonal antibody and 1 kb of the Fc
portion of the fish IgM. This plan purpose hopes to draft the setting-up of fishnized antibody
technology, to develop a method or vaccine to prevent NNV infection and to study the
regulational mechanisms of fish's immune system. Three of mouse hybridoma, fishnized
antibody and single-chain Fv antibody. Finally to develop a novel fish disease prevention and
therapeutical methods. Finally, we hope to develop a simple, innovative, perfect, and effective
prevention approaches for disease prevention and further research.
III

..........................................................................................................................................I
pET 20b-chimeric heavy chain ................................................................. 27
pET 23a-HB56 light chain ........................................................................ 27
pSecTaq2A-chimeric heavy chain ............................................................ 28
pSecTaq2B-HB56 light chain ................................................................... 28
IV
...............................................................................................................................30
pET 20b-grouper IgM CH2-CH4 ligation plasmid...........................................35
pET 20b-grouper IgM CH2-CH4 plasmidpET 20b-heavy chain of HB56 Fab-
grouper IgM CH2-CH4 ligation plasmid ..........................................................................................36
pET 20b-heavy chain of HB56 Fab-grouper IgM CH2-CH4 ligation
plasmid ..........................................................................................................................................37
pET 23a-HB56 light chain ligation plasmid..................................................39
pSecTaq2ApSecTaq2A-chimeric heavy chain ligation plasmid-1 ................................40
pSecTaq2ApSecTaq2A-chimeric heavy chain ligation plasmid-2 ................................41
pSecTaq2A-chimeric heavy chain ligation plasmid......................................42
pSecTaq2BpSecTaq2B-HB56 light chain ligation plasmid.......................................43
pSecTaq2B-HB56 light chain ligation plasmid.........................................44
pEGFP-N1 pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid-1 ...............45
pEGFP-N1 pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid-2 ...............46
pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid .....................47
pEGFP-N1-pSecTaq2B-HB56 light chain plasmidp-N1-pSecTaq2B-
HB56 light chain-pSecTaq2A-chimeric heavy chain ligation plasmid .........................................48
p-N1-pSecTaq2B-HB56 light chain-pSecTaq2A- chimeric
heavy chain ligation plasmid ........................................................................................................49
(antibody producing cell B) ()
(polypeptide) (heavy chainH chain)
(light chainL chain) (disulfide bond) (non-covalent
bond) Y
110 (variable region)
VH (heavy chain variable region) VL (light chain variable region)
(hypervarible region)
(complementarity determining region, CDR) CDR1CDR2 CDR3
CDR3
(constant region) CH CL
(C-terminal) (γαμδ
ε isotype) IgAIgDIgE
IgG IgM
( κ λ isotype)
(antigen-binding site, paratope) (epitope)

CH1CH2 (hinge) (Edelman, 1973)
(VL + CLVH + CH) Fc (CH2
CH3)
2
Fc Fc
(binding affinity)
Fc (membrane attack complex)

125I-labeled
Fv Fab'F(ab')2 IgG ( TAG-72 human pancarcinoma antigen
CC49) TAG-72
Fv TAG-72 (Colcher, 1990; Yokota, 1992)

FvFv
(papain) Fab
(fragment of antigen binding) (VL +CL) (VH +CH1)
phage surface display expression system B
(HBsAg) Fab Fab B
disulfide-stabilized Fv fragment (Jia, 2008) Fab

(cross

4
cDNA cDNA
female Lewis rats
cDNA Ig-like motif fragment
cDNA

2006)
(high affinity)
(sensitivity)
1975 (hybridoma)



Fc Fc
T101 cutaneous T cell lymphoma (CTCL) chronic
lymphocytic leukemia (CLL) human anti-mouse immunoglobulin (mIgG)
(Sears, 1984;

131I
(anticarcinoembryonic antigen) B-cell

1991; Colcher, 1999) (Jain, 1987)

90%
6
1984; Reynolds, 1989; Shawler, 1985; Jaffers, 1986)


Fab Fab Fc Fab

plasma apo B-100Fab′ (Kwak, 1996) Fab
cFab (chimeric Fab) cFab 50
ka IgG
(CH1CL) cFab
SZ-63
(murine antifibrin monoclonal antibody)
chimeric SZ-63 murine/human Fab fragment
chimeric SZ-63 murine/human Fab fragment SZ-63 fibrin
(Quinn, 2003; Lai, 2000; Xia, 1996)cFab Fc
cFab
(Better, 1993)
Fv Fv
Fv (dissociation) (Riechmann, 1988;
Glockshuber, 1990)Fv
(cysteines)
(Glockshuber, 1990)
(Gly4Ser)3 (Huston, 1988) Fv () (Bird, 1988;
Huston, 1988)
(assemble) (Tavladoraki, 1993Benvenuto,
1995)
Fv (Marasco,1997;
Rondon, 1997) Rev 1994 1997 Rev
Fv Fv Rev
Rev (Duan,
1995; Duan, 1994; Duan, 1994; Ho, 1998; Inouye,1997; Junker, 1998; Wu, 1996)
p17 1988
cDNA Fv FvT
T T
(Tewari, 1998)1993
1998 CD4

(Chen, 1996; Chen, 1994; Chen, 1994; Marasco, 1993; Zhou, 1998)
Fv
Fv Fv
8




bispecific scFv dimer (bisFv) anti-neuraminidase
(NC10) VH anti-glycophorin (1C3) VL bisFv
(Atwell, 1996)

(Newman, 1992) (Carr, 1998; Lynn, 2004)
Fab
Fc

(Covell, 1986; King, 1994; Kaku, 1996) Fc
9
TfR
Fc
(Qing, 2005)
VH IgG1 IgG2 ) (
Vκ κ )
(H2L2) (Sherie, 1984)
phosphocholine


2004 IgG1 1A5 Fab 1A5

2004) IgG1 1A5
N901 (anti-CD56) anti-B4 (anti-CD19)


1994)
anti-Her2/neu (Trastuzumab/Herceptin) anti-CD33
(Gemtuzumab/Mylotarg) (Glennie, 2003)




(Percifo0rmes) (Serranidae) (Epinephelus)
400
3 29 110 (
11


1982


(Nervous Necrosis Virus, NNV)
(Chi, 1997)
(Nodaviridae) (fish nodavirus betanodavirus) (Mori., 1992; Nishizawa,
1995)
(Yoshikoshi, 1990) RNA RNA1
RNA2 (Mori, 1992)RNA1 RNA (RNA polymerase) RNA2
(coat protein)
T4 STRIPED JACK (SJ) NNVTIGER PUFFER (TP) NNVBARFIN
FLOUNDER (BF) NNV REDSPOTTED GROUPER (RG) NNV (Nishizawa,
1997) NNV
SJNNV TPNNV RGNNV BFNNV BFNNV
12
VER) (Munday, 1992; OIE, 2000) (Mori, 1992)
1122 (Epinephelus
akaara, E. fuscogutatus, E. malabaricus, E. moara, E. septemfasciatus, E. tauvina)
(Oplegnathus fasciatus) (Pseudocaranx dentex) (Lates calcarifer, Dicentrarchus
labrax) (Takifugu rubripes) (Verasper moseri, Hippoglossus hippoglossus,
Paralichthys olivaceus, Scophthalmus maximus) (OIE, 2000)
()

(Arimoto, 1992; Comps, 1996; Yoshimizu, 1997; Grotmol, 2000)
(Arimoto, 1992; Grotmol, 2000)



(Arimoto, 1992; Comps , 1996; Yoshimizu, 1997; Grotmol, 2000)

(Mori, 1992)
IgM Fc

()
Grouper IgM heavy chain constant region plasmid Fv plasmid (
)
()
Bromophenol blue (Merck)
Calcium Chloride (J.T.Baker)
1,4-Dithiothreitol (Merck)
dNTP (Yeastern Biotech)
High-Range Rainbow Molecular Weight Markers (GE®)
Isopropanol (Sigma)
Kanamycin (Sigma)
Ligase buffer (10 ×) (RocheNew England BioLabs®)
Methanol (Mallinckrode)
NEB buffer 2 (10 ×) (New England BioLabs®)
NEB buffer 4 (10 ×) (New England BioLabs®)
NEB buffer 1 (10 ×) (New England BioLabs®)
NBT /BCIP (Roche)
Oligo dT (Invitrogen)
Phenol (Amresco®)
RT buffer (Invitrogen)
17
Yeast extract (BactoTM)
(BioDoc-ItTM System)
(Thermo HeλIOSβ)
(Lab Tech Lotplate Stirrer LMS-1003)
(MiNi-PROTEAN 3 Cell)
(Pantech 5100 Spire Mixer )
(Labnet VX-100 Vortex Mixer )
(METTLER TOLEDO PB602-S)
(Thermo Genesys 10)
1 × 107 (HyBridoma 56, HB 56)
15 ml 180 × g 5 10 ml PBS
180 × g 5 1 ml PBS
1.5 ml 180 × g 5 UltraspecTM RNA 1 ml
vortex 5 200 μl chloroform 15
5 12,000 × g 15 4 300
μl isopropanolvortex 30 12,000 × g 1 4 75
1 ml vortex 30 12,000 × g 30 4 75 1
ml vortex 30 12,000 × g 30 412,000 × g 3
50 μl DEPC-H2O
RNA
()RNA (Reverse Transcription)
RNA 5 μg DEPC-H2O 18 μl 1 μl oligo dT (1 μg/μl)
1 μl dNTP (10 mM) 20 μlvortexspin down 65
5 5 5 μl RT buffer1 μl RNAin (RNAase
inhibitor)1 μl RTasevortexspin down 37 2 (
42 1 ) cDNA
() (primer)
HB 56 light chain IgM Fc
(CH2-CH4)chimeric heavy chain 7
HB56 heavy chain to pET 20b-grouper IgM CH2-CH4 plasmid forward primer (Nde I)GGGAAT
21
TCCATATGCAGGCCCAACTGCAGCAGCCTGGG
HB56 heavy chain to pET 20b-grouper IgM CH2-CH4 plasmid reverse primer (Hind III) : CCCA
AGCTTTGTACATATGCAAGGCTTACA
HB56 light chain to pET 23a forward primer (Nde I) : GGGAATTCCATTGGACATTGTGATG
ACCCAGTCTCAG
HB 56 light chain to pET 23a reverse primer (Hind III) :CCCAAGCTTACACTCATTCCTGTT
GAAGCTCTT
IgM constant region for CH2-CH4 to pET20b forward primer (Hind III) : CCCAAGCTTATATAT
CAGTTGCCAACTCTTAAAGTA
IgM constant region for CH2-CH4 to pET 20b reverse primer (Xho I) : CCGCTCGAGCTGGGCC
TTGCACGTTTCAGGGATGTT
chimeric heavy chain to pSecTaq2A forward primer (Asc I) : TTGGCGCGCCAGGCCCAACTG
CAGCAGCCTGGG
chimeric heavy chain to pSecTaq2A reverse primer (Xho I) : CCGCTCGAGGCTGGGCCTTGC
ACG TTTCAGGGATGTT
HB 56 light chain to pSecTaq2B forward primer (Hind III) : CCCAAGCTTGACATTGTGATG
ACCCAGTCT
HB 56 light chain to pSecTaq2B reverse primer (Xho I) : CCGCTCGAGGACACTCA
TTCCTGT TGAAGCTCTT
Chimeric heavy chain to p-N1-pSecTaq2B HB 56 light chain plasmid forward primer (Kpn I) :
CGGGGTACCCGA TGTACGGGCCAGATATACGCG
Chimeric heavy chain to p-N1-pSecTaq2B HB 56 light chain plasmid reverse primer (Not I) :
ATAAGAATGCGGC CGCTTACTGGGCCTTGCACGTTTC
HB 56 light chain to p-EGFP-N1 forward primer (Nhe I) : CTAGCTAGCATGGAGACAGACA
CACTCCTGCTA
HB 56 light chain to p-EGFP-N1 reverse primer (EcoR I) : CCGGAATTCCAGCATGCCTGC
TATTGTCTTCCC
22
50 μl template
DNA (0.05 μg)dNTP (0.2 mM)forward primer (0.1 μΜ)reverse primer (0.1 μΜ)1 μl (5
U/μl) Bio Taq DNA polymerase5 μl 10X PCR buffer (1.5 mM MgCl2)
50 μl
()PCR
95 10 95 1 55 1 72 1-2 (
) 35 72 10 (extension)

()
1 (1 g +99 ml TAE buffer)
55
DNA DNA loading dye 1:5
2 100 35 50 μg/ml
ethidium bromide 10

()PCR (VIOGENE PCR-MTM clean up kit)
PCR 0.5 ml PX buffer column 2
ml 10,000 × g 1 0.5 ml WF buffer column
10,000 × g 1 0.7 ml WS buffer (100) column
10,000 × g 1 column 10,000 × g 3
column 1.5 ml 50 μl column
2 10,000 × g 2
()DNA (VIOGENE Gel-MTM Kit)
DNA 1.5 ml
23
0.5 ml GEX buffer 60 20 2 invert
0.7 ml column
2 ml 10,000 × g 1 ( 0.7 ml )
0.5 ml WF buffer column 10,000 × g 1 0.7 ml WS
buffer ( 100 ) column 10,000 × g 1
column 10000 × g 3 column 1.5 ml
50 μl column 2 10,000 × g 2

PCR 10X buffer 37
10 (6-16)
() (Ligation )
T4 DNA ligase 1 U/μl ()
PCR ( PCR 1:10) 10X ligation buffer
4 18

()
E. coli XL-10 Gold Tetracycline (30 μg/ml) 3 ml LB
(tryptone 10 gyeast extract 5 gNaCl 10 g 1 L) 37 12-16
12-16 3 ml XL-10 Gold Tetracycline (30 μg/ml)
50 ml LB 37 OD600 nm 0.4
2,150 × g 10 4 10 ml 100 mM CaCl2 4
5 30 2,150 × g 10 4
2.5 ml 100 mM CaCl2 4 5
24
() (Transformation)
30 42 (heat
shock) 90 3 75 μl LB
37 50 9,100 × g 3 50
μl 50 μl
Tetracycline(30 μg/ml) LB 37 16

ml LB () 37 12-14
() ()
1 ml 12-14 1.5 ml 10,000 × g 1
100 μl solution Ι (50 mM glucose25 mM Tris-HCl pH 8.010 mM EDTA pH 8.0)
200 μl solution (0.2 N NaOH1SDS)
5 150 μl solution (5 M potassium acetate 60
mlglacial acetic acid 11.5 mlH2O 28.5 ml) 10,000 × g 10
phenol/chloroform (1:1) 10,000 × g 5
1 ml 95 5 10,000 × g 10
50 μl
() (VIOGENE Mini-MTM Plasmid DNA Extraction Kit)
1 ml 12-14 1.5 ml 10,000 × g 1
250 μl MX1 Buffer ( RNase 4 )
250 μl MX2 Buffer 4-6 5
350 μl MX3 Buffer 10,000 × g 10
25
column 2 ml 10,000 × g 1 0.5
ml WF buffer column 10,000 × g 1 0.7 ml WS buffer
( 100 ) column 10,000 × g 1 column
10,000 × g 3 column 1.5 ml 50
μl column 2 10,000 × g 2

GB3 (Lai,2 000) GB3
75T 10 Fetal Bovine Serum100 units/ml100 μg/ml
penicillin-streptomycin Leibovitz’s L-15 28°C
PBS 1
1 ml 0.25% (Trypsin)
1/3 Leibovitz’s L-15

() (transfection)
1 × 105 GB3 24 28 20 mix 1
solution4 μg plasmid DNA 250 μl FBS Leibovitz’s L-15
mix 2 solution10 μlLipofectamineTM 2000 reagent 250 μl FBS
Leibovitz’s L-15 5 mix 1 solution mix 2 solution
25 20 PBS 1.5 ml Leibovitz’s
L-15 500 μlmix 1 solution mix 2 solution 28 5
FBS Leibovitz’s L-15
()Stable clone (screening of stable clone)
26
FBS Leibovitz’s L-15 28 24
75T 28 48 1,000 μg/ml geneticin Leibovitz’s
L-15 28 2 3 1,000 μg/ml geneticin Leibovitz’s L-15
stable clone
DNA
()DNA
OD260 nm 1 ml (5 μl DNA
995 μl) DNA ( DNA 50 μg/ml)
OD260 nm 50 5 μl DNA
()
Bio-Rad Protein Assay (Bradford, M. 1976) BSA 160 μl
0, 0.625, 1.25, 2.5, 5, 10 μg/μl 5 μl
155 μl 40 μl (protein binding dye)
2 OD595 nm

27
grouper IgM heavy chain
grouper IgM CH2-CH4 1 kb
pET 20b grouper IgM CH2-CH4 pET 20b
Hind III Xho I digest
grouper IgM CH2-CH4 pET 20b
Hind III Xho I digest pET 20b-grouper IgM CH2-CH4 ligation grouper
IgMCH2-CH4 pET 20b
pET 20b-chimeric heavy chain (heavy chain of HB56 Fab -grouper IgM CH2-CH4)

HB56 RNA
HB56 RNA cDNA
HB56 Fab heavy chain 0.7
kb pET 20b-grouper IgM CH2-CH4
Nde Hind III digest
HB56 Fabheavy chain pET 20b-grouper IgM
CH2-CH4 Nde Hind III digest pET 20b-
heavy chain of HB56 Fab-grouper IgM CH2-CH4 ligation HB56 Fabheavy
chain pET 20b-grouper IgM CH2-CH4
pET 23a-HB56 light chain
HB56 RNA
HB56 RNA cDNA
HB56 light chain (LC) 0.7 kb pET
28
23a Nde Hind III digest
HB56 light chainpET 23a
Nde Hind III digest pET 23a-HB56 light chain ligation
HB56 light chain pET 23a
pSecTaq2A-chimeric heavy chain (heavy chain of HB56 Fab -grouper IgM CH2-CH4)

pET 20b-chimeric heavy chain
chimeric heavy chain 1.7 kb pSecTaq2A
Asc I Xho I digest
pSecTaq2A signal sequence CMV promoter
chimeric
heavy chainpSecTaq2A Asc I Xho I
digest pSecTaq2A-chimeric heavy chain ligation chimeric heavy chain
pSecTaq2A
pET23a-HB56 light chain
HB56 light chain 0.7 kb pSecTaq2B
Hind III Xho I digest pSecTaq2B
signal sequencepoly A site
HB56 light chainpSecTaq2B
Hind III Xho I digest pSecTaq2B-HB56
light chain ligation HB56 light chain pSecTaq2B
29
signal sequencepoly A sitepSecTaq2B-HB56 light chain 1.2
kb pEGFP-N1 Nhe I EcoR I digest
signal sequencepoly A site
pSecTaq2B-HB56 light chain pEGFP-N1
Nhe I EcoR I digest pEGFP-N1-pSecTaq2B-HB56 light chain ligation
signal sequencepoly A sitepSecTaq2B-HB56 light chain
pEGFP-N1
p-N1-pSecTaq2B-HB56 light chain -pSecTaq2A chimeric heavy chain (heavy chain of HB56
Fab -grouper IgM CH2-CH4)
pSecTaq2A-chimeric heavy chain
signal sequenceCMV promoterpSecTaq2A-chimeric heavy chain
2.5 kb pEGFP-N1-pSecTaq2B-HB56 light chain
Kpn I Not I digest (pEGFP-N1-pSecTaq2B-HB56 light chain
digest EGFP)
signal sequence CMV promoter pSecTaq2A-chimeric heavy chain
p-N1-pSecTaq2B-HB56 light chain Kpn I
Not I digest p-N1-pSecTaq2B-HB56 light chain-pSecTaq2A chimeric heavy chain ligation
signal sequenceCMV promoter pSecTaq2A-chimeric heavy chain
p-N1-pSecTaq2B-HB56 light chain
p-N1-pSecTaq2B-HB56 light chain-pSecTaq2A-chimeric heavy chain
pSecTaq2B-HB56 light chain pSecTaq2A-chimeric heavy chain (heavy chain of
HB56 Fab-grouper IgM CH2-CH4) HB56 light chain
chimeric heavy chain

30
24-48
isotypes IgM
IgA=IgGl > IgM>
IgG3. isotypes
(Mukherjee, 1992)


T101 cutaneous T cell lymphoma (CTCL) chronic lymphocytic
leukemia (CLL) human anti-mouse immunoglobulin (mIgG)
(Sears, 1984; Reynolds,
1989; Shawler, 1985; Jaffers, 1986)
Fv 2005
phage display library B-LyS (B-lymphocyte stimulator)
Fv C305C305 B-LyS (BCMA) B-LyS
B
C305 B-LyS C305
(Liu, 2005) 2006 CTLA4 (Cytotoxic T lymphocyte associated
Ag-4) Fv (pHEN1) CTLA4
Fv CTLA4 APC CD80/CD86 T
31
(Chen, 2006) 1998
p17
p17 cDNA
cDNA Fv Fv T
T T
(Tewari, 1998)
(assemble) (Tavladoraki, 1993; Benvenuto, 1995)


N901
(Roguska, 1994) 2008 B
(H67) HuS10HuS10 B S protein
HuS10 B
B B
1988
immunoblotting G (envelope
glycoprotein)N (nucleocapsid related protein)M1 M2 (matrix proteins 1 2)

2000 model (viral
hemorrhagic septicemia virus, VHSV) Fv Fv
envelope glycoprotein in vitro Fv
DNA
DNA
(Ichthyophthirius multifiliis)

Fv
Fv Fv

33
1.7 kb chimeric heavy chain (heavy chain of HB56 Fab-grouper IgM CH2-CH4)
0.7 kb HB56 light chain (LC)
Fab IgM Fc Fab
IgM Fc
IgM Fc




Fab
Fc


34

M V 1 2 3 4 5 6 7 8 9 10 11 12 13 14
(bp)
1.5 K
CH2-CH4
Lane V: pET 20b
Lane 1-14: pET 20b-grouper IgM CH2-CH4 ligation plasmid 19121314151618
202324252729
35
500
250
1 Hind III Xho I 12 24
pET20b grouper IgM CH2-CH4 1 kb
Lane M : marker
36
(bp)
1.5 K 1 K
1 pET 20b grouper-IgM CH2-CH4 plasmid
HB56 Fab heavy chain
Lane M : marker
Lane V: pET 20b grouper-IgM CH2-CH4 plasmid
Lane 1-7: pET 20b heavy chain of HB56 Fab-grouper IgM CH2-CH4 ligation plasmid 1235
6910
500
250
1 Nde Hind III 1910
pET 20b grouper-IgM CH2-CH4 plasmid HB56 Fab heavy
chain 0.7 kb
Lane M : marker
Lane 1-3: digest pET 20b heavy chain of HB56 Fab-grouper IgM CH2-CH4 ligation plasmid 19
10
chain (LC)
Lane M : marker
Lane 1: pET 23a-HB56 light chain ligation plasmid 27
39
500
250
1 Nde Hind III 27
pET23a HB56 light chain (LC) 0.7 kb
Lane M : marker
Lane 1: digest pET 23a-HB56 light chain ligation plasmid 27
40
M V 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 (bp)
4 K 3 K
2.5 K 2 K
250
heavy chain -1
Lane M : marker
Lane V: pSecTaq2A
Lane 1-15: pSecTaq2A-chimeric heavy chain ligation plasmid 12345678910
1112131415
41
(bp)
1.5 K 1 K 750 500
M V 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
1 pSecTaq2A chimeric
heavy chain -2
Lane M : marker
Lane V: pSecTaq2A
Lane 1-15: pSecTaq2A-chimeric heavy chain ligation plasmid 16171819202122
2324252627282930
42
M 1 2 3 4 5 6 7 8 9 10 11 12
(bp)
500
250
1 Asc I Xho I 23678
111718202526 pSecTaq2A chimeric heavy chain
1.7 kb
Lane M : marker
Lane 1-12: digest pSecTaq2A-chimeric heavy chain ligation plasmid 236781117
1820252627
43
(bp)
light chain (LC)
Lane M : marker
Lane V: pSecTaq2B
Lane 1-5: pSecTaq2B-HB56 light chain ligation plasmid 711161820
44
4 K 3 K
2.5 K 2 K
250
1 Hind III Xho I 111620
pSecTaq2B HB56 light chain (LC) 0.7
kb
Lane M : marker
Lane 1-4: digest pSecTaq2B-HB56 light chain ligation plasmid 11161820
45
M V 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
(bp)
pSecTaq2B-HB56 light chain (LC) -1
Lane M : marker
Lane V: pEGFP-N1
Lane 1-15: pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid 12345678
9101112131415
46
M V 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 (bp)
4 K 3 K
2.5 K 2 K
1 pEGFP-N1
pSecTaq2B-HB56 light chain (LC) -2
Lane M : marker
Lane V: pEGFP-N1
Lane 1-15: pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid 161718192021
222324252627282930
47
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14
(bp)
1 K 750 500
1 Nhe I EcoR I 2567
9101415161722252729 pEGFP-N1 pSecTaq2B-HB56
light chain (LC) 1.2 kb
Lane M : marker
Lane 1-14: digest pEGFP-N1-pSecTaq2B-HB56 light chain ligation plasmid 2567910
1415161722252729
48
2.5 K 2 K
1 pEGFP-N1-pSecTaq2B-HB56 light chain (LC) plasmid
pSecTaq2A-chimeric heavy chain
Lane M : marker
Lane 1: p-N1-pSecTaq2B-HB56 light chain-pSecTaq2A-chimeric heavy chain ligation plasmid 1

49
2.5 K
2 K
1.5 K
1 K
750
1 Kpn I Not I 1
pEGFP-N1-pSecTaq2B-HB56 light chain plasmid pSecTaq2A-chimeric
heavy 2.5 kb
Lane M : marker
plasmid 1
IgM Fc ) CMV
promoter signal sequence

51

2.
3.
5.
(2003)
7. Arimoto, M., Mushiake, K., Mizuta, Y., Nakai, T., Muroga, K. & Furusawa, I. Detection of
striped jack nervous necrosis virus (SJNNV) by enzyme-linked immunosorbent assay
(ELISA). Fish Pathol. 27, 191-195 (1992).
8. Akabani, G., Cokgor, I., Coleman, R. E., Gonzalez Trotter, D., Wong, T. Z., Friedman, H. S.,
Friedman, A. H., Garcia-Turner, A., Herndon, J. E., DeLong, D., McLendon, R. E., Zhao, X.
G., Pegram, C. N., Provenzale, J. M., Bigner, D. D. & Zalutsky, M. R. Dosimetry and
dose-response relationships in newly diagnosed patients with malignant gliomas treated with
iodine-131-labeled anti-tenascin monoclonal antibody 81C6 therapy. Int. J. Radiat. Oncol.
Biol. Phys. 46, 947-958 (2000).
9. Aoyama, T., Kamata, K., Yamanaka, N., Takeuchi, Y., Higashihara, M. & Kato, S.
Characteristics of polyclonal anti-human nephrin antibodies induced by genetic
immunization using nephrin cDNA. Nephrol. Dial. Transplant. 4, 1073-1081 (2006).
10. Atwell, J. L., Pearce, L. A., Lah, M., Gruen, L. C., Kortt, A. A. & Hudson, P. J. Design and
expression of a stable bispecific scFv dimer with affinity for both glycophorin and N9
neuraminidase. Mol. Immunol. 17, 1301-1312 (1996).
11. Bloch, B., Gravningen, K. & Larsen, J. L. Encephalomyelitis among turbot associated with a
picornavirus-like agent. Dis. Aquat. Organ. 10, 65-70 (1991).
12. Bird, R. E., Hardman, K. D., Jacobson, J. W., Johnson, S., Kaufman, B. M., Lee, S. M., Lee,
T., Pope, S. H., Riordan, G. S. & Whitlow, M. Single-chain antigen binding proteins.
Science 242, 423-426 (1988).
13. Brinkmann, U., Reiter, Y., Jung, S. H., Lee, B. & Pastan, I. A recombinant immunotoxin
containing a disulfide-stabilized Fv fragment. Proc. Natl. Acad. Sci. U. S. A. 90, 7538-7542
(1993).
14. Better, M., Bernhard, S. L., Lei, S. P., Fishwild, D. M., Lane, J. A., Carroll, S. F. & Horwitz,
A. H. Potent anti-CD5 ricin A chain immunoconjugates from bacterially produced Fab’ and
F(ab’)2. Proc. Natl. Acad. Sci. U. S. A. 90, 457-461 (1993).
15. Benvenuto, E. & Tavladoraki, P. Immunotherapy of plant viral diseases. Trends. Microbiol.
3, 272-275 (1995).
16. Colcher, D., Milenic, D. E., Ferroni, P., Carrasquillo, J. A., Reynolds, J. C., Roselli, M.,
Larson, S. M. & Schlom, J. In vivo fate of monoclonal antibody B72.3 in patients with
colorectal cancer. J. Nucl. Med. 31, 1133-1142 (1990).
17. Chester, K. A. & Hawkins, R. E. Clinical issues in antibody design. Trends. Biotechnol. 13,
294-300 (1995).
18. Covell, D. G., Barbet, J., Holton, O. D., Black, C. D., Parker, R. J. & Weinstein, J. N.
Pharmacokinetics of monoclonal immunoglobulins G1, F(ab’)2, and Fab’ in mice. Cancer
Res. 46, 3969 (1986).
19. Chi, S. C., Lo, F., Kou, G. H., Chang, P. S., Peng, S. E. & Chen, S. N. Mass mortalities
associated with viral nervous necrosis (VNN) disease in two species of hatchery-reared
grouper, Epinephelus fuscogutatus and Epinephelus akaara (Temminck & Schlegel). J. Fish
Dis. 20, 185-193 (1997).
20. Comps, M., Trindade, M. & Delsert, C. Investigation of fish encephalitis viruses (FEV)
expression in marine fishes using DIG-labelled probes. Aquaculture 143, 113-121 (1996).
21. Colcher, D., Goel, A., Pavlinkova, G., Beresford, G., Booth, B. & Batra, S. K. Effects of
genetic engineering on the pharmacokinetics of antibodies. Q. J. Nucl. Med. 43, 132-139
(1999).
53
22. Chen, J. D., Yang, Q., Yang, A. G., Marasco, W. A. & Chen, S. Y. Intraand extracellular
immunization against HIV-1 infection with lymphocytes transduced with an AAV vector
expressing a human anti-gp120 antibody. Hum. Gene Ther. 7, 1515-1525 (1996).
23. Chen, S. Y., Bagley, J. & Marasco, W. A. Intracellular antibodies as a new class of
therapeutic molecules for gene therapy. Hum. Gene Ther. 5, 595-601 (1994a).
24. Chen, S. Y., Khouri, Y., Bagley, J. & Marasco, W. A. Combined intraand extracellular
immunization against human immunodeficiency virus type 1 infection with a human
anti-gp120 antibody. Proc. Natl. Acad. Sci. U. S. A. 91, 5932-5936 (1994b).
25. Chen, L. H., Huang, Q., Wan, L., Zeng, L. Y., Li, S. F., Li, Y. P., Lu, X. F. & Cheng, J. Q.
Expression, purification, and in vitro refolding of a humanized single-chain Fv antibody
against human CTLA4 (CD152). Protein Expr. Purif. 2, 495-502 (2006).
26. Duan, L., Zhang, H., Oakes, J. W., Bagasra, O. & Pomerantz, R. J. Molecular and
virological effects of intracellular anti-Rev single-chain variable fragments on the
expression of various human immunodeficiency virus-1 strains. Hum. Gene Ther. 5,
1315-1324 (1994a).
27. Duan, L. K., Bagasra, O., Laughlin, M. A., Oakes, J. W. & Pomerantz, R. J. Potent
inhibition of human immunodeficiency virus type 1 replication by intracellular anti-Rev
single chain antibody. Proc. Natl. Acad. Sci. U. S. A. 91, 5075-5079 (1994b).
28. Duan, L., Zhu, M., Bagasra, O. & Pomerantz, R. J. Intracellular immunization against
HIV-1 infection of human T lymphocytes: utility of anti-Rev single chain variable fragments.
Hum. Gene Ther. 6, 1561-1573 (1995).
29. Edelman, G. M. Antibody structure and molecular immunology. Science 180, 830-840
(1973).
30. Glockshuber, R., Malia, M., Pfitzinger, I. & Pluckthun, A. A comparison of strategies to
stabilize immunoglobulin Fv-fragments. Biochemistry 29, 1362-1367 (1990).
31. Glennie, M. J. & Van De Winkel, J. G. Renaissance of cancer therapeutic antibodies. Drug
Discov. Today. 8, 503-510 (2003).
32. Glazebrook, J. S., Heasman, M. P. & De Beer, S. W. Picornalike viral particles associated
54
with mass mortalities in larval barramundi, Lates calcarifer (Bloch). J. Fish Dis. 13, 245-249
(1990).
33. Grotmol, S. & Totland, G. K. Surface disinfection of Atlantic halibut Hippoglossus
hippoglossus eggs with ozonated sea-water inactivates nodavirus and increases survival of
the larvae. Dis. Aquat. Organ. 39, 89-96 (2000).
34. Goncalvez, A. P., Men, R., Wernly, C., Purcell, R. H. & Lai, C. J. Chimpanzee Fab
fragments and a derived humanized immunoglobulin G1 antibody that efficiently cross-
neutralize dengue type 1 and type 2 viruses. J. Virol. 23, 12910-12918 (2004).
35. Huston, J. S., Levinson, D., Mudgett-Hunter, M., Tai, M. S., Novotny, J., Margolies, M. N.,
Ridge, R. J., Bruccoleri, R. E., Haber, E. & Crea, R. Protein engineering of antibody binding
sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in
Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 85, 5879-5883 (1988).
36. Ho, W. Z., Lai, J. P., Bouhamdan, M., Duan, L., Pomerantz, R. J. & Starr, S. E. Inhibition of
HIV type 1 replication in chronically infected monocytes and lymphocytes by
retrovirus-mediated gene transfer of anti-rev single-chain variable fragments. AIDS Res.
Hum. Retroviruses 14, 1573-1580 (1998).
37. Inouye, R. T., Du, B., Boldt-Houle, D., Ferrante, A., Park, I. O., Hamer, S. M., Duan, L.,
Groopman, J. E., Pomerantz, R. J. & Terwilliger, F. Potent inhibition of human
immunodeficiency virus type 1 in primary T cells and alveolar macrophages by combination
anti-Rev strategy delivered in adeno associated virus vector. J. Virol. 71, 4071-4078 (1997).
38. Junker, U., Kalfoglou, C. S., Moon, J. J., Beck, M. K., Kaneshima, H. & Bo¨hnlein, E.
Inhibition of human immunodeficiency virus type 1 replication in myelomonocytic cells
derived from retroviral vector-transduced peripheral blood progenitor cells. Hum. Gene Ther.
9, 333-340 (1998).
39. Juweid, M. E., Zhang, C. H., Blumenthal, R. D., Hajjar, G., Sharkey, R. M. & Goldenberg,
D. M. Prediction of hematologic toxicity after radioimmunotherapy with (131)I-labeled
anticarcinoembryonic antigen monoclonal antibodies. J. Nucl. Med. 40, 1609-1616 (1999).
40. Jaffers, G. J., Fuller, T. C., Cosimi, A. B., Russell, P. S., Winn, H. J. & Colvin, R. B.
Monoclonal antibody therapy. Anti-idiotypic and non-anti-idiotypic antibodies to OKT3
55
arising despite intense immunosuppression. Transplantation 41, 572-578 (1986).
41. Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S. & Winter, G. Replacing the
complementarity-determining regions in a human antibody with those from a mouse. Nature
321, 522-525 (1986).
42. Jain, R. K. Transport of molecules across tumor vasculature. Cancer Metastasis Rev. 6,
559-593 (1987).
43. Jia, L., Yu, J., Song, H., Liu, X., Ma, W., Xu, Y., Zhang, C., Dong, S. & Li, Q. Screening of
human antibody Fab fragment against HBsAg and the construction of its dsFv form. Int. J.
Biol. Sci. 2, 103-110 (2008).
44. Kaku, S., Yano, S., Kawasaki, T., Sakai, Y., Suzuki, K. I., Kawamura, K., Masuho, Y.,
Satoh, N., Takenaka, T., Landolfi, N. F. & Co, M. S. Comparison of the antiplatelet agent
potential of the whole molecule, F(ab’)2 and Fab fragments of humanized anti-GPIIb/IIIa
monoclonal antibody in monkeys. Gen. Pharmacol. 27, 435 (1996).
45. Kim, S. H., Kim, S. H., Oh, H. K., Ryu, C. J., Park, S. Y. & Hong, H. J. In vivo hepatitis B
virus-neutralizing activity of an anti-HBsAg humanized antibody in chimpanzees. Exp. Mol.
Med. 1, 145-149 (2008).
46. King, D. J., Turner, A., Farnsworth, A. P. H., Adair, J. R., Owens, R. J., Pedley, B., Baldock,
D., Proudfoot, K. A., Lawson, A. D. G., Beeley, N. R. A., Millar, K., Millican, T. A., Boyce,
B. A., Antoniw, P., Mountain, A., Begent, R. H. J., Shochat, D. & Yarranton, G.T. Improved
tumour targeting with chemically cross-linked recombinant antibody fragments. Cancer Res.
54, 6176 (1994).
47. Kortt, A. A., Dolezal, Q., Power, B. E. & Hudson, P. J. Dimeric and trimeric antibodies:
high avidity scFvs for cancer targeting. Biomol. Eng. 18, 98-108 (2001).
48. Kwak, J. W., Choi, B. K., Lee, D. I., Kang, Y. K., Seo, Y. G., Cho, W. K. & Han, M. H.
Cloning and characterization of cDNAs coding for heavy and light chains of a monoclonal
antibody (MabB23) specific for human plasma apolipoprotein B-100. Gene 169, 237-239
(1996).
49. Hsueh, P. R., Kao, C. L., Lee, C. N., Chen, L. K., Ho, M. S., Sia, C., Fang, X. D., Lynn, S.,
Chang, T. Y., Liu, S. K., Walfield, A. M. & Wang, C. Y. SARS antibody test for
serosurveillance. Emerg. Infect. Dis. 9, 1558-1562 (2004).
50. Lorenzen, N., Cupit, P. M., Einer-Jensen, K., Lorenzen, E., Ahrens, P., Secombes, C. J. &
Cunningham, C. Immunoprophylaxis in fish by injection of mouse antibody genes. Nat.
Biotechnol. 11, 1177-80 (2000a).
51. Lorenzen, N., Cupit, P. M., Secombes, C. J. & Cunningham, C. Three monoclonal antibodies
to the VHS virus glycoprotein: comparison of reactivity in relation to differences in
immunoglobulin variable domain gene sequences. Fish Shellfish Immunol. 2, 129-142
(2000b).
52. Lai, Y. S., John, J. A., Guo, I. C., Chen, S. C., Fang, K. & Chang, C. Y. In vitro efficiency of
intra- and extracellular immunization with mouse anti-YGNNV antibody against yellow
grouper nervous necrosis virus . Vaccine 20, 3221-3229 (2002).
53. Lai, Z. Z., Xiong, D. S., Fan, D. M., Peng, H., Xu, Y. F., Zhu, Z. P. & Yang, Y.Z. High
expression of the chimeric antibody Fab against-CD20 in E coli and bioactivity
determination. Zhongguo Mian Yi Xue Za Zhi 16, 521-524 (2000).
54. Liu, M. Y., Han, W., Ding, Y. L., Zhou, T. H., Tian, R. Y., Yang, S. L., Liu, H. & Gong, Y.
Generation and characterization of C305, a murine neutralizing scFv antibody that can
inhibit BLyS binding to its receptor BCMA. Acta Biochim. Biophys. Sin. (Shanghai) 6,
415-42 (2005).
55. Lin, T. L., Clark, T. G. & Dickerson, H. Passive immunization of channel catfish (Ictalurus
punctatus) against the ciliated protozoan parasite Ichthyophthirius multifiliis by use of
murine monoclonal antibodies. Infect. Immun. 10, 4085-4090 (1996).
56. Lorenzen, N., Olesen, N. J. & VestergArd Jsrgensen, P. E. Production and characterization
of monoclonal antibodies to four Egtved virus structural proteins. Dis. Aquat. Organ. 4,
35-42 (1988).
57. Marasco, W. A., Haseltine, W. A. & Chen, S. Y. Design, intracellular expression, and
activity of a human anti-human immunodeficiency virus type 1 gp120 single-chain antibody.
Proc. Natl. Acad. Sci. U. S. A. 90, 7889-7893 (1993).
58. Marasco, W. A. Intrabodies: turning the humoral immune system outside in for intracellular
immunization. Gene Ther. 4, 11-15 (1997).
57
59. Meredith, R. F., LoBuglio, A. F. & Spencer, E. B. Recent progress in radioimmunotherapy
for cancer. Oncology 11, 979-984 (1997).
60. Mori, K., Nakai, T., Muroga, K., Arimoto, M., Mushiake, K. & Furusawa, I. Properties of a
new virus belonging to Nodaviridae found in larval striped jack (Pseudocaranx dentex) with
nervous necrosis. Virology 187, 368-371 (1992).
61. Munday, B. L., Langdon, J. S., Hyatt, A. & Humphrey, J. D. Mass mortality associated with
a viral-induced vacuolating encephalopathy and retinopathy of larval and juvenile
barramundi, Lates calcarifer Bloch. Aquaculture 103, 197-211 (1992).
62. Murray, J. L., Macey, D. J., Kasi, L. P., Rieger, P., Cunningham, J., Bhadkamkar, V., Zhang,
H. Z., Schlom, J., Rosenblum, M. G. & Podoloff, D. A. Phase II radioimmunotherapy trial
with 131I-CC49 in colorectal cancer. Cancer 73, 1057-1066 (1994).
63. Mukherjee, J., Scharff, M. D. & Casadevall, A. Protective murine monoclonal antibodies to
Cryptococcus neoformans. Infect. Immun. 11, 4534-4541. (1992).
64. Newman, R., Alberts, J., Anderson, D., Carner, K., Heard, C., Norton, F., Raab, R., Re, V.
M., Shuey, S. & Hanna, N. Primatization" of recombinant antibodies for immunotherapy of
human diseases: a macaque/human chimeric antibody against human CD4. Biotechnology
10, 1455-1460 (1992).
65. Nishizawa, T., Masaaki, K., Nakai, T. & Muroga, K. Comparison of the coat protein genes
of five fish nodaviruses, the causative agent of nervous necrosis in marine fish. J. Gen. Virol.
76, 1563-1569 (1995).
66. Nishizawa, T., Furuhashi, T., Nagai, T., Nakai, T. & Muroga, K. Genomic classifIcation of
fish nodaviruses by molecular phylogenetic analysis of the coat protein gene. Appl. Environ.
Microbiol. 63, 1633-1636 (1997).
67. OIE. Chapter 2.2.2. Viral encephalopathy and retinopathy. In: OIE Diagnostic Manual for
Aquatic Animal Diseases, 3rd edn: 69-73 (2000).
68. Press, O. W. Radiolabeled antibody therapy of B-cell lymphomas. Semin. Oncol. 26, 58-65
(1999).
69. Quinn, M. J., Plow, E. F. & Topol, E. J. Platelet glycoprotein IIb/IIIa inhibitors: recognition
58
of a two-edged sword? Circulation 107, E39-9 (2003).
70. Qing, Y., Shuo, W., Zhihua, W., Huifen, Z., Ping, L., Lijiang, L., Xiaorong, Z., Liming, C.,
Daiwen, X., Yu, H., Wei, X., Min, F., Zuohua, F. & Guanxin, S. The in vitro antitumor effect
and in vivo tumor-specificity distribution of human-mouse chimeric antibody against
transferrin receptor. Cancer Immunol. Immunother. 55, 1111-21 (2005).
71. Roguska, M. A., Pedersen, J. T., Keddy, C. A., Henry, A. H., Searle, S. J., Lambert, J. M.,
Goldmacher, V. S., Blättler, W. A., Rees, A. R. & Guild, B. C. Humanization of murine
monoclonal antibodies through variable domain resurfacing. Proc. Natl. Acad. Sci. U. S. A. 3,
969-73 (1994).
72. Riechmann, L., Foote, J. & Winter, G. Expression of an antibody Fv fragment in myeloma
cells. J. Mol. Biol. 203, 825-828 (1988).
73. Reynolds, J. C., Del Vecchio, S., Sakahara, H., Lora, M. E., Carrasquillo, J. A., Neumann, R.
D. & Larson, S. M. Anti-murine antibody response to mouse monoclonal antibodies: clinical
findings and implications. Int. J. Rad. Appl. Instrum B. 16, 121-125 (1989).
74. Rondon, I. J. & Marasco, W. A. Intracellular antibodies (intrabodies) for gene therapy of
infectious disease. Annu. Rev. Microbiol. 51, 257-283 (1997).
75. Sears, H. F., Herlyn, D., Steplewski, Z. & Koprowski, H. Effects of monoclonal antibody
immunotherapy on patients with gastrointestinal adenocarcinoma. J. Biol. 3, 138-150
(1984).
76. Shawler, D. L., Bartholomew, R. M., Smith, L. M. & Dillman, R. O. Human immune
response to multiple injections of murine monoclonal IgG. J. Immunol. 135, 1530-1535
(1985).
77. Sherie, L., Morrison, M., Jacqueline Johnsont Leonard, A., Herzenbergt Vernon, T.
Chimeric human antibody molecules: Mouse antigen-binding domains with human constant
region domains. Proc. Natl. Acad. Sci. U. S. A. 81, 6851-6855 (1984).
78. Tavladoraki, P., Benvenuto, E., Trinca, S., De Martinis, D., Cattaneo, A. & Galeffi, P.
Transgenic plants expressing a functional single-chain Fv antibody are specifically protected
from virus attack. Nature 366, 469-472 (1993).
59
79. Tewari, D., Goldstein, S. L., Notkins, A. L. & Zhou, P. cDNA encoding a single-chain
antibody to HIV p17 with cytoplasmic or nuclear retention signals inhibits HIV-1 replication.
J. Immunol. 161, 2642-2647 (1998).
80. Winter, G. & Harris, W. J. Humanized antibodies. Immunol. 14, 243-246 (1993).
81. Waldmann, T. A. Monoclonal antibodies in diagnosis and therapy. Science 252, 1657-1662
(1991).
82. Wu, Y., Duan, L., Zhu, M., Hu, B., Kubota, S., Bagasra, O. & Pomerantz, R. J. Binding of
intracellular anti-Rev single chain variable fragments to different epitopes of human
immunodeficiency virus type 1 Rev: variations in viral inhibition. J. Virol. 70, 3290-3297
(1996).
83. Xia, L., Gu, J., Zhang, X., Liu, Y., Wan, H., Li, P. & Ruan, C. Preparation of an antifebrin
thrombus-specific murine/human chimeric monoclonal antibody Fab fragment in
Escherichia coli. Thromb. Res. 8, 477-484 (1996).
84. Yokota, T., Milenic, D. E., Whitlow, M. & Schlom, J. Rapid tumor penetration of a
single-chain Fv and comparison with other immunoglobulin forms. Cancer Res. 52,
3402-3408 (1992).
85. Yoshikoshi, K. & Inoue, K. Viral nervous necrosis in hatchery-reared larvae and juveniles of
Japanese parrotfish, Oplegnathus fasciatus (Temminck & Schlegel). J. Fish Dis. 13, 69-77
(1990).
86. Yoshimizu, M., Suzuki, K., Nishizawa, T., Winton, J. R. & Ezura, Y. Antibody screening for
the identification of nervous necrosis carriers in flounder broodstock. In: Proceedings NRIA
International Workshop on New Approaches to Viral Diseases of Aquatic Animals. Kyoto, p
124-130 (1997).
87. Zhou, P., Goldstein, S., Devadas, K., Tewari, D. & Notkins, A. L. Cells transfected with a
non-neutralizing antibody gene are resistant to HIV infection: targeting the endoplasmic
reticulum and trans-Golgi network. J. Immunol. 160, 1489-1496 (1998).