International Buffalo Information Center (IBIC)ibic.lib.ku.ac.th/e-Bulletin/36-2.pdf · International Buffalo Information Center (IBIC) Buffalo Bulletin . ISSN: 0125-6726 (Print),

International Buffalo Information Center (IBIC)

Buffalo Bulletin

ISSN: 0125-6726 (Print), 2539-5696 (Online)

Aims

IBIC is a specialized information center on water buffalo. Established in 1981 by Kasetsart University

(Thailand) with an initial financial support from the International Development Research Center (IDRC) of

Canada. IBIC aims at being the buffalo information center of buffalo research community throughout the world.

Main Objectives

1. To be world source on buffalo information.

2. To provide literature search and photocopy services.

3. To disseminate information in newsletter.

4. To publish occasional publications such as an inventory of ongoing research projects.

Buffalo Bulletin is published quarterly in January-March, April-June, July-September and October-

December. Contributions on any aspect of research or development, progress reports of projects and news on

buffalo will be considered for publication in the bulletin. Manuscripts must be written in English and follow the

instruction for authors which describe at inside of the back cover.

Publisher

International Buffalo Information Center, Office of the University Library, Kasetsart University

Online available

http://ibic.lib.ku.ac.th/e-Bulletin

Advisory Board

Prof. Dr. Charan Chantalakhana Thailand

Prof. Dr. John Lindsay Falvey Faculty of Veterinary and Agricultural Science, University

of Melbourne, Australia

Prof. Dr. Metha Wanapat Department of Animal Science, Faculty of Agriculture,

Khon Kaen University, Thailand

Mr. Antonio Borghese International Buffalo Federation, Italy

Dr. Aree Thunkijjanukij International Buffalo Information Center, Office of the

University Library, Kasetsart University, Thailand

Miss Supanee Hongthong International Buffalo Information Center, Office of the


Editorial Member

Dr. Pakapan Skunmun Thailand

Dr. Kalaya Bunyanuwat Department of Livestock Development, Thailand

Prof. Dr. Federico Infascelli Department of Veterinary Medicine and Animal Science,

University of Naples Federico II, Italy

Dr. Rafat Al Jassim School of Agriculture and Food Sciences, Faculty of Science,

The University of Queensland, Australia

Prof. Dr. Nguyen Van Thu Department of Animal Sciences, Faculty of Agriculture and

Applied Biology, Can Tho University, Vietnam

Prof. K. Sarjan Rao Department of Livestock Production and Management,

College of Veterinary Science, India

Prof. Dr. Masroor Ellahi Babar Virtual University of Pakistan, Pakistan

Asst. Prof. Dr. Asif Nadeem Institute of Biochemistry and Biotechnology, University of

Veterinary and Animal Sciences, Pakistan

Prof. Dr. Raul Franzolin Departamento de Zootecnia, Universidade de São Paulo, Brazil

Editor

Dr. Sunpetch Sophon Thailand

Journal Manager

Mr. Chalermdej Taterian International Buffalo Information Center, Office of the


Assistant Journal Manager

Miss Kanchana Anuphan International Buffalo Information Center, Office of the


Miss Jirawadee Wiratto International Buffalo Information Center, Office of the


Buffalo Bulletin

IBIC, Kasetsart University,

P.O. BOX 1084, Bangkok 10903, Thailand

E-mail: [email protected]

Tel: 66-2-9428616 ext. 344

Fax: 66-2-9406688

Buffalo Bulletin (April-June 2017) Vol.36 No.2

CONTENTS Page Case Report

Vaginal delivery of congenital hydrocephalic calf in a Murrah buffalo with partial fetotomy A.A. Malik, M.A. Ganie and A. Kumar....................................................................................................259

Review Article Current trends and developments in the use of assisted reproductive technology and its application in the Philippine livestock improvement program-A review Trinidad C. Fernando and Danilda H. Duran........................................................................................263

Original Article

Ethno-veterinary treatment of buffalo in Arid region of Rajasthan, India Aishwarya Dudi and M.L. Meena............................................................................................................281

Effects of parity and location on body dimensional measurements in Iraqi buffaloes at southern: A case study at Al-nasiriyah Governorate Garabed Avadesian, Alaa Al-Hadad, Waleed M. Razuki, Nasr Noori Al-Anbari, Muhsen Aswadi and Ali Salih Sadiq......................................................................................................297

Management of urinary obstruction in buffalo calves by tube cystostomy Rammehar Singh, Satbir Sharma, Deepak Kumar Tiwari, R.N. Chaudhary, Sandeep Saharan and Anand Kumar Pandey......................................................................................307

Characterization of Pasteurella multocida isolates of buffalo origin from Gujarat state of India by outer membrane protein profile analysis V. Aiswarya, Rafiyuddin A. Mathakiya, Bharat B. Bhanderi and Ashish Roy.................................313

Identification of Il-1α gene from bovine peripheral blood mononuclear cells by polymerase chain reaction S.D. Audarya, A. Sanyal, J.K. Mohapatra and B. Pattnaik..................................................................323

In vitro efficacy of alphacypermethrin on the buffalo louse Haematopinus tuberculatus (Burmeister, 1839) Vincenzo Veneziano, Gianluca Neglia, Francesco Buono, Laura Pacifico, Laura Manna, Andrea Bassini, Luca Miotto, Mario Santoro and Cengiz Gokbulut...................327


CONTENTS Page Original Article Some pharmacokinetic data and dosage regimen of danofloxacin after intravenous administration in Nili-Ravi and Kundhi buffaloes Zahid Manzoor, Shaukat Hussain Munawar, Zahid Iqbal and Muhammad Abdullah Abid........335

Assessment of alteration in metabolic profile and milk composition of buffaloes with subclinical mastitis Krishna Veer Singh, Deepak Sharma, Shanker K. Singh, Mukesh Srivastava, Satish K. Garg and Brajesh K. Yadav...................................................................................................349

In vitro, in situ and in vivo evaluation of straw based diets supplemented with bypass fat as concentrated energy source in Murrah buffaloes R. Sravan Kumar, Y. Ramana Reddy, N. Nalini Kumari, K. Sridhar and D. Srinivasa Rao........357

Effect of heat stress on seminal characteristics of Murrah buffalo bull semen K.L. Ram, R.P. Tiwari, G.K. Mishra, S.A. Sahasrabudhe and A.K. Nair........................................369

Assessment of Neospora caninum seroprevalence in buffalo in Tabriz city, north-west of Iran Garedaghi Yagoob, Firouzivand Yaghuob and Heikal Abadi Mohammad.....................................379

Multilocus sequence typing of P. multocida isolates of buffalo origin from Gujarat state of India V. Aiswarya, Yogesh A. Chatur, Bharat B. Bhanderi, Rafiyuddin A. Mathakiya and Ashish Roy............................................................................................385

Follicular growth, time of ovulation and conception rate after synchronization with medroxy progesterone acetate impregnated sponges in Nili Ravi buffalo heifers Muhammad Binyameen, Saba Anwar, Rehana Kauser, Azmat Ullah, Abdul Rehaman and Mushtaq Ahmad..................................................................................................401

Morphological and digital radiographical dental anatomy of adult buffaloes R.K. Singh, R.P. Pandey, S. Purohit, S.P. Singh, A.K. Tripathi and V. Malik................................407


CONTENTS Page Original Article

Effect of feed energy levels on semen quality and freezability of young Murrah buffalo bulls Ajit Kumar, P. Singh, M. Bhakat, S. Singh, K. Nitharwal and A.K. Gupta.....................................415

Prevalence and risk factors of coccidiosis in buffaloes and cattle from Ravi River region, lahore, Pakistan M.S. Jahanzaib, M. Avais, M.S. Khan, F.A. Atif, N. Ahmad, K. Ashraf and M.U. Zafar.............427

Superovulatory responses and embryo recovery in germplasm conservation of semi wild Toda buffaloes of Nilgiris R. Anil Kumar, M. Iyue, D.V. Pate and R. Kasiraj...............................................................................439

Morphological studies of cryopreserved Toda buffalo spermatozoa by CASA R. Anilkumar, M.N. Sundararaman, D.V. Pate, M. Iyue and R. Kasiraj.........................................447


259

ABSTRACT

A case of successful pervaginal delivery of hydrocephalic calf through partial fetotomy has been reported.

Keywords: buffaloes, Bubalus bubalis, fetotomy, hydrocephalus

INTRODUCTION

Hydrocephaly can be defined as dropsical condition of the brain owing to abnormal accumulation of cerebrospinal fluid (CSF) in the cranial cavity and has been encountered as an infrequent congenital anomaly in mammals causing fetal dystocia (McEntee, 1990). Dystocia due to congenital hydrocephalus has been well documented in cattle (Purohit et al., 2006) and buffalo (Kumaresan et al., 2003). The presenr case report puts on record a rare case of dystocia due to hydrocephalic calf and its successful per-vaginal delivery through partial fetotomy.

CASE HISTORY AND OBSERVATION

A buffalo at full term in its fourth parity

after completion of first stage of labour was presented to veterinary clinics of the teaching hospital, Guru Angad Dev Veterinary and Animal Sciences University (GADVASU), Ludhiana. About 5 to 6 h had passed after the rupture of water bags. Earlier attempts by the local veterinarians for the delivery of fetus were not successful. The clinical parameters viz. rectal temperature, heart rate and respiratory rate were within normal range. Pervaginal examination revealed right lateral deviation of head with enlarged sac and poor development of frontal bone. Both the fore limbs were present in the birth canal. Absence of suckling reflex indicated that fetus was dead.

TREATMENT AND DISCUSSION

Following epidural anaesthesia (6 ml, 2% Lignocaine HCl) and after doing ample lubrication of the birth passage with sodium carboxy methy cellulose gel (Carmellose-Na 1%, WDT, Garbsen, Germany) an attempt was made to correct the head postural deviation but due to enlarged size of the cyst all exercise went futile. Thereafter, decision was taken to perform fetotomy using Thygeson’s fetotome loaded with wire saw (Bovivet, Denmark). Thygeson’s fetotome was partially threaded with wire saw on one side and other end of the wire

VAGINAL DELIVERY OF CONGENITAL HYDROCEPHALIC CALF IN A MURRAH BUFFALO WITH PARTIAL FETOTOMY

A.A. Malik, M.A. Ganie* and A. Kumar

Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Sciences, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India, *E-mail: [email protected]

Case Report

mailto:[email protected]


260

was fixed in the calving rope carrier. The wire was then carried in the birth canal with the loose loop to pass over the deviated head and retrieved from ventral side. The fetotome was then completely threaded outside and loop was positioned around the neck caudal to ears. Finally sawing was done, initially with short strides followed by a continous full hand strokes till the head was amputated. The amputated head was removed by application of eyehooks and properly guided inside the passage during application of traction. The rest of the fetus was delivered by simultaneous traction of both extended forelimbs with the help of obstetrical chins ensuring minimum damage to birth canal. The placenta was also completely removed soon after. The buffalo was discharged after three hours with the routine prescription of antibiotics and supportive therapy.

The careful examination of the fetus revealed domed skull with fluid filled sac and protruding outside from the head (Figure 1). The careful dissection of this sac revealed thinning of frontal and parietal bones with involvement of ventricular system and sub-arachnoid spaces, hence declared external hydrocephalus condition (Thomson, 1989). The size of the fetus was smaller compared to the normal. The hydrocephalus arise due to disturbances in normal circulation of CSF because of altered production or absorption (Fride, 1971). The accumulation of CSF may occur either in ventricular system alone i,e internal/non-communicating type or in ventricular systemas well as subarachnoid space i,e external/communicating type (Sharma, 1996). Jubb and Kennedy (1970) stated that congenital hydrocephalus is known to be inherited in cattle and exacerbated in its manifestation by a coexisting hypovitaminosis A. A simple autosomal recessive gene (Roberts, 1986) and autosomal gene with incomplete penetrance

have been reported to be linked with hydrocephalus in cattle.

External hydrocephalus results from either too much fluid formed and not rapidly drained by arachnoid villi or due to hindrance to the drainage of normally produced fluid (Shastry, 1971). Congenital external hydrocephalus in the form of water sac over the forehead is quite rare in animals (Jubb and Kennedy, 1970), the condition appears as a fluid sac covered with skin and contains clear serous fluid. The enlarged head can not easily pass through the birth canal and results in dystocia as was seen in present reported case.

REFERENCES

Fride, R.R. 1975. Developmental Neuropathology. Sprainger Verlag, New York, USA.

Jubb, K.V.F. and P.C. Kennedy. 1970. Pathology of Domestic Animals, 2nd ed. Academic Press, NYC.

Kumaresan, A., A. Garg, U.S. Mahapatra, U. Shankar and S.K. Agarwal. 2003. Dystocia due to hydrocephalus calf in a buffalo. Indian. J. Anim. Reprod., 24: 82.

McEntee, K. 1990. Reproductive Pathology of Domestic Mammals, 6th ed. Academic Press, Williams and Willkins, Baltimore, New York.

Purohit, G.N., M. Gaur and A. Sharma. 2006. Dystocia in Rathi cows due to congenital hydrocephalus. Indian. J. Anim. Reprod., 27: 98-99.

Roberts, S.J. 1986. Veterinary Obstetrics and Genital Diseases, 2nd ed. CBS Publishers and Distributors, Delhi.

Shastry, G.A. 1971. Veterinary Pathology, 3rd ed. Tirupati. 345p.


261

Thomson, R.Q. 1989. Special Veterinary Pathology, 1st ed. IBS Publishers and Distributors, Shahadara, Delhi.

Figure 1. Hydrocephalic calf having enlarged sac on head after partial fetotomy.



263

ABSTRACT

Assisted reproductive technology (ART) is a biotechnological tool used to achieve pregnancy in procedures such as artificial insemination, multiple ovulation and embryo transfer (MOET), in vitro maturation and fertilization (IVM/IVF), ovum pick up (OPU), cryopreservation, intracytoplasmic sperm injection (ICSI), sperm sexing, interspecies hybridization, transgenesis, and cloning. The successful use of ART and the different concerns associated with its application in humans have been extensively considered. Similarly, the application of ART in livestock production in developed countries has resulted in improved income and productivity. The Philippines, being a developing country, has to rely mainly on agriculture production to meet the increasing food demand of its 100 million population. To address food sufficiency and security concerns, the government has embraced the current biotechnological trend in food production, which includes research and development of ART to make it available in the livestock industry. The application of ART in the local livestock genetic improvement program could gradually speed up traditional and time-consuming breeding programs that will produce desired superior breeds in a shorter period with more reliable and promising outcomes. This paper

reviews the current trends and developments in the use of ART and its application in the local livestock improvement program.

Keywords: buffaloes, Bubalus bubalis, assisted reproductive technology, livestock production, genetic improvement program

InTRoduCTIon

Assisted reproductive technologies (ART) consist of different methods to achieve pregnancy by partial- or full-artificial means. In humans, ART have been medically practiced on couples with infertility problems, or even for the prevention of any communicable disease (Gout et al., 2011). The commonly used ART in humans include artificial insemination (Schwartz and Mayaux, 1982), in vitro maturation/in vitro fertilization (IVM/IVF) of oocytes (Forman et al., 2011; Gout et al., 2011), intracytoplasmic sperm injection (ICSI) (Gout et al., 2011), and embryo transfer (Betteridge, 2006; Dechaud et al., 2006; Rodriguez-Martinez, 2012). The cryopreservation of sperm, oocytes, zygotes, early cleavage-stage embryos, and blastocysts has become an integral part of most human IVF programs (Liebermann et al., 2002). Sperm sexing is a recent technology that allows the production

CURRENT TRENDS AND DEVELOPMENTS IN THE USE OF ASSISTED REPRODUCTIVE TECHNOLOGY AND ITS APPLICATION IN THE PHILIPPINE LIVESTOCK IMPROVEMENT PROGRAM-A REVIEW

Trinidad C. Fernando1,* and danilda H. duran2

1Central Luzon State University, Nueva Ecija, Philippines, *E-mail: [email protected] Philippine Carabao Center, Science City of Muñoz, Nueva Ecija, Philippines

Review Article


264

of offspring with pre-determined sex. Through ART, pre-implantation genetic diagnosis to detect the transmission of heritable diseases is also made possible (Ménézo et al., 2000).

The successful outcomes of ART and the different concerns associated with its application in humans have been extensively investigated. These concerns include issues on biometrics (Bakos et al., 2011; Forman et al., 2011; McMahon et al., 2011; Dickey et al., 2012; Haavaldsen et al., 2012; Koning et al., 2012); possible transmission of diseases, or abnormalities in the outcome of any ART procedure (Gout et al., 2011; Barton et al., 2012; Pasqualotto et al., 2002; Schippert et al., 2012; Sueldo et al., 2012; Yilmaz et al., 2012); and possibilities of having genetic disorders on ART-offsprings (Batcheller et al., 2011; Feng et al., 2011; Iliadou et al., 2011; Collier et al., 2012). Biometrics prior to application of ART is a major concern due to the incidence of the large offspring syndrome (LOS) (Dickey et al., 2012; Haavaldsen et al., 2012; Hori et al., 2010; Walker et al., 1996) causing difficulty during delivery that risks the lives of both mother and baby.

Recent studies, however, find no concern on the success of ART in relation to biometrics (Bakos et al., 2011; Koning et al., 2012). LOS is characterized by more and irregular abortions, longer gestation length, higher birth weight, more dystocia, skewed sex ratio favorable to male calves, higher level of perinatal mortality, and congenital malformations (van Wagtendonk-de Leeuw, 2006). Although LOS may be uninfluenced by the adult liveweights, the birth weight trait appears not to be heritable (Walker, 1996) and could be avoided by modification of the culture systems in the production of embryos (van Wagtendonk-de Leeuw, 2006). Disease transmission was found controllable in the application of ART vis-à-vis

employing needed interventions and washings to eliminate disease contamination (van Wagtendonk-de Leeuw, 2006; Gout et al., 2011). Similarly, there is an increased interest in the putative link between ART and genetic imprinting disorders (Batcheller et al., 2011; Feng et al., 2011; Iliadou et al., 2011).

In spite of the few risks posted by ART, its importance in addressing infertility problems in humans could not be underestimated. In fact, commercialization of ART is an increasing reality in both developed and developing countries. Similarly, application of ART in livestock production is enormous resulting in considerable improvement on income and productivity in the developed countries. Most reports on the achievements of various biotechnological tools for reproduction are in cattle, which include semen processing and handling for artificial insemination (AI), estrus/ovulation synchronization, super/multiple ovulation and embryo in vivo collection, IVM/IVF of oocytes and production of embryos, cloning by somatic cell nuclear transfer, and sperm-sexing technology to produce offsprings with pre-determined sex. Significant accomplishments have been reported in cattle and other ruminants in developed countries (Rodriguez-Martinez, 2012).

The Philippines, being an agriculture-based developing country, has to rely mainly on agriculture production to meet the increasing food demand of its population of 100 million. To address food sufficiency and security concerns, the government has embraced the current biotechnological trend in food production, which includes research and development of ART to make it available in the livestock industry. Most of the native breeds of animals here are of inferior genetics in terms of milk and meat production compared to their imported counterparts. The production of upgraded and purebred genetically superior animals is


265

necessary to satisfy the local demand for milk and meat. The development and application of ART in local livestock production, particularly in genetic improvement, could gradually lead traditional and time-consuming genetic breeding programs into a new era thus producing desired upgraded superior breeds faster with more reliable and promising outcomes.

Application of ART in the Philippine livestock improvement program has been confined in cattle with emphasis in water buffalo (Bubalus bubalis), due to its important role in the agricultural economy. Here and in developing countries in Asia, the water buffalo provides milk, meat, and draft power. It is also used in some Mediterranean and Latin American countries as a source of milk and meat for specialized markets (Perera, 2011). With the water buffaloes renowned for difficulties in the implementation of ART with both males and females being problematic (Tatham et al., 2003; Hufana-Duran, 2008), there is a current need for faster multiplication of superior genotypes and conservation of endangered buffalo breeds. Recent advances in ART, including in vitro embryo production methodologies, offer enormous opportunities not only in improving productivity but also in using buffaloes to produce novel products for applications to human health and nutrition (Singh et al., 2009). With a comprehensive knowledge on the reproductive cycle of buffaloes (Perera, 2011), these biotechnological tools are now being used to boost buffalo production. As such, ART-capable research institutions are now taking on the challenge of assuring sufficient quality meat and milk products for the next generation. This paper reviews the current trends and developments in the use of ART and its application in the livestock improvement program in the Philippines.

Assisted reproductive biotechnologies

Artificial insemination (AI)This technology is the artificial method of

introducing semen into a female for the purpose of fertilization. Although this is also used as fertility treatment in humans, it is commonly used in livestock breeding, particularly in cattle, water buffaloes, and pigs. It remains the most important ART in developing countries (Willadsen, 1986; Wilmut, 1997; Blondin et al., 2009; Seidel, 2009; Lu et al., 2010; Morrell and Rodriguez-Martinez, 2010; Rodriguez-Martinez, 2012). It is commonly used in studies exploring animal reproductive behaviors and mechanisms (Ballester et al., 2007; Carvalho et al., 2007; Garcia et al., 2008; Oropeza et al., 2010; Underwood et al., 2010; Di Francesco et al., 2011). AI is usually employed for other ART currently being used (Vecchio et al., 2012; Lu et al., 2010; Rodriguez-Martinez, 2012).

In the Philippines, small-scale carabao raisers outnumber the large-scale raisers (http://www.bas.gov.ph/?ids=downloads_view&id=759), thus having widely dispersed animal raisers using a genetically improved bull as a breeding scheme is not practical. To improve buffalo breeds throughout the country at a faster rate, a mobile breeding scheme (i.e., through AI) is needed. The National Crossbreeding Program, spearheaded by the Philippine Carabao Center (PCC), aims to genetically transform the swamp buffaloes into milk- and meat-type animals by crossing and sustained backcrossing with the riverine breed through AI and natural mating.

Upgrading native carabaos and backcrossing crossbred buffalos with purebred riverine germplasm have been actively pursued through an expanded AI program in thousands of villages in the country. In 2011, PCC served 45,240


266

farmers owning 48,289 buffaloes, covering 7,793 barangays in 831 municipalities and cities in 74 provinces of the 15 regions of the country. This significantly increased the number of services by 80% over that of 2010 (PCC Annual Report, 2011). In 2013, a total of 71,273 AI services for 53,455 female carabaos were carried out covering 6,524 barangays in 860 municipalities and cities in 73 provinces. The services were made possible by 932 AI technicians composed of 428 village-based technicians, 433 from local government units, 4 from National Dairy Authority (NDA), and 67 from PCC (PCC Annual Report, 2013). A total of 1,336 calves on the ground were monitored in 2013 as a result of the 2012 breeding services of the active bulls. The AI activities will help improve the livestock industry in the country.

Multiple ovulation and embryo transfer (MOET)

This technology is used to produce breeds with superior quality in a short period. In multiple ovulations, female animals are hormonally manipulated to produce more than the normal quantity of eggs. After which, the donor is either artificially inseminated or mated with a bull. The resultant embryos are collected on Day 7 (Cruz et al., 1992; van Wagtendonk-de Leeuw, 2006), then either transferred fresh to the recipient female animal or cryopreserved for future use expecting 60 to 70% or 50 to 60% pregnancy rate, respectively (Betteridge, 2006).

Embryo transfer (ET) is a process where the collected embryo is placed into the uterus of a surrogate mother to establish pregnancy. It has been employed in animal husbandry to facilitate the production of genetically superior animals. In dairy management, repeat breeding is a big factor affecting economic success. The effectiveness of the

transfer of frozen-thawed embryos in establishing pregnancy in repeat-breeding Holstein cattle showed that ET is an alternative in the treatment of repeat breeding (Dochi et al., 2008). To increase pregnancy rate following ET, luteolysis during the first week of transfer should be prevented to reduce incidence of embryonic mortality (Misra et al., 1999).

In the Philippines, PCC has reported one successful pregnancy in water buffalo through MOET (Jha et al., 1996). While Fresco (2001) reported MOET success in cattle, its application in water buffalo is limited by the poor response of this animal to superovulation treatment (Cruz et al., 1992).

In vitro maturation and fertilization (IVM/IVF)The introduction of IVF in 1978 has

revolutionized the lives of millions of human couples previously unable to conceive (Forman et al., 2011). IVM/IVF is a process by which an egg is matured and then fertilized by sperm outside the body, specifically in a carbon dioxide incubator. IVF research studies have been launched as this technology provides an opportunity to produce embryos for genetic manipulation, ET, and basic research in developmental physiology. It can also be exploited for emerging biotechnologies such as transgenesis and cloning.

In livestock, the first IVF calf was born in 1981 from oocytes recovered surgically from stimulated cows (Brackett, 1982). Development of reliable culture systems includes using TCM 199 or Synthetic Oviductal Fluid (SOF) with growth factors (EGF, IGF) and hormone (FSH) supplements and gas atmospheres with low oxygen tension. Many attempts had been performed in 1990 up to 2000s to increase efficiency. Most systems used serum and co-culture and these were

http://en.wikipedia.org/wiki/Ovum

http://en.wikipedia.org/wiki/Fertilisation

http://en.wikipedia.org/wiki/Spermatocyte


267

identified as part of the cause of the large offspring syndrome (LOS).

Advancement in IVM/IVF research was tremendous resulting in an increasing interest in in vitro embryo production (IVEP) technologies for faster propagation of superior germplasm. This has been demonstrated in cattle (Rodriguez-Martinez, 2012), water buffalo (Hufana-Duran et al., 2004; 2007; 2008), goat, pigs, sheep, and horses (Gupta and Nandi, 2011). Investigations on IVEP have been the subject of few reports with their usefulness for both basic research and commercial application (Katska-Ksiazkiewicz et al., 2004). IVF techniques overcome problems on male infertility providing means to use separated live sperm in a dead-dominated sperm population (Hufana-Duran et al., 2005), thus enabling bulls with semen of low post-thaw motilities to reproduce. One aspect that may still change in the future is automation and miniaturization of the IVF process, by better mimicking in vivo environment achieved by conventional microdrops/well systems and reducing the damage/influence of handling,

e.g., outside-the-incubator environment and in light (van Wagtendonk-de Leeuw, 2006).

At present, IVF can be considered a mature technology wherein an average of 20 to 30% of OPU oocytes develop into transferable embryos at Day 7. In 2003 alone, more than half a million (584,762) bovine embryos were reported to have been transferred, with America still the center of most ET activities (45% of transfers). Europe and South America have each accounted for 20% of the transfers (Betteridge, 2006). The potential of ET in disease control (Stringfellow et al., 2004; Wrathall et al., 2004) and in improving livestock production has already been seen and proven in developed countries as a result of annual increases in ET activities (Figure 1) (Betteridge, 2006).

November 2004 (data kindly provided by the Canadian Holstein Association as cited by Betteridge (2006)).

Although IVEP efficiency has improved, embryo yield and development is still the subject of present researches to further improve efficiency and success rate. The source of oocytes

Figure 1. Embryo transfer activity in Holstein dairy cattle in Canada until November 2004 [data kindly provided by the Canadian Holstein Association as cited by Betteridge (2006)].


268

significantly affected post-fertilization embryo development based on the evaluation of the effects of oocyte source and quality on subsequent embryo development in water buffalo (Hufana-Duran et al., 2009). Also, higher overall IVEP efficiency was recorded in cattle compared with buffalo when ovaries from an abattoir were used as oocyte donors (Neglia et al., 2003).

In spite of the limited success of IVEP, the technology has great potential to improve the genetic progress of buffalo through the maternal lineage (Hufana-Duran et al., 2008). Embryo cryopreservation and the potential impact of the ovum pick-up (OPU) technique combined with IVEP critically contribute to the diffusion of ET procedures in the field and on genetic improvement of buffalos (Drost, 2007). Hence, IVEP could considerably improve the efficacy and logistics of embryo transfer and the production of genetically superior animals.

In the Philippines, initial efforts on the development and application of IVM/IVF techniques in water buffaloes were initiated at PCC and had resulted in the birth of live healthy crossbred (Ocampo et al., 1996) and riverine calves (Hufana-Duran et al., 2004; 2007; 2008) after ET. These have demonstrated the possibility of using this technology in the production of genetically superior embryos that can support the genetic improvement program. To date, IVM/IVF is the tool in the production of riverine embryos used for ET in the villages to produce riverine buffaloes, using swamp buffaloes of farmers as recipient animals (Publico, 2008). This technology provided the opportunity to use retired and slaughtered riverine buffaloes as sources of eggs and IVF in using sperm from genetically superior bulls to produce a genetically superior embryo. The establishment of a satellite embryo biotechnology laboratory of PCC

in India in 2001 where river buffalo embryos were produced through IVM/IVF and transported to the Philippines in a frozen state, enabled the production of river buffalo calves in swamp buffalo recipients (Hufana-Duran et al., 2007). This was followed by the demonstration of twinning using ET techniques out of IVM/IVF purebred riverine buffalo embryos (Hufana-Duran et al., 2008).

Currently, production of embryos in the livestock industry through OPU/IVF and subsequent embryo cryopreservation has resulted in the transport of (top) genetics throughout the world thereby globalizing breeding programs. Also, transport of embryos is easier, cheaper, and allows for improved risk management of disease transmission compared to transport of live animals (van Wagtendonk-de Leeuw, 2006).

Ovum pick up (OPU)OPU is a technique used to collect eggs

from live donor-animals and have the eggs subjected to IVM/IVF to produce an embryo with desired genetics. This technique employs ultrasound-guided follicular aspiration where a vaginal probe captures the ovarian follicular images, transmits them to an ultrasound machine, and a long needle is used to aspirate the follicular oocyte. This technique allows the use of genetically superior females as sources of eggs, thus optimizing the female contribution to genetic progress and the production of genetically superior animals. Studies showed that this technique could be done two times a week to juvenile females and those that are at the early trimester of pregnancy, without compromising their reproductive performance and health (Garcia and Salaheddine, 1998; Su et al., 2012). In 2008, Liang et al. (2008) demonstrated IVEP in buffalo using sexed sperm and oocytes from OPU. Production of offspring combining OPU


269

with other available reproductive technologies such as IVEP and vitrification for direct ET appears as a promising combination of good applicability in breeding (Rodriguez-Martinez, 2012).

To hasten the genetic improvement program in the Philippines, notwithstanding the limited number of imported riverine buffaloes that serve as breeding herd, the use of OPU could optimize the reproductive potential of the available females. Studies in Italy and China noted the potential impact of OPU technique combined with IVEP in the diffusion of ET procedures in the field and on genetic improvement of buffaloes (Gasparrini, 2002; Drost, 2007). In the current application of OPU, more efforts have to be made to optimize both repeated OPU retrieval and, particularly, the current IVM procedures, which appear to be the major limiting factors for a satisfactory IVF at present (Rodriguez-Martinez, 2012). Recently, a buffalo calf was born (Aquino et al., 2014) out of embryos produced from oocytes retrieved by OPU (Duran et al., 2013). The sub-optimality and the costs-related issues make these techniques of little application in cattle breeding. However, their potential application in water buffalo genetic improvement cannot be underestimated particularly in swamp buffalo-dominated countries like the Philippines.

CryopreservationCryopreservation is a process where

cells or whole tissues are preserved by freezing them in sub-zero temperatures. Two basic techniques are currently being used in oocyte and embryo cryopreservation; the slow-freezing and vitrification. Slow-freezing is a process where extracellular water crystallizes, resulting in an osmotic gradient that draws water from the intracellular compartment till intracellular

vitrification occurs. In vitrification, both intra and extracellular compartments apparently vitrify after cellular dehydration has already occurred. Owing to these differences, the terms “freezing” and “thawing” are relevant to the slow-freezing process while “cooling” and “warming” are relevant to vitrification (Saragusty and Arav, 2011).

In the area of AI, semen cryopreservation is an important technique to preserve and maximize the semen from genetically superior bulls and allow long-term storage and transport. The technique is important for the cryobanking of animal germplasm from endangered species and exploitation of genetically superior sires through AI (Hussain et al., 2011). Semen cryopreservation is usually done under low temperature where these can be stored for very long periods without losing their viability to fertilize. In spite of its wide application for AI, such protocol still needs further optimization to obtain higher fertilization and birth rates. There have been different studies carried out in developing and improving procedures in the collection and cryopreservation of semen, as well as the effects of extenders, freeze rates, and post-thaw quality on the fertility and success in AI (Rasul et al., 2000, 2001; Sansone et al., 2000; Sukhato et al., 2001; Ballester et al., 2007; Lessard et al., 2009; Hussain et al., 2011 Krishnakumar et al., 2011).

Fragmentation level (i.e., comet assay of sperm nuclear DNA) has been used for quality assessment of the cryopreserved semen samples suggesting no induced immature sperm production in dairy bulls when semen collection is performed as frequently as possible (i.e., weekly) (Mukhopadhyay et al., 2011). Recent work has developed a more sensitive and less costly technique of laser irradiation of spermatozoa at certain wavelengths and exposure times suitable

http://en.wikipedia.org/wiki/Cell_(biology)

http://en.wikipedia.org/wiki/Biological_tissue

http://en.wikipedia.org/wiki/Temperature


270

for improvement of buffalo semen quality (Abdel-Salam et al., 2011). However, studies also showed that season affects semen’s post-thaw viability, wherein sperm samples processed during the cooler seasons are significantly better than during the summer season (Koonjaenak et al., 2007). Exact temperature when the adverse effect of environment is manifested on spermatogenesis remains to be examined.

Cryopreservation also plays an important role in the preservation of oocytes and embryos. With it, the female genetics can be preserved in the form of germplasm (oocytes and embryos), ovarian tissue, or entire ovary for transplantation. In addition, germplasm can be collected and cryopreserved at different maturation stages (Saragusty and Arav, 2011). In humans, several commercial IVF laboratories have been developed in the United States, Canada, and Europe (mainly in Germany, Italy, France, and Holland) with the purpose of obtaining viable embryos from females that may not be able to produce descendants through conventional techniques (Faber et al., 2003). To get hold of these viable germplasm for such IVF for commercial purposes, cryopreservation is the key point in these commercial laboratories. In livestock, processing and cryopreservation of swamp buffalo’s semen is one major task taken into account by PCC. At present, a total of 32 bulls are used as semen donors. In support of the expanded AI program of the country, the semen processing laboratories in PCC at CLSU/UPLB have processed a total of 105,357 doses of frozen semen. Some doses of frozen semen are also stored in PCC’s Semen Bank for genetic resource conservation (PCC Annual Report, 2011).

Intracytoplasmic sperm injection (ICSI)This is an IVF procedure where a single

sperm is injected directly into the inner part of the oocyte using microinjectors or micropipettes. Among the different assisted fertilization methods used, ICSI has emerged as the ultimate technique to allow fertilization with ejaculated, epididymal, and testicular spermatozoa (Palermo, 2012). A study in humans shows that ICSI using whole sperm produces superior fertilization rates compared to ICSI using sperm heads. Although oocytes fertilized and zygote cleavage rates were not different between the two sperm sources, oocytes injected with whole sperm produced embryos of higher cell stage (Johnson et al., 2004). No significant difference was found on obstetric and perinatal outcomes of singleton births after ART with blastocyst transfer versus nonblastocyst transfer on women who conceived using IVF and ICSI (Fernando et al., 2012).

ICSI is also widely explored in livestock with most studies focusing on the recovery, improvement, and effects of oocyte quality on blastocyst development after IVF and ICSI (Kobayashi et al., 2006; Liang et al., 2008; Jacobson et al., 2010; Catalá et al., 2012). A failure of syngamy after ICSI has been confirmed molecularly through lacking expression of paternally expressed gene in swamp buffalo (Chankitisakul et al., 2012). ICSI has also been used in the in vitro development of vitrified buffalo oocytes (Liang et al., 2011), as well as investigated the effects of vitrification cryoprotectant treatment and cooling method on the viability and development of buffalo oocytes after ICSI (Liang et al., in press). In spite of the available techniques developed in the success of producing offspring using ICSI, this still warrants further research to increase success rate in producing viable and healthy offspring.

The application of ICSI in the livestock improvement program specifically in the


271

production of pre-determined offspring is possible using sexed-sperm for fertilization. This procedure allows optimized use of sexed-sperm which is expensive and motility post-sorting is low. The rescue of genetically superior males whose sperm motility is poor can be addressed by this technique.

Sperm sexingSeveral new reproductive technologies

are foreseen developing further in the near future, with obvious advantages for breeding (Rodriguez-Martinez, 2012). Among these emerging ART technologies being continuously explored is the sexing of spermatozoa for directed production of desirable sex (Liang et al., 2008; Blondin et al., 2009; Seidel, 2009; Lu et al., 2010; Morrell and Rodriguez-Martinez, 2010; Vecchio et al., 2012). Sperm sexing is carried out using modified flow cytometric cell-sorting of fluorescent dye-loaded living spermatozoa. In cattle, sorting between X- and Y-chromosome-bearing spermatozoa is successful due to differences in its DNA contents (Garner and Seidel, 2008). Such technology is very promising, providing opportunities for sex selection of in vitro-produced embryos, surpassing the need for sex diagnosis of the embryos (which is reliably done today by DNA probing, specific for the Y chromosome, but still time-consuming and perhaps not risk-free) (Blondin et al., 2009; Carvalho et al., 2010). In spite of its importance in animal breeding, sex-sorting is too costly, slow, and yields weak spermatozoa with reduced lifespan (Lonergan, 2007; Gosálvez et al., 2011). With such drawback, efforts are now focused on producing competitively cheap sexed spermatozoa products for use in the livestock industry (Hayakawa et al., 2009; Underwood et al., 2010).

Most commercial sperm sorting has been with cattle where the company Cogent in the United

Kingdom was the first to commercially produce sexed sperm (Garner and Seidel, 2008). Although it started slow, there has been an explosion in the production of sexed bovine sperm in 2007 and 2008, with an estimate of 4 million doses for 2008 (Sharpe and Evans, 2009). Despite its limitations such as reduced fertility, the acceptance of current sexed sperm products is increasing, specifically in the production of females for dairy farmers (Seidel, 2009).

Dairy-based enterprises in the Philippines are still in the infant stage, far behind dairy production in developed countries. With the current initiatives of the government to advance these enterprises, PCC responds to challenges not only in producing high milk-yielding breeds but also in assuring the production of breedable females, which can only be done through the use of sexed sperm during AI. While the use of sexed sperm is at the planning stage, PCC would be refining such technology to be widely available and fully disseminated to more recipients.

Interspecies hybridization, transgenesis, and cloning

ART techniques have also been used to produce hybrids, transgenic, and cloned animals. Interspecies hybridization of bovids has been successfully carried out between domestic cattle and buffalo. Such hybrids are important in improving livestock production and management of diseases that impede productivity in tropical Africa (Owiny et al., 2009). In spite of the feasibility of intergeneric embryo transfer between buffalo and cattle, no pregnancy was achieved after transfer of buffalo embryos to synchronized Holstein heifers. Preliminary success was achieved on nucleus transfer of swamp buffalo fetal and adult somatic nuclei into enucleated bovine oocytes and


272

subsequent development to the blastocyst stage (Drost, 2007). A study investigating hybridization between cattle and its closest relative, the African buffalo (Syncerus caffer caffer), was carried out in an attempt to produce cattle - buffalo hybrid embryos in vitro. Although fertilization occurred in vitro, the barrier to hybridization occurs in the early stages of embryonic development (Owiny et al., 2009).

Transgenesis and cloning are emerging ART that have been widely applied not only in the animal industry but also in other bio-related industries. The first mammal born after nuclear transfer cloning was reported by Willadsen (1986). In spite of its enormous scientific significance, this discovery failed to trigger much public concern, possibly because the donor cells were derived from pre-implantation stage embryos. Wilmut (1997) described the successful application of almost exactly the same method, but using the nuclei of somatic cells from an adult mammal, to create Dolly, the sheep. Since 1997, a number of different species including pigs, goats, horses, cats, among others, have been cloned with the somatic cell nuclear transfer (SCNT) technique. In spite of some studies conducted on transgenesis and cloning (Uhm et al., 2007; Verma et al., 2008; Neerja et al., 2009; Huang et al., 2010; Aman et al., 2011; Wani, 2011), the technology has relatively low success rates. Also, there seems to be substantial problems with the welfare of some of the cloned animals, where cloning is used both within basic research and the biomedical sector. Aside from the above concerns, the ethical issues in these technologies limit their application. Nevertheless, the next step is in the development and implementation of cloning in the agricultural production system and several animals (Vajta and Gjerris, 2006). Currently, a cloned transgenic cow expressing omega-3 fatty

acids, which is important to human health, has been produced (Wu et al., 2012).

In the Philippines, cloning by SCNT has been initiated (Atabay et al., 2007). Though embryos were produced in using fibroblast cells from ear skin, full-term development after embryo transfer failed. Problems associated with the failure remain an issue of investigation. Although SCNT and hybridization technologies have hinted potential application in the production/cloning of super animals that produce more milk and meat, which may further improve livestock production, problems have yet to be solved.

ConCluSIon

ART has been gradually becoming popular for humans having problems related to reproduction. Recent studies and developments in ART in humans continuously help medical personnel in the successful outcome of any ART procedures conducted. The future and benefits of such technology have also been clearly seen in the livestock industry where continuous research works are now being carried out for its smooth and efficient application, aiming for food security for the increasing human population worldwide. The use of ART has greatly revolutionized the production of superior-quality meat and milk products. The next challenge is sufficient quantity of such products to satisfy demand.

ART such as the embryo transfer technology can be very important in using genetically superior animals as donors of embryos and the native animals as surrogate mothers. Such ART could as well improve the animals’ breed with respect to health and disease prevention, and prepare the animal industry in producing breeds


273

that are adaptable to the changing climate the world is experiencing. Emerging technologies like interspecies hybridization could also improve livestock production and management, or prevent diseases. Transgenesis and cloning would enable us to develop, preserve, or even improve the desired traits that we would like to produce. A promising ART through sperm – sexing would enable us to produce the desired sex of offspring. Optimizing all these ART, the scientific community has a social responsibility to help feed the growimg population. This should be in tandem with the government, which needs to support any biotechnological option in modernizing food production as the traditional ways of farming would not be enough to satisfy the food demand. Before the commercial exploitation and use of these ART techniques in livestock breeding programs, particularly in buffalo, their initial success warrants further research up to the cellular and molecular levels to clearly and fully understand the complex mechanisms involved in animal reproduction.

Semen cryopreservation and cryobanking have recently been taken with much research focus in the application of ART in buffaloes. In the remote and hardly accessible areas of the Philippines, the AI, coupled with cryopreservation techniques, has been a widely used ART option in the livestock industry, particularly in piggery, goat, cattle, and buffalo husbandry. More work has to be done to fine-tune the protocol on every animal in order to increase efficiency, fertilization, and birth rates. Other ART such as OPU, MOET, IVEP, ICSI, Cryopreservation, and SCNT are already being performed in research laboratories in the Philippines, mostly under the experimental and trial stages. The success and efficiency of the IVEP-cryopreservation-ET have been demonstrated (Hufana-Duran et al., 2004;

2007; 2008), but attempts to commercialize this technology are stalled by the inadequacy of donors of female gametes. Also, some sensitive issues are being raised by cause-oriented groups against transgenesis and cloning. While government supports the modernization of agriculture by adopting biotechnology, we may see in the future how these ART practices would boost the livestock industry in the Philippines.

REFERENCES

Abdel-Salam, Z., S.H.M. Dessouki, S.A.M., Abdel-Salam, M.A.M. Ibrahim and M.A. Harith. 2011. Green laser irradiation effects on buffalo semen. Theriogenology, 75: 988-994.

Aquino F., E.P. Atabay, E.C. Atabay, M. Ocampo, P.G. Duran, P.B. Pedro, D.H. Duran, R.V. de Vera and L.C. Cruz. 2014. In vitro embryo production and transfer of bubaline embryos using oocytes derived from transvaginal ultrasound-guide follicular aspiration (TUFA). Buffalo Bull., 32: 545-548.

Aman, G., S. Ruchi and S. Karn. 2011. Production of cloned transgenic embryos using buffalo (Bubalus bubalis) embryonic stem cell-like cells isolated from in vitro fertilized and cloned blastocysts. Cell. Reprogram., 13: 263-272.

Bakos, H.W., R.C. Henshaw, M. Mitchell and M. Lane. 2011. Paternal body mass index is associated with decreased blastocyst development and reduced live birth rates following assisted reproductive technology. Fertil. Steril., 95: 1700-1704.

Ballester, J., A. Johannisson, F. Saravia, M. Håård, H. Gustafsson, D. Bajramovic and


274

H. Rodriguez-Martinez. 2007. Post-thaw viability of bull AI-doses with low-sperm numbers. Theriogenology, 68: 934-943.

Barton, S.E., S.A. Missmer, K.F. Berry and E.S. Ginsburg. 2012. Female cancer survivors are low responders and have reduced success compared with other patients undergoing assisted reproductive technologies. Fertil. Steril., 97: 381-386.

Batcheller, A., E. Cardozo, M. Maguire, A.H. DeCherney and J.H. Segars. 2011. Are there subtle genome-wide epigenetic alterations in normal offspring conceived by assisted reproductive technologies. Fertil. Steril., 96: 1306-1311.

Betteridge, K.J. 2006. Farm animal embryo technologies: achievements and perspectives. Theriogenology, 65: 905-913.

Blondin, P., M. Beaulieu, V. Fournier, N. Morin, L. Crawford, P. Madan and W.A. King. 2009. Analysis of bovine sexed sperm for IVF from sorting to the embryo. Theriogenology, 71: 30-38.

Carvalho, N.A.T., M. Nichi, C.E.P. Henriquez, C.A. Oliveira and P.S. Bruselli. 2007. Use of human Chorionic Gonadotropin (hCG) for fixed-time artificial insemination in buffalo (Bubalus bubalis). Anim. Reprod., 4: 98-102.

Carvalho, J.O., R. Sartori, G.M. Machado, G.B. Mourão and M.A.N. Dode. 2010. Quality assessment of bovine cryopreserved sperm after sexing by flow cytometry and their use in in vitro embryo production. Theriogenology, 74: 1521-1530.

Catalá, M.G., D. Izquierdo, M. Rodriguez-Prado, S. Hammami and M.T. Paramio. 2012. Effect of oocyte quality on blastocyst development after in vitro fertilization

(IVF) and intracytoplasmic sperm injection (ICSI) in a sheep model. Fertil. Steril., 97: 1004-1008.

Chankitisakul, V., T. Tharasanit, N. Phutikanit, K. Tasripoo, T. Nagai and M. Techakumphu. 2012. Lacking expression of paternally-expressed gene confirms the failure of syngamy after intracytoplasmic sperm injection in swamp buffalo (Bubalus bubalis). Theriogenology, 77: 1415-1424.

Collier, A.C., K.A. Milam, L.R.A. Rougée, A. Sugawara, Y. Yamauchi and M.A. Ward. 2012. Upregulation of Ugt1a genes in placentas and fetal livers in a murine model of assisted reproduction. Placenta, 33: 77-80.

De Araujo Berber, R.C., E.H. Madureira and P.S. Baruselli. 2002. Comparison of two Ovsynch protocols (GnRH versus LH) for fixed timed insemination in buffalo (Bubalus bubalis). Theriogenology, 57: 1421-1430.

Dechaud, H., T. Anahory, L. Reyftmann, V. Loup, S. Hamamah and B. Hedon. 2006. Obesity does not adversely affect results in patients who are undergoing in vitro fertilization and embryo transfer. Eur. J. Obstet. Gyn. R. B., 127: 88-93.

Dickey, R.P., X. Xiong, R.E. Gee and G. Pridjian. 2012. Effect of maternal height and weight on risk of preterm birth in singleton and twin births resulting from in vitro fertilization: a retrospective cohort study using the society for assisted reproductive technology clinic outcome reporting system. Fertil. Steril., 97: 349-354.

Di Francesco, S., G. Neglia, D. Vecchio, M.S. Novoa, A. Balestrieri and L. Zicarelli. 2011. Efficiency of artificial insemination


275

in Mediterranean Italian buffalo during two seasons. Reprod. Domes. Anim., 46: 99-100.

Dochi, O., K. Takahashi, T. Hirai, H. Hayakawa, M. Tanisawa, Y. Yamamoto and H. Koyama. 2008. The use of embryo transfer to produce pregnancies in repeated-breeding dairy cattle. Theriogenology, 69: 124-128.

Domingo, J.L. and J.G. Bordonaba. 2011. A literature review on the safety assessment of genetically modified plants. Environmental International, 37: 734-742.

Drost, M. 2007. Advanced reproductive technology in the water buffalo. Theriogenology, 68: 450-453.

Duran, P.G., D. Hufana-Duran, J.V. del Rosario, F.P. Aquino, P.B. Pedro, E.R.S. Maylem, R.V. de Vera, E.P. Atabay and L.C. Cruz. Follicular dynamics during ovum pick-up at different intervals in water buffalo, In 10th Annual Conference of the Asian Reproductive Biotechnology Society, Vietnam.

Faber, D.C., J.A. Molina, C.L. Ohlrichs, D.F.V. Zwaag and L.B. Ferré. 2003. Commercialization of animal biotechnology. Theriogenology, 59: 125-138.

Feng, C., S. Tian, Y. Zhang, J. He, X.M. Zhu, D. Zhang, J.Z. Sheng and H.F. Huang. 2011. General imprinting status is stable in assisted reproduction-conceived offspring. Fertil. Steril., 96: 1417-1423.

Fernando, D., J.L. Halliday, S. Breheny and D. Lindsay. 2012. Outcomes of singleton births after blastocyst versus nonblastocyst transfer in assisted reproductive technology. Fertil. Steril., 97: 579-584.

Forman, E.J., N.R. Treff and R.T. Scott Jr. 2011. Fertility after age 45: From natural conception to assisted reproductive technology and beyond. Maturitas, 70: 216-

221.Fresco, M.O. 2001. Scientists find twinning

technology successful. BAR Digest., 3(1).Garcia, A.R., B. Nahum, J. Lourenco, N. Costa,

K. Goncalves, A. Miyazaki, M. Yoshio, C. De Andrade, A. Furugen and R.P. de Arruda. 2008. The association of medroxyprogesterone to the Ovsynch protocol for the fixed time artificial insemination of cyclic buffaloes (Bubalus bubalis) in the Eastern Amazon. Acta Amazon., 38: 369-377.

Garcia, A. and M. Salaheddine. 1998. Effects of repeated ultrasound-guided transvaginal follicular aspiration on bovine oocyte recovery and subsequent follicular development. Theriogenology, 50: 575-585.

Garner, D.L. and G.E. Seidel Jr. 2008. History of commercializing sexed semen for cattle. Theriogenology, 69: 886-895.

Gasparrini, B. 2002. In vitro embryo production in buffalo species: State of the Art. Theriogenology, 57: 237-256.

Gosálvez, J., R.A. Ramirez, C. López-Fernández, F. Crespo, K.M. Evans, M.E. Kjelland and J.F. Moreno. 2011. Sex-sorted bovines spermatozoa and DNA damage: I. Static features. Theriogenology, 75: 197-205.

Gout, C., N. Rougier, P. Oger, B. Dorphin, V. Kahn, L. Jacquesson, J.P. Ayel and C. Yazbeck. 2011. Assisted reproductive technologies in HIV patients: A comprehensive review of indications, techniques and results. Gynecol. Obstet. Fertil., 39: 704-708.

Gupta, P.S.P. and S. Nandi. 2011. Isolation and culture of preantral follicles for retrieving oocytes for the embryo production: Present status in domestic animals. Reprod. Domes. Anim., 47: 513-519.


276

Gupta, P.S.P., S. Nandi, B.M. Ravindranatha and P.V. Sarma. 2001. Effect of commercially available PMSG on maturation, fertilization and embryo development of buffalo oocytes in vitro. Reprod. Fert. Develop., 13: 355-360.

Gupta, P.S.P., S. Nandi, B.M. Ravindranatha and P.V. Sarma. 2002. In vitro culture of buffalo (Bubalus bubalis) preantral follicles. Theriogenology, 57: 1839-1854.

Haavaldsen, C., T. Tanbo and A. Eskild. 2012. Placental weight in singleton pregnancies with and without assisted reproductive technology: a population study of 536 567 pregnancies. Hum. Reprod., 27: 576-582.

Hayakawa, H., T. Hirai, A. Takimoto, A. Ideta and Y. Aoyagi. 2009. Superovulation and embryo transfer in Holstein cattle using sexed sperm. Theriogenology, 71: 68-73.

Hori, N., M. Nagai, M. Hirayama, T. Hirai, K. Matsuda, M. Hayashi, T. Tanaka, T. Ozawa and S. Horike. 2010. Aberrant CpG methylation of the imprinting control region KvDMR1 detected in assisted reproductive technology-produced calves and pathogenesis of large offspring syndrome. Anim. Reprod. Sci., 122: 303-312.

Huang, B., K. Cui, T. Li, X. Wang, F. Lu, Q. Lui, F.M. Da Silva and D. Shi. 2010. Generation of buffalo (Bubalus bubalis) transgenic chimeric and nuclear transfer embryos using embryonic germ-like cells expressing enhanced green fluorescent protein. Reprod. Domes. Anim., 45: 103-108.

Hussain, S.A., C. Lessard and M. Anzar. 2011. Quantification of damage at different stages of cryopreservation of endangered North American bison (Bison bison) semen and the effects of extender and freeze rate on

post-thaw sperm quality. Anim. Reprod. Sci., 129: 171-179.

Hufana-Duran D., P.B. Pedro, H.V. Venturina, R.D. Hufana, A.L. Salazar Jr, P.G. Duran and L.C. Cruz. 2004. Post-warming hatching and birth of live calves following transfer of in vitro-derived vitrified water buffalo (Bubalus bubalis) embryos. Theriogenology, 61: 1429-1439.

Hufana-Duran D., P.B. Pedro, A.L. Salazar, H.V. Venturina, P.G. Duran and L.C. Cruz. 2007. River buffalo calves (2n=50) delivered to term by swamp buffalo recipients (2n=48) out of in vitro-derived vitrified embryos. Livest. Sci., 107: 213-219.

Hufana-Duran D., P.B. Pedro, A.L. Salazar Jr, H.V. Venturina, P.G. Duran, Y. Takahashi, Y. Kanai and L.C. Cruz. 2008. Twin calf production in water buffaloes following non-surgical transfer of in vitro-produced-vitrified embryos. Philippine Journal of Science, 137: 99-104.

Iliadou, A.N., P.C.J. Janson and S. Cnattingius. 2011. Epigenetics and assisted reproductive technology. J. Intern. Med., 270: 414-420.

Jacobson, C.C., Y.H. Choi, S.S. Hayden and K. Hinrichs. 2010. Recovery of mare oocytes on a fixed biweekly schedule, and resulting blastocyst formation after intracytoplasmic sperm injection. Theriogenology, 73: 1116-1126.

Jha, S.S, H.V. Venturina, F.A. Adriano, P.G. Duran, N. Lorenzo, O.F. Smith and L.C. Cruz. 1996. Studies on embryo movement and multiple ovulation and embryo transfer (MOET) in water buffaloes, p. 48-49. In Abstracts of Water Buffalo Researches in the Philippines 1981-1995 PCC-DA.

Johnson, J.E., H.L. Higdon, D.W. Blackhurst


277

and W.R. Boone. 2004. Expectation for oocyte fertilization and embryo cleavage after whole sperm versus sperm head intracytoplasmic sperm injection. Fertil. Steril., 82: 1412-1417.

Katska-Ksiazkiewicz, L., B. Rynska, B. Gajda and Z. Smorag. 2004. Effect of donor stimulation, frozen semen and heparin treatment on the efficiency of in vitro embryo production in goats. Theriogenology, 62: 576-586.

Kobayashi, M., E.S. Lee and Y. Fukui. 2006. Cysteamine or Beta-mercaptoethanol added to a defined maturation medium improves blastocyst formation or porcine oocytes after intracytoplasmic sperm injection. Theriogenology, 65: 1191-1199.

Koonjaenak, S., P. Pongpeng, S. Wirojwuthikul, A. Johannisson, A. Kunavongkrit and H. Rodriguez-Martinez. 2007. Seasonality affects post-thaw plasma membrane intactness and sperm velocities in spermatozoa from Thai AI swamp buffaloes (Bubalus bubalis). Theriogenology, 67: 1424-1435.

Krishnakumar, S., D.P. Whiteside, B. Elkin and J.C. Thundathil. 2011. Evaluation of an animal protein-free semen extender for cryopreservation of epididymal sperm from North American bison (Bison bison). Theriogenology, 76: 252-260.

Koning, A.M.H., M.A.Q. Mutsaerts, W.K.H. Kuchenbecher, F.J. Broekmans, J.A. Land, B.W. Mol and A. Hoek. 2012. Complications and outcome of assisted reproduction technologies in overweight and obese women. Hum. Reprod., 27: 457-467.

Lessard, C., J. Danielson, K. Rajapaksha, G.P. Adams and R. McCorkell. 2009.

Banking North American buffalo semen. Theriogenology, 71: 1112-1119.

Li, J., H. Zhang, D. Wang, B. Tang, C. Chen, D. Zhang, M. Zhang, J. Duan, H. Xiong and Z. Li. 2011. Rice omics and biotechnology in China. Plant Omics, 4: 302-317.

Liang, X.W., Y.Q. Lu, M.T. Chen, X.F. Zhang, S.S. Lu, M. Zhang, C.Y. Pang, F.X. Huang and K.H. Lu. 2008. In vitro embryo production in buffalo (Bubalus bubalis) using sexed sperm and oocytes from ovum pick-up. Theriogenology, 69: 822-826.

Liang, Y.Y., T. Phermthai, T. Nagai, T. Somfai and R. Parnpai. 2011. In vitro development of vitrified buffalo oocytes following parthenogenetic activation and intracytoplasmic sperm injection. Theriogenology, 75: 1652-1660.

Liang, Y.Y., K. Sriratana, T. Phermthai, T. Somfai, T. Nagai and R. Parnpai. 2012. Effects of vitrification cryoprotectant treatment and cooling method on the viability and development of buffalo oocytes after intracytoplasmic sperm injection. Cryobiology, 65(2): 151-156.

Liebermann, J., F. Nawroth, V. Isachenko, E. Isachenko, G. Rohimi and M.J. Tucker. 2002. Potential importance of vitrification in reproductive medicine. Biol. Reprod., 67: 1671-1680.

Lonergan, P. 2007. State-the-art embryo technologies in cattle. Soc. Reprod. Fertil. Suppl., 64: 315-325.

Lu, Y., M. Zhang, S. Lu, D. Xu, W. Huang, B. Meng, H. Xu and K. Lu. 2010. Sex-preselected buffalo (Bubalus bubalis) calves derived from artificial insemination with sexed sperm. Anim. Reprod. Sci., 119: 169-171.

McMahon, C.A., J. Boivin, F.L. Gibson, J.R.W.


278

Fisher, K. Hammarberg, K. Wynter and D.M. Saunders. 2011. Older first-time mothers and early postpartum depression: a prospective cohort study of women conceiving spontaneously or with assisted reproductive technologies. Fertil. Steril., 96: 1218-1224.

Ménézo, Y.J.R., A. Veiga and J.L. Pouly. 2000. Assisted reproductive technology (ART) in humans: Facts and uncertainties. Theriogenology, 53: 599-610.

Misra, A.K., M.M. Rao, R. Kasiraj, N.S. Reddy and H.C. Pant. 1999. Factors affecting pregnancy rate following nonsurgical embryo transfer in buffalo (Bubalus bubalis): A retrospective study. Theriogenology, 52(1): 1-10.

Morrell, J.M. and H. Rodriguez-Martinez. 2010. Practical applications of sperm selection techniques as a tool for improving reproductive efficiency. Veterinary Medicine International, 2011(2).

Mukhopadhyay, C.S., A.K. Gupta, B.R. Yadav, I.S. Chauhan, A. Gupta, T.K. Mohanty and V.S. Raina. 2011. Effect of cryopreservation on sperm chromatic integrity and fertilizing potential in bovine semen. Livest. Sci., 136: 114-121.

Neerja, W., K. Neetu and T. Shuchita. 2009. Optization of embryo culture conditions for increasing efficiency of cloning in buffalo (Bubalus bubalis) and generation of transgenic embryos via cloning. Cloning Stem Cells., 11: 387-395.

Neglia, G., B. Gasparrini, V.C. Di Brienza, R. Di Palo, G. Campanile, G.A. Presicce and L. Zicarelli. 2003. Bovine and buffalo in vitro embryo production using oocytes derived from abattoir ovaries or collected by transvaginal follicle aspiration.

Theriogenology, 59: 1123-1130.Oropeza, A.J., A.F. Rojas, M.A. Velazquez, J.D.

Muro, Y.C. Marquez and L.T. Vilanova. 2010. Efficiency of two timed artificial insemination protocols in Murrah buffaloes managed under semi-intensive system in the tropics. Trop. Anim. Health Prod., 42: 1149-1154.

Owiny, O.D., D.M. Barry, M. Agaba and R.A. Godke. 2009. In vitro production of cattle x buffalo hybrid embryos using cattle oocytes and African buffalo (Syncerus caffer caffer) epididymal sperm. Theriogenology, 71: 884-894.

Palermo, G.D., Q.V. Neri, D. Monahan, J. Kocent and Z. Rosenwaks. 2012. Development and current applications of assisted fertilization. Fertil. Steril., 97: 248-259.

Pasqualotto, F.F., L.M. Rossi-Ferragut, C.C. Rocha, A. Iaconelli Jr. and E. Borges Jr. 2002. Outcome of in vitro fertilization and intracytoplasmic injection of epididymal and testicular sperm obtained from patients with obstructive and nonobstructive azoospermia. J. Urology., 167(4): 1753-1756.

Perera, B.M.A.O. 2011. Reproductive cycles of buffalo. Anim. Reprod. Sci., 124: 194-199.

Presicce, G.A., E.M. Senatore, G. De Santis, R. Stecco, G.M. Terzano, A. Borghese and G.J. De Mauro. 2002. Hormonal stimulation and oocyte maturational competence in prepuberal Mediterranean Italian buffaloes (Bubalus bubalis). Theriogenology, 57: 1877-1884.

Pablico, S. 2008. Bright prospect of biotechnology at PCC [Philippine Carabao Center]. Agriculture, 1: 24-27.

Rasul, Z., N. Ahmad and M. Anzar. 2001. Changes


279

in motion characteristics, plasma membrane integrity, and acrosome morphology during cryopreservation of buffalo spermatozoa. J. Androl., 22: 278-283.

Rasul, Z., M. Anzar, S. Jalali and N. Ahmad. 2000. Effect of buffering systems on post-thaw motion characteristics, plasma membrane integrity, and acrosome morphology of buffalo spermatozoa. Anim. Reprod. Sci., 59: 31-41.

Rodriguez-Martinez, H. 2012. Assisted reproductive techniques for cattle breeding in developing countries: A critical appraisal of their value and limitations. Reprod. Domest. Anim., 47: 21-26.

Sansone, G., M.J.F. Nastri and A. Fabbrocini. 2000. Storage of buffalo (Bubalus bubalis) semen. Anim. Reprod. Sci., 62, 55-76.

Santos, S.S.D., F.C. Biondi, M.S. Cordeiro, M.S. Miranda, J.K. Dantas, J.R. Figueiredo and O.M. Ohashi. 2006. Isolation, follicular density, and culture of preantral follicles of buffalo fetuses of different ages. Anim. Reprod. Sci., 95: 1-15.

Saragusty, J. and A. Arav. 2011. Current progress in oocyte and embryo cryopreservation by slow freezing and vitrification. Reproduction, 141: 1-19.

Schippert, C., P. Soergel, I. Staboulidou, C. Bassler, S. Gagalick, P. Hillemanns, K. Buehler and G.J. Garcia-Rocha. 2012. The risk of ectopic pregnancy following tubal reconstructive microsurgery and assisted reproductive technology procedures. Arch. Gynecol Obstet, 285: 863-871.

Schwartz, D. and M.J. Mayaux. 1982. Female fecundity as a function of achieving a first ongoing pregnancy. Because in many Western age, results of artificial

insemination in 2193 nulliparous women with developed countries ever more women are desiring to have azoospermic husbands. New Engl. J. Med., 306: 404-406.

Seidel, G.E. Jr. 2009. Sperm sexing technology-the transition to commercial application. Theriogenology, 71: 1-3.

Sharpe, J.C. and K.M. Evans. 2009. Advances in flow cytometry for sperm sexing. Theriogenology, 71: 4-10.

Singh, B., M.S. Chauhan and S.K. Singla. 2009. Reproductive biotechniques in buffaloes (Bubalus bubalis): status, prostects and challenges. Reprod. Fert. Develop., 21: 499-510.

Stringfellow, D.A., M.D. Givens and J.G. Waldrop. 2004. Biosecurity issues associated with current and emerging embryo technologies. Reprod. Fert. Develop., 16: 93-102.

Su, L., S. Yang, X. He, X. Li, J. Ma, Y. Wang, G.A. Presicce and W. Ji. 2012. Effect of donor age on the developmental competence of bovine oocytes retrieved by ovum pick up. Reprod. Domest. Anim., 47: 184-189.

Sukhato, P., S. Thongsodseang, A. Utha, N. Songsasen. 2001. Effects of cooling and warming conditions on post-thawed motility and fertility of cryopreserved buffalo spermatozoa. Anim. Reprod. Sci., 67: 69-77.

Sueldo, C.M., A.A. Milki and R.B. Lathi. 2012. Successful frozen blastocyst transfers after failed fresh transfers in assisted reproduction technologies with hydrosalpinx. American Journal of Obsterics and Gynecology, 206: e4-e6.

Tatham, B.G., T. Feehan and R. Pashen. 2003. Buffalo and cattle hybrid embryo development is decreased by caffeine treatment during in vitro fertilization.


280

Theriogenology, 59: 709-717.Uhm, S.J., M.K. Gupta, T. Kim and H.T. Lee. 2007.

Expression of enhanced green fluorescent protein in porcine-and bovine-cloned embryos following interspecies somatic cell nuclear transfer of fibroblasts transfected by retrovirus vector. Mol. Reprod. Dev., 74: 1538-1547.

Underwood, S.L., R. Bathgate, M. Ebsworth, W.M.C. Maxwell and G. Evans. 2010. Pregnancy loss in heifers after artificial insemination with frozen-thawed, sex-sorted, re-frozen-thawed dairy bull sperm. Anim. Reprod Sci., 118: 7-12.

Vajta, G. and M. Gjerris. 2006. Science and technology of farm animal cloning: state of the art. Anim. Reprod. Sci., 92: 211-230.

van Wagtendonk-de Leeuw, A.M. 2006. Ovum pick up and in vitro production in the bovine after use in several generations: A 2005 status. Theriogenology, 65: 914-925.

Vecchio, D., G. Neglia, A. Bella, P. Rossi, E.M. Senatore, G.A. Presicce and B. Gasparrini. 2012. Seasonal effect on pregnancy rates and early embryonic mortality in Pluriparous Mediterranean buffaloes (Bubalus bubalis) following artificial insemination with sexed semen. Reprod. Fert. Develop., 24: 117-117.

Verma, V., S.K. Gautam, P. Palta, R.S. Manik, S.K. Singla and M.S. Chauhan. 2008. Development of a pronuclear DNA microinjection technique for production of green fluorescent protein-expressing bubaline (Bubalus bubalis) embryos. Theriogenology, 69: 655-665.

Walker, S.K., K.M. Hartwich and R.F. Seamark. The production of unusually large offspring following embryo manipulation: Concepts

and challenges. Theriogenology, 45: 111-120.

Wani, N.A. 2011. Cloning by somatic cell nuclear transfer (SCNT) in Camelids. The 8th Annual Conference of the Asian Reproductive Biotechnology Society (abstract). Guilin City, Guangxi, China.

Willadsen, S.M. 1986. Nuclear transplantation in sheep embryos. Nature, 320: 63-65.

Wilmut, I., A.E. Schnieke, J. McWhir, A.J. Kind and K.H. Campbell. 1997. Viable offspring derived from fetal és adult mammalian cells. Nature, 385: 810-813.

Wrathall, A.E., H.A. Simmons, D.J. Bowles and S. Jones. 2004. Biosecurity strategies for conserving valuable livestock genetic resources. Reprod. Fert. Dev.,16: 103-112.

Wu, X., H. Ouyang, B. Duan, D. Pang, L. Zhang, T. Yuan, L. Xue, D. Ni, L. Cheng, S. Dong, Z. Wei, L. Li, M. Yu, Q.Y. Sun, D.Y. Chen, L. Lai, Y. Dai and G.P. Li. 2012. Production of cloned transgenic cow expressing omega-3 fatty acids. Transgenic Res., 21: 537-543.

Yilmaz, N., D. Uygur, M. Dogan, E. Ozgu, B. Salman and L. Mollamahmutoglu. 2012. The effect of follicular antimullerian hormone levels of non-obese, non-hyperandrogenemic polycystic ovary syndrome patients on assisted reproduction outcome. Gynecol. Endocrinol., 28: 162-165.

Zhou, H. and H. Zhang. 2005. Effects of growth factors on in vitro development of caprine preantral follicle oocytes. Anim. Reprod. Sci., 90: 265-272.


281

ABSTRACT

Traditional animal healthcare practices, also called ethnoveterinary medicine, provide low cost alternatives in situation where western type drugs and veterinary services are not available or are too expensive. These practices were developed and practiced through trial and error methods and deliberate experimentation and is therefore, less documented and not uni+versally recognized and for these reasons, it has no place in mainstream veterinary medicine. The majority raise buffalo or buffaloes. The present study was carried out in the purposively selected arid region of Rajasthan. A multistage stratified random sampling design was used to select the districts, blocks, villages and sample households. A sample of 240 households was selected for the present study. Data were collected personally through a well structured and pre-tested interview schedule. Keeping these facts in view, the present study was conducted with the specific objectives to document the consultation and vaccination pattern followed by the buffalo farmers of the region for the treatment of their sick animals as well as their isolation. It was found that majority of the households (66.25%) were initially providing self medication using traditional practices and in cases of severity of disease/ailment, village

quack was consulted. Vaccination of buffalo was followed in only 48.75% of the selected households. In addition, only 36 households (31.25%) the sick animals were isolated from the herd. A variety of traditional practices were observed being followed for treatment of various ailments and diseases of the buffalo with the use of locally available material, herbs, etc.

Keywords: buffaloes, Bubalua bubalis, ethno-veterinary practices, Raika, arid region, traditional and household

INTRODUCTION

The Rebari/Raika are the most numerous pastoral group in western India which live in Rajasthan and Gujarat, with some fraction living in Punjab, Haryana, and Madhya Pradesh and in other states. The term Raika is applied exclusively to the Rebari of the Marwar area of Rajasthan which denotes camel breeder with it. Sources from the colonial period describe the Maru Raika as camel breeders and the Godwar Raika as buffalo raisers, but this does not apply any longer, since both groups herd buffalo as well as cow (Kohler, 1997). The Raika have retained their reputation

ETHNO-VETERINARY TREATMENT OF BUFFALO IN ARID REGION OF RAJASTHAN, INDIA

Aishwarya Dudi* and M.l. Meena

Indian Council of Agricultural Research, Central Arid Zone Research Institute, Krishi Vigyan Kendra, Pali-Marwar, Rajasthan, India, *E-mail: [email protected]

Original Article



282

as “camel people” until today, but only a minority now engages in camel breeding. The majority raise buffalo or buffaloes. Nomadic pastoralism is critically important to the economy of Rajasthan. Aridity and poor soils, especially in the western districts, make it well-suited to a combination of agriculture and livestock rearing (IIRR, 1994). Here Raika agro-pastoralists combine buffalo husbandry with crop production for part of the year. The large number of animals in Marwar area of Rajasthan cannot be supported by existing fodder resources. Therefore a significant number of animals migrate annually in search for grazing grounds. It is interesting to see that the Raikas have build up a large network of traditional healers (bhopa, ghuni and daam) and make use of a large variety of indigenous plants, minerals and animal products to cure their buffalo especially under local circumstances (Maithias, 1996; Catley, 1999). Therefore the present study was undertaken to estimate the extent of traditional healthcare system with buffalo husbandry in Raikas which is also referred to as ethnobotany / ethno-pharmacology.

Marwar region of Rajasthan comprises of four districts viz., Jodhpur, Jalore, Pali and Barmer state of Rajasthan. This region is located between 24.45 to 26.75 degree N latitude and 72.48 to 74.20 degree E longitude at an altitude ranging between 212 m to about 220 m above mean sea level with a total geographical area of 51,387 square kilometers (DOA, 2014). Livestock rearing forms an important occupation in rural areas of this region. The contribution of livestock sector is as high as 60 to 65% of the total income from agriculture in the region (Singh, 2014). Buffalo farming is an important component of livestock rearing system in the region. Besides providing benefits of nutrition, additional income and employment to the rural households, the importance of this enterprise

is highlighted in light of the direct bearing it has on the agriculture of the region. This enterprise provides farm families the farmyard manure for maintaining the fertility of the saline and salt affected soil and draught power for performing the farming operations in the rainfed condition and important by it provides insurance against frequent crop failures in the region. The buffalo farming though holds immense importance in regional rural economy; it is still a household enterprise. The size of the buffalo herd maintained in the region is small varying from 25-50 animal heads including the young one also (Sah, 1999). The relatively difficult terrain and poor accessibility to the remote villages have led to a lesser influence of scientific buffalo farming technologies in the region. In areas where these technologies find accessibility, small herd owners operating in difficult biophysical conditions usually prefer cheaper veterinary aid in order to keep the buffalo farming enterprise cost effective.

The modern veterinary options are in most cases are cost intensive as well as several issues as that of accessibility, availability, regularity, etc. are involved. The Government veterinary aid available in the region is too meager to support all the buffalo keepers. This all have ultimately lead to development of an alternative knowledge base among the buffalo owners of the region for the treatment of their buffalo which is commonly called as indigenous or traditional knowledge. These traditional methods of treatment besides being cheaper, accessible and prepared from locally available material, are also better adapted to the local conditions. The very fact that traditional methods or knowledge base has its base in the years of experimentations by the local people in their own conditions on sustained basis makes them worth the attention of the research system by means of


283

documenting and validating them. Keeping these facts in view, the present study was conducted with the following specific objectives:

1. To document the consultation and vaccination pattern followed by the buffalo farmers of the region for the treatment of their sick animals as well as their isolation.

2. To document the traditional methods of treatment followed for the various ailment/diseases of buffalo.

MATERIAlS AND METHODS

Marwar region of Rajasthan comprises of four districts viz., Jodhpur, Jalore, Pali and Barmer state of Rajasthan. This region is located between 24.45 to 26.75 degree N latitude and 72.48 to 74.20 degree E longitude at an altitude ranging between 212 m to about 220 m above mean sea level with a total geographical area of 51,387 square kilometers (DOA, 2014). The present study was carried out in the purposively selected arid region of Rajasthan. A multistage stratified random sampling design was used to select the districts, blocks, villages and sample households. On the basis of composite index of agricultural development calculated by Narain et al. (1995), then 2 districts of the region were classified into two strata-one of the developed district and second of poorly developed district. From each stratum, one district was selected randomly. Thus, the district Jodhpur represented developed and district Pali poorly developed district of the study area. Further, for the next two stages of sampling, i.e., blocks and villages, two strata on the basis of distance from the respective headquarters were formed and random selection of 4 blocks and 8 villages was done. From each of the selected 8 villages, 30 households representing the small (1 to

5 buffaloes), medium (6 to 10 buffaloes) and large (above 10 buffaloes) herd size categories were selected randomly and probability proportionate to the size. Thus, samples of 240 households were selected for the present study (Meena, 2005). The data were collected personally through a well structured and pre tested interviewed schedule. This was also supported by the informal discussion with farmers as well as the guided field walk with them. The data thus collected were compiled, tabulated and subjected to the appropriate statistical tools to draw meaningful conclusions. It was computed by multiplying total score of the respondents by 100 and divided by the maximum obtainable score under each practice.

Mean Percent Score = x 100

RESUlTS AND DISCUSSION

Background information of the respondentsThe data presented in results that 85.7%

respondents had farming as their main occupation while, only one buffalo keepers 0.8% opted for caste occupation as his main occupation. There were 10.4% respondents who were practicing business as a main occupation and agriculture as subsidiary while, only 3.5% buffalo owners had service either government or private as main occupation. The present study was not formulated with any of the specific objectives for studying the background information of the respondents. The data presented in Table 1 revealed that out of a total of 240 respondents 51.5% were in the middle age groups of 26 to 45 years. The respondents above 45 and below 26 years of age constituted 38.89% and 09.6% respectively. On the basis of size of land

Total score obtaintedMaximaum obtainable score


284

holding, the respondents were grouped into three categories i.e. small, medium and large. Results shows that majority 57.8% of buffalo owners had big land holding i.e. more than 2 hectare, out of which large buffalo owners population was the high comprising 53.3%. There were only 36.7% and 09.2% of buffalo keepers who possessed medium (1 to 2 hectare) and small (less than 1 hectare) land holdings respectively. it is evident from the contents in results nearly half (47.9%) of the total buffalo keepers were from high income group, 40% respondents were from medium income group (Rs 1001 to 5000 per month), whereas only 4.5% and 8.6% of respondents belonged to low (<1000 per month) and very high (> 10000) income groups, respectively.

An in-depth understanding of existing buffalo farming practices would help not only in getting a comprehensive account of the level of

development of livestock in the locale, but also in planning and taking up any research or development activity. An attempt, therefore, was made, to study the traditional practices of treatment followed for buffalo farming being followed in the study area. In addition, the consultation pattern adapted for treatment of sick animals, their isolation and vaccination pattern was studied. The results are discussed under the following subheads:

Consultation pattern for sick animalsThe data presented in Table 1 clearly

indicated that majority of the households (66.25%) were initially providing self medication using traditional practices and in cases of severity of disease/ailment, village quack was consulted. While 11.25% of the household resorted to self medication only and depended on village quack. However, in 09.17% of the households village

Table 1. Frequency distribution of the selected households on basis of existing methods of treatment of buffalo.

S. No.

Particulars

Frequency and percentage distribution Pooled

(N=240)Jodhpur(N=120)

Pali(N=120)

I Consultation pattern for sick animals1 Veterinarian 7 (05.83) 2 (01.67) 9 (03.75)2 Livestock extension officer (LEO) 13 (10.13) 7 (05.83) 20 (8.33)3 Village quack 15 (12.50) 7 (05.83) 22 (09.17)4 Self medication 11 (09.17) 16 (13.33) 27 (11.25)5 Self medication followed by village quick 85 (70.83) 74 (61.67) 159 (66.25)6 Village quick followed by LEO/Veterinarian 09 (07.50) 12 (10.00) 21 (08.75)II Vaccination of buffalo 1 Yes 83 (69.17) 34 (28.33) 117 (48.75)2 No 41 (34.17) 90 (75.00) 131 (54.58)

III Isolation of sick animals1 Yes 49 (40.83) 26 (21.67) 75 (31.25)2 No 73 (60.83) 98 (81.17) 171 (71.25)


285

quack was initially consulted, and when the cases were beyond their comprehension, LEO/veterinarians were consulted. Veterinary staffs including veterinarians and livestock extension officers (LEO) were reported consulted by 08.33% of the selected households only.

Vaccination of buffaloVaccination of buffalo was followed in

only 48.75% of the selected households. Further, a considerable difference could also be observed between the number of households following vaccination of buffalo in district 1 (83) and district 2 (34). Findings lead to infer that as high as about 75% of the households in district 2 did not vaccinate their animals (Table 1).

Isolation of sick animalsIt is evident from the same table that

out of the 240 selected households, in only 75 (31.25%) cases the sick animals were isolated from the herd. The number of households following isolation of sick animals was higher in district 1 (49) as compared to that in district 2 (26). The present findings are in line with those of Pandey (1996); Mohanty (1999). The above results clearly indicated lack of awareness among the buffalo farmers and farm women of the region about the importance of isolating the sick animals from the herd to prevent spread of diseases.

Traditional methods of treatment of various buffalo diseases

The appreciation of traditional wisdom of farmers has been operationalised through proper documentation by the researchers and development personnel. Traditional/ indigenous herbs and practices for treating animals are locally available, easily accessible, culturally appropriate

and, therefore, readily comprehensible. In the present section an attempt has been to synthesize the documented traditional methods of treatment followed by the selected households in the study locale.

DiarrhoeaA total of nine indigenous methods for

treatment of diarrhoea in buffalo were documented in the study locale. From the Table 2, it is evident that arvi (Colocasia esculenta) plant was of great use in treatment of diarrhoea of animals in the study area. Paste of its dry leaves, frothed solution of green leaves and stem of this plant were used by 66.25%, 55.83% and 55.42% of the households, respectively. Majority of the households were also reported giving frothed solution of soybean (Glycine max.) 55.41% and paste of soaked chickpea (Cicer arietinum) 36.67%, respectively. Paste of latjeera (Aleurites moluccuna) root, ground tuber of gethi (Dioscorea kumaunesis), mustard oil and paste of dry leaves of bhang (Cannabis sativa) plant were also used in 31.25%, 37.50%, 33.33% and 26.67% of the selected households, respectively. Use of paste of dry leaves of bhang, soaked chickpea, and stem of arvi plant, ground gethi tuber and mustard oil were observed to be higher in district Jodhpur as compared to another district. While, use of frothed solution of soybean and green leaves of arvi (Clocasia esculenta) plant, paste of latjeera (Aleurites moluccuna) root were higher in district Pali. The indigenous methods of treatment of diarrhoea as identified in the study locale were found to be different from those reported by Gupta and Patel (1994); Pandey (1996); Hamed (1998); Mandal (1999); Mohanty (1999).

Bloat (Affara)Affara was one of the most widely prevalent


286

health disorder reported by the respondents (Table 3). In a large percent of the households, asofoetida (Ferula assafoetida) and ajwain (Trachyspermum ammi) (87.92%), ajwain and black salt (79.17%), and asofoetida and ajwain with jaggery (56.67%),

frothed solution of soybean (55.83%) and Tumba furit powder (Citrullus colocynths) (53.75%) were given to the buffalo suffering from Affara. In a considerable percent of households, powder of roasted chamsur (Lepidium latifolium) (50.00%),

Table 2. Traditional methods of treatments of diarrhea in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Frothed solution of soybean (Glycine max.) 44 (36.67) 89 (74.17) 133 (55.41)2 Frothed solution of green leaves of Arvi plant 49 (40.83) 85 (70.83) 134 (55.83)3 Paste of Latjeera (Aleurites moluccuna) roots 19 (15.83) 56 (46.67) 75 (31.25)4 Paste of dry leaves of Arvi plant 66 (55.00) 93 (77.5) 159 (66.25)5 Stem of Arvi plants (Clocasia esculenta) 80 (66.67) 53 (44.17) 133 (55.42)6 Paste of dry leaves of bhang (Cannbis sativa) 39 (32.50) 25 (20.83) 64 (26.67)7 Paste of soaked chickpea (Cicer arietinum) 43 (35.83) 45 (37.50) 88 (36.67)8 Ground Gethi tuber (Dioscorea sativa) 53 (44.17) 37 (30.83) 90 (37.50)9 Mustard (Brassica compestris) oil 47 (39.17) 33 (27.50) 80 (33.33)

Table 3. Traditional methods of treatments of bloat (affara) in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Ajwain (Trachyspermum anum) and block salt 97 (80.83) 93 (77.50) 190 (79.17)2 Asofoetida (Ferula assafoetida) and ajwain 108 (90.0) 103 (85.83) 221 (87.92)3 Asofoetida and Ajwain with jaggry 55 (45.83) 81 (67.50) 136 (56.67)4 Tumba fruit powder (Citrullus colocynths) 60 (50.00) 69 (57.50) 129 (53.75)

5Paste of fennel (Foeniculum vulgare), Chirayata (Swertia chirata), ginger (Zingiber officinale)

43 (35.82) 73 (60.83) 116 (48.33)

6Powder of roasted Chamsur (Lepidium latifolium)

37 (30.83) 83 (69.17) 120 (50.00)

7 Paste of Gurju stem (Pistacia integerrima) 25 (20.83) 77 (64.17) 102 (42.50)8 Sesame cake (Sesamum indicum) 56 (46.67) 29 (24.17) 85 (35.42)9 Frothed solution of soybean 53 (44.17) 81 (67.50) 134 (55.83)

10Drumstick (Moringa plerygospermar) leaves with cow milk

20 (6.67) 50 (41.67) 70 (29.17)


287

paste of fennel (Foeniculum vulgare), chirayata (Swertia chirata) and ginger (Zingiber officinale) (48.33%), paste of gurju stem (42.50%), sesame cake (Sesamum indicum) (35.42%) and Drumstick (Moringa plerygospermar) with cow milk (29.17%) were fed as a treatment of affara. Ajwain was used with many things like black salt, asofoetida, asafetida and jaggery for treatment of affara in a higher percent of households in district Jodhpur as compared to district Pali. Similar was the case with use of sesame cake while the rest of the methods of treatment were in use in a higher percent in district Jodhpur. Use of ginger, ajwain, asafoetida, hing and black salt for the treatment of bloat was also reported by De (1994); Pandey (1996); Mohanty (1999). Anti-flatulence property of asofoetida and ajwain was confirmed by Singh et al. (1994).

Snake/Scorpio biteDrumstick (Moringa plerygoperma) leaves

and ground turmeric powder (60.33%), neem leaves, hibiscus leaves and Marva (66.09%) leaves, Burgad leaves (Ficcuss bengalensis), custard apple (Annona squamosa) leaves and mixture of 1 part of

linseed oil (45.33%), 1 part of eucalyptus oil, 1 part of gingelly oil (22.50%) applied on the site of bite by snake/Scorpio (Table 4). The findings confirm with the findings of Amitendu, et al. (2004); Sah and Dubey (2010).

Internal parasitesSix different treatments were reported by

the respondents for tackling the problem of internal parasites in animals. Neem (Azadirachta indica) leaves, leaves of marva (Origanum majorana), roots of Latjeera (Aleurites moluccuna) and decoction prepared from leaves, roots and bark of karanj (Artemisia hilagirica) with jaggery and bran were used in 52.50%, 49.58%, 38.33% and 38.33% of the selected households, respectively (Table 5). Paste prepared from bark of simal (Ceiba pentandra) tree and wheat bran was also used by a sizable percent of households for treatment of internal parasites. A considerable difference in use of paste of simal tree bark, roots of latjeera and decoction of leaves, roots, bark of Karanj with jaggery and wheat bran was noted between the households belonging to the two districts. Feeding

Table 4. Traditional methods of treatments of snake and scorpio bite in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1Drumstick (Moringa plerygoperma) leaves and turmeric powder

80 (66.67) 70 (58.33) 150 (62.50)

2 Hibiscus leaves and marva (Origanum majorana) 85 (70.83) 75 (62.50) 160 (66.67)

3Burgad (Ficcuss bengalensis), custard apple (Annona squamosa) leaves and mixture of one part of linseed oil

78 (65.00) 30 (25.00) 108 (45.00)

4 1 part of eucalyptus oil and 1 part of gingelly oil 33 (27.50) 21 (17.50) 54 (22.50)


288

the extract of neem leaves as a treatment of internal parasites was also reported by Mandal (1999).

EctoparasitesAnimals affected with ectoparasites were

taken care of in a variety of ways in the households in the state. Rubbing of petrol (70.83%), burning of dry leaves and farm waste near animals (63.33%), roots of Goja grass (53.75%) and mustard oil (53.33%) on the body of affected animals were the most common ways to mitigate the ectoparasites. Bara nimbu (Citrus lemon), salt and mustard oil were applied externally in 42.92% and 53.33% of the households (Table 6). Application of paste of neem leaves (26.25%), burning of neem and akda (Calotropis gigantean) leaves near the buffalo herd (45.42%), rubbing frothed solution of ritha (Sapindus mukorossi) fruit (43.33%), rubbing extract of tobacco leaves (40.00%), kerosene (38.33%), vinegar (37.92%) were also found. Further, paste of lemon leaves, dry leaves of dhatura (Artemisia parviflora), haldi (Curcuma domestica) with lemon and sesame oil were practiced by 49.58%, 37.50%, 33.33% and 21.67% of the households, respectively.

Application of powder of dry leaves of pati (Artemisia parviflora), paste of leaves of custard apple (Annona squamosa), rubbing gammaxene with cow dung, crushed nephthalene balls in oil and DDT with ash on the body of affected buffalo were also practiced in the study locale. Creating fumes by burning of neem leaves near affected animals for tackling the problem of ectoparasites was also reported by De (1994); Pandey (1996); Mandal (1999). The finding is in line with that of Sah (1996) who reported burning of dry leaves and dry farm waste near such animals. Application of kerosene oil on the affected part of the animal was also reported by De (1994); Pandey (1996).

MastitisMost commonly used methods of treatment

of mastitis in the region involved application of honey (68.33%), paste of roots of doob grass (68.33%) on and inserting the root of doob grass (Cynodon dactylon) in the affected teat (78.33%). Paste of crushed kair fruits (Capparis deciua) was also applied on affected teat in 53.75% of the selected households (Table 7). A considerable percent of households were found applying paste

Table 5. Traditional methods of treatments of internal parasite in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Wheat bran 33 (27.50) 23 (19.17) 56 (23.33)2 Leaves of Marva (Origanum majorana) 53 (44.17) 66 (55.00) 119 (49.58)3 Neem leaves (Azadirachta indica) 69 (57.50) 57 (47.50) 126 (52.50)4 Paste of bark of Simal tree (Ceiba pentandra) 43 (35.82) 42 (35.00) 85 (35.42)5 Root of Latjeera (Aleurites moluccun) 30 (25.00) 62 (51.67) 92 (38.33)

6Decoction of leaves, root, bark of Karanj (Artemisia bilagirica)

19 (15.82) 73 (60.83) 92 (38.33)


289

of molasses on udder and hip point (34.17%) and paste of green crushed leaves of pilu (Salvaodora oleoides) tree (29.17%). In 33.75% and 24.17% of the households, ash was thrown and paste of fresh rhizome of haldi was applied on affected udder, respectively. The indigenous methods of treatment of mastitis as explained above were different from those reported by Gupta et al. (1996), Sah (1996); Mohanty (1999).

Foot and mouth disease (FMD)Foot and mouth disease locally known as

‘Khuriya and Bang’ was tackled in several ways in the selected households (Table 8). For foot lesions, the common indigenous treatments included application of muck on hooves of the affected animal or the animal is made to stand in the muck (55.00%), application of mustard oil and salt (51.25) and paste of haldi, doob grass and salt (44.17%). In substantial percent of households, paste of marva (Origanum majorana) leaves (38.75%) and paste of leave buds of pilu (Salvaodora oleoides) and karanj (Millettia pinnata) tree (35.00%) were also applied. Pouring the lime solution, petrol, phenyl

Table 6. Traditional methods of treatments of ectoparasite in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Bara nimbu (Citrus lemon) 47 (39.17) 56 (46.67) 103 (42.92)2 Crushed naphthalene balls in oil 32 (26.67) 40 (33.33) 72 (30.00)3 Dhatura (Artemisia parviflora) leaves 37 (30.83) 53 (44.17) 90 (37.50)4 Frothed solution of Ritha fruit (Sapindus mukorossi) 34 (28.33) 70 (58.33) 104 (43.33)5 Paste of Goja grass 60 (50.00) 69 (57.50) 129 (53.75)6 Mustard oil 59 (49.17) 69 (57.50) 128 (53.33)7 Paste of haldi (Curcuma domestica) with lemon 33 (27.50) 47 (39.17) 80 (33.33)8 Petrol 89 (74.17) 81 (67.50) 170 (70.83)9 Kerosene 49 (40.83) 43 (35.83) 92 (38.33)10 Vinegar 37 (30.83) 54 (45.00) 91 (37.92)11 DDT with ash 25 (20.83) 17 (14.17) 42 (17.50)12 Gammaxene with cow dung 26 (21.67) 18 (15.00) 44 (18.33)13 Sesame oil 33 (27.50) 19 (15.83) 52 (21.67)14 Paste of custard apple leaves (Annona squamosa) 28 (23.33) 49 (40.83) 77 (32.08)15 Paste of neem leaves 37 (30.83) 26 (21.67) 63 (26.25)16 Paste of lemon leaves 66 (55.00) 53 (44.17) 119 (49.58)17 Powder of dry leaves of Dhatura (Artemisia parviflora) 39 (32.50) 50 (41.67) 89 (37.08)18 Burning dry leaves of neem and ank () near the buffalo herd 43 (35.83) 66 (55.00) 109 (45.42)19 Burning of dry leaves and farm waste near buffalo herd 62 (51.67) 90 (75.00) 152 (63.33)20 Extract of tobacco leaves 55 (45.83) 41 (34.17) 96 (40.00)


290

Table 8. Traditional methods of treatments of foot and mouth diseases (FMD) in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

A Foot lesions1 Application of muck/animals made to stand in it 63 (52.50) 69 (57.50) 132 (55.00)2 Paste of haldi, doob grass and salt 49 (40.83) 57 (47.50) 106 (44.17)

3Paste of leaves buds of pilu and karanj (Millettia pinnata) tree

29 (24.17) 55 (45.83) 84 (35.00)

4 Paste of marva (Origanum majorana) leaves 40 (33.33) 53 (44.17) 93 (38.75)5 Pouring lime solution 55 (45.82) 31 (25.83) 86 (35.83)6 Mustard oil and salt 67 (55.82) 56 (46.67) 123 (51.25)7 Pouring kerosene 31 (25.82) 21 (17.50) 52 (21.67)8 Pouring petrol 40 (33.33) 27 (22.50) 67 (27.92)9 Pouring phenyl 43 (35.82) 21 (17.50) 64 (26.67)B Mouth lesions1 Application of ash 63 (52.50) 85 (70.83) 148 (61.67)2 Rubbing of salt 63 (52.50) 74 (61.67) 137 (57.08)

Table 7. Traditional methods of treatments of mastitis in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Honey applied on the affected teat 55 (45.83) 109 (90.83) 164 (68.33)

2Root of doob grass (Cynodone dactylon) into the affected teat

85 (70.83) 109 (90.83) 164 (68.33)

3 Paste of roots of doob grass 85 (70.83) 103 (85.83) 188 (78.33)4 Paste crushed kair fruits (Capparis decidua) 69 (57.50) 60 (50.00) 129 (53.75)5 Paste of fresh rhizome of haldi 27 (22.50) 31 (25.83) 58 (24.17)6 Paste of molasses applied on udder and hip point 49 (40.82) 33 (27.50) 82 (34.17)7 Paste of wood of pilu tree (Salvoadora oleoides) 21 (17.50) 49 (40.83) 70 (29.17)8 Ash thrown on affected udder 43 (35.82) 38 (31.67) 81 (33.75)


291

and kerosene on the hooves of the affected animal was practiced in 35.83%, 27.92%, 26.67% and 21.67% of the selected households respectively. Similar to the present finding, i.e., making the affected animal walk in mud to control foot lesions was also reported by Gupta and Patel (1991); Sah (1996); Mandal (1999). Pouring limewater on infected hooves as a treatment for foot lesions was also reported by Gupta and Patel (1991); Pandey (1996). For mouth lesions, in 61.67% of the households, ash was applied and in 57.08% salt was rubbed. Gupta and Patel (1991); Mandal (1999) also reported application of salt solution inside the mouth as well as between the hooves of animal affected with FMD.

FeverThe most common indigenous practices

followed in the study area for treatment of fever were feeding paste of kutaki (Gentiana kurroo) roots (60.00%), decoction of kilmodi (Eerberis aristata) roots and bark with sugar syrup (60.83%) and decoction of chalmodi (Geranium pratense)

leaves, roots and bark (52.92%). Concentrate solution of haldi (Abina cordifolia), leaves and paste of onion (Allium cepa), ajwain, dhania (Coriandrum sativum) and jaggery were also fed in 39.58% and 48.33% of the households (Table 9). In 54.17% of the households animal was drenched with solution of soybean, while in 47.50% of the households, paste of green leaves of brahmi (Woodfordia floribunda) was kept on forehead of animal for treatment of fever. The indigenous treatments provided to animals in case of fever in the study area were found to be different from those reported by Pandey (1996); Sah (1996); Mandal (1999).

Sprain/FractureThe indigenous treatments of sprain/

fracture followed in the selected households in the descending order of their extent of use were, application of warm paste of haldi (66.00%); paste of maitha (Polygonatum verticillatum), bhang (Cannabis sativa) and ash (48.33%); paste of haldi, doob and leaves of arandi (Ricinus communis) tree

Table 9. Traditional methods of treatments of fever in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Paste of Kutali roots (Gentiana kurroo) 47 (39.17) 97 (80.83) 144 (60.00)2 Decoction of Kilmodi roots (Eerbris aristata) 48 (40.00) 98 (81.67) 146 (60.83)3 Decoction of Chalmodi leaves (Geranium pretense) 54 (45.00) 73 (60.83) 127 (52.92) 4 Concentrate solution of haldi leaves 40 (33.33) 55 (45.83) 95 (39.58)

5Paste of onion (Allium cepa), ajwain, coriander (Coriandrum sativum)

49 (40.83) 67 (55.83) 116 ( 48.33)

6 Animal drenched with solution of soybean 73 (60.82) 57 (47.50) 130 (54.17)

7Paste of green leaves of Brabmi (Woodfordia floribunda) kept on forehead of affected buffalo

27 (22.50) 87 (72.50) 114 ( 47.50)


292

(30.83%); paste of leaves and roots of shauriya (Elaeodendron glaucum) (24.58%) and paste of haldi and lime 15.42% (Table 10). Use of haldi in the treatment of fracture was also reported by Darji (1993); Mandal (1999); Singh and Chauhan (2010).

WoundHaldi heated in ghee, juice of Haldi leaves

and powdered seeds of kusum (Schleichera oleosa) tree were used in 60.42%, 52.50% and 27.08% of the selected households, respectively, for treatment of wounds (Table 13). Application of haldi and ghee as an indigenous treatment of wounds was also reported by De (1994); Dudi and Singh (2007); Pandey (1996).

Skin diseasesIn case of skin diseases, paste of neem

leaves was applied on the affected area in 31.25% of the households, followed by 17.92% of households in which solution of roots leaves and bark of banbasa (Viola biflora) with honey was fed to affected animal (Table 11). Whole plant of

jharbari (Zizypus jujuba) was boiled in water and concentrated solution was fed to affected animal in 17.50% of households. Paste of henna (Lawsonia inermis) leaves and paste of jangli piyaz (Urginea indica) were fed in 16.25% and 11.67% households, respectively. The findings confirm with the findings of Karthikeyan and Chandrakandan (1996).

Retained placentaA perusal of Table 12 revealed that a total

of nine treatments were followed for expulsion of retained placenta, which were singly used, as well as in combination. In majority of the selected households, sugarcane (Saccharum officinarum) leaves (75.83%), bamboo (Bambusa arundinacea) leaves (69.58%), cotton seeds (56.25%) and whole barley (Cotoneaster accuminata) (48.33%) were used. However, in 47.08%, 40.00%, 40.00%, 33.33% and 31.25% of the households’ kina leaves (Sapium insigue), whole paddy (Oryza sativa), chickpea and cluster bean dry leaves, Riu (Cotoneaster accuminata) leaves and kusa leaves (Desmostachyya bipinnata) were used, respectively. In about 39.17% of the households, for expulsion

Table 10. Traditional methods of treatments of sprain/fracture in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Paste of haldi, doob grass and castor leaves 33 (27.50) 43 (35.00) 76 (31.67)

2Paste of Maitha (Polygonatum verticillatum), Bhang (Cannabis sativa) and ash

46 (38.33) 70 (58.33) 116 (48.33)

3 Warm paste of haldi 73 (60.83) 86 (71.67) 159 (66.25)

4Paste of leaves and roots of Shauriya (Elaeodendron glaucum)

23 (19.17) 36 (30.00) 59 (24.58)

5 Paste of haldi and lime 11 (09.17) 26 (21.67) 37 (15.42)


293

Table 13. Traditional methods of treatments of retain of placenta in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Sugarcane leaves (Saccharum officinarum) 83 (69.17) 99 (82.50) 182 (75.83)2 Bamboo (Bambusa arundinacea) leaves 80 (66.67) 87 (72.50) 167 (69.58)3 Kusa (Desmostachya bipinnata) leaves 39 (32.50) 36 (30.00) 75 (31.25)4 Whole paddy (Oryza sativa) 25 (20.82) 56 (46.67) 96 (40.00)5 Dry leaves of chickpea and cluster bean 63 (52.50) 33 (27.50) 96 (40.00)6 Whole barley (Horedeum vulgare) 51 (42.50) 65 (54.17) 116 (48.33)7 Cotton seeds (Gossypium arboretum) 37 (30.83) 98 (81.67) 135 (56.25)8 Kinna (Sapium insigue) leaves 25 (20.83) 88 (73.33) 113 (47.08)9 Riu (Cotoneaster accuminata) leaves 31 (25.82) 49 (40.82) 80 (33.33)

10A light weight tied at the end of the placenta to facilitate

12 (10.00) 82 (68.33) 94 (39.17)

Table 12 Traditional methods of treatments of skin diseases in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1Solution of roots, leaves, barks of banbasa (Viola biflora) with honey fed

17 (14.17) 26 (21.67) 43 (17.92)

2Whole plant of Deshi ber (Zizyphus jujuba) boiled in water and concentrate fed

23 (19.17) 19 (15.83) 42 (17.50)

3 Paste of Neem leaves applied 48 (40.00) 27 (22.50) 75 (31.25)4 Paste of Henna (Lowsonia inermis) 12 (10.00) 19 (15.83) 39 (16.25)5 Paste of Jangli piyaz (Urginea indica) 11 (09.17) 17 (14.17) 28 (11.67)

Table 11. Traditional methods of treatments of wound in buffalo by the farmers.

S. No.

Particulars



Pali(N=120)

1 Juice of leaves 60 (50.00) 66 (55.00) 126 (52.50)2 Powdered seed of Kusum (Schleichera oleosa) 28 (23.33) 37 (30.82) 65 (27.08)3 Haldi heated in cow ghee 66 (55.00) 79 (65.83) 145 (60.42)


294

of retained placenta a lightweight was tied at the end of the placenta to facilitate the expulsion. Patel et al. (1993) also reported that for expulsion of retained placenta, a lightweight was tied at the end of placenta. However, Pandey (1996) reported that ban leaves were fed for easy and smooth expulsion of placenta unlike the present findings.

CONClUSION

It may be concluded that the relative difficult biophysical conditions and poor economic resource availability of the buffalo farmers operating in this Marwar region of India have caused lesser influence of scientific buffalo farming technologies in the region. As of result of which, over the years of experimentations, buffalo farmers of this region have evolved an alternative knowledge base for the treatment of their animals. As presented in above paragraphs, a variety of traditional practices were observed being followed for treatment of various ailments and diseases of the animals with the use of locally available material, herbs etc. These traditional methods are of much importance because majority of buffalo farmers in the region were resorting to self medication using traditional practices only, while the other agents like quack and staff of formal veterinary services were consulted only in cases of severity of disease/ailment. In addition, less than half of the selected farm households were observed vaccinating their animals against diseases, while isolation of diseased animals was practiced in only 30% of the household.

REFERENCES

Amitendu, A., H.P.S. Arya, B. Tudu and A. Goswami. 2004. Indegenious technical knowledge in animal husbandry. Livestock Research for Rural Development, 16(8): 1-8.

Catley, A. 1999. Methods on the move. A Review of Veterinary Uses of Participatory Approaches and Methods Focussing on Experiences in Dryland Africa. International Institute for Environment and Development, London, U.K.

Darji, V.A. 1993. Livestock and animal husbandry. Honey Bee, 4(4): 17.

De, H.K. 1994. Identification and assessment of indigenous technologies in animal husbandry in Bankura district. M.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

DOA, 2014. Study on Agro-climatic Zones of Rajasthan, India. p. 123-124.

Dudi, A. and A.R. Singh. 2007. Traditional wisdom practices among rural women regarding health and care of infants. Indian Res. J. Ext. Edu., 7(1): 29-32.

Gupta, A.K. and K.K. Patel. 1991. Experimenting farmers, pastoralists and artisans-Report of a survey of local innovations in dry regions of Gujarat. Honey Bee, 2(1): 21.

Gupta, A.K. and K.K. Patel. 1994. Survey of farmers’ innovations in Gujarat. Honey Bee, 5(3): 14-15.

Gupta, A.K., K.K. Patel, J.H. Suthar, V. Chauhan, D. Koradia, A. Raval, A. Pastakia, Ch. Srinivas, S. Muralikrishna, H. Patel, R. Patel, R. Sinha and N. Joshi. 1996. Survey


295

of grassroots innovation. Honey Bee, 7(3): 17.

Hamed, K.S. 1998. Traditional veterinary wisdom practices from rural Medak, A.P. Honey Bee, 9(2): 17.

IIRR. 1994. Ethnoveterinary Medicine in Asia, an Information Kit on Traditional Animal Health Care Practices, International Institute of Rural Reconstruction, Philippines.

Karthikeyan, C. and K. Chandrakandan. 1996. Indigenous technical knowledge of the tribes in agriculture. Indian Research Journal of Extension Education, 7(2): 1417-1421.

Köhler, R.I. 1997. Between burning irons and antibiotics: The significance of ethnoveterinary medicine. German Research, 2(3): 4-6.

Mandal, M.K. 1999. Awareness about ethno veterinary medicines of livestock feeding and health care among dairy farmers in Bankura district. M.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Mathias, E. and Catley. 1996. How can ethnoveterinary medicine be used in field projects? Indigenous Knowledge and Development Monitor, 4(2): 6-7.

Mohanty, M. 1999. Study of the livestock feeding and health management systems in Mayurbhanj district of Orissa. M.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Narain, P., S.C. Rai and S. Sarup. 1995. Regional disparities in the levels of development in Uttar Pradesh. Journal of the Indian Society of Agricultural Statistics, 47(3): 288-304.

Pandey, A.K. 1996. A comparative study of livestock rearing system among tribals and

non tribals in Chotanagpur region of Bihar. Ph.D. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Patel, P.R., F.S. Kavati and B.T. Patel. 1993. Traditional practices in animal husbandry. Paper presented at National Seminar on Indigenous Technologies for Sustainable Agriculture, Indian Agricultural Research Institute, New Delhi, India.

Sah, A.K. 1996. A descriptive study of existing dairy farming practices and constraints in adoption of improved dairy practices among dairy farmers in Banka district (Bihar). M.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Sah, U. 1999. An analysis of dairy animal breeding and management practices in hill zone of U.P.: A gender perspective. Ph.D. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Sah, U. and S.K. Dubey. 2010. Traditional methods of treatment of dairy animals in central Himalayan region of India. Journal of Community Mobilization and Sustainability Development, 5(1): 41-49.

Singh, D., S. Kachhawa, M.K. Chaudhary, M.L. Meena and P.K. Tomar. 2014. Ethno-veterinary knowledge of Raikas of Marwar for nomadic pastoralism. Indian J. Tradit. Know., 13(1): 123-131.

Singh, H., A. Kumar and P.C. Chaudhari. 1994. Some important indigenous drugs usable in veterinary practice. Veterinary Clinical Guide, Kalyani Publishers, New Delhi.

Singh, S.K. and J. Chauhan. 2010. Perceived effectiveness of ITK among livestock owners. Indian Research Journal of Extension Education, 10(1): 12-15.



297

ABSTRACT

This study was carried out in the AL-Nasiriyah governorate (385 km in south of Baghdad) to investigate on some morphological characteristics of buffaloes raised in southern area of Iraq. A total of 119 females from four different locations are randomly chosen over period 11/10/2011 to 16/10/2011 to be used. The overall mean for body dimension, heart girth (HG), barrel girth (BG), heart depth (HD) barrel depth (BD), body length (BDL) and slanting body length (SBDL), height at shoulder (HAS), height at tail attachment (HAT), distance between shoulder (DBS) and femurs (DBF), horn length (HL) and tail length (TL) were 215.7, 242.9, 76.7, 72.6, 231.5 and 113.1, 146.2, 142.9, 43.0, 55.6, 43.3 and 106.0 cm respectively. Parity has a highly significant effect on most of studied traits except of DBF (P<0.05) and there was no significance effect on TL. Results showed gradual increasing in HG, BG, BD, HAS and SBDL from calving to the fourth or fifth calving, whereas BDL and HAT was increased from first calving to the third calving. However, the most of body dimensional traits were deleterious during sixth calving onward. Location has highly significant effect (P<0.01) on

HAS, HAT, DBF and TL and significant effect (P<0.05) on BDL and SBDL, while the others was not affected by location. The current findings reflect the poor feeding and management practices in southern region of Iraq due to many farmers depend mainly on marshes grasses such canes. Furthermore, the positive correlation between most dimensional traits and milk production could enhance smallholder buffalo farmers to improve their productivity via improve feeding practice and veterinary care.

Keywords: buffaloes, Bubalus bubalis, Iraqi buffaloes, body dimension, parity, location effect, correlation coefficient

INTRODUCTION

The total number of world buffaloes reached to 172 million heads and 98% from them they are found in Asia besides decreasing was happened in some countries in buffalo numbers such as Bulgaria, Romania, Turkey and Iran, because of the replacement of cattle by buffalo was occurred in the world (Borghese, 2009). Iraqi buffalo only used for milk production and never

EFFECTS OF PARITY AND LOCATION ON BODY DIMENSIONAL MEASUREMENTS IN IRAQI BUFFALOES AT SOUTHERN: A CASE STUDY AT AL-NASIRIYAH GOVERNORATE

Garabed Avadesian1, Alaa Al-Hadad2, Waleed M. Razuki3,*, Nasr Noori Al-Anbari1, Muhsen Aswadi2 and Ali Salih Sadiq2

1College of Agriculture, University of Baghdad, Iraq2Ministry of Agriculture, Baghdad, Iraq3Offices of Agricultural Research, Ministry of Agriculture, Baghdad, Iraq, *E-mail: [email protected]

Original Article


298

used for work and meat production came in second degree from importation for this animal, so the Iraqi buffaloes, was used for primarily dairy animals and contribute to about 8% of the output of bovine milk (FAO, 1988), and spread in 16 Iraqi governorate except to Erbil and Duhok. Prasad et al. (2010) found that the total milk production from buffaloes in the words approximately 12%, while India produced alone 60% from buffalo milk global and this were 100 million tons of milk, and other side, still buffalo the most neglect able domesticated animal from the world (Cockrill, 1985). The first domestication of buffaloes was appeared on seals in two regions, first in the Indus Valley (Mohenjo-Daro) and second in Mesopotamia (Ur/Sumerians civilization) in south of Iraq from about the middle of the third millennium B.C. (Cockrill, 1985; Shalash, 1991). While some study revealed that the Iraqi buffaloes was introduced into Iraq about 13 centuries age, has adapted considerably to the prevailing environmental conditions of the country (Ashfaq, 1973). Recently, based on molecular study of Jaayid and Dragh (2014), the Iraqi buffalo have 16 alleles compared with others proved it’s originated in Iraq and never imported from India.Most, if not all, milk is processing to thick butter cream named GAYMER, which it has popularity over country. Daily cream selling provide farmer with cash income annually. These merit made buffalo to be an important animal after cattle in Iraq. By the National Survey for Animal Resources which was done by Iraqi Agriculture Ministry (2008) there are number in AL-Nasiriyiah governorate was 49283 heads and this contains of the percentage 17.3% from total number of buffalo in Iraq which was distributed in seven regions with 2494 farm households (Dept. of Agriculture in Dhi-Qar, 2011), in marshes area for AL-Nasiriyiah governorate, the number of buffaloes was 33000

heads. The important of this area come from its location in the marhsres and have old history in breeding of buffaloes where greater producers are located in this area.Iraqi buffaloes are differing in colors, shapes (phenotypic variations) and milk production and have bigger body measurements comparing to Indian, Pakistani and Egyptian buffaloes (Baghdasar et al., 2011). Thy typical buffalo breeder in Iraq, Locally named the Ma’dan, the marshes Arabs. In recent study to Baghdasar et al. (2012) in Nineveh governorate, they found a highly significant effect for parity on chest and abdominal girth with chest and abdominal depth and fill length for animal beside to significant effect (P<0.01) for locations of study on slanting length for animal and distance between femurs and height of udder from the earth. In additions, variations in buffalo management due to climate, feeding practice, availability of land resources and seasonal feed could reflect variations in buffalo production and dimensional traits. So, the present study was conducted in southern area of Iraq, where a majority of buffaloes founded and this area was reached to 62.5% of total Iraqi buffaloes, to assess whether the bodies dimensions are differ or similar with that found in mid and north area of Iraq due to affecting parity and locations.


Site of study (Source of data)This study was carried out in the southern

region of Iraq at AL-Nasiriyiah governorate (385 km south of Baghdad) to be sample of southern buffalo’s community.

AnimalsA total of 119 females from four different


299

areas (1: Souq AL-Shwokh, 2: Qalat Sukar, 3: AL-Jabaush marshes and 4: AL-Aslah area) are randomly chosen over period 11/10/2011 to 16/10/2011 to estimate body dimension characteristics.

Animal husbandryThe animals in four sites were fed

according to the farmer knowledge and attitude as well as Body length availability BDL of land resources and seasonal feed, however, based on input and buffaloes management in these locations three main systems feeding practice described: 1. All year-round free-grazing in the land that cropped with green fodder. 2. Feedlot on green cane that bringing from marshes which done basely women. 3. Free-range feeding on swamp and marshes green grass (cane and bardi plant, native mane).

Based on the feeding that imposed in different smallholder owner, body conditions are differing accordingly and clearly evidence that the feeding system may affect on body dimensions and

consequently on milk production then after. Group 1 has good body conformations whereas, Group 3 has weak conformation and Group 2 is middle between them. The direct dialogue and question between the researcher team and owners (face to face), we get this information about the feeding systems that owners adopted. Little veterinary care was noticed due lack of official services in these area. The owners depend on their self to maintain animal surviving.

Study parametersThe parameters studied in this study were

heart girth (HG), barrel girth (BG), heart depth (HD) barrel depth (BD), body length (BDL), slanting body length (SBDL), height at shoulder (HAS), height at tail attachment (HAT), distance between shoulder (DBS) and femurs (DBF), horn length (HL) and tail length (TL) as shown in Figure (1).

Briefly, the measurements were done on all animals that contributing in this study at 900 to 930 h am after recording animal’s age and parity from owners. The measurements were taken using the

Figure 1. Meansurement of body dimension od Iraqi buffalo.


300

tailor’s tape measure and measuring stick while the animals were on standing location, as previously reported (Baghdasar, 1990). Heart girth (HG) was measured as circumferential measurement taken around the chest behind the front legs and withers, barrel girth (BG) was measurement taken around the abdomen in middle body. Heart depth (HD) was measured as the distance from backbone at the shoulder to the brisket between the front legs. Barrel depth (BD) was measured as the distance from distal dorsal to abdomen end. BDL was measured as the distance from the base of the ear to the base of the tail. Slanting body length (SBDL) was measured as the distance from brisket between the front legs to the rump. Height at shoulder (HAS) been measured as the distance from the base of fetlock to the shoulder. Height at tail attachment (HAT) was measured as the distance from the surface of back fetlock to the base of the tail.

Statistical analysisData were subjected to two-way analysis

of variance. The following model was used:

Yijk = µ + Pi + Lj + eijk

Where, Yijk the individual observation; µ=The overall mean; Pi=The parity effect (i=6); Lj=The location effect (j=4) (1: Souq AL-Shwokh, 2: Qalat Sukar, 3: AL-Jabaush marshes and 4: AL-Aslah area); eijk=The random error associated with experimental unit (NID, σ2e). Duncan’s multiple range tests was used to compare the differences among treatment means. All statistical analysis by General Linear Models (GLM) procedure was carried out by SAS (2001) program.


The owners in this study were chosen as a volunteer to give information about their herds. The owners of buffalo in Iraq followed district feeding practice that depend mainly on owners financial support where some of those able to feed animals on forage and green fodder whereas others depend on free range feeding on Bardi and cane in the marshes area. Owners household had have about fifty heads or lower and little or not veterinary care was noticed due lack of official services in these area.

The overall mean for body dimensions, heart girth (HG), barrel girth (BG), heart depth (HD) barrel depth (BD), body length (BDL) and slanting body length (SBDL) were 215.7, 242.9, 76.7, 72.6, 231.5 and 113.1 cm respectively. The overall mean for each of height at shoulder (HAS), height at tail attachment (HAT), distance between shoulder (DBS) and femurs (DBF), horn length (HL) and tail length (TL) were 146.2, 142.9, 43.0, 55.6, 43.3 and 106.0 cm respectively (Table 1).

Effect of parityTable (1) summarized the effect of parity

on body dimension of Iraqi buffalo. Parity had highly significant (P<0.01) effect on all body dimension measurements, except tail length (TL). Results showed gradual increasing in HG, BG, BD and HAS from first calving to the fourth or fifth calving. HG increased from 202.3 to 225.0 cm, BG increased 222.8 to 250.7 cm, BD increased from 70.9 to 79.6 cm, HAS increased from 141.0 to 149.1 cm whereas, BDL and HAT was increased from first calving to the third calving. BDL increased from 214.3 to 238.1 cm and HAT increased from


301

139.8 to 145.51 cm. SBDL was increased from first calving to sixth calving, from 107.5 to 116.0 cm. However, the most of body dimensions were deleterious during sixth calving onward. These findings are confirmed the results obtained by Al-Jamas (1997) and Baghdasar et al. (2011, 2012) for their studies on buffaloes at Baghdad and Mosul governorate. It can be noticed that the body dimensions are increased with age till the six calving where the parameters reduce significantly. The results that obtained on Indian buffalo are similar present results as reported by McDowell (1972).

Effect of locationLocation had highly significantly (P<0.01)

effect on HAS, HAT, TL and DBF and significant (P<0.05) for BDL and SBDL. Whereas, the other studied traits was not affected by location (Table 1). The greater value of HAS was noticed in site four (AL-Aslah area; 150.8 cm) followed by sites one (Souq AL-Shwokh; 146.3 cm), two (Qalat Sukar, 145.0) and three (AL-Jabaush marshes; 142.4 cm). Furthermore, the greater value of BDL and HAT was recorded in site one (Souq AL-Shwokh, 235.3 and 145.4 cm) respectively, and the lowest value was recorded in site three (AL-Jabaush marshes, 225.1 and 140.4 cm) respectively. These body dimensions revealed that the buffaloes founded in marshes region could be from swamp and marshes buffalo as which found in china other south-east countries. But the Iraqi southern buffalo is similar his counterparts in mid and northern region of Iraq. This result is consistent previous results that obtained by Baghdasar et al. (2012). The reason of differences in body dimensions due different locations may due to the management practices (availability of land resources and green fodder, veterinary care and farmer knowledge and attitude). Idris et al. (2007) found the Iraqi buffalo

respond well to improvement of feeding quality, where, replace the rations that depend on cane, rice hulls and flour mill by product to concentrate diets achieved difference in milk output and body dimensions as well.

The correlation coefficients between the all body dimensions measurements are presented in Table 2. HG was positively significant correlation with BG (r=0.596 P<0.01), HD (r=0.513, P<0.01), BD (r=0.532, P<0.01), BDL (r=0.408, P<0.01), SBDL (r=0.388, P<0.01), HAS (r=0.380 P<0.01), HAT (r=0.27, P<0.05), DBS (r=0.386, P<0.01), DBF (r=0.248, P<0.05) and HL (r=0.435, P<0.01). The significant positive correlation was also noticed between BG and all traits mentioned above with values ranged from 0.278 to 0.632. BDL was also positively correlated with SBDL (r=0.457, P<0.01), HAS (r=0.493, P<0.01), HAT (r=0.422, P<0.01), DBS (r=0.445, P<0.01) and HL (r=0.444, P<0.01). Furthermore, most traits tend to be positive and significant. Positively significant correlation between HG and BG was also reported by Baghdasar (1990); Juma (1997). The dimensional traits could be used as predictable tools to milk production since positive correlation between milk production and HG or BG. Several studies (Asker and El-Itriby, 1956; Manik and Nath, 1981; Saini and Gill, 1987; Baghdasar, 1990) found positive correlation between dimensional body measurements and milk yield.The high positive correlations that obtained from this study may refer to the importance of body dimensional traits as predictable tools to assess 1) whether buffalo belonging to the river or swamp type buffalo, 2) the availability of feed (quality and quantity), 3) select the females that have good body conditions to be parent of next generations.


302

Tabl

e 1.

Effe

ct o

f par

ity a

nd lo

ctat

ion

on b

ody

dim

ensi

onal

trai

ts in

Iraq

i buf

falo

es (M

ean±

SEM

) .

Fact

ors

No.

HG

BG

HD

BD

BD

lSB

Dl

HA

SH

ATB

DS

DB

FH

lT

l

Ove

rall

mea

n11

921

5.7

±1.2

242.

9 ±1

.576

.7 ±

0.5

72.6

±0.

423

1.5

±1.4

113.

1 ±0

.514

6.2

±0.6

142.

6 ±0

.5

43.0

±0.

455

.6 ±

0.7

43.3

±0.

910

6.0

± 0.

9

Parit

y

1st P

ar.

1920

2.3

±2.3

c22

2.8

±2.5

c70

.9 ±

1.0c

67.6

±0.

8c21

4.3

±5.0

b10

7.5

±1.1

b14

1.0

±1.2

c13

9.9

±1.2

b38

.9 ±

1.0b

51.0

±1.

3b33

.3 ±

1.3c

104.

0 ±3

.0

2nd P

ar.

2121

3.1

±2.4

b23

6.1

±3.2

b75

.3 ±

1.1b

71.5

±1.

1b23

0.5

±3.2

a11

2.6

±0.8

a14

4.6

±1.2

b14

2.4

±1.0

a44

.0 ±

1.3a

55.5

± 1.

2ab36

.8 ±

1.5c

106.

9 ±2

.6

3rd P

ar.

1921

9.0

±2.6

ab25

0.0

±2.7

a77

.2 ±

2.5ab

73.

8 ±0

.8ab

238.

1 ±1

.4a

115.

7 ±1

.4a

147.

5 ±0

.9a

145.

5 ±0

.8a

44.4

±7.

5a56

.0±

1.6ab

43.1

±1.

3b10

8.3

±2.2

4th P

ar.

2621

8.2

±1.8

ab25

0.7

±3.0

a78

.6 ±

0.8a

73.5

±0.

7ab23

7.8

±2.0

a11

5.1

±1.3

a14

2.4

±1.1

a14

2.4

±1.1

a43

.4 ±

0.5ab

55.5

±16

ab47

.1 ±

1.5ab

104.

0 ±2

.0

5th P

ar.

1522

5.0

±4.5

a24

9.2

±3.4

a79

.6 ±

1.5a

75.7

±1.

4a23

6.4 ±

3.7a

114.

7 ±1

.2a

144.

7 ±1

.9a

144.

7 ±1

.9a

44.4

±1.

1a55

.5 ±

1.2ab

48.5

±2.

9a11

0.0

±1.5

≥ 6th

Par

.19

218.

3 ±2

.7ab

247.

7 ±2

.8a

78.4

±0.

9a73

.6 ±

1.1ab

235.

1 ±2

.8a

116.

0 ±1

.5a

143.

4 ±1

.5a

143.

4 ±1

.5a

42.8

±0.

7a59

.9 ±

2.4a

51.5

±1.

6a10

4.3

±2.0

Leve

l of s

igni

fican

t**

****

****

****

****

***

NS

Lact

atio

n

Souq

AL-

Shw

okh

3021

4.6

±2.3

239.

0 ±3

.475

.8 ±

1.1

72.7

±1.

023

5.3

±2.3

a11

4.1

±1.3

a14

6.2

±0.9

b14

5.4

±1.3

a42

.9 ±

0.8

58.5

±1.

9a41

.9 ±

2.0

100.

9 ±2

.0a

Qal

at S

ukar

3021

9.1

±2.5

243.

6 ±2

.276

.8 ±

0.9

73.8

±0.

823

1.7

±3.8

b11

2.6

±1.0

a14

5.0

±0.8

b14

3.8

±0.7

ab42

.8 ±

0.6

57.7

±1.

2a46

.0 ±

1.8

105.

8 ±1

.6ab

AL-

Jaba

ush

mar

she

2821

1.6

±2.4

240.

0 ±3

.576

.1 ±

0.9

71.5

±1.

022

5.1

±3.1

b11

1.3

±1.1

b14

2.4

±1.0

a14

0.4

±1.2

b42

.8 ±

0.6

52.7

± 1

.2a

52.7

±0.

910

6.9

±1.8

a

AL-

Asl

ah

area

3121

7.4

±2.4

248.

6 ±2

.678

.0 ±

0.9

72.2

±0.

623

3.5

±1.8

a11

4.2

±0.9

a15

0.8

±1.1

a14

1.9

±0.7

b43

.9 ±

0.9

53.3

±1.

0b53

.3 ±

1.0

110.

3 ±1

.7a

Leve

l of s

igni

fican

t N

SN

SN

SN

S*

***

**N

S**

NS

**

a-

d Mea

n w

ithin

sam

e co

lum

n ha

ve d

iffer

ent s

uper

scrip

t diff

er si

gnifi

cant

ly (P

<0.0

5). 1 A

ll tra

its a

re m

easu

red

in c

entim

eter

uni

t (cm

),

H

G=

Hea

rt gi

rth, H

D=

Hea

rt de

pth,

BD

L= B

ody

leng

th, H

AS=

Hei

ght a

t sho

ulde

r, D

BS=

Dis

tanc

e be

twee

n sh

ould

er, H

L= H

orn

leng

th,

BG

= B

arre

l girt

h, B

D=

Bar

rel d

epth

, SB

DL=

Sla

ntin

g bo

dy le

ngth

, HAT

= H

eigh

t at t

ail a

ttach

men

t, D

BF=

Dis

tanc

e be

twee

n fe

mur

s,

TL=

Tail

leng

th.

*

(P<0

.05)

, **

(P<0

.001

), N

S: N

on-s

igni

fican

t.


303

Tabl

e 2.

Cor

rela

tion

coef

ficie

nt b

etw

een

para

met

ers i

n th

is in

vest

igat

e.

BG

HD

BD

BD

lSB

Dl

HA

SH

ATB

DS

DB

FH

lT

lH

G0.

596*

*0.

513*

*0.

532*

*0.

408*

*0.

388*

*0.

380*

*0.

280*

0.38

3*0.

248*

0.43

5**

0.09

1NS

BG

0.63

2**

0.50

4**

0.50

2**

0.39

3**

0.48

0**

0.27

8**

0.48

4**

0.22

1*0.

485*

*0.

127N

S

HD

0.65

5**

0.53

1**

0.44

8**

0.51

6**

0.36

0**

0.41

9**

0.18

1**

0.58

2**

0.13

4NS

BD

0.39

3**

0.25

0**

0.36

0**

0.37

6**

0.31

7**

0.19

1NS

0.43

0**

0.20

1*B

Dl

0.45

7**

0.49

3**

0.42

2**

0.44

5**

0.16

6NS

0.44

4**

0.09

6NS

SBD

l0.

372*

*0.

278*

*0.

341*

*0.

227*

0.32

2**

0.02

2NS

HA

S0.

530*

*0.

245*

*0.

190N

S0.

367*

*0.

216*

HAT

0.25

6**

0.35

8**

0.28

8**

0.10

9NS

BD

S0.

178N

S0.

222N

S0.

095N

S

DB

F0.

159N

S0.

038N

S

Hl

0.04

4NS

1A

ll tra

its a

re m

easu

red

in c

entim

eter

uni

t (cm

), H

G=

Hea

rt gi

rth, H

D=

Hea

rt de

pth,

BD

L= B

ody

leng

th, H

AS=

Hei

ght a

t sho

ulde

r,

D

BS=

Dis

tanc

e be

twee

n sh

ould

er, H

L= H

orn

leng

th, B

G=

Bar

rel g

irth,

BD

= B

arre

l dep

th, S

BD

L= S

lant

ing

body

leng

th,

H

AT=

Hei

ght a

t tai

l atta

chm

ent,

DB

F= D

ista

nce

betw

een

fem

urs,

TL=

Tail

leng

th.

*

(P<0

.05)

, **

(P<0

.001

), N

S: N

on-s

igni

fican

t.


304

CONClUSION

The low dimensional traits that obtained from this study concise with poor milk production reflect the poor management practices in southern region of Iraq due to many farmers depend mainly on marshes grasses due to lack of pastures. Furthermore, the positive correlation between most dimensional traits and milk production could enhance smallholder buffalo farmers to improve their productivity via improve feeding practice and veterinary care. On the other hand, cytological studies are needed in southern area of Iraq for local buffaloes (like Al-Nasiryia governorate) to prove whether its belonging to the river an origin having 50 chromosomes or to swamp buffalo that lives in China and South East Asia countries having 48 chromosomes.

ACKNOWlEDGEMENT

The author gratefully acknowledges the Directorate Animal Resource at Ministry of Agriculture for financial support and provided all facilities that helped authors to collect experimental data.

REFERENCES

AL-Jamas, R.K.A. 1997. Fixation for some morphological and production characters for Iraqi buffalo in Badosh. Ph. D. Thesis, College of Agriculture and Forestry, University of Mosul.

Ashfaq, M. 1973. Perfect on the Development of Buffalo in Iraq. United Nations Development Programme, Food and

Agriculture Organization and Ministry of Agriculture and Again Reform. Baghdad, Iraq.

Asker, A.A. and A.A. El-Itriby. 1956. Relationship between milk production and certain body measurement buffaloes. Indian J. Dairy Sci., 9: 173-176.

Baghdasar, G.A. 1990. Some productive and reproductive characters and their genetic parameters and body measurements in Iraqi buffaloes. Ph. D. Thesis, College of Agriculture, University of Baghdad.

Baghdasar, G.A., S.F. Abbas, J.K. AL-Saadi, A.S. AL-Hadad and A.S. Sadiq. 2011. Study body dimensions and udder measurements in Iraqi buffalo in AL-Fadhalyia region-Baghdad. 1-Body measurement in dairy buffaloes. Iraqi Agric. J., 16(1): 72-81.

Baghdasar, G.A., A.S. AL-Hadad, O.S. AL-Abadi, M.D. Ali, A.S. Sadiq and A.I. Azawi. 2012. Study effect of parity and location in different body measurement for Iraqi milking buffalo rearing in Nineveh governorate. AL-Qadisyah Vet. Med. Sci. J., 11(2): 10-18.

Borghese, A. 2009. Present situation and future prospective of buffalo production in Europe and Near East, Pakistan J., 9: 491-502.

Cockrill, W.R. 1985. The domestic buffalo. The Blue Book, 25: 121-131.

Department of Animal Production, Agriculture Direct rate in Dhi-Qar. 2011. Report.

FAO. 1988. FAO/Production Yearbook, Vol. 42. Rome.

Jaayid, T.A. and M.A. Dragh. 2014. Genetic diversity and conservation of animal genetic resources in Iraqi buffalo using microsatellite markers. Buffalo Bull., 33(3): 271-276.


305

Juma, K.M. 1997. Present status of Buffalo Production in Iraq. Buffalo J., 16(5): 103-113.

Idris, S.M., K.T. AL-Tememy, S.A. Taha and M.M. Kamal. 2007. Investigation on the effect of standardized diet on the milk yield and fat percentage in native buffaloes. Iraqi Agric. J., (Special Issue) 12(3): 145-153.

Manik, R.S. and I. Nath. 1981. Relationship of certain body measurements with milk production in Murrah buffaloes. Indian J. Dairy Sci., 34: 118-119.

McDowell , R.E. 1972 . The Improvement of Livestock in Warm Climates. W.H. Freeman and Company, San Francisco.

Ministry of Agriculture. 2008. Status of Animal Genetic Resources in Iraq. National Survey for Animal Resources in Iraq. Iraq.

Prasad, R.M., K. Sudhakar, E.R. Rao, B.R. Gaupta and M. Mahender. 2010. Studied on the udder and teat morphology and their relationship with milk yield in Murrah buffaloes. Livest. Res. Rural Develop., 22(1): 1-7.

Saini, A.I. and R.S. Gill. 1987. Relationship among different physical characteristics in Murrah type heifers and dry buffaloes. Indian J. Anim. Prod. Manage., 3: 193-199.

SAS, 2001. SAS/ STAT Users Guide for Personal Computers. Release 6.12 SAS. Institute Inc. Cary and N.C.,USA.

Shalash, M.R. 1991. The present status of buffaloes in the World. p. 242-267. In Proceeding of the 3rd World Buffalo Congress, Bulgaria.



307

ABSTRACT

Urinary obstruction in calves is a fatal disease that predisposes to high mortality rate, due to subsequent uraemia, unless the animal is subjected to emergency treatment for correction of the obstruction. The present study was conducted to evaluate tube cystostomy procedure for management of urethral obstruction in 108 male buffalo calves of age 1 to 5 months presented to TVCC, LUVAS, Hisar (Haryana) from November, 2013 to February, 2014. Diagnosis of the disease was made with the history of anuria, distended abdomen, fluid thrill, abdominocentesis and ultrasonographic examinations. All the calves were treated surgically by tube cystostomy. Simultaneously ammonium chloride 500 mg/kg b. wt. was administered orally to dissolve the calculi. Out of 108 cases, 102 animals recovered uneventfully while six died within 24 to 48 h after the surgery.

Keywords: buffalo calves, buffaloes, Bubalus bubalis, tube cystotomy, urinary obstruction

INTRODUCTION

Obstructive urolithiasis causes economic loss to the farmer due to loss of animals and cost of treatment. Factors such as diet, age, sex, breed, genetic makeup, season, soil, water, hormone, mineral, and urinary tract infections play an important role in the genesis of urolithiasis (Udall and Chow, 1969). Urolithiasis describes the concretion of urinary calculi or organic compound, which may lodge anywhere in the urinary system but most frequently at the distal end of sigmoid flexure in ruminants, and causes subsequent urine flow obstruction (Radostitis et al., 2000; Kushwaha et al., 2011). Occurrence of urolithiasis is significantly more common in male calves compared to females due to their anatomical conformation of the urethral tract (Smith and Sherman, 1994).

Urethral obstruction in calves is a fatal disease that predisposes to high mortality rate, due to subsequent uraemia, unless the animal is subjected to emergency treatment for correction of the obstruction. Treatment of obstructive urolithiasis is definitely surgical if the urethral obstruction is complete (Haven et al., 1993; House et al., 1996). Multiple surgical techniques have been described for treatment of such affection including

MANAGEMENT OF URINARY OBSTRUCTION IN BUFFALO CALVES BY TUBE CYSTOSTOMY

Rammehar Singh1, Satbir Sharma2, Deepak Kumar Tiwari1,*, R.N. Chaudhary1, Sandeep Saharan2 and Anand Kumar Pandey2

1Department of Veterinary Surgery and Radiology, College of Veterinary Sciences, Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana, India, *E-mail: [email protected] Veterinary Clinical Complex, College of Veterinary Sciences, Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana, India

Original Article


308

urethrotomy (Singh et al., 2010), urethrostomy (Stone et al., 1997), tube cystostomy (Williams and White, 1991), bladder marsupialization (May et al., 1998) and penile transaction with urethral fistulation (Misk and Semieka, 2003) with little practical value in treating obstructive urolithiasis. Tube cystostomy together with medical dissolution of calculi is considered an effective technique for resolution of obstructive urolithiasis in small ruminants (Ewoldt et al., 2008). Advantages of this technique include simple procedure, fewer recurrences, preservation of the reproductive function of the animal (May et al., 1998), an opportunity for the removal of cystic calculi, attains a full urethral patency in short period of time and easy application in field conditions. The tube cystostomy gives passage for removal of urine and prevents its accumulation which might lead to the rupture of bladder or the urethra (Dubey et al., 2006). Animals with prolonged obstruction have high morbidity due to subsequent uraemia. Tube cystostomy, though reportedly successful in small ruminants but it is not widely used in large ruminants. The present study describes the clinical signs, surgical management of obstructive urolithiasis and its outcome in 108 cases of male buffalo calves.


AnimalsA retrospective study was conducted

on 108 male buffalo calves of age 1 to 5 month with obstructive urolithiasis presented to TVCC, LUVAS, Hisar (Haryana) from November, 2013 to February, 2014. Thorough clinical examination was conducted for vital parameters and the status of urethra and urinary bladder. Abdomenocentesis

was performed in the cases showing ‘water belly’ appearance to confirm cystorrhexis, if any. Dehydration status was evaluated by physical appearance and skin tent test.

Intraoperatively the bladder was observed for its integrity and appearance (smooth, rough, inflamed or necrosed). Animals which have severe dehydration and uraemia were stabilized preoperatively with fluid therapy, corticosteroids and drainage of urine from abdominal cavity by centesis. Animals were prepared for aseptic surgery and tube cystostomy was performed.

Surgical procedureAll the animals were controlled in right

lateral recumbency with left hind limb flexed and abducted from trunk under mild sedation with xylazine hydrochloride 0.05 mg/kg intravenously. Prepubic paramedian left abdominal area was prepared for aseptic surgery. Site of incision was infiltrated with 2% lignocaine hydrochloride. A linear skin incision was given (Figure 1). Fascia, muscles and the peritoneum were separated by blunt incision to open the abdominal cavity and the bladder was identified. The status of bladder was checked. If bladder was intact, a subcutaneous tunnel starting from anterior end of incision and parallel to the prepuce was made by passing straight artery forceps through the subcutaneous tissue opening near the prepucial orifice (Figure 2). Foley’s catheter (#18G/ 20G) was passed through tunnel and stabbed at an acute angle into the bladder at an avascular healthy area (Figure 3 and Figure 4). Once the urine starts to dribble through drainage channel then catheter bulb was inflated with sterile normal saline (30 ml) to fix the catheter tip inside the bladder. Alternatively, in cases of ruptured urinary bladder, cystorrhaphy was done with chromic catgut (#1) followed by


309

catheter placement after necessary debridement (Figure 5 and Figure 6). Peritoneum, muscles and subcutaneous tissues was sutured with absorbable suture material using simple continuous or lock stitch pattern. Skin was sutured with non-absorbable suture in routine manner. The free excess hanging Foley’s catheter was fixed at multiple sites on the ventral abdomen (Figure 7). Postoperatively, ceftriaxone 20 mg/kg and amikacin 5 mg/kg combination along with analgesic meloxicam (0.5 mg/kg) were administered by intramuscular route for five days. Ammonium chloride 500 mg/kg per day orally was given for one month. Local antiseptic dressing with povidone iodine was done twice a day till healing. The catheter was allowed to drain freely for three days; thereafter the owner was instructed to clamp the urinary drainage outlet of catheter to block the urine flow for a brief period of 1 to 2 h in order to determine the urethral patency. After the normal urination through urethra resumed, the time of blockage of catheter was increased systematically in installments up to 24 h in 3 to 4 days. Then catheter was removed by deflating the bulb. The skin sutures were removed after 10 days.


The occurrence of urolithiasis in peak winter season i.e. during the period of study may be due to the decreased water intake and deficiency of vitamin- A, arising from lesser availability of green fodder (Radostits et al., 2000). Desquamated epithelial cells may be due to deficiency of vitamin A and infections (Jones and Miesner, 2009). This may be related to water imbalance of animals, during winter animals will not take much water and produce concentrated urine (Kushwaha et al.,

2011). Majority of affected buffalo calves were of the age of 2 to 4 months. Sharma et al. (2007) recorded about 60% urethral obstruction occurs at an early age in ruminants. Gugjoo et al. (2013) reported that 84.61% affected buffalo calves were of the age of 4 to 7 months. Duration of urine retention was less than three days in 80% of all cases while more than five days in the 12%. In eighteen buffalo calves, urinary bladder was ruptured which were subjected to cystorrhaphy followed by tube cystostomy. The prevalence of urolithiasis may occur due to imbalance of mineral intake in feed as the calves receive more cereals and concentrated feeds during growing period. These feeds contain more level of phosphorus and magnesium and relatively less level of calcium and potassium, as a result may lead to urolithiasis (Unmack et al., 2011).

Clinical signs in calves with intact bladder were complete anorexia or inappetance, stranguria or anuria, reluctant to walk and frequent attempt for urination. In eight cases with a history of urine retention for more than seven days, rectum prolapse was accompanied due to constant straining. In case of ruptured urinary bladder, bilateral ventral distension of abdomen was noted and on abdomenocentesis urine was present in abdomen. Two calves with ruptured bladder were in recumbent position and had tachycardia with feeble heart sound. The dehydration was usually much more marked due to loss of water and electrolyte over a period of several days. This results in loss of skin elasticity, dryness of the skin and mucosa, and a reduction and retraction of the eyeball (enophthalmia) due to reduction in the volume of the postorbital fat deposits. Dehydration was more in cases of ruptured urinary bladder which might be due to the loss of fluid from the interstitial and


310

Figure 1. Skin incision.

Figure 2. Subcutaneous tunnel.

Figure 3. Passing of Foley’s catheter at through the tunnel

Figure 4. Stabbing of Foley’s catheter avascular area on bladder.

Figure 5. Cystorraphy in ruptured bladder.

Figure 6. Placement of Foley’s catheter in bladder.


311

intracellular spaces into peritoneal cavity. Late reporting of cases and indiscriminate use of diuretic (Frusemide) by local practitioners were the main cause of the rupture of the bladder. The increasing pressure and distended stretching of bladder wall results in inflammation, pressure ischaemia, devitalization, thinning, trabeculae formation and herniation of mucosa through the musculature of the urinary bladder leading to seepage of urine into the peritoneal cavity resulting in uroperitoneum (Makhdoomi and Ghazi, 2013). When the urinary bladder ruptures, it gives relief for 1 or 2 days then severe uremia and uroperitoneum develops. Cystorrhaphy followed by tube cystostomy was done for all cases of ruptured bladder. Different post-operative complications were observed in 66 cases which include suppurative infection of subcutaneous tunnel around catheter (n=38) and blockage of catheter (n=24). Complication of urethral rupture was seen in 4 calves. Subcutaneous suppurative infection was managed by flushing the tunnel with diluted povidone iodine solution, while catheter blockage was removed by using clutch wire and flushing catheter with normal saline and povidone iodine

solution. Catheter was removed at an average period of 13 to 15 days after normal urination through the external urethral orifice. Out of 108 cases, 102 animals recovered uneventfully and six died within 24 to 48 h after the surgery. Complication of tube cystostomy might be due to blockade of tube with blood or tissue debris, urethral rupture, tube dislodgement, and suppurative infection of subcutaneous tunnel (Parrah et al., 2010). The free flow of urine through the external urethral orifice could be due to many factors which include post-operative medication with anti-inflammatory drugs that relived the spasm and inflammation of urethra. Calculolytic agent like ammonium chloride along with water reduced the pH of urine which promotes the dissolution of calculi. Bypassing of urine through the Foley’s catheter may reduce the calculi size and frequent occlusion of catheter with clamp could lead to flushing urethra of all debris and calculus material with urine.

CONClUSIONS

Tube cystostomy along with oral administration of ammonium chloride has a good success rate in management of cases of urinary obstruction in buffalo calves with intact as well as ruptured urinary bladder.

REFERENCES

Dubey, A., K. Pratap, Amarpal, H.P. Aithal, P. Kinjavdekar, T. Singh and M.C. Sharma. 2006. Tube cystotomy and chemical dissolution of urethral calculi in goats. Indian J. Vet. Surg., 27: 98-103.

Ewoldt, J.M., M.L. Jones and M.D. Miesner.

Figure 7. Fixing of Foley’s catheter on ventral abdomen.


312

2008. Surgery of obstructive urolithiasis in ruminants. Vet. Clin. N. Am-Food A., 24: 455-465.

Gugjoo, M.B., M.M.S. Zama, Amarpal, A. Mohsina, A.C. Saxena and I.P. Sarode. 2013. Obstructive urolithiasis in buffalo calves and goats: incidence and management. Journal of Advanced Veterinary Research, 3: 109-113.

Haven, M.L., K.F. Browman and T.A. Engle. 1993. Surgical management of urolithiasis in small ruminants. Cornell Vet., 83: 47-55.

House, J.K., B.P. Smith and L.W. George. 1996. Obstructive urolithiasis in ruminants: Medical treatment and urethral surgery. Compendium Continuing Edu. Pract. Vet., 18: 317-328.

Jones, M.L. and M.D. Miesner. 2009. Urolithiasis, p. 322-325. In Merchant, T. (ed.) Food Animal Practice, 5th edn. St Louis. Saunders.

Kushwaha, R.B., A.K. Gupta, D.K. Dwivedi and A. Sharma. 2011. Obstructive urolithiasis in Small Ruminants and its surgical management. Intas Polivet, 12: 359-362.

Makhdoomi, D.M. and M.A. Ghazi. 2013. Obstructive urolithiasis in ruminants-A review. Vet. World, 6: 233-238.

May, K., A.H.D. Moll, L.M. Wallace, R.S. Pleasant and R.D. Howard. 1998. Urinary bladder marsupialization for treatment of obstructive urolithiasis in male goats. Vet. Surg., 27: 583-588.

Misk, N.A. and M.A. Semieka. 2003. Clinical studies on obstructive urolithiasis in male cattle and buffalo. Assiut Veterinary Medical Journal, 49: 258-274.

Parrah, J.D., B.A. Moulvi, S.S. Hussain, S. Bilal and Ridwana. 2010. Comparative efficacy of tube cystostomy and cystostomy with

indwelling urethral catheterization in the management of obstructive urolithiasis in bovines. Indian Journal of Veterinary Surgery, 31(2): 81-85.

Radostitis, O.M., D.C. Blood, C.C. Gay and K.W. Hinchcliff. 2000. Veterinary Medicine: A Textbook of the Diseases of Cattle, Sheep, Pigs, Goats and Horses. Bailliere Tindall, London.

Sharma, A.K., I.V. Mogha, G.R. Singh and H.P. Aithal. 2007. Incidence of urethral obstruction in animals. Indian J. Anim. Sci., 77: 455-546.

Singh, T., P. Amarpal, H.P. Kinjavdekar and A.M. Pawde. 2010. Comparison of four surgical techniques for the management of obstructive urolithiasis in male goats. Indian Journal of Veterinary Surgery, 31: 15-20.

Smith, M.C. and D.M. Sherman. 1994. Urinary system, p. 398-402. In Cann, C.G. (ed.) Goat Medicine. Philadelphia, Lea and Febiger.

Stone, W.C., D.E. Bjorling. and S.S. Trostle. 1997. Prepubicurethrostomy for relief of urethral obstruction in a sheep and a goat. J. Am. Vet. Med. Assoc., 210: 939-941.

Udall, R.H. and F.H. Chow. 1969. The etiology and control of urolithiasis. Adv. Vet. Sci. Comp. Med., 13: 29-57.

Unmack, A. 2011. Constituents of calculi from the urinary tract of bulls and bullocks. Evidence of silica urolithiasis in cattle in Denmark. KongeligeVeterinaer-ogLandbohoiskol-esAarsskrift, 1963: 1-12.

Williams, J.M. and R.A.S. White. 1991. Tube cystotomy in dog and cat. J. Small Anim. Pract., 32: 598-602.


313

ABSTRACT

Haemorrhagic septicaemia caused by Pasteurella multocida is one of the most fatal diseases affecting Indian buffaloes. The disease is of high economic significance in India due to the high mortality rate in the affected population. The outer membrane proteins (OMPs) are virulence factors of P. multocida which play an important role in the pathogenesis of Pasteurellosis. In the present study, P. multocida B: 2 field isolates (n=7) and a vaccine strain (P52) were grown under normal and iron restricted conditions. OMPs were extracted by sarkosyl method. Characterization of OMP rich extracts from isolates grown under normal conditions by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) revealed a total of 11 to 13 bands of about 16 to 86 kDa. Two bands of molecular weights 68 and 71 kDa were present only in the OMP profile of vaccine strain. Under iron restricted conditions, two additional protein bands of molecular weights 112 and 125 kDa were expressed in all isolates including the vaccine strain. Based on band intensity, 31 and 37 kDa proteins were assumed to be the major proteins expressed under both normal and iron restricted conditions. Further studies are required to study the role of major proteins and iron regulated outer membrane proteins (IROMPs)

in the virulence of the bacteria.

Keywords: buffaloes, Bubalus bubalis, Pasteurella multocida, outer membrane protein, SDS-PAGE, major protein, iron regulated outer membrane protein

INTRODUCTION

Pasteurella multocida is a small, nonmotile, gram-negative, indole positive, fastidious and facultatively anaerobic coccobacillus which is found in the nasopharynx and gastrointestinal tract of apparently healthy domestic and wild animals. P. multocida can be a primary or secondary pathogen in the disease process of domestic animals and birds (Rimler and Rhoades, 1989) and is the causative agent of numerous, economically important diseases, including bovine haemorrhagic septicaemia, avian fowl cholera, enzootic pneumonia and swine atrophic rhinitis (De Alwis, 1992). In India, P. multocida have been recovered from various outbreaks in different agro climatic geographical regions of the country (Kumar et al., 2004) and haemorrhagic septicaemia alone causes 46 to 55% of bovine deaths (Dutta et al., 1990). This shows the economic impact of this pathogen on Indian livestock industry.

CHARACTERIZATION OF PASTEURELLA MULTOCIDA ISOLATES OF BUFFALO ORIGIN FROM GUJARAT STATE OF INDIA BY OUTER

MEMBRANE PROTEIN PROFILE ANALYSIS

V. Aiswarya*, Rafiyuddin A. Mathakiya, Bharat B. Bhanderi and Ashish Roy

Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand, Gujarat, India, *E-mail: [email protected]

Original Article



314

Outer membrane proteins (OMPs) and lipoproteins interact with signaling pathways in host cells and play roles in host response and or host evasion (Mclean, 2012). OMPs of P. multocida act as an interface between host and pathogen (Lin et al., 2002) and have a significant role in the bacterial pathogenesis (Srivastava, 1998). Many studies conducted on immunogenicity of selected OMPs (Dabo et al., 1997; Confer et al., 2001) revealed that some OMPs can serve as potent immunogens (Hatfaludi et al., 2010; Borkowska-Opacka and Kedrak, 2002).

Iron being an essential factor for bacterial growth and replication plays a role in the establishment and advancement of infection. Due to the presence of iron-binding glycoproteins such as transferrins and lactoferrins, the host iron is largely unavailable and the free ionic concentration of iron in vivo is inadequate to support microbial growth (Ruffolo et al., 1998). In order to survive under these iron limiting conditions, pathogens like P. multocida express a number of iron regulated proteins and low MW siderophores which aid in the sequestration of iron binding host glycoproteins (Hu et al., 1986).These OMPs involved in acquisition of iron from the host are also regarded as potential virulence factors (Snipes et al., 1988).

The study was aimed to characterize and to compare the outer membrane protein profiles of P. multocida isolates of buffalo origin grown under normal and iron limited conditions.


Bacterial strainsSeven P. multocida strains isolated from

buffalo affected with haemorrhagic septicaemia and a vaccine strain P52 was used for the present study. The field isolates had been isolated and typed based on capsular antigens as per the method of Townsend et al. (2001) at the Department of Microbiology, College of Veterinary Science and Animal Husbandry, Anand. The details of the isolates used are furnished in Table 1. The reference vaccine strain P52 was procured from Animal Vaccine Institute, Gandhinagar.

Preparation of OMPs from P. multocida strainsThe bacterial strains were cultured

under normal (BHI broth) and iron restricted (BHI medium supplemented with 150 μM of 2, 2’-dipyridyl) conditions. The cultures were incubated for 18 h at 37ºC. OMPs were obtained

Table 1. Details of the isolates used for outer membrane protein profile analysis.

Sr. No.

Isolate ID Host YearSamples used for isolation

RegionCapsular

type1 PAB-78-1/13 Buffalo 2013 Bone marrow Patan B:22 PAB-80-3/13 Buffalo 2013 Exudate Patan B:23 PAB-81-4/13 Buffalo 2013 Blood Patan B:24 PAB-83-6/13 Buffalo 2013 Tissue Amreli B:25 PAB-84-7/13 Buffalo 2013 Tissue Amreli B:26 PAB-86-9/13 Buffalo 2013 Tissue Ahmedabad B:27 PAB-89-1/14 Buffalo 2014 Tissue Gandhinagar B:2


315

as per the protocol described by Choi-Kim et al. (1991) with minor modifications as per Munir et al. (2007). The culture in BHI broth was subjected to centrifugation at 10,000 rpm for 30 minutes at 4ºC. The pellets obtained were then washed twice in PBS and resuspended in 10 mM HEPES buffer (pH 7.4). These cells were subjected to sonication for ten cycles of 10 seconds each, with 10 seconds interval between each cycle for cooling. The unbroken cells and debris were removed by centrifugation at 1500 xg for 20 minutes. The supernatant was collected and centrifuged at 100,000 xg for 60 minutes at 4ºC. The pellet was resuspended in HEPES buffer containing 2% sodium lauroyl sarcosinate (sarkosyl) detergent and incubated at 22ºC for 60 minutes. The detergent insoluble outer membrane protein enriched fractions were pelleted out by centrifugation at 100,000 xg for 60 minutes at 4ºC. The pellets were resuspended in distilled water and stored at -20ºC. The protein content of OMPs was estimated by using Nanodrop 1000 spectrophotometer at 280 nm using bovine serum albumin as a standard.

Separation in SDS-PAGEElectrophoretic separation of the outer

membrane proteins of P. multocida strains was performed in 4% stacking gel and 12% resolving gel as per Laemmli, 1970. The separation was carried out at a constant voltage of 100 V, at room temperature and the gel was stained with 0.5% Coomassie blue. The molecular weight of the OMPs was determined by GelAnalyzer software. A pre-stained protein molecular weight marker was used for comparison of the molecular size of OMPs.


The electrophoretic protein profiles revealed the presence of 11 to 13 protein fractions of about 16 to 86 kDa (Table 2). The band patterns of all the buffalo field isolates revealed presence of 11 common bands with MWs of ~16, 20, 22, 24, 26, 31, 37, 45, 46, 50 and 86 kDa respectively. Reference strain, P52 revealed the presence of 13 bands with protein fractions of ~16, 19, 22, 24, 26, 31, 37, 45, 46, 49, 68, 71 and 86 kDa. Based on the intensity of bands, polypeptides with MWs of 31 and 37 kDa were assumed to be the major OMPs in field isolates and vaccine strain.

Under iron restricted condition, all the isolates along with vaccine strain revealed the expression of two additional proteins of MWs 112 and 125 kDa. The intensity of the bands with MWs 20, 24, 26, 31 and 37 kDa were found to be downregulated in isolates grown in iron restricted conditions whereas 50 and 86 kDa bands were found to be upregulated (Figure 1).

Outer membrane proteins (OMPs) of gram negative bacteria are important virulence factors involved in colonization, invasion and pathogenesis. It is important to have thorough knowledge of the outer membrane proteome of P. multocida which will help in the identification of potential virulence factors, diagnostic antigens, drug targets, and vaccine candidates (Prasannavadhana et al., 2014).

In the present study, for OMP extraction, the bacterial cells suspended in 10 mM HEPES buffer were disrupted by sonication, followed by treatment with 2% sarkosyl. Sarkosyl treated suspensions were then subjected to ultracentrifugation for the separation of OMPs. Extraction by 2% sarkosyl was also performed by Abdullahi et al. (1990), Davies et al. (1992), Pati et al. (1996), Tomer et al. (2002)


316

and Jain et al. (2005) with minor modifications. Marandi and Mittal (1995), Marandi et al. (1996) and Borkowska-Opacka and Kedrak (2002, 2003) used 1% sarkosyl for OMP extraction, while Ullah et al. (2008), Asma et al. (2009) and Prasannavadhana et al. (2014) used 0.5% sarkosyl extraction method.

In the present study, electrophoretic protein profiles of the buffalo field isolates revealed the presence of 11 protein fractions of about 16 to 86 kDa. The eleven protein fractions with MW of ~16, 20, 22, 24, 26, 31, 37, 45, 46, 50 and 86 kDa respectively were common in all the isolates.

Johnson et al. (1991) reported five main protein bands with MW of 27, 32, 37, 45 and 47 kDa. They found that protein with MW 32 kDa was more intensely stained than the rest of the protein

fractions in B type bovine isolates. Wasnik (1998) characterized the OMP of P. multocida serotype B: 2 and reported 13 protein fractions with MW ranging from 15.92 to 93.92 kDa. OMP characterization of P. multocida serotype B: 2 isolates and P52 vaccine strain by Pati et al. (1996) revealed ten major protein bands ranging from 25 to 88 kDa. Arora and co-workers (2007) studied the OMP profiles of 17 P. multocida isolates of bovine origin by SDS-PAGE. All the isolates showed homogenous protein profiles comprising 23 different polypeptide bands ranging in molecular weight from 13 to 94 kDa. On the basis of stain intensity, 32 kDa appeared to be the major protein band followed by 25 and 28 kDa bands. Munir et al. (2007) characterized the OMPs of P. multocida B: 2 strains and a total of 6 polypeptides ranging from 15 kDa to 91 kDa

Table 2. Details of outer membrane protein profiles of P. multocida isolates.

Sr. No.

Isolate No.No. of bands

Molecular weights (kDa)IROMP bands

Molecular weights (kDa)

1 PAB-78-1/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

2 PAB-80-3/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

3 PAB-81-4/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

4 PAB-83-6/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

5 PAB-84-7/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

6 PAB-86-9/13 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

7 PAB-89-1/14 1116, 20, 22, 24, 26, 31, 37, 45, 46, 50

and 86 kDa2

112 and 125 kDa

8 P52 1316, 19, 22, 23, 24, 31, 37, 45, 46,

49, 68, 71 and 86 kDa2

112 and 125 kDa


317

Figure 1. Outer Membrane protein profiles of P. multocida isolates on 12% Coomassie Blue stained PA gel. Lane M- Marker (11 to 245kDa) Lane 1: OMP profile of P52 grown in iron restricted media (BHI broth containing 2, 2’ dipyridyl) Lane 2 to 4: OMP profiles of field isolates grown in iron restricted media (BHI broth containing 2, 2’ dipyridyl) Lane 6: OMP profile of P52 grown in normal BHI broth Lane 7 to 10: OMP profiles of isolates grown in normal BHI broth A-16 kDa; B-20 kDa; C-22 kDa; D-24 kDa; E-26 kDa; F- 31 kDa; G-37 kDa; H-45 kDa; I-46 kDa; J-49 kDa; K-86 kDa L-68 kDa, M-71 kDa, N-50 kDa, O-112 kDa, P-125 kDa


318

were observed which included two intense bands of 39 and 32 kDa, and four less intense bands of 91, 72, 44 and 15 kDa. The characterizations of OMPs of P. multocida serotype B: 2 by Dey and Singh (2008) revealed that the MW of isolates and the vaccine strain ranged between 18 and 93 kDa in SDS-PAGE. Asma et al. (2009) noticed 4 types of electrophoretic profiles among 9 isolates and the most commonly occurring proteins were found to be of 21, 30, 33, 36, 50, 54, 58, 60, 75, 86, 90 and 108 kDa. Somshekhar et al. (2014) extracted OMPs from 12 isolates of P. multocida obtained from buffaloes and analyzed them by SDS-PAGE. The OMP profile revealed a total of 9 to 14 bands with approximate molecular weights ranging from 16 to 123 kDa. They observed that protein band of MW 69 kDa was present in only four of the field isolates. They also found that OMPs with MW 89, 72, 48, 37, 32, 29, 26 and 16 kDa were common to all isolates, of which 32 kDa protein was considered to be the major protein.

In the present study, two polypeptides of 31 kDa and 37 kDa could be considered as major OMPs based on the band intensity. This is in agreement with the findings of Tomer et al. (2002). They also reported 31 and 37 kDa proteins as the major proteins, though they found an additional major band of MW 33 kDa in the vaccine strain in addition to 31 and 37 kDa protein bands. Similar findings were also reported by Pati and co-workers (1996). The presence of a major protein which is ~32kDa was also reported by Pal et al. (2002), Singh and Goel (2002), Arora et al. (2007) and Somshekhar et al. (2014). Jain et al. (2005) found two polypeptides of MW 31.7 kDa and 34.9 kDa as major proteins in serotype B isolates of P. multocida.

H.S. vaccine strain, P52 revealed the presence of 13 bands with protein fractions of 16,

19, 22, 24, 26, 31, 37, 45, 46, 49, 68, 71 and 86 kDa. Based on the intensity of bands, polypeptides with MW of 31 and 37 kDa were assumed to be the major OMPs.

Somshekhar et al. (2014) reported the OMP profile of P52 vaccine strain having polypeptide bands ranging from 16 to 123 kDa, of which 32 kDa protein being the most intense band. Other bands were of MW 123, 89, 72, 69, 48, 46, 37, 29, 26 and 16 kDa respectively. OMP characterization of P. multocida P52 vaccine strain by Pati et al. (1996) revealed ten major protein bands ranging from 25 to 88 kDa while, Wasnik et al. (1998) detected 13 OMP bands ranging from 15.92 to 93.92 kDa. Tomer and co-workers (2002) found 20 polypeptide bands ranging from 16 to 90 kDa in the OMP profile of P52 vaccine strain. Even though the range of MW of protein bands obtained in our study was similar (16 to 86 kDa), only 11 protein bands were obtained in our study. Twenty three polypeptide bands were detected in the P52 vaccine strain by Arora et al. (2007) ranging from 13 to 94 kDa in MW and they assumed 32, 25 and 28 kDa bands to be the major proteins based on stain intensity. The studies conducted by Prasannavadhana et al. (2014) revealed 15 polypeptide bands in P52 vaccine strain, of which 33 and 38 kDa proteins were found to be major proteins.

The comparison of OMP profiles of the buffalo isolates and the vaccine strain used in the present study revealed that the overall profiles were similar in terms of amount, number and position of protein bands, with only minor differences. The total number of bands in the buffalo isolates was 11 while H.S. vaccine strain expressed a total of 13 protein bands. The two extra bands expressed in the vaccine strain were having MWs of 68 and 71 kDa. These bands were not expressed in the buffalo isolates and this represent some minor variations


319

between the buffalo isolates and H.S vaccine strain.The minor differences were observed in

the molecular weights of OMP profiles by different workers. The determination of molecular weights solely on the basis of molecular marker is erroneous and could have led to such incompatibilities (Prasannavadhana et al., 2014); the same organism used at different passage level in vitro may express different proteins (Knights et al., 1990). The pressure of the host environment in vivo on the expression of the protein can also cause difference in the molecular weights of the proteins recognized in SDS-PAGE (Prasannavadhana et al., 2014)

In the present study, the buffalo isolates and P52 vaccine strain were grown in the medium with iron chelating compound (2, 2’ bipyridyl), to study the difference in protein profile under iron restricted conditions. The OMP profiles revealed 13 to 15 bands ranging from 16 to 125 kDa including two additional proteins of MW 112 and 125 kDa. These two proteins were expressed only in iron-limited conditions; all the other bands were of the same molecular weight as in the OMP profile obtained in normal conditions. So the 112 and 125 kDa proteins can be considered as the iron-restricted outer membrane proteins (IROMPs). An upregulation of 50 and 86 kDa proteins was also observed upon iron-restriction. Prasannavadhana (2014) reported three additional proteins (110, 125 and 127 kDa) when P52 vaccine strain of P. multocida was grown in iron restricted conditions. Borkowska-Opacka and Kedrak (2002) reported IROMPs of MW 102 and 110 kDa from P. multocida of serotype B: 2, 5 when grown in iron restricted conditions. Jain et al. (2005) also reported the presence of an IROMP of 102 kDa in serotype B isolates of P. multocida. In contrast to our study, some studies (Jain et al., 2005 and Wasnik, 1998) revealed no additional bands when P52 cells were grown in

iron restricted conditions. These variations in iron restricted protein expression might be due to the difference in the amount of 2, 2’ dipyridyl used for iron restriction and also owing to the difference in the passage levels of the organisms employed in different studies (Knights et al., 1990).

However, there are reports that the immunogenicity of IROMPs is higher than OMPs prepared in iron sufficient medium (Srivastava, 1998 and Confer et al., 2001). So a vaccine prepared from IROMPs can come up with better protection than normal vaccines prepared from P. multocida grown under iron sufficient conditions. In summary, outer membrane protein profiling of P. multocida buffalo isolates revealed two major proteins of 31.7 kDa and 34.9 kDa. Two iron regulated outer membrane proteins of MW 112 and 125 kDa were expressed by P. multocida isolates but further their role in virulence needs to be studied.

ACKNOWlEDGEMENT

The authors thankfully acknowledge the laboratory facilities extended by the Department of Agriculture Biotechnology, AAU, Anand.

REFERENCES

Abdullahi, M.Z., N.J.L. Gilmour and I.R. Poxton. 1990. Outer membrane proteins of bovine strains of Pasteurella multocida type A and their doubtful role as protective antigens. J. Med. Microbiol., 32: 55-61.

Arora, A.K., S.K. Jand, K.S. Sandhu and M.S. Oberoi. 2007. Outer membrane protein profiles of Pasteurella multocida isolates


320

of bovine origin. Indian J. Anim. Sci., 77: 663-666.

Asma, A., S. Mahboob, M.S. Shah and S. Nadeem. 2009. Analysis of outer membrane proteins of Pasteurella multocida strains isolated from buffaloes affected with hemorrhagic septicemia. Australian Journal of Basic and Applied Sciences, 3(3): 2360-2365.

Borkowska-Opacka, B. and A. Kedrak. 2002. Expression of iron-regulated outer membrane proteins (IROMPS) by Pasteurella multocida strains isolated from cattle. Bull. Vet. I. Pulawy, 46: 157-164.

Borkowska-Opacka, B. and A. Kedrak. 2003. Evaluation of immunogenicity of outer membrane proteins of Pasteurella multocida serotype B: 2, 5 in cattle. Bull. Vet. I. Pulawy, 47: 377-385.

Choi-Kim, H., S.K. Maheswaran, L.J. Felice and T.W. Molitor. 1991. Relationship between the iron regulated outer membrane proteins and the outer membrane proteins of in vivo grown Pasteurella multocida. Vet. Microbiol., 28: 75-92.

Confer, A.W., M.A. Suckow, M. Montelongo, S.M. Dabo, L.J. Miloscio, A.J. Gillespie and G.L. Meredith. 2001. Intranasal vaccination of rabbits with Pasteurella multocida A: 3 outer membranes that express iron-regulated proteins. Am. J. Vet. Res., 62: 697-703.

Dabo, S.M., A.W. Confer and G.L. Murphy. 1997. Outer membrane proteins of bovine Pasteurella multocida serogroup A isolates. Vet. Microbiol., 54: 167-183.

Davies, R.L., R. Parton, J.G. Coote, H.A. Gibbs and J.H. Freer. 1992. Outer membrane protein and lipopolysaccharide variation in Pasteurella haemolytica serotype A under different growth conditions. J. Gen.

Microbiol., 138: 909-922.De Alwis, M.C.L. 1992. Haemorrhagic septicaemia.

A general review. Brit. Vet. J., 148: 99-112.Dey, S. and V.P. Singh. 2008. Outer membrane

protein profiles of Indian isolates of Pasteurella multocida serotype B: 2. Indian J. Anim. Sci., 78: 4943.

Dutta, J., B.S. Rathore, S.G. Mullik, R. Singh and G.C. Sharma. 1990. Epidemiological studies and occurrence of haemorrhagic septicaemia in India. Indian Vet. J., 67: 893-899.

Hatfaludi, T., K. Al-Hasani, J.D. Boyce and B. Adler. 2010. Outer membrane proteins of Pasteurella multocida. Vet. Microbiol., 144: 1-17.

Hu, S.J., L.J. Felice, V. Sivanandan and S.K. Maheswaran. 1986. Siderophore production by Pasteurella multocida. Infect. Immun., 54: 804-810.

Jain, A., A. Roy, D.N. Rank, C.G. Joshi and J.H. Purohit. 2005. Characterization of the Pasteurella multocida isolates by their outer membrane protein profiles. Indian J. Compo. Microbiol. Immunol. Infect. Dis., 26: 63-65.

Johnson, R.B., D.J.S. Hugh and T. Spencer. 1991. Electrophoretic profile of Pasteurella multocida isolates from animals with haemorrhagic septicaemia. Am. J. Vet. Res., 52: 1644-1648.

Knights, J.M., C. Adlam and P. Owen. 1990. Characterization of envelope proteins from Pasteurella haemolytica and Pasteurella multocida. J. Gen. Microbiol., 136: 495-505.

Kumar, A.A., S.B. Shivachandra, A. Biswas, V.P. Singh, V.P. Singh and S.K. Srivastava. 2004. Prevalent serotypes of Pasteurella


321

multocida isolated from different animal and avian species in India. Vet. Res. Commun., 28: 657-667.

Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685.

Lin, J., S. Huang and Q. Zhang. 2002. Outer membrane proteins: key players for bacterial adaptation in host niches. Microbes. Infect., 4: 325-331.

Marandi, M.V. and K.R. Mittal. 1995. Identification and characterization of outer membrane proteins of Pasteurella multocida serotype D by using monoclonal antibodies. J. Clin. Microbiol., 33: 952-957.

Marandi, M.V., J.D. Dubreuil and K.R. Mittal. 1996. The 32 kDa major outer membrane protein of Pasteurella multocida capsular serotype D. Microbiology, 32: 199-206.

McLean, S. 2012. Eight stranded β-barrel and related outer membrane proteins: role in bacterial pathogenesis. Protein Peptide Lett., 19(10): 1013-1025.

Munir, R., D. Shahwar, U. Farooq, I. Nawaz, I. Shahzad and A. Khanum. 2007. Outer membrane protein profiling of Pasteurella multocida. Pak. Vet. J., 27: 1-4.

Pal, A., S.K. Srivastava and V.P. Singh. 2002. Heat modifiability of outer membrane protein of Pasteurella multocida serotype B: 2. Indian J. Exp. Biol., 40: 106-108.

Pati, U.S., S.K. Srivastava, S.C. Roy and T. More. 1996. Immunogenicity of outer membrane protein of Pasteurella multocida in buffalo calves. Vet. Microbiol., 52: 301-311.

Prasannavadhana, A., S. Kumar, P. Thomas, L.N. Sarangi, S.K. Gupta, A. Priyadarshini, V.K. Nagaleekar and V.P. Singh. 2014. Outer membrane proteome analysis of Indian

strain of Pasteurella multocida serotype B: 2 by MALDI-TOF/MS analysis. Sci. World J., (http://dx.doi.org/10.1155/2014/617034).

Rimler, R.B. and K.R. Rhoades. 1989. Pasteurella multocida, p. 37-73. In Adlam, C.F. and J.M. Rutter (eds.) Pasteurella and Pasteurellosis, Academic Press, London.

Ruffolo, C.G., B.H. Jost and B. Adler. 1998. Iron-regulated outer membrane proteins of Pasteurella multocida and their role in immunity. Vet. Microbiol., 59: 123-137.

Singh, R. and M.C. Goel. 2002. Isolation and purification of purification of outer membrane proteins of Pasteurella multocida. Indian J. Anim. Sci., 72: 625-626.

Snipes, K.P., L.M. Hansen and D.C. Hirsh. 1988. Plasma-and iron-regulated expression of high molecular weight outer membrane proteins by Pasteurella multocida. Am. J. Vet. Res., 49: 1336-1338.

Somshekhar, S.H., B.M. Veeregowda, V.V.S. Suryanarayana, G. Leena, K. Dhama and S. Chakraborty. 2014. Outer membrane protein (OMP) profiles of Pasteurella multocida isolates associated with haemorrhagic septicaemia by SDS-PAGE and western blot analysis. Asian J. Anim. Vet. Adv., 9: 513-518.

Srivastava, S.K. 1998. Outer membrane protein of Pasteurella multocida serotype B: 2 is immunogenic and antiphagocytic. Indian J. Exp. Biol., 36: 530-532.

Tomer, P., G.C. Chaturvedi, M.P. Malik and D.P. Monga. 2002. Comparative analysis of the outer membrane protein profiles of the isolates of Pasteurella multocida B: 2 associated with haemorrhagic septicaemia. Vet. Res. Commun., 26: 513-522.

http://dx.doi.org/10.1155/2014/617034


322

Townsend, M.K., D.J. Boyce, Y.J. Chung, J.A. Frost and B. Adler. 2001. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. J. Clin. Microbiol., 39: 924-929.

Ullah, I., M. Abubaker, R. Durrani, R. Anjum, N. Ayub and Q. Ali. 2008. Differentiation of closely related vaccinal strains of Pasteurella multocida using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Pak. Vet. J., 28: 175-180.

Wasnik, R.V. 1998. Characteristics of outer membrane proteins of Pasteurella multocida serotype B: 2. M.V.Sc. Thesis, Indian Veterinary Research Institute, Izatnagar, India.


323

ABSTRACT

Interleukin-1 (IL-1) play its role in inflammation, fever and release of acute phase proteins by acting on major organs of the body. IL-1α gene along with other cytokines compels Th1 and Th17 inflammatory responses. The present study is aimed at standardization of polymerase chain reaction for amplification of IL-1α gene from bovine peripheral blood mononuclear cells. Blood samples were collected in containers with 0.1% Ethylenediaminetetraacetic acid (EDTA) anticoagulant (Sigma, USA). Peripheral blood mononuclear cells (PBMCs) were isolated using commercially available Histopaque®-1077. Extracted total ribose nucleic acid (RNA) was utilized in reverse transcription to prepare complementary deoxyribose nucleic acid (cDNA). IL-1α gene specific primers were used to amlify partial nucleotide sequence of IL-1α. The cDNA was employed in polymerase chain reaction (PCR). The resulting IL-1α DNA product (124 bp) was identified on agar gel electrophoresis and documented.

Keywords: buffaloes, Bubalus bubalis, bovine peripheral, blood mononuclear cells, Interleukin-1

INTRODUCTION

Cytokines are proteins released from cells to act on adjacent or distantly located cells and even on the cell itself and modulate the immune responses. Cytokines secreted by some leukocytes and act upon other leukocytes are referred as Interleukins. Cytokines exhibit attributes of pleiotropy, redundancy, antagonism, and synergy and cascade induction and hence regulate cellular activity in a co-ordinated, interactive way as per Kindt et al. (2007). Cytokines play a pivotal role in regulating immune responses of infected or vaccinated animals. Fate of the infectious process is also governed by antiviral cytokines induced after infection. Three primary classes of cytokines were divided into pro-inflammatory, anti-inflammatory and chemokines by Flint et al. (2004). Cytokine interleukin-1 (IL-1), tumour necrosis factor (TNF), IL-6 and IL-12 are examples of pro-inflammatory which promote leukocyte activation, while others IL-10, IL-4 and tumour growth factor (TGF) β are anti-inflammatory and suppress activity of pro-inflammatory cytokines and return system to basal “circulate and wait state”. Adhesion molecules (intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion molecule (VCAM)-1) are induced at site of inflammation by TNF-α, IL-1

IDENTIFICATION OF IL-1α GENE FROM BOVINE PERIPHERAL BLOOD MONONUCLEAR CELLS BY POLYMERASE CHAIN REACTION

S.D. Audarya1,*, A. Sanyal2, J.K. Mohapatra2 and B. Pattnaik2

1Department of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Nanaji Deshmukh Veterinary Science University, Mhow Indore, Madhya Pradesh, India, *E-mail: [email protected] Veterinary Research Institute Campus, Mukteshwar-Kumaon, Nainital, Uttarakhand, India

Original Article



324

and IFN-γ. Hence the present study is aimed to standardize and identify IL-1α gene from peripheral blood mononuclear cells from healthy bovines.


Blood samples were collected asceptically in glass containers with anticoagulant (0.1% Ethylenediaminetetraacetic acid (EDTA) from the Jugular vein of bovine animals. The animals were kept at Dairy section of Indian Veterinary Research Institute (IVRI), Mukteshwar-Kumaon, Uttarakhand (Himalayan Holstein Friesian

crossbred cattle residing at high altitude of more than 2000 m above sea level). IL-1α and 18S RNA custom oligonucleotide synthesized primers (Standard, 0.02 µmol) were obtained from Metabion GmBH (Germany) as per Lahmers et al. (2006). Primers were diluted as per instructions of the manufacturer and kept at -80oC as a stock. The details of which are given in the Table 1. Peripheral blood mononuclear cells were isolated by using Histopaque®-1077 by adopting the method of Boyum (1968). RNA was extracted as per Chomczynski and Sacchi (1987). Reverse Transcription (RT) method was used to produce cDNA by employing only Oligo dT(15) primers.

Table 1. List of primers used to amplify IL-1α and 18S RNA.

Item Primer sequenceProduct size, bp

Primer length

IL-1α F-5’- CCA CTT CGT GAG GAC CAG ATG AAT-3’ 124 24R-5’- TCT TCA GAA TCT TCC CAC TGG CTG-3’ 24

18S RNA F- 5’-CTG AGA AGA CGG TCG AAC TTG ACT-3’ 90 24R-5’-TCC GTT AAT GAT CCT TCC GCA GGT-3’ 24

Figure 1. Agarose gel electrophoresis of amplified products. Marker: DNA Ladder

100 bp18S RNA, 90 bp

IL-1α, 124 bp


325

The procedures of isolation of PBMCs and RT were given by Audarya et al. (2014). Polymerase chain reaction (PCR) was conducted as per the following in a reaction volume of 13 μl for both 18S RNA and IL-1α; GoTq 5x buffer -2.5 μl, MgCl2 (25 mM/μl) -0.75 μl, dNTP mix (10 mM/μl) -0.5 μl, cDNA -1 μl, GoTq Tq DNA polymerase (5 U/μl) -1 μl and Nuclease Free Water -6.25 μl and Primers (forward and reverse) -1 μl (0.5 μl each). The final concentration of the primers was 100 nM. Cycling conditions were as follows; i) Initial activation at 95oC for 2 minutes, ii) denaturation at 95oC for 30 seconds, annealing 60oC for 30 seconds and extension 72oC for 1 minute for 35 subsequent cycles and iii) final extension at 72oC for 10 minutes thereafter iv) hold at 4oC. Tris Borate EDTA buffer (TBE, Promega, USA) was used to prepare 1% agarose gel. 0.5 µg/ml Ethidium bromide (Electran®, BDH, UK) was added in the gel. Then, 5 µl of amplified DNA product of IL-1α and 18S RNA genes were loaded in the wells using 6x loading dye and the gel electrophoresis was run for 1 h duration at 100 V and thereafter documented using gel the results were documentation system.


In the present investigation, peripheral blood mononuclear cells were isolated, total RNA extracted, cDNA prepared and used in PCR to document successful amplification of 18S RNA (90 bp) and IL-1α (124 bp) DNA products (Figure 1). 18S RNA is normally expressed by the cells and its detection makes sure about the vitality of cells. In Indian cattle and buffalo there was transient but marked decrease in the circulating leukocyte and monocyte levels on 1 day post Foot-and-Mouth disease virus (FMDV) infection (Mohan et al.,

2008). Mingala et al. (2009) studied expression of cytokines in water buffalo after inactivated FMDV vaccination and reported that IFN-γ, IL-10 and TNF-α was highest at three week post-vaccination than IL-2, IL-4 and IL-6. Increase in T lymphocyte activity after vaccination was thought to be linked with failure in detecting IL-1 after emergency FMDV vaccination by Barnett et al. (2002) while as per Zhang et al. (2006) in acute stage of infection, there was increased mRNA expression of IL-1α. There were changes in cytokine expression during the day and night in case of IL-6 as reported by Vgontzas et al. (2005). Hence successful standardization, amplification and identification of IL-1α will subsequently help in formulating strategies to study differential expression of cytokines in FMDV infection and vaccination.

ACKNOWlEDGEMENTS

The authors would like to thank the staff of the PDFMD for extending timely help during the investigation and also express the gratitude to Indian Council of Agricultural Research for funding the study.

REFERENCES

Audarya, S.D., A. Sanyal, L.K. Pandey, J.K. Mohapatra and B. Pattnaik. 2014. Molecular cloning and sequencing of bovine TNF-α cytokine gene from peripheral blood mononuclear cells. Indian Res. J. Ext. Edu., 14: 65-69.

Barnett, P.V., S.J. Cox, N. Aggarwal, H. Gerber and K.C. McCullough. 2002. Further studies on the early protective responses of pigs


326

following immunization with high potency Foot-and-Mouth disease vaccine. Vaccine, 20(25-26): 3197-3208.

Boyum, A. 1968. Separation of leukocytes from blood and bone marrow. Scand. J. Clin. Lab. Inv., 97(7).

Chomczynski, P. and N. Sacchi. 1987. Single step method of RNA isolation by acid guanidium thiocyanate - phenol - chloroform extraction. Anal. Biochem., 162: 156-159.

Flint, S.J., L.W. Enquist, V.R. Racaniello and A.M. Skalka. 2004. Principles of Virology: Molecular Biology, Pathogenesis, and Control of Animal Viruses. ASM Press, Washington D.C., USA. 918p.

Kindt, T.J., R.A. Goldsby and B.A. Osborne. 2007. Kuby Immunology, 6th ed., WH Freeman and Company, New York, USA. 574p.

Lahmers, K.K., J.F. Hedges, M.A. Jutila, M. Deng, M.S. Abrahamsen and W.C. Brown. 2006. Comparative gene expression by WC1+ γ/d and CD4+ α/β T lymphocytes, which respond to Anaplasma marginale, demonstrates higher expression of chemokines and other myeloid cell-associated genes by WC1+ γ/d T cells. J. Leukocyte. Biol., 80: 939-952.

Mingala, C.N., S. Konnai, F.A. Venturina, M. Onuma and K. Ohashi. 2009. Quantification of water buffalo (Bubalus bubalis) cytokine expression in response to inactivated Foot-and-Mouth disease (FMD) vaccine. Res. Vet. Sci., 87: 213-217.

Mohan, M.S., M.R. Gajendragad, S. Gopalkrishna and N. Singh. 2008. Comparative study of experimental Foot-and-Mouth disease in cattle (Bos indicus) and buffaloes (Bubalus bubalis). Vet. Res. Commun., 32: 481-489.

Vgontzas, A.N., E.O. Bixler, H.M. Lin, P. Prolo, G. Trakada and G.P. Chrousos. 2005. IL-6

and its circadian secretions in humans. Neuroimmunomodulat., 12(3): 131-140.

Zhang, Z., J.B. Bashiruddin, C. Doel, J. Horsington, S. Durand and S. Alexandersen. 2006. Cytokine and toll-like receptor mRNAs in the nasal-associated lymphoid tissues of cattle during Foot-and-Mouth disease virus infection. J. Comp. Pathol., 134: 56-62.


327

ABSTRACT

In Italy buffalo farms adopted intensive breeding techniques, however the high density of animals in intensive breeding favours the diffusion of ectoparasites, such as louse.

The aim of this study was to determine the in vitro efficacy of the insecticide alphacypermethrin (ACYP) against the buffalo louse, Haematopinus tuberculatus. The study was performed by using louse collected from animals in a commercial buffalo farm located in the Campania region of Southern Italy. Lice (adults and nymphs) were collected from highly infested buffaloes. The ACYP was diluted with physiological solution to different concentrations: 1.5%, 0.75%, 0.37%. A volume of 600 µl of the diluted sample was spread evenly over a filter paper held in the lower half of Petri dish. Ten adult lice and ten nymphs were placed on the top of each filter paper disc. The control groups were treated with physiological solution. Seven replicates were used for each concentration. The louse vitality was assessed at different time intervals: 1, 2, 4, 8, 10, 15, 20, 30, 40, 50, 60 minutes, after every 10 minutes until 240

minutes or at the louse death. After 240 minutes the louse vitality was examined each 60 minutes until 540 minutes. In vitro bioassays revealed that the lousicidal efficacy of ACYP improved as the concentration and the exposure time increased. The results of this in vitro study confirm that ACYP at 1.5% concentration can also be used in buffalo for the control of lice, as already in use in cattle. Further field trials will need to be conducted to confirm the safety, the dosage and the in vivo parasitological efficacy of this drug on buffaloes.

Keywords: alphacypermethrin, water buffalo, Bubalus bubalis, louse, Haematopinus tuberculatus

INTRODUCTION

The sucking louse Haematopinus tuberculatus (Burmeister, 1839), Phylum Arthropoda, Class Insecta, Order Phthiraptera, Suborder Anoplura, Family Haematopinidae, is a specific louse of water buffalo (Bubalus bubalis), being the principal ectoparasite which attaches this species (Bastianetto et al., 2002); it has

IN VITRO EFFICACY OF ALPHACYPERMETHRIN ON THE BUFFALO LOUSE HAEMATOPINUS TUBERCULATUS (BURMEISTER, 1839)

Vincenzo Veneziano1,*, Gianluca Neglia1, Francesco Buono1, Laura Pacifico1, Laura Manna1, Andrea Bassini2, Luca Miotto2, Mario Santoro3 and Cengiz Gokbulut4

1Department of Veterinary Medicine and Animal Productions, University of Naples Federico II, Naples, Italy, *E-mail: [email protected], Rome, Italy3Istituto Zooprofilattico Sperimentale del Mezzogiorno, Portici, Napoli, Italy4Department of Medical Pharmacology, Faculty of Medicine, Balikesir University, Balikesir, Turkey

Original Article



328

been reported on water buffalo in Asia, Africa, Australia, and South America (Meleney and Kim, 1974). In Europe it has been reported in Albania, Macedonia, France, England and Italy (Veneziano et al., 2003). Cattle, camels and American bison are also susceptible to infection (Chaudhuri and Kumar, 1961). Louse infestation often leads to skin irritation, anemia, anorexia, restlessness and loss of body condition. The itch caused by H. tuberculatus is responsible for the low milk and meat productivity (Bastianetto and Leite, 2005).

The buffalo louse infestation needs to be controlled, particularly if the general condition of animals is affected (Veneziano et al., 2004). On water buffalo, several formulations marketed for cattle have been tested in field trials against H. tuberculatus in particular macrocyclic lactones such as ivermectin (Lau and Sing, 1985), avermectin, doramectin (Bastianetto et al., 2002) and eprinomectin (Veneziano et al., 2004).

Alphacypermethrin (ACYP) is a synthetic pyrethroid insecticide, containing more than 90% of the most active enantiomer pair of the four cis isomers of cypermethrin as a racemic mixture. ACYP acts on insect’s axons in the peripheral and central nervous systems by interacting with sodium channels. This compound is effective against a wide range of pests of many crops and is also used for the control of various veterinary and public health insects, including lice. In Italy ACYP is marketed as a pour-on formulation for use in cattle, with zero milk-withdrawal time. Therapeutics, such as antiparasitic compounds, are often administered to buffaloes based on dosage and intervals recommended for cattle because very few drugs have buffalo-specific label indications (Veneziano et al., 2004).

This is why the literature lacks information on the use and efficacy on buffaloes of most

insecticides. Because there is no data on the in vitro efficacy of the different group of insecticide on buffalo louse, the aim of this study was to determine, for the first time, the in vitro efficacy of the ACYP at different concentrations against the buffalo louse, H. tuberculatus.


The study was performed by using louse collected from animals in a commercial buffalo farm located in the Campania region of Southern Italy. The buffaloes had naturally lice infestation. In order to carry out species identification, 50 louse were collected 5 days before the beginning of the trial from 5 randomly selected adult buffaloes. Louse specimens were studied by using the following routine procedure: in vitro mounting, examination under optical and dissection microscopes, and comparison of the resulting morphometric data with those reported in the literature. Species determination was based on the keys proposed by Chaudhuri and Kumar (1961) and Meleney and Kim (1974). The buffalo louse H. tuberculatus (nearly 600) was collected by 5 researchers from 5 buffaloes highly infested.

A commercial preparation of ACYP (Renegade™, pour on, 1.5%, w/v, Pfizer Animal Health, Italy) was used to prepare three different working concentrations of ACYP (1,5%, 0.74%, 0.37%).

The method used to assess the lousicidal activity of ACYP was adapted from the World Health Organization (WHO, 1981) protocol and according to the methodology from Priestley et al. (2006). Bioassays were performed at 27°C and 75% relative humidity (RH). The direct contact assay was carried out as follows. The ACYP


329

was diluted in physiological solution to different concentrations: 1.5%, 0.74%, 0.37%. Three drops of Tween 80 were added as emulsifier. A volume of 600 µl of each concentration was properly distributed over a 9 cm diameter filter paper held in the lower half of a 9 cm glass Petri dish. The liquid was allowed to evenly spread for 15 minutes until the filter paper was totally soaked with the insecticide.

Ten adult lice and ten nymphs of H. tuberculatus were placed in two Petri dishes for each concentration. Additional adult and nymphs stages treated with the same volume of physiological solution and Tween 80 only served as untreated control and were placed in two separate plates. Seven replicates were used for each concentration.

Louse vitality was assessed by stereomicroscopy (Leica EZ4 HD) at different time intervals: 1, 2, 4, 8, 10, 15, 20, 30, 40, 50, 60 minutes and then every 10 minutes until 240 minutes or at the louse death. After 240 minutes, the vitality of lice has been measured at 60 minutes intervals up to 540 minutes, i.e. the time when all treated parasites were found to be dead. Lice showing no movements of legs and intestine and unresponsive when stimulated with an entomological pin were considered as dead (Priestley et al., 2006).

The efficacy (%) of ACYP was calculated at 1, 2, 4, 8, 10, 15, 20, 30, 40, 50, 60, 70 to 240 minute (at ten minutes’ interval) and 240 to 540 minutes (at sixty minutes’ interval), by using a modified Abbot’s formula (1925):

Efficacy=100 x [n live lice in control plate - n live lice in treated plate] n live lice in control plate

Differences in louse count were analysed using an ANOVA test for comparison of the treated with the control group. P-values<0.05 were

considered significant.


The morphometric data regarding the lice collected during this study were closely corresponded to those reported for H. tuberculatus (Figure 1).

The results demonstrated that ACYP was effective against both adults and nymphs at all concentration levels. In vitro bioassays revealed a higher efficacy of ACYP on lice with increasing concentrations and exposure times. The results have been summarized in Figure 2 and Figure 3, showing the knockdown activity of the ACYP against H. tuberculatus. The Table 1 shows the efficacy values of all concentrations at different time intervals, expressed as percent reduction.

ACYP was effective against the buffalo louse at all concentration levels. The 1.5% concentration has shown the fastest parasiticidal effect on adults lice, with a complete knockdown activity achieved within 70 minutes. On the contrary, while a parasiticidal activity was observed at concentrations 0.75% and 0.37%, the death of all lice occurred at 200 and 540 minnutes, respectively. Moreover, a significant difference (P<0.05) between 1.5% and lower concentrations was reported as early as 4 minutes post-treatment, indicating the important role of drug dilution. At lower concentrations (0.75 to 0.37%), no significant differences were observed, although the death of lice occurred more rapidly at 0.75%. The nymph stages have shown higher susceptibility to ACYP than adults, with a overall knockdown activity being achieved earlier. The 1.5% concentration of ACYP displayed a complete knockdown activity


330

Figure 1. Haematopinus tuberculatus at different stages.

Figure 2. Knockdown activity of Alphacypermethrin on adult stages of Haematopinus tuberculatus at different

concentrations.


331

after 50 minutes post-treatment, and mortality in nymphs was significantly higher (P<0.05) than in adults as early as 8 minutes post-treatment. Similarly, mortality in nymphs was found higher (P<0.05) than adults also at concentration 0.75% as early as 8 minutes from the start of treatment. At 0.37%, no increase in mortality has been observed for the nymphs as compared to adults.

A full knockdown activity of ACYP at different concentrations has been indicated on nymphs after 50 minutes at 1.5%, and after 190 and 360 minutes at 0.75% and 0.37%, respectively. Although 1.5% was statistically the most effective concentration as compared to lower dilutions (as early as 2 minutes post-treatment) also on nymphs, 0.75% concentration was more effective than 0.37% from 4 to 110 minutes (P<0.05). Thereafter, these two concentration levels induced similar reductions of lice.

There are limited data available on in vitro efficacy of drugs against the buffalo louse, the results observed in the present study are comparable only to data reported by Khater et al. (2009). The authors showed, in a similar in vitro bioassay, that all treated lice were killed within a minute after

treatment by using some essential oils. While the in vitro treatment of H. tuberculatus with different concentrations of d-phenothrin determined the 100% mortality within 20 minutes.

In relation with the lousicidal efficacy, according to WAAVP guidelines (Holdsworth et al., 2006), an in vivo ectoparasiticide drug should provide a reduction in the parasitic population of at least 95% to demonstrate its efficacy in louse control. Highly efficacy values have been recorded within 60 minutes on adults and from 30 minutes on nymphs at 1.5% concentration. The concentration of 0.75% the efficacy value ≥ 95% has been achieved starting 190 and 180 minutes on the adults and on the nymphs, respectively. The times were longer at the concentration 0.37%, 220 minutes and 190 minutes on adults and on nymphs, respectively.

The preliminary results of this in vitro study confirm that ACYP may be used in buffaloes, as well as in cattle, for the control of sucking lice at a 1.5% concentration.

This is the first study to evaluate the in vitro efficacy of ACYP against the buffalo louse H. tuberculatus. Further field trials are required to

Figure 3. Knockdown activity of Alphacypermethrin on nymph stages of Haematopinus tuberculatus at different concentrations.

http://www.ncbi.nlm.nih.gov/pubmed/16359804?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum



332

Tabl

e 1.

Lou

sici

dal e

ffica

cy o

f diff

eren

t con

cent

ratio

ns o

f Alp

hacy

perm

etrin

at d

iffer

ent t

ime

inte

rval

s.

C

= C

ontro

l T =

Tre

ated

Con

cent

ratio

ns1.

5%0.

75%

0.37

%

N° A

dults

N°

Nym

phs

N° A

dults

N°

Nym

phs

N° A

dults

N°

Nym

phs

Tim

e

(min

utes

)C

TE

ffica

cy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

070

70-

7070

-70

70-

7070

-70

70-

7070

-

170

70-

7069

1.4

7070

-70

70-

7070

-70

70-

270

674.

370

6014

.370

70-

7068

2.9

7070

-70

70-

470

5817

.170

5127

.170

70-

7065

7.1

7070

-70

70-

870

5324

.370

3254

.370

70-

7056

20.0

7070

-70

682.

9

1070

4437

.170

2170

.070

70-

7056

20.0

7070

-70

682.

9

1570

3845

.170

1085

.770

682.

970

5127

.170

70-

7065

7.1

2070

3057

.170

592

.970

682.

970

5127

.170

70-

7065

7.1

3070

1874

.370

395

.770

6310

.070

4437

.170

682.

970

657.

1

4070

1085

.770

198

.670

6310

.070

3747

.170

6112

.970

657.

1

5070

691

.470

010

0.0

7061

12.9

7035

50.0

7056

20.0

7061

13.0

6070

297

.170

4240

.070

3352

.970

4437

.170

6113

.0

7070

010

0.0

7040

42.9

7030

57.1

7040

42.9

7058

17.1

8070

3845

.770

2860

.070

3747

.170

5422

.9

9070

2860

.070

1282

.370

2860

.070

3747

.1

100

7026

62.9

7012

82.3

7021

70.0

7030

57.1

110

7023

67.1

7012

82.3

7019

72.9

7023

67.1

120

7019

72.3

7012

82.3

7014

80.0

7012

82.9

130

7019

72.3

709

87.1

709

87.1

7012

82.9

140

7014

80.0

707

90.0

709

87.1

7011

84.3

150

709

87.1

707

90.0

705

92.9

709

87.1

160

709

87.1

707

90.0

705

92.9

708

88.6

170

705

92.9

705

92.9

705

92.9

705

92.9

180

704

94.3

702

97.1

705

92.9

705

92.9


333

Tabl

e 1.

Lou

sici

dal e

ffica

cy o

f diff

eren

t con

cent

ratio

ns o

f Alp

hacy

perm

etrin

at d

iffer

ent t

ime

inte

rval

s. (C

ont.)

C =

Con

trol T

= T

reat

ed

Con

cent

ratio

ns1.

5%0.

75%

0.37

%

N° A

dults

N°

Nym

phs

N° A

dults

N°

Nym

phs

N° A

dults

N°

Nym

phs

Tim

e

(min

utes

)C

TE

ffica

cy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

CT

Effi

cacy

(%)

190

702

97.1

700

100.

070

494

.368

395

.6

200

700

100.

070

494

.368

297

.1

210

704

94.3

682

97.1

220

703

95.7

682

97.1

230

702

97.1

682

97.1

240

702

97.1

681

98.5

300

702

97.1

681

98.5

360

701

98.6

680

100.

0

420

701

98.6

480

691

98.6

540

690

100.

0


334

confirm safety, dosage and in vivo parasitological efficacy of this insecticide on water buffalo.

ACKNOWlEDGMENT

The authors would like to thank Zoetis, Italy for technical support.

REFERENCES

Abbott, W.S. 1925. A method of computing the effectiveness of an insecticide. J. Econ. Entomol., 18: 265-267.

Bastianetto, E., V.M. Barbosa and R.C. Leite. 2002. Evaluation of the different avermectin bases in the control of Haematopinus tuberculatus. p. 357-359. In Proceedings of 1st Buffalo Symposium of Americas.

Bastianetto, E. and R.C. Leite. 2005. Control of the louse (Haematopinus tuberculatus) in herds of water buffalo (Bubalus bubalis) raised for milk and meat. Rev. Bras. Reprod. Anim. 29: 118-121.

Chaudhuri, R.P. and P. Kumar. 1961. The life history and habits of the buffalo louse, Haematopinus tuberculatus (Burmeister) Lucas. Indian J. Vet. Sci., 31: 275-287.

Holdsworth, P.A., J. Vercruysse, S. Rehbein, R.J. Peter, T. Letonja and P. Green. 2006. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) guidelines for evaluating the efficacy of ectoparasiticides against biting lice, sucking lice and sheep keds on ruminants. Vet. Parasitol., 136(1): 45-54.

Khater, H.F., M.Y. Ramadan and R.S. El-Madawy. 2009. Lousicidal, ovicidal and repellent

efficacy of some essential oils against lice and flies infesting water buffaloes in Egypt. Vet. Parasitol., 164: 257-266.

Lau, H.D. and N.P. Singh. 1985. Efficacy of ivermectin in control of louse (Haematopinus tuberculatus) in buffaloes, p. 47. In Proceedings of the 11th International Conference of World Association for the Advancement of Veterinary Parasitology.

Meleney, W.P. and K.C. Kim. 1974. A comparative study of cattle-infesting Haematopinus, with redescription of H. quadripertusus Fahrenholz, 1919 (Anoplura: Haematopinidae). J. Parasitol., 60: 507-522.

Priestley, C.M., I.F. Burgess and E.M. Williamson. 2006. Lethality of essential oils constituents towards the human louse Pediculus humanus, and its eggs. Fitoterapia, 77: 303-309.

Veneziano, V., L. Rinaldi, S. Giannetto and G. Cringoli. 2003. The first record of Haematopinus tuberculatus on Bubalus bubalis (water buffalo) in Italy. Bubalus Bubalis, 9(3): 69-75.

Veneziano, V., L. Rinaldi, C. Grassi, G. Neglia, G. Campanile and G. Cringoli. 2004. Efficacy of eprinomectin pour-on against Haematopinus tuberculatus infestation in Italian Mediterranean buffalo (Bubalus bubalis) and influence of the treatment on milk production. Bubalus Bubalis, 2: 56-65.

World Health Organization. 1981. Instructions for determining the susceptibility or resistance of body lice and head lice to insecticides. World Health Organization, 81: 5-55.




335

ABSTRACT

Danofloxacin is a fluoroquinolone antibiotic which is extensively used against a variety of bacterial infection in animals worldwide except in Pakistan. The optimal dosage regimen of danofloxacin was necessary in order to use this drug therapeutically and to minimize the emergence of bacterial resistance in local buffaloe breeds in Pakistan. For this, the present study aimed to investigate the pharmacokinetics behavior and optimal dosage regimen of danofloxacin in 16 adult healthy buffaloes, 8 each of Nili-Ravi and Kundhi breed following single intravenous administration at the dose of 2.5 mg/kg body weight. Blood samples (5 ml) were drawn from jugular vein in heparinized plastic centrifuge tubes at zero and 0.083, 0.167, 0.25, 0.5, 0.75, 1, 1.5, 2, 4, 6, 8, 10, 12, 24 h after injection and drug concentrations in plasma were measured by HPLC method. The distribution of drug was rapid whereas elimination was low in both breeds. Volume of distribution at steady state (Vss) was significantly (P<0.05) higher in Kundhi buffaloes indicating the extensive

distribution of danofloxacin in Kundhi than Nili-Ravi buffaloes. However, the total body area covered by drug was remarkably lower in Kundhi than Nili-Ravi buffaloes as indicated by lower values of area under concentration time curve (AUC) in Kundhi than Nili-Ravi buffaloes. Total body clearance (ClB) was significantly (P<0.05) faster in Kundhi buffaloes than Nili-Ravi buffaloes. The mean residence time (MRT) was noted to be (Mean±SD) 4.78±0.52 and 4.44±0.37 h in Nili-Ravi and Kundhi buffaloes respectively. On the basis of pharmacokinetic parameters, suitable intravenous dosage regimens for danofloxacin in Nili-Ravi and Kundhi buffaloes would be 6.5 and 8.3 mg/kg to be repeated after 12 h intervals. The present study is the foremost pharmacokinetics study of danofloxacin in the local species which would provide the valuable contribution in the local manufacturing of danofloxacin in Pakistan in future.

Keywords: buffaloes, Bubalus bubalis, pharmacokinetics, danofloxacin, dosage regimen, plasma protein binding

SOME PHARMACOKINETIC DATA AND DOSAGE REGIMEN OF DANOFLOXACIN AFTER INTRAVENOUS ADMINISTRATION IN NILI-RAVI AND KUNDHI BUFFALOES

Zahid Manzoor1,*, Shaukat Hussain Munawar2, Zahid Iqbal2 and Muhammad Abdullah Abid3

1Department of Biosciences, Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan, Pakistan, *E-mail: [email protected] of Pharmacology, Al-Nafees Medical College, Isra University, Islamabad, Pakistan3Department of Physiology and Pharmacology, Faculty of Veterinary Science, University of Agriculture, Faisalabad, Pakistan

Original Article


336

INTRODUCTION

Danofloxacin (DNF) is a synthetic antibacterial agent of fluoroquinolone group, developed specifically for veterinary use. DNF possesses great potential against a variety of microorganisms by concentration-dependent killing mechanisms (Sarasola et al., 2002). In field experiments, DNF was found to be highly effective in the treatment of bovine respiratory diseases associated with Pasteurella and Mannheimias species (Giles, 1996). Pasteurella multocida is the primary cause of Haemorrhagic septicemia (HS), which is a common disease of buffaloes and cattle causing high mortality in many countries of Asia, Middle East and sub-Saharan Africa (Verma and Jaiswal, 1998). Moreover, DNF displayed great potential against respiratory as well as many other infections caused by Mycoplasma species in cattle, pigs and poultry (Cooper et al., 1993).

For the successful therapy, optimal dose of any drug should be strictly followed during the treatment. Wiuff et al. (2003) suggested the suboptimal dosage regimens of fluoroquinolones to be an important risk factor for the emergence of resistance in experimental studies. One clinical approach to prevent the resistance is to adjust the antibiotic dosage regimens upwards to the mutant prevention concentrations. Thus, the pharmacokinetic study of a drug is required in the species in which the drug is going to be used clinically for the selection of optimal dosing schedule.

Many drugs at the same dose rate showed variable pharmacological effects due to the diverse pharmacokinetics behavior among several species. Sidhu (2001) have determined such differences in fluoroquinolones. In addition, many studies revealed that the pharmacokinetics behavior,

optimal dosage, renal clearance and urinary excretion of the investigated drugs were different under indigenous conditions when compared with the values given in the literature or in the product inserts supplied by the manufacturers (Muhammad, 1997). The change in the genetic makeup has an influence on the biodisposition and fate of drugs in a population (Muhammad et al., 2003). Such geonetical influences have been reported for blood and urine pH, blood proteins, drug metabolism and kidney function in buffaloes, cows, sheep and goats (Nawaz et al., 1988). In veterinary field, DNF is being used successfully in many parts of the world except in Pakistan. The pharmacokinetics of danofloxacin has been studied in cattle, sheep and goats (McKellar et al., 1998; Aliabadi and Lees, 2001; Sarasola et al., 2002). Recently, Sappal et al. (2009) examined the kinetic behavior of DNF in buffalo calves, but no study exists describing the pharmacokinetics of DNF in adult buffaloes. Therefore, the present project has been planned to determine the pharmacokinetics and optimal dosage regimen of DNF following intravenous administration in adult local buffaloes of two breeds (Nili-Ravi and Kundhi) and to explore the interspecies variation between them. In Pakistan, this is the first study regarding the pharmacokinetics behavior of DNF in local buffaloes. The study will facilitate the pharmaceutical companies/manufacturers in the local manufacturing of DNF in Pakistan.


Experimental animalsThe study was performed in sixteen healthy

adult female buffaloes, eight each of Nili-Ravi and Kundhi breed, weighting between 350 to 430 kg


337

and 310 to 370 kg respectively. The animals were 2 to 3 years of age of both breeds. The animals were kept at Livestock Experimental Farm, Institute of Nutrition and Feed Technology, University of Agriculture, Faisalabad and examined for any apparent clinical condition for 2 weeks prior start of the experiment. All the buffaloes were housed in a separate pen provided by wire mesh barriers to maintain social contact. The animals were fed on seasonal green fodder and water was provided ad libitum. The research protocol was critically reviewed and approved by the Institutional Animal Ethics Committee (IAEC). The animals were cared for according to the national animal welfare guidelines and technical supervision was provided at all the times.

MethodologyThe animals were weighted individually

and restrained in standing position before the start of each experiment. One of the jugular veins of each animal was cannulated under strict aseptic conditions with plastic cannula No. 90 (Protex Ltd., England) for the collection of blood samples. A commercial preparation of danofloxacin mesylate (CAS 119478-55-6) in powdered form was procured from Hanqzou Thick Chemical Co. Ltd. China. An injectable preparation of danofloxacin (10%) was prepared and injected intravenously in the jugular vein at dose rate of 2.5 mg/kg body weight to each animal.

The blood samples (5 ml) were drawn from jugular vein in heparinized plastic centrifuge tubes at zero and 0.083, 0.167, 0.25, 0.5, 0.75, 1, 1.5, 2, 4, 6, 8, 10, 12, 24 h post administration of drug. The plasma was separated and stored at -20ºC until analysis.

Analytical procedureDanofloxacin concentrations in plasma

were determined by High Performance Liquid Chromatographic (HPLC) method as described by Soback et al. (1994) with certain modifications.

ChemicalsAll the chemicals used were analytical

grade. Danofloxacin standard (Danofloxacin mesylate, 99%) was used as external standard, while the paracetamol (Paracetamol 99.7%) was used as internal standard (IS); these standards were requested from the Ferozssons Pvt. Ltd., Pakistan. Methanol and acetonitrile (Fisher Scientific Limited, UK) and phosphoric acid (Merk, Germany) were used.

Instrumentation and chromatographic conditions

The HPLC system contained quarternary solvent delivery module, a UV- and visual-light variable-wavelength detector (Sykam, S-3210) and an integrator (HP 1050; Hewlett-Packard, Waldbron, Germany). A reversed-phase base deactivated column packed with YMC pack A-312 (Thermo Hypersil-Keystone, BDS-C18 with 250 × 4.6 mm dimensions and 5 µm particle size) was used. The column was protected with a pre-column (Guard-PakTM) filled with a µBondapakTM C18 cartidge (Thermo Hypersil, England). The mobile phase consisted of a mixture of 800 ml of 14 ml/L phosphoric acid (Merk, Germany) and 200 ml of acetonitrile (Fisher Scientific Limited, UK) per liter at pH 6.0. The flow rate was set at 1 ml/min. The detector wavelength was adjusted to 275 nm. The lower limit of detection (LOD) was 0.005 µg/ml while the limit of quantitation (LOQ) was 0.25 µg/ml. The output of the detector was monitored with computer software (Peak Simple Chromatography


338

Data System, Buck Scientific Inc., East Norwalk). Separation of danofloxacin was achieved at 37oC, using an isocratic mode.

Stock solutions and standardsDanofloxacin and paracetamol (IS) were

made up as 1 g/L stock solutions in methanol and distilled water (1: 10, by volume). Danofloxacin was diluted with distilled water to make additional working stocks of 10 mg/L for the plasma assay. Paracetamol was diluted with mobile phase to make a single working IS stock solution of 1 mg/ml. Plasma calibrators (0.5 to 32 µg/ml) for the calibration curve were prepared in drug-free control plasma. The working solutions were used to supplement the drug free matrics.

Sample preparationIn a centrifuge tube, 2 ml of acetonitrile

was added to 1 ml of plasma or plasma calibrator. The mixture was vortexed for one minute and centrifuged for 30 minutes at 4000 rpm. The supernatant was transferred into a glass tube and evaporated to dryness in a water bath. The residue was then reconstituted in 10 µl of IS and 1 ml of 14 ml/L phosphoric acid. The final solution was again vortexed for 30 seconds; filtered through cellulose acetate membrane filter (Sartorius AG, Germany, 13 mm diameter) and 0.2 µl was injected into the HPLC system.

Standard curveWorking standards having danofloxacin

concentrations 0.5, 1, 2, 4, 8, 16 and 32 µg/ml were prepared in the drug free plasma of adult buffaloes. These working standards were analyzed using HPLC and concentrations versus peak area data were plotted on a graph to construct the calibration curves. The curves were linear over the range of

2-32 µg/ml for plasma (R2 = 0.9968; y = 48.709x +0.2083) as shown in Figure 1. The concentrations of danofloxacin in samples were determined by the regression equation:

Y = bx+a

Where, Y = Peak area for unknown concentration of danofloxacin determined through HPLC, a = Intercept, b = Slope of regression line, x = Concentration of danofloxacin.

In vitro plasma protein bindingIn vitro plasma protein binding was

determined by ultrafiltration technique according to the method described by Bratton and Marshall (1939) which is based on the physical separation of free drug molecules in plasma water from drug bound to plasma proteins by filtering plasma samples through a semi permeable membrane under a positive pressure generated by centrifugation. Stock solutions of danofloxacin were used to prepare the drug concentration in plasma ranging from 50, 100, 150, 200 and 250 µg/ml. Ultrafiltrates of the plasma samples were prepared by ultrafiltration through a cellophane membrane with pore-size of 20-80ºA which permit molecules with a molecular weight up to 5000 to pass through the membrane. After ultrafiltration, drug concentration in the ultrafiltrate was the concentration of the free drug in plasma and the fraction of unbound drug was measured using the equation below:

Unbound drug = (Drug (Ultrafiltrate))

(Total drug in plasma)

Pharmacokinetics and dosage regimenPharmacokinetic parameters were

calculated by non-compartment and compartment


339

analyses with non linear least square regression method using a computerized program WinNonlin (Pharsight Corporation, Mountain View, version 6.3, CA, USA). For comparing the pharmacokinetic parameters obtained by two methods, Mininmum Akaike Information Criteria Estimates (MAICE) in different models were applied to determine the best fit of model for each animal (Yamaoka et al., 1978).

The maintenance dose (D) was based on the minimum effective concentration (CºP (min))/peak desired concentration of the drug in plasma which is sufficient to eradicate the bacterial population in the body. The equation was given by:

D = CºP (min). Vd (eβt-1)

Where, CºP represents the minimum effective concentration/peak desired plasma

drug concentration, Vd denotes the volume of distribution, e =exponantional term, β = over all elimination rate constant, t = time at which dose was calculated.

The priming dose was obtained by omitting “-1” from the above equation.

STATISTICAl ANAlYSIS

Mean with standard deviation values for each parameter was calculated by Microsoft Excel version 2007. Two tailed Student’s T test was used to compare the pharmacokinetic parameters in Nilli-Ravi and Kundhi buffaloes. P<0.05 was considered as significant.

Figure 1. Standard curve of danofloxacin in plasma of buffaloes.


340


The chromatogram of danofloxacin standard in the plasma of buffaloes is presented in Figure 2. The Mean±SD plasma levels of danofloxacin versus different time intervals as a function of time following intravenous administration in Nili-Ravi and Kundhi buffaloes

are described as a semi-logarithmic plot (Figure 3). The pharmacokinetic parameters obtained are depicted in Table 1.

Data were best fitted by a two-compartment model with no lag time in all the buffaloes.

C(t) = Ae-αt + Be-βt

Figure 2. Chromatogram of 32 µg/ml danofloxacin standard in the plasma of buffalo.

Figure 3. Semilogarithmic plot of danofloxacin concentrations (mean±SD) in plasma following (i.v.) administration at dose rate of 2.5 mg/kg in Nili-Ravi and Kundhi buffaloes.


341

Where C(t) is the plasma concentration of danofloxacin; t is the time after drug administration; A and α are the intercepts and slope of the distribution phase; B and β are the intercepts and slope of the elimination phase; and e is the base of natural logarithm.

The Mean±SD plasma concentration of danofloxacin was significantly (P<0.05) lower (3.00±0.17 µg/ml) in Kundhi buffaloes than Nili-Ravi buffaloes (3.30±0.19 µg/ml) obtained at 5 minutes after injection. The plasma concentration

declined in two phases, i.e. a rapid decline to 1.16±0.22 µg/ml and 0.90±0.20 µg/ml at 2 h, followed by a slow decline to 0.056±0.028 µg/ml and 0.03±0.015 µg/ml at 24 h in Nili-Ravi and Kundhi buffaloes respectively. The maximum concentration (Cpº) achieved after danofloxacin administration at zero time was considerably (P<0.05) lower (3.32±0.25 µg/ml) in Kundhi buffaloes as compared to Nili-Ravi buffaloes (3.66±0.74 µg/ml). In the current study, danofloxacin was detected up to 24 h in plasma

Table 1. Pharmacokinetic parameters of danofloxacin after IV administration in 16 buffaloes (Mean ± SD) using two compartment model.

Parameter/variable Nili-Ravi buffaloes Kundhi buffaloesA (µg mL-1) 1.72±0.11 1.86±0.32B (µg mL-1) 1.94±0.21 1.46±0.46*Cpº (µg mL-1) 3.66±0.14 3.32±0.25*t1/2α (hr) 0.25±0.09 0.31±0.10t1/2β (hr) 3.26±0.43 3.49±0.87k12 (L.hr-1) 1.11±0.28 1.02±0.31k21 (L.hr-1) 1.63±0.31 1.64±0.32AUC (µg. h. mL.-1) 9.80±2.14 7.74±0.98*ClB (Lkg-1 h-1) 0.49±0.21 0.32±0.04*Kel (L.hr-1) 0.38±0.06 0.43±0.05α (hr) 2.92±0.59 2.48±0.78β (hr) 0.21±0.02 0.20±0.04Vdarea (L.kg-1) 2.28±0.86 1.67±0.54Vss (L.kg-1) 1.14±0.12 1.47±0.37*Vc (L.kg-1) 0.68±0.02 0.75±0.05*

A,B = Y-axis intercept terms for distribution and elimination phases, Cpº = Plasma drug concentration at the time of drug administration, t1/2α=Distribution half life, t1/2β = Elimination half-life, AUC = Area under concentration, ClB = Total body clearance, Kel = Elimination rate constant, α and β = Distribution and Elimination rate constants, Vdarea = Volume of distribution at terminal phase of elimination, Vss = Volume of distribution at steady state, Vc = Volume of central compartment. *Significant at (P< 0.05).


342

after higher doses (2.5 mg/kg) in both breeds of buffaloes. Apley and Upson (1993) also reported the similar findings in cow calves. Similarly, some other investigators (Shem-Tov et al., 1998; McKellar et al., 1999; Shojaee Aliabadi and Lees, 2003) documented the DNF detection up to 24 h in various biological fluids. Hence, the results of present study are consistent with the results described by Apley and Upson (1993); Shem-Tov et al. (1998); McKellar et al. (1999); Shojaee Aliabadi and Lees (2003). On the other hand, DNF was quantified up to 4 h in goats and 12 h in cattle (Giles et al., 1991; Atef et al., 2001).

The distribution half-life (t1/2α) was 0.25±0.09 and 0.31±0.10 h, whereas, elimination half-life (t1/2β) for DNF was 3.26±0.43 and 3.49±0.87 h in Nili-Ravi and Kundhi buffaloes respectively with no significant difference between them (Table 1). Sappal et al. (2009) determined this value to be 0.16±0.07 hours in buffalo calves. Similarly, rapid distribution of danofloxacin was also observed in cows, ewes and goats (Atef et al., 2001; Shem-Tov et al., 1997, 1998).

The higher volume of distribution at steady state (Vss) suggests the good tissue penetration of DNF in adult local buffaloes. However, the value of Vss was remarkably lower in Nili-Ravi buffaloes (1.14±0.12 L/kg) than Kundhi buffaloes (1.47±0.37 L/kg) indicating the best tissue penetration of DNF in Kundhi buffaloes than Nili-Ravi buffaloes, but at terminal phase (Vdarea), these values were insignificant between them. However, the values of Vdarea in both breeds were lower than value of (Vdarea = 4.35±2.02 L/kg) articulated by Sappal et al. (2009) in buffalo calves. The volume of the central compartment (Vc) was also lower in Nili-Ravi buffaloes (0.68±0.02 L/kg) than Kundhi buffaloes (0.75±0.05 L/kg).

Area under the plasma concentration time

curve (AUC) was lower (7.74±0.98 µg.h.mL-1) in Kundhi buffaloes as compared to Nili-Ravi buffaloes (9.80±2.14 µg.h.mL-1) suggesting the large body area covered by DNF in Nili-Ravi than Kundhi buffaloes. Sappal et al. (2009), on the other hand, determined the lower value of AUC (1.79±0.028 µg.hr/ml) than the current values (9.80±2.14 and 7.74±0.98 µg.hr/ml) at lower doses (1.25 mg/kg) in buffalo calves. Kundhi buffaloes exhibited faster clearance (0.30±0.05 L.kg-1h-1) than Nili-Ravi buffaloes (0.23±0.05 L.kg-1h-1) in non compartment analysis (Table 2). The elimination half life (t1/2β) was comparable (P>0.05) in both breeds of adult buffaloes in the current study, but shorter than (t1/2β = 4.24±1.78 h) in buffalo calves at lower doses (Sappal et al., 2009). Aliabadi et al. (2003) determined this value to be 3.39 h following intravenous administration of DNF at dose rate of 1.25 mg/kg in sheep. The values of total body clearance (ClB = 0.23±0.05 and 0.30±0.05 L.kg-

1h-1), suggested the low elimination of DNF in both breeds. To classify the drug clearance, Toutain and Bousquet-Melou (2004) determined the breakpoint clearance values as high (28 ml/kg/min), medium (12 ml/kg/min) or low (5.8 ml/kg/min), based on extraction ratios of 0.35, 0.15 and 0.05 respectively. DNF clearance (3.83 ml/kg/min) in Nili-Ravi and (5 ml/kg/min) in Kundhi buffaloes may be classified as low clearance in the current study. The mean residence time (4.78±0.52 and 4.44±0.37 h) values obtained by non-compartmental analysis were also in close agreement of low clearance as indicated by ClB values in Nili-Ravi and Kundhi buffaloes.

At plasma concentrations of 50 to 250 µg/ml, the extent of plasma protein binding of DNF ranged from 23.6% to 30.4% with an overall mean of 27±2.83% in current study (Table 3). In general, the plasma protein binding of fluoroquinolones is


343

Table 2. Pharmacokinetic parameters of danofloxacin after IV administration in 16 buffaloes (Mean ± SD) using non-compartment model.

Parameter Nili-Ravi buffaloes Kundhi buffaloesAUC0-last (µg. h. mL-1) 10.3±2.0 8.07±1.21*AUC0-∞ (µg. h. mL-1) 10.96±2.3 8.31±1.39*AUMC0-∞ (µg. h2. mL-1) 74.0±30.6 44.9±15.2*MRT0-last (hr) 4.78±0.52 4.44±0.37λz (L.hr-1) 0.11±0.05 0.14±0.043Cmax (µg.mL-1) 3.30±0.19 3.00±0.17*Vss (L.kg-1) 1.50±0.34 1.59±0.22ClB (L.kg-1 h-1) 0.23±0.05 0.30±0.05*

AUC0-∞ = Area under plasma concentration-time curve, AUMC0-∞ = Area under the first moment curve, MRT0-last = Mean residence time to last sampling time, λz = Exponential constant for the terminal phase, Cmax = Maximum plasma concentration, Vss = Volume of distribution at steady state, ClB = Total body clearance. *Significant at (P<0.05).

Table 3. Mean±SD in vitro danofloxacin binding to plasma proteins of adult buffaloes (Each data point is average of 3 determinants).

Total drug(µg/ml)

Drug concentration (µg/ml) Percent drugFree Bound Free Bound

50 34.8±1.65 15.2±1.07 69.6±1.58 30.4±1.47100 71.4±0.98 28.6±1.85 71.4±2.41 28.6±2.04150 108.2±1.84 41.8±1.07 72.1±0.97 27.8±1.06200 150.8±0.67 49.2±0.86 75.4±1.19 24.6±0.97250 190.9±1.04 59.1±2.14 76.3±2.87 23.6±1.43

Overall mean ± SD = 27.0±2.83

low and it directly affects the kinetic behavior and therapeutic efficacy of the drug. Sappal et al. (2009) determined relatively higher (36%) plasma protein binding for DNF in buffalo calves as compared to the current value (27%) in adult buffaloes. The low plasma protein binding along with other physicochemical properties of DNF may allow

its widespread penetration into intracellular and extra vascular sites, which was further supported by high values of Vss (1.14±0.12 and 1.47±0.37 L/kg) obtained in both breeds. The plasma protein binding of fluoroquinolones differ largely amongst species. Kaartinen et al. (1995) reported 36 to 45% protein binding for enrofloxacin in lactating


344

cows, whereas, 70% binding of ciprofloxacin was observed in calves (Nouws et al., 1988).

The optimal dosage regimens of DNF based upon the pharmacokinetic parameters were calculated in both breeds of buffaloes (Table 4). The calculations of priming and maintenance doses of DNF following intravenous administration were based upon the minimum effective concentration CºP (min) or minimum inhibitory concentration (MIC) of DNF in blood. The minimum effective concentrations of DNF CºP (min) 0.02, 0.03, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.75 and 1 µg/ml have been used in the calculations for each time interval. The priming and maintenance doses of DNF in Nili-Ravi buffaloes at MIC=0.5 µg/ml were 7.08 and 6.51 mg/kg, and in Kundhi buffaloes 9.14 and 8.31 respectively; to be repeated after 12 h interval.

In vitro, DNF has great potential against a variety of microorganisms. Rowan et al. (2004) reported the MIC90 of 0.25 and 0.06 μg/ml for DNF against Mannheimia haemolytica and Pasteurella multocida, respectively. Various pharmacokinetic/pharmacodynamic (PK/PD) indices have been proposed to predict the effectiveness of an antibiotic (Aliabadi and Lees, 2000). Three PK/PD indices are commonly used. These include T > MIC when the antibiotic is time

dependent, AUIC (AUC/MIC) and Cmax/MIC when antibiotic is concentration dependent Pickerill et al. (2000) proposed that AUIC (AUC:MIC) is a better interpreter of antibacterial activity of fluoroquinolones as compared to the time during which plasma concentration exceeds the MIC level. The Cmax/MIC ratio has no meaning in terms of PK/PD index in this study being the intravenous administration. Brown (1996) suggested the AUIC value of 125 h for DNF against Mannheimia haemolytica (MIC90=0.25 μg/ml) for obtaining optimal efficacy. In order to calculate the AUIC in this study, the MIC50 value of 0.06 μg/ml value has been used for DNF against Pasteurella multocida. The determined value of AUIC was 163 and 129 h for a dosage of 2.5 mg/kg in Nili-Ravi and Khundhi buffaloes respectively. Thus, the current dose of 2.5 mg/kg/24 h of DNF is adequate against the Pasteurella multocida with (MIC50=0.06 μg/ml) in both breeds. But the optimal dose is the amount of drug that rapidly kills as well as inhibits the re-growth of bacteria without the support of host defense mechanisms (Toutain et al., 2002). By incorporating the (MIC90=0.25 μg/ml) of DNF against Pasteurella multocida, the determined values of AUIC were 39.2 h in Nili-Ravi and 30.9 h in Kundhi buffaloes. The values of the surrogate

Table 4. Intravenous dosage regimen of danofloxacin (mg/kg) to be repeated after 12 h for different dosing intervals and minimum effective concentrations in adult buffaloes.

Breed

Minimum Effective

Concentration (µg/ml)

0.02 0.03 0.05 0.1 0.2 0.3 0.4 0.5 0.75 1

Nili-Ravi

Priming dose 0.28 0.43 0.71 1.41 2.83 4.25 5.66 7.08 10.6 14.16Maintenance dose 0.26 0.39 0.65 1.30 2.60 3.90 5.21 6.51 9.7 13.02

KundhiPriming dose 0.36 0.54 0.91 1.82 3.66 5.49 7.31 9.14 13.7 18.3

Maintenance dose 0.33 0.49 0.83 1.66 3.32 4.99 6.65 8.31 12.4 16.6


345

marker obtained by PK-PD integration in the present study fall below of suggestive values (AUIC=125 h). Hence, it is supposed that the current dose of 2.5 mg/kg will promote the resistant mutants in the adult local buffaloes.

The optimal dosage regimen of DNF by means of pharmacokinetic parameters obtained in this study for the treatment of diseases caused by susceptible bacteria with MIC90 of≤0.50 μg/ml computed after intravenous administration at 12 h time interval are 6.5 mg/kg and 8.31 mg/kg body weight in Nili-Ravi and Kundhi buffaloes respectively. It is speculated that these dosage regimens might achieve the desired value of AUIC=125 h; predictor of antibacterial activity. Further, the plasma concentrations will remain in mutant prevention window as a minimum for 75% of dosage time interval which is essential for fluoroquinolones to ensure the bacteriological eradication and emergence of resistance explained by Drlica (2003). In another study, the optimal dose of DNF was supposed to be 6 mg/kg on the basis of clinical reports. Brown (1996) demonstrated that the administration of DNF at dose rate of 6 mg/kg in European cattle achieved an AUIC of 126 h and successful therapeutic efficacy of this dose was seen against natural outbreaks of calf respiratory disease.

This is the first study regarding the pharmacokinetics behavior of DNF in local adult buffaloes in Pakistan. The study will aid in the local manufacturing of DNF in the light of its pharmacokinetic profile in these species. However, further detailed pharmacodynamic studies of DNF in adult local buffaloes are required to identify an actual as opposed to an assumed MIC90 for confirming the dose by generating sufficient data from field isolates in future studies before issuing final recommendations.

CONClUSION

The pharmacokinetics behavior of danofloxacin displayed some inter and intra species variations due to the difference in the environment and genetic makeup among species. The current dose of 2.5 mg/kg body weight may promote the bacterial resistance in Nilli-Ravi and Kundhi buffaloes. Hence, the suggested doses of 6.5 and 8.31 mg/kg/12 h calculated on the basis of PK/PD integration in the current study may be optimum doses for successful therapeutic outcome and prevention of mutant selection pressure. The computed dosage regimens will help in the local manufacturing of the drug and can be used to establish disposition kinetics of danofloxacin following extra vascular administration in buffalo species. However, there is further need to conduct detailed pharmacodynamic studies of danofloxacin against respiratory disease causing organisms in buffalo species in order to establish PK-PD inter-relationships.

ACKNOWlEDGMENTS

The study was funded by Higher Education Commission, Pakistan. The authors thank to the Chairman, HEC, Pakistan for providing the enough funds for the study and special thanks to Dr. Nathan Teuscher, Founder and President, PK/PD Associates, Pvt. Ltd., USA for his technical assistance throughout the experiment.

REFERENCES

Aliabadi, F.S. and P. Lees 2000. Antibiotic treatment for animals: effect on bacterial population


346

and dosage regimen optimisation. Int. J. Antimicrob. Ag., 14: 307-313.

Aliabadi, F.S. and P. Lees. 2001. Pharmacokinetics and pharmacodynamics of danofloxacin in serum and tissue fluids of goats following intravenous and intramuscular administration. Am. J. Vet. Res., 62: 1979-1989.

Aliabadi, F.S., M.F. Landoni and P. Lees. 2003. Pharmacokinetics (PK), pharmacodynamics (PD), and PK-PD integration of danofloxacin in sheep biological fluids. Antimicrob. Agents Chemother., 47: 626-635.

Apley, M.D. and D.W. Upson. 1993. Lung tissue concentrations and plasma pharmacokinetics of danofloxacin in calves with acute pneumonia. Am. J. Vet. Res., 54: 937-943.

Atef, M., A.Y. El-Gendi, M.M.A. Amer and A.M. El-Aty. 2001. Some pharmacokinetic data for danofloxacin in healthy goats. Vet. Res. Commun., 25: 367-377.

Bratton, A.C. and E.K. Marshall. 1939. A new coupling component for sulfanilamide determination. J. Biol. Chem., 128: 537-550.

Brown, S.A. 1996. Fluoroquinolones in animal health. J. Vet. Pharmacol. Ther., 19: 1-4.

Cooper, A.C., J.R. Fuller, M.K. Fuller, P. Whittlestone and D.R. Wise. 1993. In vitro activity of danofloxacin, tylosin and oxytetracycline against mycoplasmas of veterinary importance. Res. Vet. Sci., 54: 329-334.

Drlica, K. 2003. The mutant selection window and antimicrobial resistance. J. Antimicrob. Chemoth., 52: 11-17.

Giles, C.J., R.A. Magonigle, W.T.R. Grimshaw, A.C. Tanner, J.E. Risk, M.J. Lynch and J.R.

Rice. 1991. Clinical pharmacokinetics of parenterally administered danofloxacin in cattle. J. Vet. Pharmacol. Ther., 14: 400-410.

Giles, C.J. 1996. Discovery and development of danofloxacin for treatment of respiratory disease in cattle. In Proceedings of the Pfizer Scientific Symposium, Edinburgh, Scotland, UK.

Kaartinen, L., M. Salonen, Alli and S. Pyorala. 1995. Pharmacokenetics of enrofloxacin after single intravenous, intramuscular and subcutaneous injections in lactating cows. J. Vet. Pharmacol. Ther., 18: 357-362.

Mckellar, Q.A., I.F. Gibson and R.Z. McCormack. 1998. Pharmacokinetics and tissue disposition of danofloxacin in sheep. Biopharm. Drug Dispos., 19: 123-129.

Mckellar, Q.A., I. Gibson, A. Monteiro and M. Bregante. 1999. Pharmacokinetics of enrofloxacin and danofloxacin in plasma, inflammatory exudate, and bronchial secretions of calves following subcutaneous administration. Antimicrob. Agents Chemother., 43: 1988-1992.

Muhammad, F. 1997. Disposition kinetics, renal clearance and urinary excretion of kanamycin in mule. MSc. Thesis, Department of Physiology and Pharmacology, University of Agriculture, Faisalabad, Pakistan.

Muhammad, F., F. Hussain, M. Nawaz and I. Javed. 2003. Disposition kinetics of kanamycin in mules. Veterinarski Archiv., 73(4): 221-226.

Nawaz, M., T. Iqbal and R. Nawaz. 1988. Geonetical considerations in disposition kinetics evaluation of chemotherapeutic agents. Veterinary pharmacology toxicology and therapy in food producing animals, Vol.


347

2, 260p. In Proceeding 4th Congress of the European Association for Veterinary Pharmacology and Toxicology, Budapest, Hungary.

Nouws, J.F.M., D.J. Mevius, T.B. Vree, A.M. Baars and J. Leurensen. 1988. Pharmacokinetics, renal clearance and metabolism of ciprofloxacin following intravenous and oral administration to calves and pigs. Vet. Quart., 10: 156-163.

Pickerill, K.E., J.A. Paladino and J.J. Schentag. 2000. Comparison of the fluoroquinolones based on pharmacokinetic and pharmacodynamic parameters. Pharmacother, 204: 417-428.

Rowan, T.G., P. Sarasola, S.J. Sunderland, C.J. Giles and D.G. Smith. 2004. Efficacy of danofloxacin in the treatment of respiratory disease in European cattle. Vet. Rec., 154(19): 585-589.

Sappal, R., R.K. Chaudhary, H.S. Sandhu and P.K. Sidhu. 2009. Pharmacokinetics, urinary excretion and plasma protein binding of danofloxacin following intravenous administration in buffalo calves (Bubalus bubalis). Vet. Res. Commun., 33: 659-667.

Sarasola, P., P. Lees, F.S. AliAbadi, Q.A. McKellar, W. Donachie, K.A. Marr, S.J. Sunderland and T.G. Rowan. 2002. Pharmacokinetic and pharmacodynamic profiles of danofloxacin administered by two dosing regimens in calves infected with Mannheimia (Pasteurella) haemolytica. Antimicrob. Agents Chemother., 46(9): 3013-3019.

Aliabadi, F.S. and P. Lees. 2003. Pharmacokinetic-pharmacodynamic integration of danofloxacin in the calf. Res. Vet. Sci., 74(3): 247-259.

Shem-Tov, M., G. Ziv, A. Glickman and A. Saran. 1997. Pharmacokinetics and penetration of

danofloxacin from the blood into the milk of ewes. Vet. Res., 28: 571-579.

ShemTov, M., O. Rav-Hon, G. Ziv, E. Lavi, A. Glickman and A. Saran. 1998. Pharmacokinetics and penetration of danofloxacin from the blood into the milk of cows. J. Vet. Pharmacol. Ther., 21: 209-213.

Soback, S., M. Gips, M. Bialer and A. Bor. 1994. Effect of lactation on single-dose pharmacokinetics of norfloxacin nicotinate in ewes. Antimicrob. Agents Chemother., 38: 2336-2339.

Sidhu, P.K. 2001. Pharmacokinetics and pharmacodynamics of marbofloxacin and tolfenamic acid in ruminant species. Ph. D. Thesis, University of London, United Kingdom.

Toutain, P.L., J.R. Del Castillo and A. Bousquet-Melou. 2002. The pharmacokinetic- pharmacodynamic approach to a rational dosage regimen for antibiotics. Res. Vet. Sci., 73(2): 105-114.

Toutain, P.L. and A. Bousquet-Melou. 2004. Plasma clearance. J. Vet. Pharmacol. Ther., 27: 415-425.

Verma, R. and T.N. Jaiswal. 1998. Haemorrhagic septicaemia vaccines. Vaccine, 16(11-12): 1184-1192.

Wiuff, C., J. Lykkesfeldt, O. Svendsen and F.M. Aarestrup. 2003. The effects of oral and intramuscular administration and dose escalation of enrofloxacin on the selection of quinolone resistance among Salmonella and coliforms in pigs. Res. Vet. Sci., 75(3): 185-193.

Yamaoka, K., T. Nakagawa and T. Uno. 1978. Statistical moment in pharmacokinetics. J. Pharmacokin. Biopharm., 6: 547-558.



349

ABSTRACT

The present study aimed to assess the metabolic status and milk composition of buffaloes with subclinical mastitis. Forty buffaloes in early lactation from local buffalo dairy farms of Mathura district Uttar Pradesh (India) and instructional livestock farm complex of DUVASU, Mathura, found positive for subclinical mastitis at the quarter level by California mastitis test (CMT) (++ score) and high somatic cell counts (SCC) (>5 lakh cells per ml) were included in the present study. Another 20 clinically healthy buffaloes in early lactation and free of mastitis were used as healthy control group. Blood samples (5 mL) were collected from the both healthy and subclinical mastitic buffaloes and were used for estimation of serum metabolites including glucose, total cholesterol, triglycerides, total protein, albumin, urea, calcium (Ca), magnesium (Mg) and phosphorus (P). Further, milk samples were obtained from each affected quarter of buffaloes having subclinical mastitis as well as from healthy group and used for assessment of milk composition. To evaluate the milk quality, milk lactose, protein, fat, solid-not-fat (SNF), salt, specific gravity and depression in freezing point were estimated. Statistical differences between groups were evaluated by using using ANOVA

with general linear models. Significantly lower serum glucose (P≤0.01), Ca (P≤0.05) and P (P≤0.05) levels were revealed by buffaloes with subclinical mastitis as compared to healthy control group. Whereas, serum urea level of buffaloes with subclinical mastitis was significantly higher (P≤0.01) than healthy control group. However, significant alteration in serum total cholesterol, triglycerides, total protein and magnesium contents was not revealed by buffaloes with subclinical mastitis in comparison with the healthy controls.

Milk samples obtained from buffaloes with subclinical mastitis revealed significantly higher (P≤0.01) total protein and salts contents as well as depression in freezing point as compared to that of the healthy control group. However, significantly lower lactose (P≤0.01), fat (P≤0.01), SNF (P≤0.01) contents and specific gravity (P≤0.05) was estimated in mastitic milk as compared to non-mastitic milk (healthy control group). Therefore, it can be concluded that remarkably altered metabolic status of buffaloes could be associated with subclinical mastitis. In tandem, subclinical mastitis could result in marked alteration in the milk composition conferring the poor milk quality of buffaloes.

Keywords: buffaloes, Bubalus Bubalis, metabolic

ASSESSMENT OF ALTERATION IN METABOLIC PROFILE AND MILK COMPOSITION OF BUFFALOES WITH SUBCLINICAL MASTITIS

Krishna Veer Singh1, Deepak Sharma1, Shanker K. Singh1,* Mukesh Srivastava1, Satish K. Garg2 and Brajesh K. Yadav1

1Department of Veterinary Medicine, *E-mail: [email protected] of Pharmacology and Toxicology, College of Veterinary Science and Animal Husbandry, U.P. Pt. Deen Dayal Upadhyaya Pashu Chikitsa Vigyan Vishwavidyalaya Evam Go Anusandhan Sansthan (DUVASU), Mathura, Uttar Pradesh, India

Original Article



350

status, milk composition, subclinical mastitis

INTRODUCTION

The dairy sector in the India has shown remarkable development in the past decade and the country become the largest producer of milk and value-added milk products among the milk producing countries. This was mainly achieved by momentous improvement in the productivity of bovine population, particularly of buffaloes, during the past three decades. Population of buffaloes has increased at a faster rate than cattle in India, confirming their pivotal role in the agricultural economy of the sub-continent. Albeit, India has attained the first position in the milk production but still per animal milk productivity is substantially not enough. One of the most important causes of low milk production could be mastitis. Mastitis can be defined as an inflammatory disease of the mammary gland parenchyma; characterized by a range of physical and chemical changes of milk and pathological changes in the udder tissues (Contreras and Rodriguez, 2011). The disease remains the most frequent cause of antibacterial use on dairy farms, and contributes to a substantial portion of total drug and veterinary costs incurred by the dairy industry (Ozawa et al., 2011; Wellnitz and Bruckmaier, 2012). It adversely affects animal health, quality of milk and economics of milk production globally and entails huge financial losses (Tesfaye et al., 2010; Plozza et al., 2011). It may be in the form of clinical or subclinical. Subclinical cases show no visible changes in the appearance of the milk or the udder, but milk production decreases, composition is altered and bacteria are present in the secretion (Mansor et al., 2013). Presently, subclinical mastitis is considered

to be the main form of mastitis in modern dairy herds (Tesfaye et al., 2010; Mweu et al., 2012).

The occurrence of disease is an outcome of interplay between the infectious agents and management practices stressing the defense of udder (De Vliegher et al., 2012; Dimri et al., 2013). Inflammation in mastitis may damage the mammary secretary epithelium and decreases the food value of milk by interfering with the synthesis of lactose, fat and protein (Ullah et al., 2005). Milch buffaloes were earlier thought to be less susceptible to mastitis compared to cows, but similar frequencies for both the species were reported in the recent past from different quarters (Moroni et al., 2006). Identification of factors predisposing animals for subclinical mastitis is imperative for the development of control and prevention strategies. Metabolic demands associated with late pregnancy, parturition, and initiation of lactation would be expected to increase the production of reactive oxygen species (Sordillo, 2009). Additionally, increased susceptibility of the mammary gland to intramammary infections during transition period has been linked to a compromised state of the innate defense system (Sordillo, 2009) as well as negative energy balance (Esposito et al., 2014). Altered metabolic status of the lactating buffaloes can bestow favorable condition for the intramammary infections. Thus, in the present study we indented to evaluate the metabolic status and milk composition of buffaloes with subclinical mastitis.


Lactating Indian water buffaloes from local buffalo dairy farms of Mathura district Uttar Pradesh (India) and instructional livestock farm complex of DUVASU, Mathura were screened for


351

subclinical mastitis at the quarter level by using California Mastitis Test (CMT) and Somatic Cell Counts (SCC). Forty buffaloes in early lactation (within one month of parturition) and found positive for subclinical mastitis by CMT (++ score) and high SCC (>5 lakh cells per ml) were used for the study. Simultaneously, 20 buffaloes in early lactation and free of mastitis were used as healthy control group for comparing the estimated panels of subclinical mastitic buffaloes.

Assessment of metabolic status5 mL blood sample each was collected

from the both healthy and subclinical mastitic buffaloes by jugular venipuncture into a tube containing clot activators and was used for serum harvesting. To evaluate the metabolic status, serum metabolites including glucose, total cholesterol, triglycerides, total protein, albumin, urea, calcium (Ca), magnesium (Mg) and phosphorus (P) were determined by using automated biochemistry analyzer (BS-120 Chemistry Analyzer; Shenzhen Mindray Biochemical Electronics Co. Ltd.) using the biochemistry estimation kits from RFCL Ltd. and Dialab.

Assessment of milk composition 20 mL milk samples were also obtained

from each affected quarter of buffaloes having subclinical mastitis and used for assessment of milk composition. Moreover, 20 mL milk samples were also obtained from healthy controls and used as standard for milk composition comparison. To evaluate the milk quality, milk quality assay panels including lactose, protein, fat, solid-not-fat (SNF), salt, specific gravity and depression in freezing point were estimated by using milk analyzer Lactoscan of Milkotronics Ltd.

Statistical analysis Statistical differences between groups were

evaluated by using using ANOVA with general linear models in SPSS 16. Data were presented as mean ± standard error (±SE) and the significance level was set as P<0.05.


Serum metabolic panels; glucose, total protein, triglyceride, cholesterol, blood urea, calcium (Ca), magnesium (Mg) and phosphorus (P) were estimated to assess the metabolic status of buffaloes suffering from subclinical mastitis and compared with the healthy control (Table 1). Serum glucose level of buffaloes with subclinical mastitis was significantly lower (P≤0.01), when compared with the healthy control. Additionally, significantly lower levels of serum calcium (P≤0.05) and phosphorus (P≤0.05) were also recorded in buffaloes with subclinical mastitis. Whereas, serum urea level of buffaloes with subclinical mastitis was significantly higher (P≤0.01) than healthy control group. However, significant alteration in serum total cholesterol, triglycerides, protein and magnesium contents was not revealed buffaloes with subclinical mastitis in comparison with the healthy control.

Remarkably decreased serum calcium, phosphorus, glucose levels of buffaloes with subclinical mastitis indicate that the buffaloes with altered nutritional status and in negative energy balance could be more prone to intramammary infections. One of the reasons that infectious diseases such as mastitis may be associated with a poorly managed transition period is that the dairy animals experience a substantial periparturient immunosuppression (Esposito et al., 2014).


352

Immunosuppression together with marked changes in endocrinological, nutritional and metabolic status cause increased concentrations of circulating cortisol around parturition. These dynamic changes seem to be central to the metabolic disturbances which favors the establishment of infection in the postpartum dairy animals (Goff, 2006; Spears and Weiss, 2008). The severity of this immunosuppression is exacerbated by factors such as negative energy balance (Ohtsuka et al., 2006), hypocalcaemia (Ducusin et al., 2003) and increased circulating levels of cortisol for prolonged periods around calving (Burton et al., 2005). Moreover, hypocalcemia reduces feed intake so that greater body fat mobilization occurs in early lactation. It also reduces all muscle contraction including the teat sphincter muscle responsible for closure of the teat orifice after milking, thus increasing the risk of mastitis.

It has been demonstrated that hypocalcemia directly impairs immune cell response to an activating stimulus (Kimura et al., 2006). In agreement to the results of the present study, an association between altered metabolic status of parturient cattle and occurrence of various diseases including mastitis has recently been addressed by different scientific workers (Goff, 2008; Sordillo and Raphael, 2013; Esposito et al., 2014; Sharma et al., 2014 ). An elevated serum urea level of buffaloes with subclinical mastitis could be resultant of stress induced protein catabolism of diseased buffaloes. Therefore, altered metabolic status of buffaloes with early lactation could be accountable as a predisposing cause of subclinical mastitis.

For analysis of milk quality of buffaloes with subclinical mastitis, milk quality panels including lactose, protein, fat, SNF, salt, specific gravity and depression in freezing point were

assessed and compared with the healthy control group (Table 2). Total protein and salts contents as well as depression in freezing point of milk samples obtained from buffaloes with subclinical mastitis were significantly higher (P≤0.01) in comparison with the milk quality panels of healthy control group. However, lactose, fat and SNF contents of milk samples obtained from buffaloes with subclinical mastitis were significantly lower (P≤0.01) in comparison with the healthy control group. Moreover, milk specific gravity of these buffaloes was also significantly lower (P≤0.05) in comparison with the healthy control.

Mastitis and the elevation of SCC are commonly accomplished with evident changes in milk composition (Forsback et al., 2010; Leitner et al., 2011). Both, clinical and subclinical mastitis may alter milk composition by altering protein composition, concentration of salt and lactose (Pyörälä, 2003). During mastitis, the net synthesis of casein, lactose and fat in the mammary gland is generally decreased (Forsback et al., 2010). The result of the present study clearly indicates remarkably increased total protein and salts levels as well as remarkable reduction lactose, fat, SNF contents of milk from affected quarters compared to the healthy quarters. Remarkable reduction in specific gravity of milk from affected quarters was also recorded when compared with the specific gravity of milk from healthy quarters. It is well known that lactose content decreases during mastitis as a consequence of the lower blood-milk barrier caused by increased tight junction permeability and damaged epithelial cells. The osmotic pressure of milk is maintained by the balance of concentration of lactose and of soluble minerals. Therefore, changes in the sodium and potassium content of mastitic milk could results in reduced lactose synthesis and thus milk production.


353

Table 1. Comparison of metabolic profile of subclinical mastitic and healthy buffaloes.

Panels Healthy control (n=20)Subclinical mastitic buffaloes

(n=40)Glucose (mg/dl) 48.6±2.34 38.07±0.90a

Triglyceride (mg/dl) 11.29±0.89 11.26±0.09Cholesterol (mg/dl) 102.85±4.2 101.92±1.5Total Protein(g/dl) 6.46±0.12 6.43±0.04Urea (mg/dl) 24.29±1.9 31.84±0.86 a

Calcium (mg/dl) 8.82±0.15 7.66±0.05 b

Magnesium (mg/dl) 2.39±0.12 2.41±0.01Phosphorus (mg/dl) 4.60±0.09 4.31±0.04b

astatistically significant difference (P≤0.01), when compared with the healthy control. bstatistically significant difference (P≤0.05), when compared with the healthy control.

Table 2. Comparison of milk quality assay panels of subclinical mastitic and healthy buffaloes.

Panels Healthy control milk (n=20) Subclinical mastitic milk (n=40)Fat (%) 8.03±0.23 4.61±0.26a

SNF (%) 9.60±0.02 8.33±0.09a

Protein (%) 3.87±0.01 4.32±0.08a

Lactose (%) 5.23±0.01 4.23±0.06a

Salt (%) 0.687±0.032 0.707±0.004a

Specific gravity 1.0297±0.0005 1.0187±0.0039b

Depression in freezing point

0.546±0.002 0.491±0.005a

astatistically significant difference (P≤0.01), when compared with the healthy control. bstatistically significant difference (P≤0.05), when compared with the healthy control.


354

Reduction in lactose content of mastitic milk could also be due to its losses into the circulation through damaged epithelial cells and leaky tight junctions. Moreover, lowered SNF contents of milk from affected quarters might be the effect of decreased lactose content. Since lactose and protein are the major components of SNF, it appeared that drop in SNF was mainly due to decreased lactose content in mastitic milk. Our findings are in agreement with the recent scientific reports demonstrating remarkably reduced content of lactose in subclinical mastitic milk of cattle and buffaloes (Forsback et al., 2010; Hussain et al., 2012; Malek dos Reis et al., 2013; Sharma et al., 2014)

An increased permeability of the blood-milk barrier could also result in an influx of serum proteins and enzymes (such as plasminogen) from the blood, which may lead to increased proteolysis. Plasmin and other proteolytic enzymes, such as cathepsin, elastase and collagenase, all contribute to the degradation of caseins I in milk (Kelly et al., 2006). In the present study we have not estimated the milk caseins content, but total milk protein content was estimated. The result of the present study revealed an elevated protein content in milk from affected quarters; might be the outcome of damaged blood-milk barrier and thus an influx of serum proteins. The increased protein content could also be the outcome of a much greater decreased milk volume after infection than in per day synthesis of this component. Using the total protein content as a milk quality marker is therefore questionable, whereas measuring the whey protein content, in addition to total protein, could be more correct validation for the protein quality of milk. Our findings are in accordance with the other scientific reports demonstrating higher total protein content of milk owing to the increased SCC and mastitis (Nielsen et al., 2005; Forsback et al.,

2010).

CONClUSION

Thus, it can be concluded that remarkably lowered serum metabolites including, glucose, calcium and phosphorus could be associated with subclinical mastitis of buffaloes. In tandem, subclinical mastitis could confer remarkable alteration in milk quality of the affected quarters in buffaloes.

REFERENCES

Burton, J.L., S.A. Madsen, L.C. Chang, P.S. Weber, K.R. Buckham, R. van Dorp, M.C. Hickey and B. Earley. 2005. Gene expression signatures in neutrophils exposed to glucocorticoids: a new paradigm to help explain “neutrophil dysfunction” in parturient dairy cows. Vet. Immunol. Immunopathol., 105(3-4): 197-219.

Contreras, G.A. and R.M. Rodrígue. 2011. Mastitis: comparative etiology and epidemiology. J. Mammary Gland Biol., 16(4): 339-356.

De Vliegher, S., L.K. Fox, S. Piepers, S. McDougall and H.W. Barkema. 2012. Invited review: Mastitis in dairy heifers: Nature of the disease, potential impact, prevention, and control. J. Dairy Sci., 95(3): 1025-1040.

Dimri, U., M.C. Sharma, S.K. Singh, P. Kumar, R. Jhambh, B. Singh, S. Bandhyopadhyay and M.R. Verma. 2013. Amelioration of altered oxidant/antioxidant balance of Indian water buffaloes with subclinical mastitis by vitamins A, D3, E, and H supplementation. Trop. Anim. Health Pro., 45: 971-978.


355

Ducusin, R.J., Y. Uzuka, E. Satoh, M. Otani, M. Nishimura, S. Tanabe and T. Sarashina. 2003. Effects of extracellular Ca2+ on phagocytosis and intracellular Ca2+ concentrations in polymorphonuclear leukocytes of postpartum dairy cows. Res. Vet. Sci., 75(1): 27-32.

Esposito, G., P.C. Irons, E.C. Webb and A. Chapwanya. 2014. Interactions between negative energy balance, metabolic diseases, uterine health and immune response in transition dairy cows. Anim. Reprod. Sci., 144(3): 60-71.

Forsback, L., H. Lindmark-Mansson, A. Andren, M. Akerstendt and K. Svennersten-Sjaunja. 2010. Udder quarter milk composition at different levels of somatic cell count in cow composite milk. Animal, 3(5): 710-717.

Goff, J.P. 2006. Major advances in our understanding of nutritional influences on bovine health. J. Dairy Sci., 89(4): 1292-1301.

Goff, J.P. 2008. The monitoring, prevention, and treatment of milk fever and subclinical hypocalcemia in dairy cows. Vet. J., 176(1): 50-57.

Hussain, R., M.T. Javed and A. Khan. 2012. Changes in some biochemical parameters and somatic cell counts in the milk of buffalo and cattle suffering from mastitis. Pak. Vet. J., 32(3): 418-421.

Kelly, A.L., F.O. Flaherty and P.F. Fox. 2006. Indigenous proteolytic enzymes in milk: A brief overview of the present state of knowledge. Int. Dairy J., 16: 563-572.

Kimura, K., J.P. Goff, M.E.J. Kehrli, J.A. Harp and B.J. Nonnecke. 2006. Effects of mastectomy on composition of peripheral blood mononuclear cell populations in periparturient dairy cows. J. Dairy Sci.,

85(6): 1437-1444.Leitner, G., U. Merin and N. Silanikove. 2011.

Effects of glandular bacterial infection and stage of lactation on milk clotting parameters: comparison among cows, goats and sheep. Int. Dairy J., 21: 279-285.

Malek dos Reis, C.B., J.R. Barreiro, L. Mestieri, M.A. Porcionato and M.V. dos Santos. 2013. Effect of somatic cell count and mastitis pathogens on milk composition in Gyr cows. BMC Vet. Res., 9: 67

Mansor, R., W. Mullen, A. Albalat, P. Zerefos, H. Mischak, D.C. Barrett, A. Biggs and P.D. Eckersall. 2013. A peptidomic approach to biomarker discovery for bovine mastitis. J. Proteomics, 85: 89-98.

Moroni, P., C.S. Rossi, G. Pisoni, V. Bronzo, B. Castiglioni and P.J. Boettcher. 2006. Relationships between somatic cell count and intra-mammary infection in buffaloes. J. Dairy Sci., 89: 998-1003.

Mweu, M.M., S.S. Nielsen, T. Halasa and N. Toft. 2012. Annual incidence, prevalence and transmission characteristics of Streptococcus agalactiae in Danish dairy herds. Prev. Vet. Med., 106(3-4): 244-250.

Nielsen, N.I., T. Larsen, M. Bjerring and K.L. Ingvartsen. 2005. Quarter health, milking interval, and sampling time during milking affect the concentration of milk constituents. J. Dairy Sci., 88(9): 3186-3200.

Ohtsuka, H., C. Watanabe, M. Kohiruimaki, T. Ando, D. Watanabe, M. Masui, T. Hayashi, R. Abe, M. Koiwa, S. Sato and S. Kawamura. 2006. Comparison of two different nutritive conditions against the changes in peripheral blood mononuclear cells of periparturient dairy cows. J. Vet. Med. Sci., 68(11): 1161-1166.


356

Ozawa, T., Y. Kiku, M. Mizuno, S. Inumaru, S. Kushibiki, H. Shingu, T. Matsubara, H. Takahashi and T. Hayashi. 2011. Effect of intramammary infusion of rbGM-CSF on SCC and expression of polymorphonuclear neutrophil adhesion molecules in subclinical mastitis cows. Vet. Res. Commun., 36(1): 21-27.

Plozza, K., J.J. Lievaart, G. Potts and H.W. Barkema. 2011. Subclinical mastitis and associated risk factors on dairy farms in New South Wales. Aust. Vet. J., 89: 41-46.

Pyörälä, S. 2003. Indicators of inflammation in the diagnosis of mastitis. Vet. Res., 34(5): 565-578.

Sharma, D., S.K. Singh, M.K. Srivastava, P. Sachan, A. Srivastava and A.P. Singh. 2014. Evaluation of metabolic status and milk compositions of indigenous cattle with subclinical mastitis and its amelioration by nutritional supplementations. Indian J. Anim. Sci., 84(8): 846-850.

Sordillo, L.M. 2009. Current concepts on immunity and mastitis. Western Canadian Dairy Seminar Advanced in Dairy Technologies., 21: 111-119.

Sordillo, L.M. and W. Raphael. 2013. Significance of metabolic stress, lipid mobilization, and inflammation on transition cow disorders. Vet. Clin. N. Am.-Food A., 29(2): 267-278.

Spears, J.W. and W.P. Weiss. 2008. Role of antioxidants and trace elements in health and immunity of transition dairy cows. Vet. J., 176: 70-76.

Tesfaye, G.Y., F.G. Regassa and B. Kelay. 2010. Milk yield and associated economic losses in quarters with subclinical mastitis due to Staphylococcus aureus in Ethiopian crossbred dairy cows. Trop. Anim. Health

Pro., 42: 925-931.Ullah, S., T. Ahmad, M.Q. Bilal, M.G. Zia-ur-

rehman and S.U. Rehman. 2005. The effect of severity of mastitis on protein and fat contents of buffalo milk. Pak. Vet. J., 25: 1-4.

Wellnitz, O. and R.M. Bruckmaier. 2012. The innate immune response of the bovine mammary gland to bacterial infection. Vet. J., 192: 148-152.


357

ABSTRACT

Four complete iso-nitrogenous rations containing crude protein 12.6% with 0 (T1), 5 (T2), 7.5 (T3) and 10 (T4) percent calcium soap of red palm oil (protected fat) were formulated and evaluated using in vitro and in sacco digestibility/degradability techniques. The rations with 0 to 10 percent of calcium soap were further evaluated in vivo using four Murrah buffaloes (221.3±3.60 kg body weight) in a Latin Square Design (LSD) to find out optimum level of inclusion of protected fat in complete diets based on intake and nutrient utilization. The average in vitro DMD values were lowered (P>0.05) by 2.91, 4.84 and 7.04% due to incorporation of protected fat at 5, 7.5 and 10% level, respectively compared to control ration (T1). The dry matter (DM) intake (kg/d or g/kg w0.75) and the digestibility of proximate principles and cell wall constituents except ether extract (EE) were not significantly (P>0.05) affected by the level of protected fat in the diet. The EE digestibility was improved significantly (P<0.05) by 23.0 to 26.1% with protected fat (5, 7.5 and 10%) supplementation compared to control diet. Nitrogen retention (g/d, percent intake or percent absorbed) in buffaloes was not affected (P>0.05) with dietary supplementation of protected fat. The DCP values of rations with varying levels of calcium soap of red palm oil were

not different from each other.The TDN value of the rations with 5, 7.5

and 10% calcium soap was significantly (P<0.01) higher by 3.18, 4.84 and 6.80 percentage units, respectively as compared to ration without calcium soap. Further, the DCP and TDN intakes were non-significantly (P>0.05) higher in buffaloes fed rations supplemented with protected fat. Based on results, it is concluded from the present study that, calcium soap prepared from red palm oil can be used as an energy supplement up to 10% level for Murrah buffalo animals without affecting DMI and nutrient utilization for improved production.

Keywords: buffaloes, Bubalus Bubalis, bypass fat, supplementation, in vitro, in sacco evaluation, nutrient utilization, Murrah buffaloes

INTRODUCTION

India is currently the largest producer of milk (124.85 million tons) in the world with 115.4 and 218 million buffaloes and cattle, respectively (FAO, 2012). Further, the buffalo population in rural India continued to grow in the near future as they thrive well on fibrous crop residues. However, eenergy and protein are the two major limiting nutrients that affect the production potential of

IN VITRO, IN SITU AND IN VIVO EVALUATION OF STRAW BASED DIETS SUPPLEMENTED WITH BYPASS FAT AS CONCENTRATED

ENERGY SOURCE IN MURRAH BUFFALOES

R. Sravan Kumar, Y. Ramana Reddy, N. Nalini Kumari, K. Sridhar* and D. Srinivasa Rao

Department of Animal Nutrition, College of Veterinary Science, Sri Venkateswara Veterinary University, Rajendranagar, Hyderabad, India, *E-mail: [email protected]

Original Article



358

both small and large ruminants in India, owing to shortage of 45, 44 and 38% of dry roughage, concentrates and green fodder, respectively, which led to the deficiency of energy and protein to the extent of 37 and 34%, respectively, for the existing ruminant population (Ramachandra et al., 2007).

Deficiency of energy, especially during critical physiological stages such as early lactation, advanced stage of pregnancy and faster rate of growth, adversely affects milk production, growth and subsequent breeding performance (Horton et al., 1992) causing heavy economic loss to the milk and meat producers.

Productivity of ruminants can be enhanced by strategic supplementation with energy and protein rich feedstuffs (Preston and Leng, 1987). Interest in the use of fats as source of energy for ruminants is increasing in the tropics owing to their high energy density and low heat increment.

Devendra and Lewis (1974) reported that at dry matter intake (DMI) of 18 to 22%, if contributed by the fibre component in the ration, the supply of energy by fat becomes more important for meeting the increased demand for production. Feeding of fat to ruminants at 5 to 6% level in the ration would maximize the efficiency of nutrient utilization (Coppock and Wilks, 1991). However, feeding of free or unprotected fats in excess of 3 to 4% results in reduction in microbial activity in the rumen and depresses the digestion of cellulose (Czerkawski et al., 1996; Henderson, 1973). Jenkins and Palmquist (1984) and Schauff and Clark (1989) reported that protected fat in the form of calcium soap allows normal rumen fermentation and digestibility of nutrients. The present experiment aimed at to evaluate the rations supplemented with varying levels of by-pass fat by in vitro and in sacco techniques and effect on digestibility and utilization of nutrients in Murrah

buffaloes.


The experiment was conducted at the Department of Animal Nutrition, College of Veterinary Science of Sri Venkateswara Veterinary University Rajendranagar, Hyderabad (17o 12’N. 78o 18’E, 518 m above sea level) in India. The ambient temperature and relative humidity values during the period of study were in the range of 28 to 42oC and 64 to 88%, respectively.

Procurement of crude oil and preparation of calcium soaps

In the present experiment, based on the yield and cost of different oils prevailing in the market, red palm oil was chosen as it was relatively cheaper oil source for the preparation of protected fats. Crude red palm oil was obtained from M/s. Andhra Pradesh Cooperative Oilseeds Growers Federation Ltd., Hyderabad.

Calcium soap from red palm oil was prepared by the ‘double decomposition method’ originally proposed by Duell (1951) and standardized in this laboratory by Ramana et al. (1999) using commercial-grade calcium chloride and sodium hydroxide. The procedure used to prepare calcium soap was as follows. Calcium salts of long-chain fatty acids were prepared by heating a mixture of 25 kg of crude red palm oil and 38.75 L of a 0.1 (w/v) sodium hydroxide solution in a metallic drum. The mixture was heated on a hotplate and stirred until the fatty acids were completely dissolved. Calcium chloride (5.875 kg) dissolved in 11.75 L of water was added slowly to the water-soluble soaps while stirring for to aid precipitation of calcium soaps. Excess solid calcium chloride


359

was added to salt out the insoluble soaps. Excess water was removed by squeezing the soap through muslin cloth. Calcium salts were then dried in a tray drier at 105oC overnight.

Ration formulationFour iso-nitrogenous rations with 12.6%

CP using sorghum stover as roughage base and groundnut extract, maize, deoiled rice bran, sunflower extract as concentrate sources were formulated with 0 (T1), 5 (T2), 7.5 (T3) and 10 (T4) percent levels of protected fat for further evaluation.

In vitro and in sacco evaluation To determine the effective level of

inclusion of protected fat of red palm oil, rations with varying levels of protected fats were evaluated using two stage in vitro dry matter digestibility (IVDMD) technique (Tilly and Terry, 1963) and in sacco method (Kempton, 1980).

Three grams of ground (2 mm) samples were weighed into each of five bags and incubated in the ventral sac of the rumen of each buffalo steer with the aid of 60 cm nylon string secured to each bag to allow free movement of bags with in the rumen. The canulated buffalo steers were maintained on a ration to have 50:50 roughage to concentrate ratio throughout the study to maintain constant rumen out flow rate. At the end of 12, 24, 36, 48 and 72 h incubation, the bags were retrieved from the rumen and washed under tap and dried to a constant weight at 70oC for 48 h in a forced draft oven and percent DM disappearance was determined. The constants a, b and c were derived using computer formula (Mc Donald, 1981) and the effective degradable dry matter (EDDM) of different samples were calculated using an assumed out flow rate (k) value of 0.05/h.

Nutrient utilization and nitrogen balance studiesThe experimental rations were evaluated

in a 4 x 4 latin square design using buffalo steers with average body weight of 221.3±3.60 kg. The buffalo steers were dewormed before the start of the experiment. A 14-day preliminary period and 7 days collection period were followed during the metabolism trial. The rations were offered twice daily at 8.30 and 14.00 h in equal proportions. The live weight of the animals was recorded before the start and at the end of the each metabolism trial consecutively for 3 days.

During the metabolism trial, samples of feed offered and of leftovers were collected daily in separate polythene bags for each animal for chemical analysis. Total faeces voided during 24 h were collected and an aliquot of 10% was composited in polythene bags and frozen. Daily urine output was measured and an aliquot of 5% was added to a glass bottle with few drops of HCl and preserved at 4oC. After completion of the collection period, frozen samples were thawed and mixed thoroughly for nitrogen (N) and dry matter (DM) determination. For further chemical analysis, faecal materials were dried, ground through a Wiley mill and processed in airtight bottles. Feed samples were also prepared similarly for analysis.

Chemical analysis Feed, feces, and urine samples were

analyzed for N using “Terbotherm” and “Vapodest” (Gerhard, Germany) analysed on micro-Kjeldal method (AOAC, 1997). DM and total ash were determined according to the procedures described by AOAC (1997). Ether extract was estimated after acid hydroly-sis (Wiseman et al., 1992). Cell wall constituents in feeds, feces, and residues were performed as per the method described by Van Soest et al. (1991). Digestible energy (DE) and


360

metabolizable energy (ME) values were calculated using the NRC (1989) formulae: 1 kg TDN=17.45 MJ DE; ME=DE × 0.82, where TDN=total digestible nutrients.

Statistical analysisThe data collected during the experiment

was subjected to least square analysis of variance. The differences between the means were tested by significance using Duncan’s multiple range test (Duncan 1955). All the statistical procedures were carried out as per the procedures of Snedecor and Cochran (1980) by programming and processing in computer.


Ingredient and chemical compositionsIngredient and chemical compositions of

rations are shown in Tables 1 and 2. The level of groundnut cake was increased by 60, 90 and 110 g/kg, respectively, as the level of protected fat increased in the supplemental component of the

ration from 0 to 50, 75 and 100 g, to maintain the isonitrogenous (12.6% CP) status of the rations (Table 1). Correspondingly the proportion of sunflower cake, maize, deoiled rice bran (DORB) was decreased in the rations. The EE content increased progressively as the level of protected fat increased from 0 to 5%, 7.5% and 10% in the rations, which was attributed to the addition of fat in the ration at graded level (Table 2).

Whereas, the CF and NFE content of rations T2, T3 and T4 were lowered by 0.81, 3.13; 2.04, 4.41 and 3.01 and 5.44 percentage units, respectively, as compared to ration T1 which was due to the dilution effect of added protected fat at varying levels in rations T2, T3 and T4. The organic matter (OM) was also slightly decreased and the ash content increased as the level of fat increased in the diets, which may be due to added chemical reagents and residual water-soluble salts left in the protected fat after drying. Cell wall fractionations progressively were also decreased as the level of protected fat increased from 0 to 5, 7.5 and 10% in the rations, which may be due to dilution effect of added protect fat.

Table 1. Ingredient composition (g/kg) of different experimental rations.

Ingredient Ration

T1 T2 T3 T4Sorghum straw 400 400 400 400Maize 125 115 90 70Groundnut extract 140 200 230 250Sunflower extract 150 100 70 55Deoiled rice bran 100 50 50 40Protected fat 0 50 75 100Molasses 70 70 70 70Mineral mixture 10 10 10 10Salt 5 5 5 5

Vitamin AD3 was added 10 g/100 kg


361

In vitro and in sacco evaluationThe average in vitro DMD values were

lowered (P>0.05) by 2.91, 4.84 and 7.04% (Table 2) due to incorporation of protected fat at 5, 7.5 and 10% level, respectively compared to control ration (T1). Our results were in consistent with the findings of Raman Malik et al. (1999) who observed no adverse effect on in vitro DM and OM digestibility of ration having up to 7.5% calcium soap of soybean and mustard oil. Similarly, Ramana et al. (2001) and Kumar et al. (2006) also reported that the inclusion of calcium soap of palm oil up to 15% level in rations of sheep had no adverse effect on in vitro dry matter digestibility. The average in sacco DM disappearance was non-significantly decreased with increase in the level of calcium soap inclusion as the period

of incubation increased from 12 to 72 h. Among the rations evaluated, higher (P>0.05) average DM disappearance values were observed for T1 ration with 0% calcium soap irrespective of period of incubation (Table 3). The average in sacco DM disappearance was lower (P>0.05) by 2.13, 4.41 and 6.40% irrespective of time of incubation in rations with 5, 7.5 and 10% protected fat, respectively in comparison to ration without protected fat. However, the average DM disappearance values of rations with varying levels of calcium soap did not differ significantly (P>0.05) irrespective of time of incubation in the rumen. Whereas, effective dry matter degradability was comparable among the dietary treatments (Table 4). Similar to our results, Ramana et al. (2001) reported that supplementation of protected fat up to 15% level in straw based diet

Table 2. Chemical composition (%) and in vitro dry matter digestibility (IVDMD) of experimental rations with varying levels of calcium soap of red palm oil.

Parameter Ration

T1 T2 T3 T4Dry matter 89.44 89.72 88.38 89.07Organic matter 91.19 90.80 90.19 90.03Crude protein 12.65 12.65 12.67 12.64Ether extract 1.93 5.48 7.36 9.23Crude fiber 26.70 25.89 24.66 23.69Nitrogen free extract 49.91 46.78 45.50 44.47Total ash 8.81 9.20 9.81 9.97Neutral detergent fiber 49.15 46.37 43.73 41.71Acid detergent fiber 30.86 28.98 27.31 26.09Hemicelluloses 18.29 17.39 16.42 15.62Cellulose 24.85 23.30 21.87 20.83Lignin 6.01 5.68 5.44 5.26IVDMD* 42.32 41.09 40.27 39.34

Each value is an average of duplicate analysis *Each value is an average of four observations and mean values did not differ significantly (P>0.05)


362

did not influence the effective DM degradability.In vitro and in sacco evaluation studies

revealed that supplementation of calcium soap of red palm oil up to 10% in the ration had no profound effect on DM digestibility though the values decreased as the level of calcium soap increased from 0 to 5, 7.5 or 10% level in the rations. Hence, all the four rations with varying level of calcium soap of red palm oil were further evaluated in vivo.

Voluntary intake and nutrient digestibilityThe dry matter intake (DMI, g/kg W0.75or

per day) in buffalo steers was not affected (P>0.05) by gradual increase (0, 5, 7.5 and 10%) in dietary

supplementation of bypass fat through complete ration (Table 5). Our results were in accordance with the findings of Ramana Reddy et al. (2003) and Kumar et al. (2006) who found no difference in DMI in sheep due to supplementation of protected fat at 10 to 12% level in the diet. Similarly, Thakur and Shelke (2010) stated that supplementation of Ca salts of soya acid oil fatty acids at 4% could not affect the DMI of Murrah buffaloes. Purushothaman et al. (2008) also noted no difference (P>0.05) in DMI of lactating crossbred cows with gradual increase in bypass fat (calcium soaps of palm oil fatty acids) supplementation in the diet up to 6%. In contrast, Ganjkhanlous et al. (2009) observed

Table 3. Effect of different levels of protected fat on in situ dry matter degradability in Murrah buffaloe steers fed straw based diet.

Incubation Interval

Complete ration T1 T2 T3 T4 SEM

12 30.70 29.44 28.65 27.57 0.6624 42.28 41.24 40.22 39.6 0.5936 46.54 45.84 44.61 43.90 0.5948 55.17 53.97 52.71 51.45 0.8072 62.64 61.79 60.66 59.63 0.66

Each value is an average of four observations, Mean values did not differ significantly (P>0.05)

Table 4. Effect of supplementation of different levels of protected fat on rumen kinetics and effective rumen degradable dry matter (EDDM) in graded Murrah buffaloes steers.

Parameter Complete rationT1 T2 T3 T4

a 18.72 17.18 16.96 15.67b 57.17 57.35 57.49 56.34c 0.0203 0.0208 0.0198 0.0209

EDDM (%) 35.30 34.10 33.30 32.20

a (soluble), b (insoluble but degradable) and c (rate constant/h) are constants and EDDM represents effectively degradable dry matter (Orskov and McDonald, 1979) at an assumed outflow rate (k) of 0.05/h.


363

reduction (P<0.05) in DMI of lactating Holstein cows with supplementation of rumen protected fat (30 g/kg prilled protected or 35 g/kg Ca salts of protected fat). Whereas Kumar and Thakur (2007) observed higher (P<0.05) DMI in Murrah buffalo

calves by addition of 2.5% by pass fat to the basal diet. Similarly, Shelke et al. (2012) reported that, DMI (P<0.05) was improved in Murrah buffaloes with inclusion of bypass protein and bypass fat (2.5%) to the basal diet.

Table 5. Effect of supplementation of different levels of calcium soap of red palm oil on dry matter intake (DMI), nutrient digestibility, nutritive value and plane ofnutrition in Murrah buffalo steers fed straw based diet.

ParameterComplete ration

T1 T2 T3 T4 SEMAverage body weight (kg) 221.25 227.00 32.75 235.75 3.21DMI (g/day) 6.02 6.24 6.07 6.22 0.05DMI (g/kg W0.75 per day) 104.9 106.7 101.9 103.4 1.03DigestibilityDry matter 60.53 59.64 60.47 61.01 0.28Organic matter 62.32 61.39 61.25 62.23 0.28Crude protein 70.74 72.03 73.63 73.46 0.68Crude fibre 52.35 51.24 50.16 49.69 0.59Ether extract 65.97a 81.17 b 82.86 b 83.19 b 4.13Nitrogen free extract 65.17 63.63 62.40 61.69 0.76Neutral detergent fibre 56.28 54.32 51.46 50.14 1.39Acid detergent fibre 47.58 45.35 43.93 42.36 1.11Hemicellulose 68.35 65.75 63.99 62.63 1.23Cellulose 62.22 59.67 57.14 56.25 1.35Nutritive valueDCP (g/kg DM) 8.95 9.11 9.33 9.29 0.09TDN (g/kg DM) 58.97a 62.15b 63.81bc 65.77c 1.44DE (MJ/kg DM) 10.88a 11.47b 11.77bc 12.13c 0.26ME (MJ/kg DM) 8.92a 9.40b 9.65bc 9.95c 0.22Nutritive ratio 1 : 5.59 1 : 5.82 1 : 5.84 1 : 6.08Plane of nutritionDCP intake (g/kg w0.75) 9.39 9.72 9.50 9.60 0.07TDN intake (g/kg w0.75) 61.87 66.27 64.97 68.02 1.30

Each value is an average of four observations. abcMean value bearing different superscript letters in a row differ significantly (P<0.05). DCP: digestible crude protein; TDN: total digestible nutrients; DE: digestible energy; ME: metabolizable energy.


364

The digestibility of proximate principles and cell wall constituents was not significantly (P>0.05) affected by the supplementation of protected fat at different levels except for ether extract (EE) (Table 5). The digestibility of EE was higher (P>0.05) by 15.20, 16.89 and 17.22, percentage units, respectively in buffaloes fed rations T2, T3 and T4 as compared to those fed ration T1 (Table 5). Whereas, no significant (P>0.05) differences were observed among rations T2, T3 and T4.

Our results were in consistent with the findings of Ramana et al. (2003) and Kumar et al. (2006) who reported that supplementation of calcium soap of fatty acids (up to 15%) in sheep ration enhanced the dietary lipid digestibility without affecting the digestibility of other nutrients. Similar findings were reported by Thakur and Shelke (2010), who observed no difference (P>0.05) in digestibility of DM, CP, CF, NDF and ADF with exception of EE, which digestibility coefficient was higher in Murrah buffaloes fed on diet supplemented with bypass fat (4% Ca salts of soya acid oil) compared to usupplemented buffaloes. Similarly, Sirohi et al. (2010) observed comparable digestibilities of nutrients except that of EE which was higher in bypass fat (300 g/d) supplemented lactating crossbred cows compared to control group (no bypass fat supplementation). Kumar and Thakur (2007) found higher (P<0.05) digestibility of EE with bypass fat supplementation (2.5% or 4%) in Murrah buffalo calves while no adverse effect was recorded on the digestibility of other nutrients. Purushothaman et al. (2008) found no significant difference in digestibility of DM, OM, CP and CF, however, EE digestibility in cows of bypass fat (2% and 4%) supplemented groups was significantly (P<0.05) higher than the control group (0% bypass fat). Whereas, Tyagi et al. (2009)

noted better utilization of DM and CP in lactating crossbred cows with addition of 2.5% bypass fat to the basal diet.

Nutritive value and plane of nutritionThe data on digestible crude protein (DCP)

values (%) of rations indicated that DCP values were not significantly (P>0.05) affected by varying levels of protected fat due to iso nitrogenous nature of rations (Table 5). Ramana Reddy et al. (2003) and Kumar et al. (2006) in sheep also did not find any significant difference in DCP value of ration up to 15% level of calcium soap supplementation. Total digestible nutrients (TDN) values of rations T2, T3 and T4 were significantly (P<0.01) increased by 3.18, 4.84 and 6.80 percentage units, respectively as compared to ration T1.

Because of higher EE intake and digestibility, the rations T2, T3 or T4 rations had higher TDN than that of control ration (T1). The nutritive ratio of rations T1, T2, T3 and T4 were 1 : 5.59, 1 : 5.82, 1 : 5.84 and 1 : 6.08, respectively. The narrow nutritive value for ration T2, T3 and T4 could be attributed to added energy through protected fat supplementation. Digestible energy and metabolizable energy values followed same trend as TDN. Supplementation of calcium soap in sheep diet increased (P<0.05) the TDN content of diet at 10% level (Alexander et al., 2002) or 15% level (Ramana et al., 2003). In contrast, Hill and West (1990) reported that supplementation of 4.5% of calcium soap of fatty acids did not significantly affect the digestibility of energy. The intake of DCP and TDN (g/d) in buffalo fed rations T2, T3 and T4 was non-significantly (P>0.05) higher than those fed ration T1 due to increased digestibility of CP and energy. Similar findings were also reported by Ramana et al. (2003). Sklan et al. (1990) reported that increasing the amount of CSFA up to 90 g/


365

kg diet enhanced energy (ME) intake by 14.22%. Thakur and Shelke (2010) found no difference in CP intake, whereas observed higher TDN intake in Murrah buffaloes fed on diets supplemented with bypass fat (4% Ca salts of soya acid oil) compared to no bypass fat supplemented buffaloes. The requirements for growing buffaloes weighing 240 kg body weight with an average daily gain of 450 g are DM 6.1 kg, DCP 375 g, TDN 3.3 kg (ICAR, 1998). The nutrient intake was higher in buffaloes fed ration T1, T2, T3 and T4 than the recommended level of ICAR (1998) for growing buffaloes.

Nitrogen balanceN intake (g/d) and N excretion (g/d)

through faeces, urine or total was not significantly (P>0.05) affected by supplementation of protected fat at different levels (Table 6). There was no significant (P>0.05) difference observed in N balance among dietary treatments and irrespective of the diet, all the buffalo steers were on positive

nitrogen balance. This might be due to comparable DMI of iso-nitrogenous complete rations by all experimental animals. Ngidi et al. (1990), Sklan et al. (1990) and Ramana et al. (2003) reported that addition of calcium soap did not alter N digestion/retention of rations. In contrast, Ohajuruka et al. (1991) observed slight improvement in the digestibility of N in dairy cows supplemented with bypass fat.

CONClUSIONS

In vitro and in sacco studies indicated that calcium soap of red palm oil can be added up to 10% level in straw based diets of buffaloes without any significant effect on DM digestibility. Inclusion of calcium soap of red palm oil at 10% level in the rations of Murrah buffaloes was found to be optimum without affecting the dry matter intake, nutrient digestibility, N balance with improved

Table 6. Effect of supplementation of different levels of calcium soap of red palm oil on nitrogen balance in Murrah buffalo steers fed straw based diet.

ParameterComplete ration

T1 T2 T3 T4 SEMN intake (g/d) 121.8 126.2 123.0 125.8 1.07N output (g/d)In faeces 35.63 35.35 32.41 33.48 0.77In urine 34.96 39.44 42.08 37.51 1.51Total 70.59 74.78 74.49 70.98 1.12Balance (g/d) 51.22 51.43 48.50 54.85 1.30% of intake 42.05 40.75 39.44 43.59 0.89% of absorbed 59.44 56.60 53.55 59.39 1.40

Each value is an average of four observations. Mean values did not differ significantly (P>0.05).


366

nutrient intake.

REFERENCES

Alexander, G., Z. Prabhakara Rao and J. Rama Prasad. 2002. Effect of supplementing sheep with sunflower acid oil or its calcium soap on nutrient utilization. Asian Austral. J. Anim. Sci., 15(9): 1288-1293.

AOAC. 1997. Official Methods of Analysis. Association of Official Analytical Chemists, Washington, D.C.

Coppock, C.E. and D.L. Wilks. 1991. Supplemental fat in high energy rations for lactating cows; effects on intake digestion and composition. J. Anim. Sci., 69(9): 3826-3837.

Czerkawski, J.W., K.L. Blaxter and F.W. Wainman. 1966. The metabolism of oleic, linoleic and linolenic acids by sheep with reference to their effects on methane produc-tion. Brit. J. Nutr., 20(2): 349-362.

Devendra, C. and D. Lewis. 1974. Fat in the ruminant diet: re-view. Indian J. Anim. Sci., 44: 917-938.

Duell Jr, H.J. 1951. The Lipids: Their Chemistry and Biochemistry. Inter-science Publishers, New York.

Duncan, D.B. 1955. Multiple range and multiple F tests. Biometrics, 11: 1-42.

FAOSTAT. 2012. Statistical Databases and Data-Eets of the Food and Agricultural Organization of the United Nations, Rome, Italy.

Ganjkhanlous, M., K. Rezayazdi, G.R. Ghorbani, M. DehghanBanadaky, H. Morraveg and W.Z. Yang. 2009. Effects of protected fat supplements on production of early lactation Holstein cows. Anim. Feed Sci. Tech., 154:

276-283.Henderson, C. 1973. The effect of fatty acids on

pure culture of rumen bacteria. J. Agr. Sci., 81(1): 107-112.

Hill, G.M. and J.W. West. 1991. Rumen protected fat in line barley or corn diets for beef cattle: digestibility, physiolog-ical and feed lot responses. J. Anim. Sci., 68: 3376-3388.

Horton, G.M.J., J.E. Wohlt, D.D. Palatani and J.A. Baldwin. 1992. Rumen protected lipid for lactating ewes and their nursing lambs. Small Ruminant Res., 9: 27-36.

ICAR. 1998. Nutrient Requirements of Livestock and Poultry, Indian Council of Agricultural Research, Pusa, New Delhi.

Jenkins, T.C. and D.L. Palmquist. 1984. Effect of fatty acids or calcium soaps on rumen and total nutrient digestibility of dairy rations. J. Dairy Sci., 67: 978-986.

Kempton, T.J. 1980. The use of nylon bags to characterize the potential degradabilites of feeds for ruminants. Trop. Anim. Prod., 5: 107-116.

Kumar, B. and S.S. Thakur. 2007. Effect of supplementing bypass fat on the performance of buffalo calves. Indian J. Anim. Nutr., 24: 233-236.

Kumar, R., K. Sivaiah, Y.R. Reddy, B. Ekambaram, T.J. Reddy and G.V.N. Reddy. 2006. Effect of supplementation of dietary protected lipids on intake and nutrient utilization in Deccani lambs. Trop. Anim. Health Prod., 38: 151-158.

Mc Donald, I. 1981. A revised model for the estimation of protein degradability in the rumen. J. Agri. Sci., 96: 251-252.

Ngidi, M.E., S.C. Loerch, F.L. Fluharty and D.L. Palmquist. 1990. Effects of calcium soaps of long chain fatty acids on feed lot


367

performance, Carcass characteristics and ruminal metabolism of steers. J. Anim. Sci., 68: 2555-2565.

NRC. 1989. Nutrient Requirement of Dairy Cattle. 5th revised ed. National Research Council, National Academy of Sciences, Washington, DC.

Ohajuruka, O.A., Z. Wu and D.L. Palmquist. 1991. Ruminal metabolism, fibre and protein digestion by lactating cows fed calcium soap or animal-vegetable fat. J. Dairy Sci., 74: 2601-2606.

Preston, T.R and R.A. Leng. 1987. Matching Ruminant Pro-duction Systems with Available Resources in the Tropics and Sub-tropics. Penambul Books, Arimidale, Australia. p. 103-128.

Purushothaman, S., A. Kumar and D.P. Tiwari. 2008. Effect of feeding calcium salts of palm oil fatty acids on performance of lactating crossbred cows. Asian Austral. J. Anim. Sci., 21(3): 376-385.

Ramachandra, K.S., V.K. Taneja, K.T. Sampath, S. Anandan and U.B. Angadi. 2007. Livestock Feed Resources in Different Agro Ecosystem of India: Availability, Requirement and Their Management. National Institute of Animal Nutrition and Physiology, Bangalore, India.

Malik, R., S.K. Sirohi, T.K. Walli and S.S. Thakur. 1999. Development of bypass fat from difference sources and its evaluation in total mixed ration, p. 43. In Proceedings of 9th

Animal Nutition Conference, Hyderabad, India.

Reddy, Y.R., N. Krishna, E.R. Rao and D.V.G.K. Mohan. 1999. Effect of level of calcium chloride on yield of calcium soap and extent of protection of fat in vegetable oil, p. 134. In Proceedings of the 9th Animal Nutrition

Conference, Hyderabad, India.Reddy, Y.R., N. Krishna and E.R. Rao. 2001. In

vitro and in sacco evaluation of rations supplemented with varying levels of dietary bypass fat in sheep. Indian J. Anim. Nutr., 18: 243-247.

Reddy, Y.R., N. Krishna, E. RaghavaRao and T.J. Reddy. 2003. Influence of dietary protected lipids on intake and digestibility of straw based diets in Deccani sheep. Anim. Feed Sci. Tech., 106: 29-38.

Schauff, D.J. and J.H. Clark. 1989. Effects of pilled fatty acids and calcium salts of fatty acids in rumen fermentation nutrient digestibilities milk production and milk composition. J. Dairy Sci., 72: 917-927.

Shelke, S.K., S.S. Thakur and S.A. Amrutkar. 2012. Effect of feeding protected fat and proteins on milk production, composition and nutrient utilization in Murrah buffaloes (Bubalus bubalis). Anim. Feed Sci. Tech., 171: 98-107.

Sirohi, S.K., T.K. Walli and R.K. Mohanta. 2010. Supplementation effect of bypass fat on production performance of lactating crossbred cows. Indian J. Anim. Sci., 80: 733-736.

Sklan, D., L. Nagar and A. Arieli. 1990. Effect of feeding different levels of fatty acids or calcium soaps of fatty acids on digestion and metabolizable energy in sheep. Anim. Sci., 50(1): 93-98.

Snedecor, G.W. and W.G. Cochran. 1980. Statistical Methods, 7th ed. Iowa State University Press, Ames, Iowa, USA.

Thakur, S.S. and S.K. Shelke. 2010. Effect of supplementing bypass fat prepared from soybean acid oil on milk yield and nutrient utilization in Murrah buffaloes. Indian J.


368

Anim. Sci., 80(4): 354-357Tilly, J.M.A. and R.A. Terry. 1963. A two-stage

technique for the in vitro digestion of forges crops. J. Brit. Grassland Soc., 18(2): 104-111.

Tyagi, N., S.S. Thakur and S.K. Shelke. 2009. Effect of feeding bypass fat supplement on milk yield, its composition and nutrient utilization in crossbred cows. Indian J. Anim. Nutr., 26: 1-8.

Van Soest, P.J., J.B. Robertson and B.A. Lewis. 1991. Methods for dietary fibre, neutral detergent fibre and non-starch polysaccharides in relation to animal nutrition. J. Dairy Sci., 74: 3583-3597.

Wiseman, J., B.K. Edmunds and N. Shepperson. 1992. The apparent metabolizable energy of sunflower oil and sunflower acid oil for broiler chickens. Anim. Feed Sci. Technol., 36: 41-51.


369

ABSTRACT

A total of 48 semen ejaculates from 6 Murrah bulls were collected during winter period (15oC to 25oC) and heat stress (42oC to 48oC) through artificial vagina method to study the effect of heat stress on seminal characteristics of Murrah buffalo bull semen. Overall mean values of ejaculated volume (3.95±0.33 Vs 3.43±0.21 ml), sperm concentration (1324.80±67.84 Vs 1133.11±74.27 millions/ml), total number of sperm per ejaculate (6575.74±1306.37 Vs 4785.31±619.18), mass motility (3.63±0.09 Vs 3.33±0.10), initial progressive motility (72.50±0.89 Vs 73.33±0.87%), live sperm (85.82±0.77 Vs 84.12±0.94%), abnormal sperm (8.71±0.47 Vs 12.25±0.72%), intact acrosome (83.54±0.30 Vs 82.92±0.32%), cervical mucus penetration (21.10±0.32 Vs 24.31±0.48 mm) and hypo osmotic swelling reactive sperm (55.88±2.65 Vs 52.08±0.34%) were in fresh semen during winter period (15oC to 25oC) and heat stress (42oC to 48oC), respectively. The overall mass activity (P<0.05) and percent HOS positive sperm (P<0.01) were found significantly lower during heat stress whereas percent abnormal sperm and the mean distance travelled by vanguard spermatozoa (CMPT) was found significantly higher (P<0.01)

during heat stress. There is variation in sensitivity among individual bulls to heat stress for sperm concentration, initial progressive motility, abnormal sperm, intact acrosome, cervical mucus penetration and hypo osmotic swelling reactive sperm.

Keywords: buffaloes, Bubalus bubalis, fresh semen, heat stress, Murrah bulls, physical characteristics

INTRODUCTION

Artificial insemination using frozen semen is now worldwide tool employed for improving the genetic potential of livestock. Attempts are being intensified to increase the coverage of AI so as to exploit the full potential of the technology. The use of the best bulls is often restricted by the limited number of doses of semen produced as there are several inherent and functional constraints in realizing the breeding goals through AI. Moreover, the quality of frozen thawed semen is one of the most influential factors affecting the likelihood of conception (Saacke, 1984). Application of AI with frozen thawed semen has been reported on a limited scale in buffalo, because of poor freezability and fertility of buffalo spermatozoa when compared

EFFECT OF HEAT STRESS ON SEMINAL CHARACTERISTICS OF MURRAH BUFFALO BULL SEMEN

K.l. Ram1, R.P. Tiwari1, G.K. Mishra1,*, S.A. Sahasrabudhe2 and A.K. Nair2

1Department of Veterinary Gynaecology and Obstetrics, College of Veterinary Science and Animal Husbandry, Chhattisgarh Kamdhenu Vishwavidyalaya, Anjora, Durg, Chhattisgarh, India, *E-mail: [email protected] Semen Station, Anjora, Durg, Chhattisgarh, India

Original Article


370

with cattle spermatozoa (Kakar and Anand, 1981; Muer et al., 1988; Raizada et al., 1990; Singh and Pant, 2000; Andrabi et al., 2001; Ahmad et al., 2003; Senatore et al., 2004; Kumaresan et al., 2005). Semen quality and quantity of breeding bulls is influenced by several non-genetic factors including age of the bulls and season of the year. High ambient temperature during summer adversely affects testicular size, libido and semen quality (Soderquist et al., 1996).

Similarly, epididymal spermatozoa are adversely affected by elevated testicular temperature resulting in a decreased ability of spermatozoa to maintain motility and acrosomal integrity after freezing. Seasonal patterns of reproductive performance in both male and female buffaloes are well established (Roy et al., 1962; Sengupta et al., 1963; Qureshi et al., 1999). High heat stress during summer is known to depress the thyroid activity which consequently results in weak libido of breeding bulls, and poor semen quality, freezability and fertility. However, very little information is available on environmental factor variables like temperature, humidity and day length in a particular season as during recent past years, the temperature is rising very high to 42oC to 48oC during summer. Therefore, the present research work was carried out to study the effect of heat stress on seminal characteristics in Murrah buffalo bull.


The study was conducted on six Murrah buffalo bulls aged between of 5 to 6 years of age maintained in identical feeding and management regimes according to minimum standard protocol (MSP) of Government of India at Central Semen

Station (CSS), Anjora, Durg (Chhattisgarh). A total of 48 semen ejaculates from 6 bulls (8 ejaculates from each bull) were collected during period of heat stress (temperature ranged between 42oC to 48oC) and winter (temperature ranged between 15oC to 25oC) during year 2013. Durg is located at an altitude of 951 feet above the mean sea level at a latitude of 21o10’ North and a longitude of 81o16’ East. The climate of this place is of tropical region with temperature ranging between 7.3oC to 47.4oC and relative humidity between 20 to 75%. All the bulls were maintained in identical feeding and management regimen according to minimum standard protocol (MSP) of Government of India. Semen from experimental bulls was collected twice a week, in morning hours between 7.00 to 8.30 A.M. before feeding by using Artificial Vagina (25 cm long and 6.5 cm in diameter) maintained at 42oC to 45oC in incubator as per procedure described by Singh et al., 2000. A male partner of the same species was used as a dummy for semen collection. Two false mounts were provided to each bull before collection. Immediately after collection, the semen was kept at 37oC in a water bath placed inside the passbox.

Evaluation for volume (Sardar, 2007), mass motility (Salisbury et al., 1978), initial progressive motility (Ahmad, 1994), sperm concentration (Mishra et al., 2012), total number of spermatozoa per ejaculate (Bane, 1954), percent live sperm (Campbell et al., 1953), percent total abnormal sperm (Kedia, 2011) and percent intact acrosome (Watson, 1975), Cervical mucus penetration test (Kremer, 1965; Matouseket et al., 1989; Prasad et al., 1999) and Hypo-osmotic swelling test (Jeyendran et al., 1984) were carried out. The sample of neat semen was processed in Accucell Bovine Photometer (IMV technologies France), so as to pack 20 million sperms per 0.25 ml per straw


371

following the initial evaluation and finally diluted with a calculated quantity of Tris diluent (Rasbech, 1975). Filling and sealing of straws was done in integrated system-4 (IS-4, IMV technologies France) under laminar air flow cabinet. Then straws were transferred to the cold handling cabinet (IMV technologies, France) for equilibration at 4oC for 4 h and then to a programmable bio-freezer (IMV technologies, France) for 8 to 10 minutes. so as to reach the temperature to -140oC. The straws were then collected in the pre-cooled goblet and were immersed directly into the liquid nitrogen (-196oC) to ensure the proper freezing after equilibration under standard conditions (Graham et al., 1985).

The means of the seminal characteristics were calculated as per procedures outlined by Snedecor and Cochran (1994) and the data was analyzed statistically using standard procedure of ANOVA with the help of SPSS computer software.


Fresh seminal characteristicsSeminal characteristics of fresh semen of

six Murrah bulls during winter and heat stress are presented in Table 1.

VolumeThere was no significant difference in

ejaculate volume during winter period and heat stress. However between bulls, significant (P<0.05) variation was recorded during winter period only (Table 2). The seminal volume of Murrah bulls in present study is in close agreement with Bhavsar et al. (1986); Hussain et al. (1985); Hardin et al. (1982); Igboeli and Rakha (1971); Sardar et al. (2000) between season. Similar findings between seasons in Murrah bulls were observed by Tiwari

et al. (2011) but differed significantly (P<0.05) between bulls. Significant variance in ejaculate volume between bulls was also reported by Bhavsar et al. (1986) in Murrah bulls.

Sperm concentrationThere was no significant difference in sperm

concentration during winter period and heat stress. Between bulls, there was significant difference (P<0.05) in sperm concentration during heat stress. However, no significant difference between bulls was observed during winter period (Table 2). Similar observations in sperm concentration in semen of Murrah bulls were reported by Tomar et al. (1966). Sperm concentration of present study is in close agreement between Murrah bulls as well as seasons (Tiwari et al., 2011).

Total number of spermatozoa per ejaculateThere was no significant difference in

total spermatozoa per ejaculate between winter period and heat stress. Significant (P<0.05) bull to bull variation was observed during winter, whereas during heat stress, there was no significant difference between bulls (Table 2). Tiwari et al. (2011) reported comparable seasonal variation in total number of spermatozoa per ejaculate in Murrah bulls. However, the finding of Mishra et al. (2012) revealed that season had significant (P<0.05) effect on sperm out per ejaculate in Jersey bulls and recorded highest during winter and lowest during summer seasons, respectively.

Mass motilityThe overall mass motility at winter period

was found to be significantly (P<0.05) higher than heat stress. However, no significant bull to bull variation was observed during winter period and heat stress. The findings in the present study


372

were comparable to that reported by Dugwekar (1968) and Tuli (1984) in Murrah buffalo bulls. The variation in result may be attributed due to subjective assessment of nature of mass motility.

Initial progressive motilityThe average initial progressive motility

did not differ significantly between winter period and heat stress but differed significantly (P<0.05) between bulls (Table 2) during winter and heat stress. The findings of the present study were contrary to that reported by Tiwari et al. (2011) with significant (P<0.05) difference between season. A range of comparable individual spermatozoal motility (60.00 to 83.60±0.83%) in Murrah buffalo was reported by Nath et al. (1991); Tuli (1984); Singh et al. (1983); Gopalkrishna and Rao (1978); Eusebio (1977); Bhosrekar and Nagarcenkar (1973); Dugwekar (1968); Pangawkar (1968). The variation in the present initial motility might be due to attributed factor like degree of sexual

excitement, method of semen collection and frequency of semen collection (Tomar, 1986).

Percent live spermThere was no significant difference in live

sperm percent between winter period and heat stress as well as between bulls (Table 2). Percent live sperm between Murrah bulls is in close agreement with the findings of Sahu (1996); Mandal et al. (2000) was observed decrease in live sperm percent in high temperature in Murrah buffalo bulls.

Sperm abnormalitiesThere was significant difference (P<0.01)

in mean sperm abnormalities between winter period and heat stress. However, bull to bull significant (P<0.05) variation of sperm abnormalities was also observed during winter and heat stress period (Table 2). Rao et al. (1996) were also reported comparable percent sperm abnormalities in Ongole bulls. Elevated environmental temperature during

Table 1. Seminal characteristics of fresh semen of Murrah bulls during winter period (15-25oC) and heat stress (42-48oC).

Semen ParametersOverall mean during period

Winter period Heat stressEjaculate volume (ml) 3.95±0.33 3.43±0.21Sperm concentration (Million/ml) 1324.80±67.84 1133.11±74.27Total number of sperm per ejaculate (Million)

6575.74±1306.37 4785.31±619.18

Mass motility (0-5 scale) 3.63±0.09 3.33±0.10*Initial progressive motility (%) 72.50±0.89 73.33±0.87Live sperm (%) 85.82±0.77 84.12±0.94Abnormal sperm (%) 8.71±0.47 12.25±0.72**Intact acrosome (%) 83.54±0.30 82.92±0.32CMPT (mm) 21.10±0.32 24.31±0.48**HOST (%) 55.88±2.65 52.08±0.34**

*Differed significantly (P<0.05); **Differed significantly (P<0.01).


373

Table 2. Bullwise seminal characteristics of fresh semen of Murrah bulls during winter period (15-25oC) and heat stress (42-48oC).

Parameters SeasonBull No 44816

Bull No 116627

Bull No 114161

Bull No 70501

Bull No 43712

Bull No 81027

Ejaculate volume (ml)

Winter period

3.20bcd

±0.28

2.95cd

±0.44

4.61abc±

0.78

5.51a

±1.00

5.28ab

±1.03

2.18d

±0.46

Heat stress3.47

±0.34

3.17±

0.47

2.90±

0.47

3.57±

0.72

4.22±

0.71

3.29±

0.26

Sperm concentration (Million/ml)

Winter period

1168.13±

186.21

1570.00±

132.88

1318.80±

144.97

1182.91±

91.16

1236.23±

193.08

1471.99±

215.83

Heat stress1198.47ab

±173.4

823.17b

±119.86

1085.85ab

±112.98

1071.18ab

±114.48

1422.32a

±292.46

1197.66ab

±194.40

Total no. of sperm/ejaculate

(Million)

Winter period

3735.36b

±739.85

4753.00b

±877.11

6653.56ab

±1527.03

6370.64b

±1582.36

14525.05a

±7039.96

3416.07b±

852.10

Heat stress4567.81

±1121.10

2868.35±

670.70

5810.50±

2301.66

4111.48±

1051.45

6900.46±

2242.84

4426.08±

835.53

Mass Activity (0-5 scale)

Winter period

3.50±

0.19

3.88±

0.23

3.88±

0.23

3.63±

0.18

3.50±

0.27

3.38±

0.18

Heat stress3.37

±0.182

3.12±

0.22

3.37±

0.18

3.12±

0.48

3.62±

0.18

3.37±

0.18

Initial Progressive Motility (%)

Winter period

70.63ab

±1.75

74.38a

±1.13

75.00a

±1.34

75.00a

±1.34

72.50ab

±1.34

67.50b

±4.01

Heat stress70.62b

±3.71

73.12b

±0.91

73.12ab

±2.48

77.50a

±0.94

74.37ab

±0.62

71.25ab

±2.05

Live Sperm (%)

Winter period

84.95±

2.38

85.59±

2.82

86.25±

1.15

85.25±

1.78

88.00±

1.31

84.88±

1.68

Heat stress81.25

±4.28

85.62±

1.08

86.87±

1.80

87.37±

1.61

80.12±

1.07

83.87±

1.52


374

summer may be one of possible reason to impair the testicular functions which leads to decreased sperm production with abnormal morphology.

Percent intact acrosomeThere was no significant difference in

acrosomal integrity during winter period and heat stress. Acrosomal integrity differed significantly (P<0.05) between bulls during heat stress whereas no significant difference between bulls during winter period (Table 2). The findings of present

study was corresponding to the study undertaken by McNitt and First (1970); Heitman and Cockrell (1984); Larsson and Einarsson (1984); Colenbrander and Kemp (1990). This may be due to the disturbed spermatogenesis caused by high ambient temperature.

Cervical mucus penetration test (CMPT)Cervical mucus penetration distance

differed significantly (P<0.01) between winter period and heat stress. Cervical mucus penetration

Table 2. Bullwise seminal characteristics of fresh semen of Murrah bulls during winter period (15-25oC) and heat stress (42-48oC). (Cont.)

Parameters SeasonBull No 44816

Bull No 116627

Bull No 114161

Bull No 70501

Bull No 43712

Bull No 81027

Abnormal

Sperm (%)

Winter

period

10.63ab

±0.82

6.50c

±1.25

6.63c

±0.50

12.00a

±0.65

7.63c

±0.50

8.88bc

±1.42

Heat stress18.25a

±1.55

11.00bc

±2.01

14.20b

±1.22

9.50c

±0.86

11.06bc

±1.37

9.50c

±1.42

Intact acrosome

(%)

Winter

period

83.00±

0.65

83.75±

0.49

84.00±

0.65

82.75±

0.65

84.25±

0.75

83.50±

1.13

Heat stress83.87a

±0.95

82.12ab

±0.54

83.62ab

±0.67

81.25b

±0.49

83.00ab

±0.90

83.62ab

±0.82

CMPT (mm)

Winter

period

23.00a

±1.02

20.63ab

±0.75

20.25b

±0.49

20.88ab

±0.64

20.50b

±0.78

21.38ab

±0.80

Heat stress25.87a

±1.12

25.25a

±0.99

25.75a

±1.12

25.12a

±0.97

22.00b

±1.16

21.87b

±0.92

HOST (%)

Winter

period69.00a

±2.53

59.67b

±4.46

59.50ab

±2.17

58.80ab

±0.93

61.60ab

±1.41

58.60b

±2.31

Heat stress53.78a

±0.83

52.31abc

±0.60

51.75abc

±0.56

51.00bc

±0.65

50.25c

±0.88

53.375ab

±0.82

Values with different superscript (a,b,c, d) in same row differ significantly (P<0.05).


375

distance differed significantly (P<0.05) between bulls during winter period as well as during heat stress (Table 2). In vitro cervical mucus penetration test it was showed that cervical mucus (CM) acted as a barrier which eliminates the spermatozoa with abnormal morphology and allows only the spermatozoa with normal morphology to pass and the spermatozoa which cannot penetrate in to the mucus lack the ability to fertilize the ovum (Robayo et al., 2008). Only limited information is available on the effective usage of this method for prediction of Murrah bull fertility (Dev et al., 1996).

Hypo-osmotic swelling test (HOST)There was significant difference in HOS

positive sperms between winter period and heat stress (P<0.01) as well as between bulls (P<0.05). Observations of present study were similar to Mandal et al. (2000); McNitt and First (1970); Heitman and Cockrell (1984); Larsson and Einarsson (1984) and Colenbrander and Kemp (1990).

The present study indicates that heat stress result in significant decrease in mass motility (P<0.05), increase in abnormal spermatozoa percent (P<0.01). The significant effect of season is observed between bulls for semen volume, sperm concentration, total number of sperms per ejaculate, initial motility, abnormal sperm percent, cervical mucus penetration and hypoosmotic swelling of spermatozoa.

ACKNOWlEDGEMENTS

Authors are highly thankful to Dean, College of Veterinary Science and Animal Husbandry, Anjora, Durg and Director Veterinary Services (C.G.) for permitting to carry out the

research project at Central Semen Station, Anjora, Durg and providing necessary facilities.

REFERENCES

Ahmad, N. 1994. Clinical and experimental studies of reproductive functions in the ram and male goat with special reference to the use of diagnostic ultrasound. Ph.D. Thesis, Department of Large Animal Medicine, and Surgery, Royal Veterinary College, University of London, London, England.

Ahmad, Z., M. Anzar, M. Shahab, N. Ahmad and S.M.H. Andrabi. 2003. Sephadex and sephadex ion-exchange filtration improves the quality and freezability of low-grade buffalo semen ejaculates. Theriogenology, 59: 1189-1202.

Andrabi, S.M.H., N. Ahmad, A. Abbas and M. Anzar. 2001. Effect of two different antibiotic combinations on fertility of frozen buffalo and Sahiwal bull semen. Pak. Vet. J., 21: 166-169.

Bane, A. 1954. Studies on monozygous cattle twins. XV. Sexual functions of bulls in relation to hereditary, rearing intensity and somatic conditions. Acta Agric. Scand., 2: 95-208.

Bhavsar, B.K., K.S. Patil, V.K. Kerur and S.B. Kodagali. 1986. Seminal characters, freezability and fertility in Mehsana and Murrah buffalo bulls. Indian J. Anim. Reprod., 7: 7-14.

Bhosrekar, M.R. and R. Nagarcenkar. 1973. Investigation on semen quality and reproductive behavior of buffalo bulls. Animal Breeding Abstracts, 41: 3894.

Campbell, R.G., J.L. Hancock and L. Rothschild.


376

1953. Counting live and dead bull spermatozoa. J. Exp. Biol., 30: 44-49.

Colenbrander, B. and B. Kemp. 1990. Factors influencing semen quality in pigs. J. Reprod. Fertil., 40: 105-115.

Dugwekar, Y.G. 1968. Studies on preservation of Murrah buffalo semen at room temperature. M.V.Sc. Thesis, Jawaharlal Nehru Krishi Vishwavidyalaya, Jabalpur, India.

Dev, S., G.R. Pangawkar, R.K. Sharma and J.S. Matharoo. 1996. Sperm penetration and it’s relation to semen quality of buffalo bulls. Indian J. Anim. Sci., 66: 713-715.

Eusebio, A.N. 1975. Breeding management and feeding practices of buffaloes in the Philippines. The Asiatic Water Buffalo, p. 257-280.

Graham, E.F., B. Crabo and K.L. Gand Brown. 1985. Effect of some zwitter ion buffers on freezing and storage of spermatozoa of bull. Indian J. Dairy Sci., 55: 372-378.

Gopalakrishna, T. and A.R. Rao. 1978. Semen characteristics in Murrah buffalo bulls. Indian Vet. J., 55: 216-221.

Hardin, D.R., P.J. Chenoweth, T.H. Friend and R.D. Randel. 1982. Seasonal variation in seminal parameters and libido of Angus and Brahman bulls. Anim. Breed. Abstr., 51: 679-679.

Heitman, H. and J.R. Cockrell. 1984. Cycling ambient temperature effect on boar semen. Anim. Prod., 38: 129-132.

Hussain, S.S., A. Ahmed, K.G. Mostafa and A.K.F.H. Bhuiyan. 1985. Effect of season on semen characteristics of crossbred bulls under field conditions. Bangladesh J. Anim. Sci., 14: 18-22.

Igboeli, G. and Rakha. 1971. Seasonal changes in ejaculate characteristics of Angoni (short

horn Zebu) bulls. National council for scientific research, Chilanga, Zambia. J. Anim. Sci., 33: 651-654.

Jeyendran, R.S., H.H. Van der Ven, M. Perez-Pelaez, B.G. Grabo and L.Z.D. Zaneveld. 1984. Development of an assay to assess the functional integrity of the human sperm membrane and its relationship to other semen characteristics. J. Reprod. Fertil., 70: 219-228.

Kakar, S.S. and S.R. Anand. 1981. Changes in adenosine 5’-triphosphate, adenylate energy charge and adenosine 3’5’-cyclic monophosphate during the freezing of buffalo semen. J. Reprod. Fertil., 62(2): 543-548.

Kedia, N.K. 2011. Studies on characteristics and freezability of tharparkar bull semen. M.V.Sc. Thesis, Indira Gandhi Krishi Vishwa Vidyalaya, Raipur, India.

Kremer, J.A. 1965. A simple sperm penetration test. Int. J. Fertil. Steril., 10: 138-143.

Kumaresan, A., M.R. Ansari and G. Abhishek. 2005. Modulation of post-thaw sperm functions with oviductal proteins in buffaloes. Anim. Reprod. Sci., 90: 73-84.

Larsson, K. and S. Einarsson. 1984. Seminal changes in boars after heat stress. Acta. Vet. Scand., 25: 57-66.

Mandal, D.K., P.K. Nagpaul and A.K. Gupta. 2000. Seasonal variation in seminal attributes and sexual behaviour of Murrah buffalo bulls. Indian J. Dairy Sci., 53: 278-283.

Matousek, J., J. Riha, V. Srsen, L. Veselsky and F. Louda. 1989. Penetration of cervical mucus and other body fluids by bull sperm in capillary tubes. Anim. Reprod. Sci., 18: 161-166.

McNitt, J.L. and N.L. First. 1970. Effects of 72-


377

hour heat stress on semen quality in boars. Int. J. Biometeorol., 14(3): 373-380.

Mishra, G.K., R. Tiwari, S.U. Rehman, K.S. Rathore, R.B. Singh, S.K. Saxena and M.U. Siddiqui. 2012. Effect of Seasons on Semen Production Performance of Jersey Bulls. Indian J. Dairy Sci., 65(6): 497-500.

Muer, S.K., S.B. Roy, G. Mohan and R.L. Dhoble. 1988. Cryogenic changes in seminal protein of cattle and buffalo. Theriogenology, 30: 1005-1010.

Nath, R., S.S. Tripathi, V.B. Saxena and R.D. Tripathi. 1991. Tris diluent and freezability of buffalo semen. Indian Vet. J., 68(2): 135-138.

Pangawkar, G.R. 1968. Studies on the relative efficacy of various dilutors for preservation of buffalo bull semen at 3oC to 7oC. M.V.Sc. Thesis, Jawaharlal Nehru Krishi Vishwavidyalaya, Jabalpur, India.

Prasad, J.K., S. Kumar, G. Mohan, U. Shankar and S.K. Agrawal. 1999. Hypo osmotic swelling Test and its response in fresh and freeze thawed semen. Indian J. Anim. Sci., 69(10): 766-769.

Qureshi, M.S., H.A. Samad, G. Habib, R.H. Usmani and M.M. Siddiqui. 1999. Study on factors leading to seasonality of reproduction in dairy buffaloes. Asian Austral. J. Anim., 12: 1019-1024.

Rao, A.V.N., O. Sreemannarayana and C.V. Rao. 1996. Studies on sex-behaviour and seminal traits in Ongale, Jersey, Jersey x Ongole and Murrah bulls. Indian Vet. J., 73: 284-287.

Rasbech, N.C. 1975. Tris egg yolk citric acid glycerol as extender for bovine semen. Manual for Indo-Danish Training Course, DANIDA. Institute for Animal Reproduction, Copenhagen, Denmark.

Raizada, B.C., A. Sattar and M.D. Pandey. 1990. A comparative study of freezing buffalo semen in two dilutors, p. 66-74. In Acharya, R.M., R.R. Lokeshwar and A.T. Kumar (eds.) In Proceedings of 2nd World Buffalo Cong, New Delhi, India.

Robayo, I., V. Montenegro, C. Valds and J.F. Cox. 2008. CASA assessment of kinematic parameters of ram spermatozoa and their relationship to migration efficiency in ruminant cervical mucus. Reprod. Domest. Anim., 43: 393-399.

Roy, A., B.P. Sengupta and M.S. Mishra. 1962. Effect of varying environment on semen quality cardio-respiratory activity, milk products and female fertility of buffaloes. In Proceeding UNESCO Conference. Indian Symposium on Environmental Physiology and Psychology.

Saacke, R.G. 1984. Semen quality: importance of and influencing factors, p. 30-36. In Proceedings of 10th NAAB Technical Conference on Artificial Insemination in Reproduction Milwaukee, WI, USA. National Association of Animal Breeders, Columbia, USA.

Sahu, S.B. 1996. Grading Murrah bulls of the state frozen semen bank, Bhopal, on the basis of sexual behaviour seminal characteristics and cryopreservability. M.V.Sc. Thesis, Jawaharlal Nehru Krishi Vishwavidyalaya, Jabalpur, India.

Salisbury, G.W., N.L. VanDemark and J.R. Lodge. 1978. Physiology of Reproduction and Artificial Insemination of Cattle, 2nd ed. W.H. Freeman and Co, San Francisco. 788p.

Sardar, M.J.U. 2007. Environmant related variation in the semen characteristics of bulls used for Artificial Insemination (AI) programme in


378

Bangladesh. University Journal of Zoology, Rajshahi University, 26: 81-88.

Sardar, M.J.U., O.I. Joarder, M.S. Ali and M.H. Imam. 2000. Influence of genetic group, season and age on semen characteristics of breeding bulls. Bangladesh Journal of Genetics and Biotechnology, 1: 51-57.

Senatore, E.M., S. Verberckmoes, M. Pascale and G.A. Presicce. 2004. A deep utero-tubal semen deposition in Mediterranean Italian buffaloes using a new artificial insemination device. Reprod. Fert. Develop., 16(2): 133-133.

Sengupta, B.P., M.S. Mishra and A. Roy. 1963. Climatic environment and reproductive behaviour of buffaloes. Indian J. Dairy Sci., 16: 150.

Singh, M. and H.C. Pant. 2000. Effect of post-thaw incubation on semen quality of buffalo bulls-comparison with cattle. Buffalo Bull., 19: 51-54.

Singh, M.P., S.N. Sinha and B. Singh. 1983. Some semen characteristics of Murrah buffalo bulls. Indian J. Anim. Health., 22: 35-37.

Singh, S.P., R.K. Pandit and H.B.S. Bhadoria. 2000. Sexual behaviour and seminal characteristics in Jersey, Sahiwal and halfbred bulls. Indian J. Anim. Sci., 70(3): 279-280.

Snedecor, G.W. and W.G. Cochran. 1994. Statistical Methods, 8th ed. The Iowa State University Press, Iowa, USA.

Soderquist, L., L. Janson, M. Haard and S. Einarsson. 1996. Influence of season, age and breed and some other factors on the variation in sperm morphological abnormalities in Swedish dairy A I bulls. Anim. Reprod. Sci., 44: 91-98.

Tiwari, R., G.K. Mishra, M.K. Shukla, R.B. Singh,

S.K. Saxena and M.U. Siddiqui. 2011. Seasonal variation in semen production of murrah buffalo bulls. Indian J. Anim. Reprod., 32(2): 52-54.

Tomar, N.S. 1986. Artificial Insemination and Reproduction of Cattle and Buffaloes, 3rd ed. Saroj Prakashan Allahabad.

Tomar, N.S., B.S. Mishra and C.B. Johari. 1966. Seasonal variation in reaction time and semen production and predication of semen attributes on initial motility of spermatozoa in Hariana and Murrah bulls. Indian J. Dairy Sci., 19: 87-93.

Tuli, R.K. 1984. Seasonal variation in seminal characteristics of Murrah buffalo bulls. Livestock Advisor, 9: 37.

Watson, P.F. 1975. Use of Giemsa stain to detect changes in the acrosome of frozen ram spermatozoa. Vet. Record., 97: 12-15.


379

ABSTRACT

Neospora caninum is an intracellular parasite which causes abortion in buffalo worldwide. The aim of this study was to determine the seroprevalence of Neospora caninum in buffalo in the province of east-Azerbaijan in north-west Iran. Blood samples were collected from 236 buffalo in the province of east-Azerbaijan for determining the seroprevalence of Neospora caninum. A total of 236 serum samples were tested for anti-neospora antibodies.

Serum samples were analyzed for antibodies against N. caninum antigen using a commercial N. caninum ISCOM ELISA kit. Antibodies to N. caninum were found in 42 of the 236 (17.7%) sera based on ELISA test results. This study is the first report of Neospora infection in this area. With regard to seropositivity, no significant difference was observed regarding origin, sex and age (P>0.05).

Keywords: Neospora caninum, buffaloes, Bubalus bubalis, ELISA, Tabriz city, Iran

INTRODUCTION

Neospora caninum (Apicomplexa) is a worldwide-distributed pathogen which causes abortions in buffalo cows and cattle cows leading to economic losses in the cattle industry (DUBEY, 1999a).The parasite was first detected in 1984 in dogs with myositis, lameness and encephalitis and named as N. caninum (Bjerkas et al., 1984; Dubey, 1999b). Neospora caninum has worldwide distribution and has been known as one of the most commonly diagnosed causes of bovine abortion. The parasite was subsequently identified in aborted bovine foetuses (Barr et al., 1990; Thilsted and Dubey, 1989) and is now recognized as a significant cause of economic loss in dairy and beef cattle herds worldwide, due primarily to abortion and reduced reproductive efficiency (Barling et al., 2000; Dubey, 1999b, Waldner et al., 1998). The economic impact of Neospora-induced abortions depends on direct costs and the value of fetuses lost. Indirect costs include those associated with establishing the diagnosis, rebreeding cows that aborted and possible loss of milk yield. As clinical diagnosis is difficult, serological tests are necessary for an exact diagnosis (Dubey et al.,

Original Article

ASSESSMENT OF NEOSPORA CANINUM SEROPREVALENCE IN BUFFALO IN TABRIZ CITY, NORTH-WEST OF IRAN

Garedaghi Yagoob1, Firouzivand Yaghuob2 and Heikal Abadi Mohammad3

1Department of Veterinary Parasitology, Tabriz Branch, Islamic Azad University, Tabriz, Iran, E-mail: [email protected] of Veterinary Medicine, Malekan branch, Islamic Azad University, Malekan, Iran3Department of Veterinary Medicine, Tabriz Branch, Islamic Azad University, Tabriz, Iran


380

1988). Several serological tests, including the enzyme-linked immunosorbent assay (ELISA), the indirect fluorescent antibody technique (IFAT), the direct agglutination test (DAT), and immunoblots (IB) can be used to detect anti Neospora caninum antibodies (Bjorkman and Uggla, 1999).

N. caninum is transmitted vertically from an infected cow to her foetus during pregnancy (Anderson et al., 1997). Dogs have been shown to excrete N. caninum oocysts (Demarez et al., 1999; Lindsay et al., 1999; Mcallister et al., 1998).

Although neosporosis has been reported from many parts of the world (Dubey and Lindsay, 1996; Dubey et al., 2005), there is only one published report available on its occurrence in Iran, Mashhad; that indicated that 123 (15.18%) of 810 cattle were seropositive by indirect fluorescent antibody test in 4 herds (Sadrebazzaz et al., 2004). So this study was performed to determine the prevalence of antibodies to N. caninum in cattle in the province of east-Azerbaijan in north-west Iran.

MATERIALS AND METHODS

Serum samples. Serum samples were collected from a total of 236 buffalo, the animals being randomly selected. Blood samples were taken using disposable needles. The owners were questioned about animal management and age, and the information obtained was recorded. This study was performed between September 2013 and October 2014. All samples were immediately transported to the diagnostic laboratory. Serum was removed after centrifugation at 1000×g for 10 minutes. All sera were divided equally into two microtubes and stored at -20oC until laboratory testing.

ELISA. Serum samples were stored at -20oC

until tested. They were analyzed for antibodies to N. caninum using ELISA. Anti-Neospora antibodies were detected using a commercially available N. caninum iscom ELISA kit (Svanova Biotech AB, Sweden).

The kit was used according to the manufacturer’s instructions. Briefly, 100 microlitres of pre-diluted serum sample added as first antibody and the plate incubated at 37oC on shaker for 1 h. The wells were washed 3 times with PBS Tween Buffer and 100 microlitres of HRP conjugate added to each well and incubated for 1 h at 37oC. The plate was washed again and 100 microlitres of substrate solution added and incubated at room temperature for 10 minutes. Then 50 microlitres of stop solution were added to stop the reaction and the plates were read in an ELISA microplate reader (Anthos 2020, Austria) at a wavelength of 450 nm. The optical density (OD) of the ELISA was read on an automatic plate reader and the Percent Positivity values (PP) of the test samples were calculated by the following formula:

PP = Mean OD value (sample or Negative Control) × 100) Mean OD value Positive Control

The results were expressed as the percent positivity (PP) of the high positive control sera. The manufacturer’s current recommendations for the interpretation of the test are that a test result of below 20 PP indicates a negative result, and a test result of above or equal to 20 PP indicates a positive result.

Statistical analysis. A chi-square test of independence was used to analyze associations between infection by N. caninum and other factors studied in the present study. For statistical analysis, the SPSS 12 computer program was used and P<0.05 was


381

considered to be significant.

RESULTS

Results obtained from the sera using ELISA are given in Table 1 and Table 2. The results were expressed as the percent positivity (PP) of the high positive control sera. Antibodies to N. caninum were found in 42 of the 236 (17.7%) sera based on ELISA results. Among the 80 sera in the Buffalo <18 month age group, 9 (11.2%) were seropositive, whereas among the 156 sera above 18 months old, 33 (21.1%) were seropositive (Table 1).

Among the 74 bulls, 8 (10.8%) were seropositive whereas of the 162 buffalo, 34 (20.9%)were seropositive (Table 2). There was no statistically significant relationship between seroprevalence of sex and age groups (P>0.05).

DISCUSSION

N. caninum is considered to be one of the major causes of abortion in cattle and buffalo worldwide (Barling et al., 2000; Dubey, 1999a). In contrast to vertical transmission, horizontal

transmission involves a two-host life cycle whereby the cow is infected from the ingestion of coccidial oocyst stages shed by the definitive host. Dogs are known to be a definitive host and produce oocysts in their faeces after ingesting infected meat (Mcallister et al., 1998; Gondim et al., 2004).

In this study we decided to obtain information on seroprevalence of N. caninum antibodies in buffalo in north-west Iran (east-Azerbaijan). Several serologic tests including ELISA, IFAT, and DAT can be used to detect N. caninum. The capability of a test to distinguish infected from non infected individuals is often described by its diagnostic sensitivity and specificity. All the serological tests mentioned above are valuable for identifying sera with moderate to high levels of anti-neospora antibodies. At present, the 2 main types of serological tests most commonly used for the diagnosis of Neospora infection are IFAT and ELISA.

Characterization studies have shown that N. caninum NC-1 iscoms contain membraneantigens from both the cell surface and from intracellular compartments. Iscom ELISA for the detection of Neospora caninum antibodies in blood serum and milk was developed to decrease cross-reactivity (Bjorkman et al., 1997; Bjorkman and

Table 1. Seroprevalence of Neospora caninum in relation to age.

Age The number of animals tested No. of positives Seroprevalence (%)<18 months 80 9 11.2≥18 months 156 33 21.1

Table 2. Comparison of Neospora caninum antibodies in relation to sex.

Sex The number of animals tested No. of positives Seroprevalence (%)Bull 74 8 10.8Buffalo 162 34 20.9


382

Lunden, 1998; Frossling et al., 2003), therefore we used a commercial iscom ELISA kit (Svanova, Sweden) for diagnostics of bovine neospora-species antibodies in blood serum.

The sensitivity and specificity of this technique were high (Bjorkman and Uggla, 1999). This study showed that the seroprevalence of N. caninum infection is 17.7% in east-Azerbaijan’s cattle was higher than 15.18% which has been reported by Sadrebazzaz et al. (2004) in Mashhad, Iran. AKCA et al. (2005) reported that 8.2% of Simmental cows tested were positive in Kars province, Turkey. Sevgili et al. (2005) found antibodies to N. caninum in 23 of the 305 (7.5%) cow sera based on ELISA test results in the province of Sanliurfa, Turkey. With regard to seropositivity, no significant difference was observed in origin, animal breed, and age (P>0.05). The presence of antibodies against N. caninum in cows only indicate exposure to the parasite. In this study there was no significant difference in seroprevalence between the different age groups. Wouda et al. (1998) and Sadrebazzaz et al. (2004) reported for most herds that the seroprevalence levels were equal across all age groups. The relationship between age and seroprevalence in bovine neosporosis is speculative. Jensen et al. (1999) suggested that seroprevalence increases with age. In contrast, Sanderson et al. (2000) reported that cows below 3 years of age had higher CI-ELISA inhibition percentage values than cows above 6 years of age.

They also suggested that infected cows can infect fetuses, and if these calves have not been reinfected, antibody titers decline over time, resulting in an apparent decrease in seroprevalence with cow age. Due to the lack of information about the prevalence of infection in the definitive host, the dog, in Iran, it is not possible to know which method of transmission (horizontal or vertical)

is the main route of infection. However, further studies on the epidemiological evidence for a relationship between N. caninum infection in dogs and cattle and the relationship between abortion in cows and infection with N. caninum in Iran are required.

ACKNOWLEDGEMENTS

The authors wish to thanks the Islamic Azad university,Tabriz Branch, Tabriz, Iran for the financial supports, and all laboratory technicians for technical aids in this project.

CONFLICTS OF INTEREST

Authors declare that there is no any conflict of interest.

REFERENCES

Akca, A., H.I. Gokce, C.S. Guy, J.W. Mcgarry and D.J.L. Williams. 2005. Prevalence of antibodies to Neospora caninum in local and imported cattle breeds in the Kars province of Turkey. Res. Vet. Sci., 78: 123-126.

Anderson, M.L., J.P. Reynolds, J.D. Rowe, K.W. Sverlow, A.E. Packham, B.C. Barr and P.C. Conrad. 1997. Evidence of vertical transmission of Neospora sp. infection in dairy cattle. J. Am. Vet. Med. Assoc., 210: 1169-1172.

Barling, K.S., J.W. Mcneill, J.A. Thompson, J.C. Paschal, F.T. Mccollum, F. Craig and T.M. Adams. 2000. Association of serologic status for Neospora caninum with post weaning


383

weight gain and carcass measurements in beef calves. J. Am. Vet. Med. Assoc., 217: 1356-1360.

Barr, B.C., M.L. Anderson, P.C. Blanchard, B.M. Daft, H. Kinde and P.A. Conrad. 1990. Bovine fetal encephalitis and myocarditis associated with protozoal infections. Vet. Pathol., 27: 354-361.

Bjerkas, I., S.F. Mohn and J. Presthus. 1984. Unidentified cyst-forming sporozoon causing encephalomyelitis and myositis in dogs. Z. Parasitenkd., 70: 271-274.

Bjorkman, C. and A. Uggla. 1999. Serological diagnosis of Neospora caninum infection. Int. J. Parasitol., 29: 1531-1536.

Bjorkman, C. and A. Lunden. 1998. Application of iscom antigen preparations in ELISAs for diagnosis of Neospora and Toxoplasma infections. Int. J. Parasitol., 28: 187-193.

Bjorkman, C., O.J.M. Holmdahl and A. Uggla. 1997. An indirect enzyme-linked immunoassay (ELISA) for demonstration of antibodies to Neospora caninum in serum and milk of cattle. Vet. Parasitol., 68: 251-260.

Demarez, T., S. Liddell, J.P. Dubey, M.C. Jenkinsgas and L. Barre. 1999. Oral infection of calves with Neospora caninum oocysts from dogs: humoral and cellular immune responses. Int. J. Parasitol., 29: 1647-1657.

Dubey, J.P., A.L. Hattel, D.S. Lindsay and M.J. Topper. 2005. Neonatal Neospora caninum infections in dogs. Acta Parasitol., 50: 176-179.

Dubey, J.P. 1999a. Neosporosis in cattle: biology and economic impact. J. Am. Vet. Med. Assoc., 214: 1160-1163.

Dubey, J.P. 1999b. Recent advances in Neospora and neosporosis. Vet. Parasitol., 84: 349-367.

Dubey, J.P., J.L. Carpenter, A. Speer, M.L. Topper and A. Uggla. 1988. Newly recognised fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc., 192: 1269-1285.

Dubey, J.P. and D.S. Lindsay. 1996. A review of Neospora caninum and neosporosis. Vet. Parasitol., 67: 1-59.

Frossling, J., B. Bonnett, A. Lindberg and C. Bjorkman. 2003. Validation of a Neospora caninum iscom ELISA without a gold standard. Prevent. Vet. Med., 57: 141-153.

Gondim, L.F.P., M.M. Mcallister, N.E. Mateus-pinilla, W.C. Pitt, L.D. Mech and M.E. Nelson. 2004. Transmission of Neospora caninum between wild and domestic animals. J. Parasitol., 90: 1361-1365.

Jensen, A.M., C. Bjorkman, A.M. Kjeldsen, A. Wedderkopp, C. Willadsen, A. Uggla and P. Lind. 1999. Associations of Neospora caninum seropositivity with gestation number and pregnancy outcome in Danish dairy herds. Prev. Vet. Med., 40: 151-163.

Lindsay, D.S., J.P. Dubey and R.B. Duncan. 1999. Confirmation that the dog is a definitive host for Neospora caninum. Vet. Parasitol., 82: 327-333.

Mcallister, M.M., J.P. Dubey, D.S. Lindsay, W.R. Jolley, R.A. Wills and A.M. Mcguire. 1998. Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol., 28: 1473-1478.

Nourollahi Fard, S.R., M. Khalili and A. Aminzadeh. 2008. Prevalence of antibodies to Neospora caninum in cattle in Kerman province, south east Iran. Vet. Arhiv., 78: 253-259.

Sadrebazzaz, A., H. Haddadzadeh, K. Esmailnia, G. Habibi, M. Vojgani and R. Hashemifesharaki. 2004. Serological prevalence of Neospora caninum in healthy


384

and aborted dairy cattle in Mashhad, Iran. Vet. Parasitol., 124: 201-204.

Sanderson, M.W., J.M. Gay and T.V. Baszler. 2000. Neospora caninum seroprevalence and associated risk factors in beef cattle in the northwestern United States. Vet. Parasitol., 90: 15-24.

Sevgili, M. and M.G. Altas. 2005. Seroprevalence of Neospora caninum in cattle in the province of Sanliurfa. Turk. J. Vet. Anim. Sci., 29: 127-130.

Thilsted, J.P. and J.P. Dubey. 1989. Neosporosis-like abortions in a herd of dairy cattle. J. Vet. Diag. Invest., 1: 205-209.

Waldner, C.L., E.D. Janzen and C.S. Ribble. 1998. Determination of the association between Neospora caninum infection and reproductive performance in beef herds. J. Am. Vet. Med. Assoc., 213: 685-690.

Wouda, W., A.R. Moen and Y.H. Schukken. 1998. Abortion risk in progeny of cows after a Neospora caninum epidemic. Theriogenol., 49: 1311-1316.


385

Original Article

ABSTRACT

Haemorrhagic septicaemia in Indian buffaloes is mainly caused by Pasteurella multocida serotype B: 2. The present study was conducted to characterize the P. multocida serotype B: 2 isolates of buffalo origin by multilocus sequence typing (MLST) to identify the sequence types prevailing around Gujarat state in India. A total of seven field isolates collected from different regions across the state and a reference strain (P52) were used for this study. Seven housekeeping genes were specifically amplified by PCR; the gene sequences obtained were trimmed to specific length and allelic profiles were assigned to these seven loci. The assigned allelic profiles were 23, 37, 21, 17, 4, 2 and 17 for adk, est, pmi, zwf, mdh, gdh and pgi genes, respectively and all the isolates were grouped in one sequence type, sequence type 122 (ST122). eBURST analysis classified ST122 into group number 23 when group definition was 5 or more matches. But when group definition was 6 or more matches it was classified into group number 22 along with ST63. Phylogenetic and Splits Tree analysis showed that ST122 is closely related to ST63, ST127, ST162 and ST147 and all five of them were grouped in a cluster. From the study it was concluded that ST122 may be the predominant sequence type in buffaloes of Gujarat state.

Keywords: buffaloes, Bubalus bubalis, Pasteurella multocida, multilocus sequence typing, Gujarat, sequence type, allelic profile

INTRODUCTION

In epidemiological studies involving Pasteurella species, the differentiation of strains of the same species has been done by serotyping, bacteriophage typing, determination of antibiogram, biotyping, plasmid DNA analysis, and whole-cell protein analysis. But many of these conventional typing relies on phenotypic traits which are inconsistently expressed. Also, the sensitivity level is inadequate to differentiate strains accurately (Snipes et al., 1989).

The limitations of traditional phenotypic procedures can be overcome by genotypic methods of bacterial identification. Highly sensitive and reproducible techniques that have proved its value for epidemiologic studies are restriction endonuclease analysis (REA) of whole-cell DNA, ribotyping, Polymerase chain reaction (PCR) based typing techniques like REP-PCR, ERIC-PCR, Amplified fragment length polymorphism (AFLP), Multilocus enzyme electrophoresis (MLEE), Multilocus sequence typing (MLST) etc. (Snipes et al., 1989; Savelkoul et al., 1999; Townsend et

MULTILOCUS SEQUENCE TYPING OF P. MULTOCIDA ISOLATES OF BUFFALO ORIGIN FROM GUJARAT STATE OF INDIA

V. Aiswarya1,*, Yogesh A. Chatur1, Bharat B. Bhanderi2, Rafiyuddin A. Mathakiya2 and Ashish Roy2

1Department of Veterinary Public Health, *E-mail: [email protected] of Veterinary Microbiology, College of Veterinary Science and Animal Husbandry, Anand Agricultural University, Anand, Gujarat, India



386

al., 2001; Blackall and Miflin, 2000).Multilocus sequence typing (MLST), a

molecular typing method for characterizing the microbial isolates, is considered as a gold standard test for global epidemiology (Maiden et al., 1998; Enright and Spratt, 1999). MLST takes advantage of the speed and simplicity of automated DNA sequencing and has many important advantages over the other methods that are used for global epidemiology (Enright and Spratt, 1999).

Apart from playing a major role in diagnosing pathogens, MLST has proven to be a high resolution genetic approach that provides data amenable to sophisticated phylogenetic and population genetic analysis (Perez-Losada et al., 2013). The method has high discriminatory power and can be applied to all isolates of any species for which there is sufficient knowledge of relevant gene loci to allow DNA sequencing (Spratt, 1999). It is possible to compare typing results from laboratory to laboratory and use a centralized Web-based databank (Feil, 2004; Enright and Spratt, 1998).With the aid of MLST databases one can identify and compare allele sequence, identify the allele profile and also match and compare the isolates (Perez-Losada et al., 2013).


Bacterial strainsSeven P. multocida strains isolated from

buffalo affected with haemorrhagic septicaemia and a vaccine strain P52 was used for the present study. The field isolates had been isolated and capsular typing was performed as per the method of Townsend et al. (2001) at the Department of Microbiology, College of Veterinary Science and Animal Husbandry, Anand. The details of

the isolates used are furnished in Table 1. The reference vaccine strain P52 was procured from Animal Vaccine Institute, Gandhinagar.

DNA ExtractionThe genomic DNA of P. multocida

isolates was extracted according to Antony et al. (2006) with minor modifications. A pure colony of P. multocida was inoculated into 5 ml of BHI broth and incubated at 37ºC for 18 h 1.5 ml of this broth culture was transferred into an Eppendorf tube and it was centrifuged at 3000 x g for 10 minutes. The pellet was washed twice in phosphate buffered saline and the final pellet was resuspended in 100 µl of triple distilled water. Quality and quantity of DNA was calculated by using NanoDrop 1000 spectrophotometer at 260 and 280 nm with distilled water as reference. The pellet suspended in 100 µl triple distilled water was boiled for 10 minutes and immediately chilled on ice for 30 minute. The sample was then thawed and centrifuged at 3000 x g for 5 minutes. The supernatant was stored at -20ºC for further use as template DNA.

Confirmation of P. multocidaThe isolates were reconfirmed as P.

multocida by PM-PCR (Townsend et al., 1998).

Multilocus sequence typingAll the isolates were subjected to MLST

scheme developed by Subaaharan et al. (2010) for P. multocida. PCR amplification and sequencing was carried out for seven housekeeping genes using primers and protocols available at RIRDC MLST Database (http://pubmlst.org/pmultocida_rirdc/) of PUBMLST developed by Jolley et al. (2004) and sited at University of Oxford. Genomic DNA from seven buffalo isolates and one vaccine strain of P. multocida was used as the template for


387

PCR assay. Primer sequences used for detection of seven housekeeping genes are given in Table 2.

Forward and reverse sequences of each representative sample of each gene locus were assembled against most closely related reference sequence of respective gene by using SeqScape (V2.5) software, and total length sequence was obtained.

The obtained sequences of genes were trimmed to the length of 466, 535, 602, 500, 521, 530 and 560 bp for adk, est, pmi, zwf, mdh, gdh and pgi genes, respectively as described in the Rural Industries Research and Development Corporation (RIRDC) MLST scheme for P. multocida. The sequence of each locus was checked in RIRDC MLST Database website for determination of the allele and sequence type of the isolates.

The sequence type was analysed by eBURST v3 software analysis. Concatenated sequences of ST122 and other related sequence types were downloaded from RIRDC MLST database. Phylogenetic tree analysis and split decomposition analysis were carried out for comparison of ST122 with these sequence types. Details of the sequence types used for phylogenetic analysis are given in Table 3. The phylogenetic organization of aligned concatenated sequences of various STs were analysed by neighbour-joining method available in MEGA programme. For split decomposition analysis using Splitstree V4 programme, allelic profile data were required.


On PM-PCR, All the isolates showed an amplified product size of ~460bp (Figure 1). PCR amplification of seven housekeeping genes revealed amplified products of ~570, 620, 641,

702, 739, 784 and 808 bp for the genes adk, mdh, est, gdh, pmi, pgi and zwf, respectively as analysed by agarose gel electrophoresis (Figure 2 to Figure 8).

The sequences of seven housekeeping genes obtained from all the seven isolates were 100% similar. The gene sequences were then trimmed to the length of 466, 535, 602, 500, 521, 530 and 560 bp for adk, est, pmi, zwf, mdh, gdh and pgi genes, respectively as described in the Rural Industries Research and Development Corporation (RIRDC) MLST scheme for P. multocida. The allelic profiles assigned to all the isolates at the seven loci were 23, 37, 21, 17, 4, 2 and 17 for adk, est, pmi, zwf, mdh, gdh and pgi genes, respectively and all the isolates and the vaccine strain were grouped in sequence type 122 (Table 4).

All the sequence types of P. multocida available in the RIRDC MLST database were subjected to eBURST analysis. In the database, as on 5th May 2015, 749 isolates belonging to 286 sequence types were available. These 286 STs belonged to 23 clonal complexes with 152 being unassigned. eBURST v3 divided them into groups according to their allelic profiles. When sequences were grouped based on sharing of five or more alleles, all the 286 sequence types could be clustered into 40 groups and 57 singletons. ST122 was placed in group 23 along with ST63, ST127, ST 147 and ST 162 which are referred to as H.S. clonal complex (Table 5). When group was defined for sharing of six or more alleles, the ST122 was placed in group 22 along with ST 63 (Table 6).

The phylogenetic analysis by neighbour-joining method revealed that ST122 formed a cluster along with ST63, ST127, ST162 and ST147 (Figure 8) which are also HS related sequence types and all five of them collectively referred to as HS clonal complex (Petersen et al., 2014). Split


388

decomposition analysis revealed a network-like tree structure (Figure 9). Parallelograms suggest the evidence of recombination. In both split tree and phylogenetic tree, HS clonal complex formed a separate cluster. The percentage similarities of ST122 with other sequence types are given in Table 7.

Subaaharan et al. (2010) had developed an MLST scheme for avian strains of P. multocida. They recognized 39 sequence types (STs) among 63 Australian poultry isolates and three reference strains of P. multocida. Further MLST based investigations included P. multocida isolated from cattle, sheep, goats and pigs (Hotchkiss et al., 2011;

Pors et al., 2011; Mir et al., 2011; Cardoso-Toset et al., 2013; Moustafa et al., 2013 and Sarangi et al., 2014). Hotchkiss et al. (2011) assigned 62 STs to the 195 P. multocida isolates used in their study. They found that majority of the HS isolates belong to the ST122 and it included isolates from cattle, buffalo, elephant and bison. Moustafa et al. (2013) noticed that ST122 is the predominant HS-associated strain from countries like India, East Timor, Indonesia, Thailand, Myanmar and Pakistan, based on which they suggested that there is potential for region-wide strategies to be adopted aimed at regional control of HS. Petersen et al. (2014) carried out MLST of 64 isolates of P.

Table 1. Details of the P.multocida isolates used for multilocus sequence typing.

Sr. No.

Isolate ID Host YearSample used for isolation

RegionCapsular

type1 PAB-12-3/08 Buffalo 2008 Bone marrow Khambat B:22 PAB-33-5/09 Buffalo 2009 Tissue Kapadvanj B:23 PAB-36-8/09 Buffalo 2009 Tissue Mehsana B:24 PAB-78-1/13 Buffalo 2013 Tissue Patan B:25 PAB-83-6/13 Buffalo 2013 Bone marrow Amreli B:26 PAB-86-9/13 Buffalo 2013 Tissue Ahmedabad B:27 PAB-89-1/14 Buffalo 2014 Tissue Gandhinagar B:2

Table 2. Details of primers used for the amplification of the seven housekeeping genes (http://pubmlst.org/pmultocida_rirdc/info/primers.shtml).

Sr. No. GenePrimer Sequence (5’ to 3’)

ForwardPrimer Sequence (5’ to 3’)

ReverseSize(bp)

1 adk TTTTTCGTCCCGTCTAAGC GGGGAAAGGGACACAAGC 5702 est TCTGGCAAAAGATGTTGTCG CCAAATTCTTGGTTGGTTGG 6413 pmi TGCCTTGAGACAGGGTAAGC GCCTTAACAAGTCCCATTCG 7394 zwf-1 AATCGGTCGTTTGACTGAGC TGCTTCACCTTCAACTGTGC 8085 mdh ATTTCGGGATCAGGGTTAGC GGAAAACCGGTAATGGAAGG 6206 gdh ATCGACTTCTTCCGCAGACC GCGGGTGATATTGGTGTAGG 7027 pgi ACCACGCTATTTTTGGTTGC ATGGCACAACCTCTTTCACC 784

http://pubmlst.org/pmultocida_rirdc/info/primers.shtml

http://pubmlst.org/pmultocida_rirdc/info/primers.shtml


389

Tabl

e. 3

. Det

ails

of t

he se

quen

ce ty

pes u

sed

for p

hylo

gene

tic a

naly

sis a

nd S

plit

deco

mpo

sitio

n an

alys

is a

s per

the

data

in R

IRD

C M

LST

data

base

for

P. m

ulto

cida

and

oth

er a

vaila

ble

liter

atur

es.

STH

ost

les

ion

Cou

ntry

/C

ontin

ent

Cap

sula

r se

roty

peR

efer

ence

63B

ovin

eH

aem

orrh

agic

se

ptic

aem

iano

info

rmat

ion

BPe

ters

en e

t al.

(201

4)

162

Bov

ine

Hae

mor

rhag

ic

sept

icae

mia

Afr

ica

EPe

ters

en e

t al.

(201

4)

147

Bov

ine

Hae

mor

rhag

ic

sept

icae

mia

Vie

tnam

, Sou

th

Afr

ica

EPe

ters

en e

t al.

(201

4)

127

Bov

ine

Hae

mor

rhag

ic

sept

icae

mia

Afr

ica

EH

otch

kiss

et a

l. (2

011)

51B

ovin

eH

aem

orrh

agic

se

ptic

aem

iaN

o in

form

atio

nA

Hot

chki

ss e

t al.

(201

1)

50Sw

ine,

Bov

ine

and

othe

rs

Pneu

mon

ia,

atro

pic

rhin

itis,

Bro

ncho

pneu

mon

ia

Cze

ck R

epub

lic,

Den

mar

k,

Ger

man

y, U

KA

, B, D

Hot

chki

ss e

t al.

(201

1) a

nd B

isga

ard

et a

l. (2

013)

163

Ant

elop

eno

info

rmat

ion

USA

BR

IRD

C M

LST

data

base

for P

. mul

toci

da16

4El

kno

info

rmat

ion

USA

BR

IRD

C M

LST

data

base

for P

. mul

toci

da

129

Bov

ine

Hae

mor

rhag

ic

sept

icae

mia

Sri L

anka

BH

otch

kiss

et a

l. (2

011)

277

Cat

tlePn

eum

onia

(HS

like

sym

ptom

s)In

dia

ASa

rang

i et a

l. (2

014)

9C

attle

, Goa

tPn

eum

onia

Indi

aF

Sara

ngi e

t al.

(201

4)22

9Sh

eep,

Cat

tleno

info

rmat

ion

Indi

aF

Sara

ngi e

t al.

(201

4)


390

Tabl

e 4.

Alle

lic p

rofil

es o

f P. m

ulto

cida

sero

type

B: 2

isol

ates

of G

ujar

at.

Isol

ate

deta

ilsA

llelic

pro

files

Isol

ate

Dat

abas

e ID

Hos

tYe

arC

ount

ryD

isea

seH

eddl

esto

n se

rova

rC

arte

rse

roty

pead

kes

tpm

izw

fm

dhgd

hpg

iST

PAB

-12-

3/08

743

Buf

falo

2008

Indi

aH

S2

B23

3721

174

217

122

PAB

-33-

5/09

744

Buf

falo

2009

Indi

aH

S2

B23

3721

174

217

122

PAB

-36-

8/09

745

Buf

falo

2009

Indi

aH

S2

B23

3721

174

217

122

PAB

-78-

1/13

746

Buf

falo

2009

Indi

aH

S2

B23

3721

174

217

122

PAB

-83-

6/13

747

Buf

falo

2013

Indi

aH

S2

B23

3721

174

217

122

PAB

-86-

9/13

748

Buf

falo

2013

Indi

aH

S2

B23

3721

174

217

122

PAB

-89-

1/14

749

Buf

falo

2014

Indi

aH

S2

B23

3721

174

217

122

P 52*

253

Buf

falo

-In

dia

HS

2B

2337

2117

42

1712

2

* Su

bmitt

ed b

y M

ir et

al.

(201

1).


391

Table 5. eBURST analysis of the isolates (Group definition: 5 or more matches).

Group: 23ST Frequency SlV DlV SAT63 1 1 1 2

122 1 1 1 2127 1 1 1 2147 1 - 2 2162 1 1 3 -

Table 6. eBURST analysis of the isolates (Group definition: 6 or more matches).

Group: 22ST Frequency SlV DlV SAT63 1 1 - -

122 1 1 - - SLV-Single locus variant DLV- Double locus variant SAT- satellites

Table 7. Percentage similarity of ST122 of Pasteurella multocida with other sequence types.

Sequence type Percentage similarityST63 99.97%ST162 99.89%ST127 99.86%ST147 99.65%ST229 99.49%ST9 99.16%ST51 98.92%ST71 98.73%ST50 98.62%ST277 98.73%ST163 98.65%ST164 98.78%ST129 98.84%


392

Figure 1. PM-PCR amplification (460 bp) of field isolates on 2% agarose gel. M- Molecular marker, P- Positive control, N- Negative control, Lane 1-7: field isolates.

Figure 2. PCR amplification of adk gene (570 bp) on 2% agarose gel. M- Molecular marker, P-Positive control, N-Negative control, Lane 1-7: field isolates.


393

Figure 3. PCR amplification of est gene (641 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.

Figure 4. PCR amplification of pmi gene (739 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.


394

Figure 5. PCR amplification of zwf gene (808 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.

Figure 6. PCR amplification of mdh gene (620 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.


395

Figure 8. PCR amplification of pgi gene (784 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.

Figure 7. PCR amplification of gdh gene (702 bp) on 2% agarose gel. M- Molecular marker, + Positive control, - Negative control, Lane 1-7 field isolates.


396

Figure 9. Unrooted Phylogenetic tree showing relationship between concatenated sequences of Gujarat isolates and other sequence types which can produce HS like symptoms reported from various parts of the world.

Figure 10. Splitstree analysis of ST122 and other sequence types of P. multocida obtained from RIRDC MLST database revealing a network-like tree. The parallelograms suggest the evidence of recombination.


397

multocida associated with HS in bovines, pigs and buffaloes. They found that the HS isolates were grouped into ST122, ST63, ST147 and ST162; and these four STs along with ST127 formed a HS clonal complex. Sarangi et al. (2014) studied the diversity of P. multocida isolates circulating in India and they identified ST122 from capsular type B isolates recovered from cattle, mithun, goat and pig which showed the widened host range of ST122. They suggested that the inclusion of pigs and small ruminants in the preventive vaccination policy may help to reduce the overall susceptible population.

In the present study, seven field isolates and vaccine strain P52 were grouped in ST122. Mir et al. (2011) also carried out MLST of P. multocida isolates (n=14) of buffalo origin in India. All the fourteen isolates (including P52 vaccine strain) used in their study were also grouped in ST122. Presently, the RIRDC MLST isolate database contain 114 isolates belonging to ST122 including 7 from the current study (P52 vaccine strain was already submitted to the database by Mir et al., 2011). Remaining 107 isolates include submissions by Mir et al. (2011), Moustafa et al. (2013), Petersen et al. (2014) and Sarangi et al. (2014).

In conclusion, ST122 was found to be the dominant sequence type in P. multocida isolated from HS suspected buffaloes from Gujarat. Further studies incorporating different animal and bird species can give a clear picture of other sequence types circulating in the state.

ACKNOWlEDGEMENT

The authors thankfully acknowledge the laboratory facilities extended by the Department of Agriculture Biotechnology, AAU, Anand.

REFERENCES

Antony, P.X., G.K. Nair, V. Jayaprakasan, M. Mini and T.V. Aravindakshan. 2006. A simple protocol for amplification of genes from inactivated oil adjuvant vaccine. Int. J. Poult. Sci., 5: 623-626.

Bisgaard, M., A. Petersen and H. Christensen. 2013. Multilocus sequence analysis of Pasteurella multocida demonstrates a type species under development. Microbiol., 159: 580-590.

Blackall, P.J. and J.K. Miflin. 2000. Identification and typing of Pasteurella multocida: A review. Avian Pathol., 29: 271-287.

Enright, M.C. and B.G. Spratt. 1998. A multilocus sequence typing scheme for Streptococcus pneumoniae: identification of clones associated with serious invasive disease. Microbiol., 144: 3049-3060.

Enright, M.C. and B.G. Spratt. 1999. Multilocus sequence typing. Trends Microbiol., 7: 482-487.

Feil, E.J. 2004. Small change: keeping pace with microevolution. Nature Rev. Microbiol., 2: 483-495.

Hotchkiss, E.J., J.C. Hodgson, A. Lainson and R.N. Zadoks. 2011. Multilocus sequence typing of a global collection of Pasteurella multocida isolates from cattle and other host species demonstrates niche association. BMC Microbiol., 11: 115-122.

Jolley, K.A., M.S. Chan and M.C.J. Maiden. 2004. mlstdbNet-distributed multi-locus sequence typing (MLST) databases. BMC Bioinformatics, 5: 86-94.

Maiden, M.C.J., J.A. Bygraves, E. Feil, G. Morelli, J.E. Russel, R. Urwin, Q. Zhang, J. Zhou, K. Zurth, D.A. Caugant, I.M. Feavers, M.


398

Achtman and B.G. Speatt. 1998. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. USA, 95: 3140-3145.

Mir, R.A., P. Thomas, K.N. Viswas, S.K. Gupta, J.K. Verma, A.P. Singh and V.P. Singh. 2011. Multilocus sequence typing of Indian isolates of Pasteurella multocida. Indian J. Comp. Microbiol. Immunol. Infect. Dis., 32: 30-35.

Moustafa, A.M., M.D. Bennett, J. Edwards, K. Azim, M.A. Mesaik, M.I. Choudhary, P. Pathanasophon, A .Worarach, Q. Ali, M. Abubakar and R. Anjum. 2013. Molecular typing of haemorrhagic septicaemia-associated Pasteurella multocida isolates from Pakistan and Thailand using multilocus sequence typing and pulsed-field gel electrophoresis. Res. Vet. Sci., 95: 986-990.

Munir, R., D. Shahwar, U. Farooq, I. Nawaz, I. Shahzad and A. Khanum. 2007. Outer membrane protein profiling of Pasteurella multocida. Pak. Vet. J., 27: 1-4.

Perez-Losada, M., P. Cabezas, E. Castro-Nallar and K.A. Crandall. 2013. Pathogen typing in the genomics era: MLST and the future of molecular epidemiology. Infect. Gen. Evol., 16: 38-53.

Petersen, A., M. Bisgaard, K. Townsend and H. Christensen. 2014. MLST typing of Pasteurella multocida associated with haemorrhagic septicaemia and development of a real-time PCR specific for haemorrhagic septicaemia associated isolates. Vet. Microbiol., 170: 335-341.

Pors, S.E., M.S. Hansen, H. Christensen, H.E. Jensen, A. Petersen and M. Bisgaard. 2011.

Genetic diversity and associated pathology of Pasteurella multocida isolated from porcine pneumonia. Vet. Microbiol., 150: 354-361.

RIRDC, (Rural Industries Research and Development Corporation). 2014. MLST scheme for P. multocida (http://pubmlst.org/pmultocida_rirdc/). Accessed November 2014.

Sarangi, L.N., P. Thomas, S.K. Gupta, S. Kumar, K.N. Viswas and V.P. Singh. 2014. Molecular epidemiology of Pasteurella multocida circulating in India by multilocus sequence typing. Transbound. Emerg. Dis., doi:10.1111/tbed.12270.

Savelkoul, P.H.M., H.J.M. Aarts, J. de Haas, L. Dijkshoorn, B. Duim, M. Otsen, J.L.W. Rademaker, L. Schouls and J.A. Lenstra. 1999. Amplified- Fragment Length Polymorphism analysis: the state of an art. J. Clin. Microbiol., 37: 3083-3091.

Snipes, K.P., D.C. Hirsh, R.W. Kasten, L.M. Hansen, D.W. Hird, T.W. Carpenter and R.H. McCapes. 1989. Use of an rRNA probe and restriction endonuclease analysis to fingerprint Pasteurella multocida isolated from turkeys and wildlife. J. Clin. Microbiol., 27: 1847-1853.

Spratt, B.G. 1999. Multilocus sequence typing: molecular typing of bacterial pathogens in an era of rapid DNA sequencing and the internet. Curr. Opin. Microbiol., 2: 312-316.

Subaaharan, S., L.L. Blackall and P.J. Blackall. 2010. Development of a multi-locus sequence typing scheme for avian isolates of Pasteurella multocida. Vet. Microbiol., 141: 354-361.

Townsend, M.K., A.J. Frost, C.W. Lee, J.M. Papadimitriou and H.J.S. Dawkins. 1998.

http://pubmlst.org/pmultocida_rirdc/

http://pubmlst.org/pmultocida_rirdc/


399

Development of PCR assays for species and type specific identification of Pasteurella multocida isolates. J. Clin. Microbiol., 36: 1096-1100.

Townsend, M.K., D.J. Boyce, Y.J. Chung, J.A. Frost and B. Adler. 2001. Genetic organization of Pasteurella multocida cap loci and development of a multiplex capsular PCR typing system. J. Clin. Microbiol., 39: 924-929.



401

ABSTRACT

A study was designed to study follicular growth, time of ovulation and conception rate after synchronization with medroxy progesterone acetate sponges in Nili Ravi buffalo heifers. A total of (n=18) nulliparous heifers were selected and divided into two groups on the basis of ultrasonography. Group A (n=9) contained no palpable or visible structure of follicle or Carpus luteum larger than 4 mm, while group B (n=9) contained palpable or visible structure of follicle or Carpus luteum larger than 4 mm on ultrasound screen. The medroxy progesterone acetate impregnated sponge containing 250 mg of progestin was implanted in fornix vagina to each experimental heifer, and day of implantation was declared as D 1. The medroxy progesterone acetate impregnated sponges were implanted up to 6 days. On day 7, sponges were removed with the single injection of pgf2α (+ cloprostenol, 0.075 mg) and GnRH Analog injection (Lecirelin, 50 mcg) was used on day 9 to every experimental animals. Both ovaries were scanned with (Honda 7400, Japan. 7.5 MHz) on D 1, D 6, and D 7 to 9 until ovulation. Ovulation started earlier (23% ovulation at 24 h) and finished later (23% at 36 h) in cyclic heifers

as compared to acyclic heifers in which ovulation started 33% at 24 h and finished earlier 56% at 30 h post GnRH Analog injection (Lecirelin, 50 mcg). Estrus response was more pronounced (P<0.05) in acyclic heifers as compared to cyclic. Ovulation rate was 100% in cyclic heifers and 89% in acyclic heifers. Conception rate was significantly higher (P<0.05) in acyclic heifers (56%) as compared to cyclic heifers (30%). It was concluded from this study that conception rate was higher in cyclic group while ovulation rate was greater in acyclic buffalo heifers’ meanwhile, time and size of ovulatory graffian follicle is similar among cyclic and acyclic buffalo heifers in a same synchronization protocol.

Keywords: buffaloes, Bubalus bubalis, heifers, sponges, synchronization

INTRODUCTION

Buffalo is a prestigious animal for Pakistani farmers due to its big share in dairy and meat sector. Buffalo reproduction is very sluggish as compared to other dairy animals. Its production is adversely

FOLLICULAR GROWTH, TIME OF OVULATION AND CONCEPTION RATE AFTER SYNCHRONIZATION WITH MEDROXY PROGESTERONE ACETATE IMPREGNATED

SPONGES IN NILI RAVI BUFFALO HEIFERS

Muhammad Binyameen1,*, Saba Anwar1, Rehana Kauser2, Azmat Ullah3, Abdul Rehaman4 and Mushtaq Ahmad4

1Buffalo Research Institute, Pattoki District Kasur Pakistan, *E-mail: [email protected] Institute for Agriculture and Biology, Faisalabad, Pakistan3Livestock and Dairy Development Department, Khyber Pakhtunkhwa, Pakistan4Department of Theriogenology, University of Veterinary and Animal Sciences, Lahore, Pakistan

Original Article


402

affected due to higher incidence of reproductive disorders (Akhter et al., 2008). Due to lack of homosexual behavior and silent heat, buffalo is different from the cattle (Companile et al., 2010; Perera, 2011). However, buffaloes respond well to exogenous hormones and higher conception rate can be achieved by synchronization of ovulation (Rensis and López-Gatius, 2007). Various hormonal protocols have been tried to induce the estrus (Das and Khan, 2010). Prostaglandin alone or with the combination of GnRH satisfactory conception rate can be achieved (Borghese, 2005). To control the estrus cycle different control released products have been used in different animals as reported by (Rathbone et al., 1998). For better conception rate in buffalo’s different hormonal protocols and their effect on follicular dynamics must be observed (Brito et al., 2002). It was first time study in Nili Ravi Buffalo heifers that medroxy progesterone acetate sponges were implanted to check their response on the onset of estrus, changes in growth of follicles, time of ovulation and conception rate.


Selection of animalsA total of (n=18) buffalo heifers having

400 to 450 kg body weight and age between 36 to 42 months were selected on the basis of ultrasonography (Honda 7400, Japan 7.5 MHz). Both ovaries were scanned twice at the interval of 10 days with transrectal ultrasound for confirmation of ovarian status. Heifers (n=9) bearing follicle more than 4 mm or palpable CL with hand or through transrectal ultrasound were placed in cyclic group. However heifers (n=9) bearing follicle less than 4 mm or lack of palpable CL with hand or through transrectal ultrasound were placed in acyclic group.

The feed offered to each experimental buffalo was 40 kg berseem (Alexendrium Trifolium), 35 kg corn silage and 5 kg concentrate daily, while water was offered ad libtium. All the experimental animals were tied during the experiment.

UltrasonographyBoth ovaries were scanned through

ultrasound (Honda, Japan 7400) having transrectal probe (2.5 M Hz) during selection of experimental animals. Ultrasonography was repeated after 10 days to check any variation in ovarian structure. The heifers having no change in ovarian structure at D 0 and D 10 were placed in (1) Acyclic group (n=9), while animals having different ovarian structure at both time (D 0 and D 10) during ultrasonography were placed in (2) Cyclic group (n=9. Furthermore, follicular dynamic of both ovaries was scanned after every 6 h from day 7 to 9 until ovulation. Absence of graffian follicle having a size of 9 mm or above was confirmatory sign of ovulation.

TreatmentMedroxy progesterone sponges containing

250 mg of Medroxy progestin were prepared by Robinson’s method (Robinson, 1965) and implanted in all experimental animals. The day of implantation was declared as D 1. On D 7 sponges were removed with a single injection of pgf2α (+ cloprostenol, 0.075 mg). After 48 h of first injection, GnRH Analog injection (Lecirelin, 50 mcg) was administered to each experimental animal.


Ultrasonography was carried out after every six hour post GnRH Analog injection (Lecirelin, 50 mcg) until ovulation. There was clear mucus


403

discharge, swollen valve when size of graffian follicle exceeded from 11 mm and estrus response was maximum 60 h after removal of Medroxy progesterone acetate sponges. The size of graffian follicle and time of ovulation at different time intervals post GnRH Analog injection (Lecirelin, 50 mcg) in cyclic and acyclic buffalo heifers is

shown in Table 1 and Table 2 respectively.The estrus response was maximum 60 h

after the removal of Medroxy progesterone Acetate sponges with the presence of graffian follicle more than 11 mm and clear mucous discharge were positive sign of estrus. One heifer failed to ovulate in acyclic group as shown in Table 2. Average time

Table 1. Size of graffian follicle (mm) post GnRH injection at different time intervals in cyclic buffalo heifers until ovulation.

Serial # 0 h 6 h 12 h 18 h 24 h 30 h 36 h1 6.5 10.5 13.6 14.3 Ovulation - -2 4.5 6.5 9.7 11.2 13.5 ovulation -3 4.7 6.2 8.1 9.5 12.5 14.3 Ovulation4 3 3 5.3 8 11.3 11.3 Ovulation5 4.4 7.5 9.2 11 14.2 ovulation -6 3.9 7 10.5 12.5 ovulation - -7 6.9 11.2 13.5 15.2 ovulation - -8 5.3 8.7 11 12.5 14.6 Ovulation -9 4.1 7.3 13.5 15.6 Ovulation - -

Table 2. Size of graffian follicle (mm) post GnRH injection at different time intervals in acyclic buffalo heifers until ovulation.

Serial # 0 h 6 h 12 h 18 h 24 h 30 h 36 h1 4.3 5.5 8.5 14.3 15.4 ovulation -2 6.8 11 12.2 15.2 Ovulation - -3 3.9 4.3 6.5 6.5 6.5 6.5 Unovulated4 3.7 6.5 8.8 8.8 8.8 ovulation -5 4 6.6 9.4 9.4 ovulation - -6 5.1 7.8 9 11.4 14.6 ovulation -7 4.9 7.3 10.5 14.3 Ovulation - -8 6.1 7.6 9.5 12.6 14.4 ovulation -9 4.7 6.9 9.7 12.5 15.3 ovulation -


404

of ovulation (hours) post GnRH injection in cyclic and acyclic buffalo heifers until ovulation was same (P<0.05) in both group. Ovulation started earlier (23% ovulation at 24 h) and finished later (23% at 36 h) in cyclic heifers as compared to acyclic heifers in which ovulation started 33% at 24 h and finished earlier 56% at 30 h post GnRH Analog injection (Lecirelin, 50 mcg). Our results are in line with (Paul and Parkash, 2005) who reported ovulation occurred earlier and lasted for longer time in cyclic animals as compared to acyclic buffalo heifers. Our results are also similar to (Ali and Fahmy, 2007) and (Karen and Darwish, 2010) who reported early ovulation in acyclic buffalo’s heifers as compared to cyclic buffaloes. Our results are in line to (Perry et al., 2007) who reported that maximum estrus response observed when follicle size reached between 11 to 12 mm. The maximum size of follicles at the time of ovulation reported by (Sharma et al., 2012) was 16.07±0.99 mm which is more close to our study. The result of this study are similar to (Mirmahmoudi et al., 2014) who gave the range of 11 to 15 mm size of follicles at the time of ovulation. This study is opposite to (Sartori et al., 2001) who reported that follicle less than 10 mm are unable to ovulate in cows. This difference might be variation from species to species and parity.

CONClUSION

It was concluded from this study that conception rate was higher in cyclic group while ovulation rate was greater in acyclic buffalo heifers’. The ovulation time and size of ovulatory follicle was similar among cyclic and acyclic buffalo heifers in a same synchronization protocol. All heifers expressed pronounced estrus response

when size of graffian follicle exceeded from 11 mm.

REFERENCES

Akhtar, S.M., L.A. Lodhi., I. Ahmad, Z.I. Qureshi and G. Muhammad. 2008. Serum concentrations of calcium, phosphorus and magnesium inpregnant nili-ravi buffaloes with or without vaginal prolapse in irrigated and rain fed areas of Punjab. Pak. Vet. J., 28(3): 107-110.

Ali, A. and S. Fahmy. 2007. Ovarian dynamics and milk progesterone concentrations in cycling and non-cycling buffalo-cows (Bubalus bubalis) during Ovsynch program. Theriogenology, 68(1): 23-28.

Borghese, A. 2005. Technical Series 67. Food and Agriculture Organization, Rome, Italy.

Brito, L.F.C., R. Satrapa, E.P. Marson and J.P. Kastelic. 2002. Efficacy of PGF2α to synchronize estrus in water buffalo cows (Bubalus bubalis) is dependent on plasma progestrone concentration, corpous leutum size and overian follicular statusbefore treatment. Anim. Reprod. Sci., 73: 23-35.

Campanile, G., P.S. Baruselli, G. Neglia, E.M. Senatore, A. Bella, G.A. Presicce and L. Zicarelli. 2011. Pregnancy rate following AI with sexed semen in Mediterranean Italian buffalo heifers. Theriogenology, 76: 500-506.

Das, G.K. and F.A. Khan. 2010. Summer anoestrus in buffalo-A review. Reprod. Domest. Anim., 45(6): e483-e494.

Karen, A.M. and S.A. Darwish. 2010. Efficacy of Ovsynch protocol in cyclic and acyclic Egyptian buffaloes in summer. Anim.


405

Reprod. Sci., 119(1-2): 17-23.Mirmahmoudi, R., M. Souri and B.S. Prakash. 2014.

Endocrine changes, timing of ovulation, ovarian follicular growth and efficacy of a novel protocol (Estradoublesynch) for synchronization of ovulation and timed artificial insemination in Murrah buffaloes (Bubalus bubalis). Theriogenology, 81(2): 237-242.

Paul, V. and B.S. Prakash. 2005. Efficacy of the Ovsynch protocol for synchronization of ovulation and fixed-time artificial insemination in Murrah buffaloes (Bubalus bubalis). Theriogenology, 64(5): 1049-1060.

Perera, B.M. 2011. Reproductive cycles of buffalo. Anim. Reprod. Sci., 124(3-4): 194-199.

Perry, G.A., M.F. Smith, A.J. Roberts, M.D. MacNeil and T.W. Geary. 2007. Relationship between size of the ovulatory follicle and pregnancy success in beef heifers. J. Anim Sci., 85: 684-689.

Rathbone, M.J., K.L. Macmillan, W. Jochle, M. P. Boland and E.K. Inskeep. 1998. Controlled-release products for the control of the estrous cycle in cattle, sheep, goats, deer, pigs and horses. Crit. Rev. Ther. Drug., 15: 285-380.

Rensis, F.De. and F. López-Gatius . 2007. Protocols for synchronizing estrus and ovulation in buffalo (Bubalus bubalis): A review. Theriogenology, 67(2): 209-216.

Robinson, T.J. 1965. Use of progestagen-impregnated sponges inserted intravaginally or subcutaneously for the control of the oestrous cycle in the sheep. Nature, 206: 39-41.

Sartori, R., P.M. Fricke, J.C.P. Ferreira, O.J. Ginther and M.C. Wiltbank. 2001. Follicular deviation and acquisition of ovulatory

capacity in bovine follicle. Biol. Reprod., 65(5): 1403-1409.

Sharma, R.K, J.K. Singh, S. Khanna and I. Singh. 2012. Ovarian response of prepubertal Murrah heifers to exogenous GnRH. Anim. Reprod. Sci., 133(3-4): 153-158.



407

ABSTRACT

Gross and radiographic anatomical study of the dental arch of buffalo revealed deeply and firmly anchored 6 incisors, 1 canine, 3 premolars and 3 molar in lower jaw and 3 premolar and 3 molar in the upper jaw. The morphometric and radiographic measurement of the crown length, root length, and total root length of the incisor and cheek tooth were observed. The length of root was 0.8 times than that of the crown for the incisor. The crown length, root length and total tooth length of the maxillary teeth was constantly more than that of the mandibular cheek tooth. The morphometric measurement of the crown length, root length and total tooth length were non-significantly higher than the radiographic measurement except second premolar of lower jaw and first premolar of upper jaw which was significantly differ at (P≤0.05).

Keyword: buffaloes, Bubalus bubalis, crown length, root length, total tooth length, dental anatomy

INTRODUCTION

A large number of clinical studies analyzed the importance of tooth size in the development

of occlusion or malocclusion. Because the variability in tooth size, as a consequence of the interrelationship between biological variables, these studies have focused on the size of permanent teeth. Haws (2010) reported that the role of radiology in dentistry continuously expands with the advance of imaging technology. In recent years, with digitization of radiographic image many software applications were coded by different commercial company to execute radiology investigation and manipulate the radiographic images. This provides an alternative of imaging other than conventional radiography.

Lozano et al. (2002) observed the development of diagnostic imaging techniques in dentistry has been of fundamental importance. Ingle (2002) reported the application of such techniques in endodontic allows the definition of root canal morphology as well the determination of endodontic working length. Anthony (2014) reported that the oral dental radiology is fundamental to the practice of veterinary dentistry. Radiographs show pathologic lesion or foreign bodies that cannot be identified by any other way and assist the localization of these objects.

St. Clair (1975) reported that the teeth are known to be unique organ made of the most enduring mineralized tissue in the human body.

MORPHOLOGICAL AND DIGITAL RADIOGRAPHICAL DENTAL ANATOMY OF ADULT BUFFALOES

R.K. Singh1, R.P. Pandey1, S. Purohit1, S.P. Singh2,*, A.K. Tripathi3 and V. Malik1

1Department of Surgery and Radiology, 2Department of Anatomy, *E-mail: [email protected] of Medicine, College of Veterinary Science and Animal Husbandry, U.P. Pandit Deen Dayal Upadhyaya Pashu Chikitsa Vigyan Vishwavidyalaya Evam Go Anusandhan Sansthan, Mathura, India

Original Article


408

Teeth, being the hardest and chemically most stable tissue in the body are an excellent material in the living and non-living populations for anthropological, genetic, odontologic and forensic investigation.

Radiographic determination of tooth length is one of the critical aspects of pulpectomy in primary teeth because minor degrees of resorption may not be obvious radiographically and an underling permanent tooth germ can cause image superimposition. Consequently, the root apex is not clearly identified Mente et al. (2002). Hence the present study was undertaken to provide the basic data for bubaline teeth anatomy and its clinical significance.


Source of specimenA total number of 10 Cadaver (same

size and weight) of adult buffaloes heads were collected from abattoir or from hospital casualty all the measurements were done in the Department of Surgery and Radiology, College of Veterinary Sciences and Animal Husbandry Mathura.

Morphometric measurementThe morphometric measurement of the

crown length, root length and total tooth length were measured by using a Vernier calipers to the nearest 0.5 mm, needle point divider and scale.

The measurements included:1. The crown length (CL): It was recorded

from the center of the cervical margin to the highest points of the crown

2. Root length (RL): It was recorded from the center of the cervical margin to the highest points of the root.

3. Total tooth length (TTL): It was measured between the highest points of the crown and root along the center of the cervical margin.

Radiographic measurement The radiographs of maxilla and mandible (separately) were taken using a portable X ray machine with technique setting of 82 Kvp and 14 mAs using 14 “X17’’ digital X ray phosphor plate. Image thus captured was digitized using CR system (Konica Regius 110). The X ray cassette was kept below the maxilla and mandible for radiographic images and a minimum of two radiographic projection (view) were made like lateral view and oblique view.

Statistical analysis All the parameters like crown height, root length, and total tooth length were recorded in centimeters (cm) by using computer software. The data generated by biometrical observations were subjected to statistical analysis (Snedecor and Cochran, 1967) with the help of SPSS 17.0 software.


Gross and radiographic anatomical study of the dental arch of buffalo revealed deeply and firmly anchored 6 incisors, 1 canine, 3 premolars and 3 molar in lower jaw and 3 premolar and 3 molar in the upper jaw. The permanent dental formula of buffalo was incisor 0/3, C=0/1, PM=3/3, M=3/3 as described by Raghavan (1964).

IncisorA total of 6 simple incisors were embedded

in the lower jaw. The dental pad was present against


409

these incisors in the upper jaw are in agreement with St. Clair (1975) in for cattle and Archana et al. (2000) for yak. The morphometric mean of the crown length, root length and total tooth length were 1.98±0.01, 2.4±0.11 and 4.42±0.23 cm (Figure 7) where as the mean values for the radiographic measurement were 2.05±0.09, 2.35±0.15 and 4.49±0.24 cm (Table 2, Figure 8). There was non-significant difference between the morphometric and radiographic measurements. In the buffalo, the roots were rounded and curved and 0.82 times as long as crown in the present study whereas in Ox it was one and half times as long as crown St. Clair (1975) and in Yak 2 times Archana et al. (2000). Thus the incisor of buffaloes is less deeply and firmly anchored in the alveolus than cattle. So root does not fit tightly in the alveolus allowed the tooth a small movement similar observation was made by St. Clair (1975) in ox. In buffaloes the root of Incisor was straight and gradually increasing curvature was noticed as the corner incisor was approached similar observations were made by St. Clair (1975). In contrast in Yak Archana et al. (2000) reported that the root of the incisors appeared curved. There curvature increased from I1 to I3. The root of the corner incisor looked almost straight. The shovel shaped crowns were marked by a distinct neck and round blunt pointed root embedded in to the respective alveoli similar to Archana et al. (2000) in Yak and St. Clair (1975) in ox. The medial edge of each tooth was slightly overlapped at the lingual surface of the tooth. The teeth decreased in size from number one to four and alveoli became shallower. Similar observations were made by St. Clair (1975) in ox.

Cheek tooth (premolar and molar)The total 6 cheek tooth (3 premolar and

3 molar) occurred on either side in the upper jaw

(maxilla) or lower jaw (mandible).

Crown lengthIn the upper jaw, the morphometric mean

value of the crown length of the premolar (PM) and molar (M) were PM1 1.73±0.09, PM2 2.05±0.1, PM3 2.17±0.10, M1 2.43±0.14, M2 2.44±0.08 and M3 2.38±0.08 cm respectively while radiographic mean±SE for the same was PM1 2.05±0.23, PM2

2.34±0.40, PM3 2.49±0.38, M1 2.83±0.46, M2 2.82±0.23 and M3 2.76±0.21 cm respectively. There was non-significant difference between the morphometric and radiographic mean value of crown length in the upper jaw (Table 1, Figure 1 and Figure 2).

Whereas in the lower jaw the morphometric mean value of crown length were PM1 1.27±0.10, PM2 1.59±0.07, MP3 1.88±0.14, M1 1.83±0.12, M2

2.01±0.13 and M3 2.04±0.14 while radiographic mean value for the same was PM1 1.51±0.11, PM2 1.91±0.08, PM3 2.18±0.16, M1 2.14±0.12, M2 2.27±0.14 and M3 2.32±0.15 cm respectively. There was non-significant difference between the morphometric and radiographic mean value of the crown length except PM2 which differed significantly at (P≤0.05, Table 2). The crown length of upper jaw and lower jaw was gradually increased from PM1 to M1 while crown length of the M2 and M3 almost similar. A similar observation was made by St. Clair (1975) in ox.

Root lengthIn the upper jaw the morphometric mean

value of the root length of the premolar and molar were PM1 2.89±0.22, PM2 2.93±0.18, PM3 3.16±0.17, M1 3.49±0.20, M2 3.66±0.22 and M3 4.02±0.21 while radiographic mean value for the same were PM1 2.54±0.69, PM2 2.69±0.54, PM3 3.06±0.64, M1 3.23±0.83, M2 3.41±0.83 and M3


410

Tabl

e 1.

Mor

phom

etric

and

radi

ogra

phic

mea

sure

men

t of d

iffer

ent t

ooth

in th

e up

per J

aw o

f buf

falo

es.

.

Cro

wn

leng

thR

oot l

engt

hTo

tal t

ooth

leng

th

Sr. N

oTe

eth

nam

eM

orph

omet

ric

Rad

iogr

aphi

cM

orph

omet

ric

Rad

iogr

aphi

cM

orph

omet

ric

Rad

iogr

aphi

c

1C

.I…

……

……

……

……

…..

……

……

……

……

……

……

……

……

....

……

……

……

.2

PM1

1.73

±0.0

92.

05±0

.23

2.89

±0.2

22.

54±0

.69

4.61

±0.2

44.

59±0

.74

3PM

22.

05±0

.11

2.34

±0.4

02.

93±0

.18

2.69

±0.5

44.

98±0

.19

5.03

±0.5

54

PM3

2.17

±0.1

02.

49±0

.38

3.16

±0.1

73.

06±0

.64

5.38

±0.2

05.

55±0

.74

5M

12.

43±0

.14

2.83

±0.4

63.

49±0

.20

3.23

±0.8

35.

93±0

.18

6.12

±0.8

06

M2

2.44

±0.0

82.

82±0

.23

3.66

±0.2

23.

41±0

.83

6.09

±0.2

16.

23±0

.79

7M

32.

38±0

.08

2.76

±0.2

14.

02±0

.21

3.52

±0.8

06.

40±0

.20

6.28

±0.7

3

* M

orph

omet

ric a

nd ra

diog

raph

ic v

alue

diff

er si

gnifi

cant

ly a

t 0.0

5 %

leve

l of s

igni

fican

ce.

Tabl

e 2.

Mor

phom

etric

and

radi

ogra

phic

mea

sure

men

t of d

iffer

ent t

ooth

in th

e lo

wer

Jaw

of b

uffa

loes

C

row

n le

ngth

R

oot l

engt

h

Tot

al to

oth

leng

th

Sr. N

oTe

eth

nam

eM

orph

omet

ric

Rad

iogr

aphi

cM

orph

omet

ric

Rad

iogr

aphi

cM

orph

omet

ric

Rad

iogr

aphi

c

1C

.I1.

98±0

.11

2.0

5±0.

092.

4±0.

112.

35±0

.15

4.42

±0.2

3 4

.49±

0.24

2PM

11.

27±0

.10

1.51

±0.1

12.

20±0

.11

1.81

±0.1

2*3.

46±0

.16

3.32

±0.1

73

PM2

1.59

±0.0

71.

91±0

.08*

2.59

±0.1

52.

41±0

.14

4.18

±0.1

64.

32±0

.15

4PM

31.

88±0

.14

2.18

±0.1

62.

99±0

.09

2.79

±0.1

04.

87±0

.18

4.97

±0.1

85

M1

1.83

±0.1

22.

14±0

.12

3.48

±0.1

43.

25±0

.17

5.30

±0.2

05.

39±0

.23

6M

22.

01±0

.13

2.27

±0.1

43.

79±0

.17

3.74

±0.2

75.

79±0

.23

6.03

±0.3

27

M3

2.04

±0.1

42.

32±0

.15

4.29

±0.2

64.

22±0

.32

6.32

±0.2

96.

47±0

.33

*

Mor

phom

etric

and

radi

ogra

phic

val

ue d

iffer

sign

ifica

ntly

at 0

.05

% le

vel o

f sig

nific

ance

.


411

Figure 1. Morphometric measurement of crown length of upper jaw.

Figure 2. Radiographic measurement of crown length of cheek tooth in upper jaw.

Figure 3. Morphometric measurement of root length of cheek tooth in upper jaw.

Figure 4. Radiographic measurement of root length of cheek tooth in upper jaw.

Figure 5. Morphomertic measurement of root length of cheek tooth lower jaw.

Figure 6. Radiographic measurement of root length of cheek tooth in lower jaw.


412

Figure 7. Morphomertic measurement of total tooth length of incisor in lower jaw.

Figure 8. Radiographic measurement of total tooth length of incisor in lower jaw.

Figure 9. Morphometric measurement of total tooth length of cheek tooth in upper jaw.

Figure 10. Radiographic measurement of total tooth length of cheek tooth in upper jaw.

Figure 11. Morphometric measurement of total tooth length of cheek tooth in lower jaw.

Figure 12. Radiographic measurement of total tooth length of cheek tooth in lower jaw.


413

3.52±0.80 cm respectively. The morphometric values of root length were higher than the radiographic mean value (Table 1, Figure 3 and Figure 4).

In the lower jaw, the morphometric mean values of the root length of the Premolar and Molar were PM1 2.20±0.11, PM2 2.59±0.15, PM3 2.99±0.09 cm, M1 3.48±0.14, M2 3.79±0.17 and M3 4.29±0.26, while radiographic mean value was PM1 1.81±0.12, PM2 2.41±0.14, PM3 2.79±0.10 M1 3.25±0.17, M2 3.74±0.27 and M3 4.22±0.32cm respectively. The morphometric mean value of root length of PM1 was significantly higher than the radiographic mean values. (Table 2, Figure 5 and Figure 6).

Total tooth length The morphometric mean value of total

tooth length in the upper jaw were PM1 4.61±0.24, PM2 4.98±0.19, PM3 5.38±0.20 and M1 6.40±0.20, M2 6.09±0.21, M3 6.40±0.20 while radiographic mean value were PM1 4.59±0.74, PM2 5.03±0.55, PM3 5.55±0.74 and M1 6.12±0.80, M2 6.23±0.79, M3 6.28±0.73cm respectively. The morphometric mean values of total tooth length were non-significantly higher than the radiographic mean values. A similar observation was made by (St Clair, 1975) in ox. (Table 1, Figure 9 and Figure 10).

In the lower jaw, the morphometric mean values of total tooth length were PM1 3.46±0.16, PM2 4.18±0.16, PM3 4.87±0.18 and M1 5.30±0.20, M2 5.79±0.23, M3 6.32±0.29, while radiographic mean value were PM1 3.32±0.17, PM2 4.32±0.15, PM3 4.97±0.18 and M1 5.39±0.23, M2 6.03±0.32, M3 6.47±0.33 cm respectively. The morphometric values of total tooth length were non-significantly higher than radiographic mean values (Table 2, Figure 11 and Figure 12).

The PM1 was smallest and PM3 largest. The crown length of the upper molar was higher than premolar, the upper premolar and molar were resemble with lower one except they were narrow. In the upper jaw all the cheek tooth were embedded in the corresponding alveoli of the maxilla and in the lower jaw the root of the cheek tooth were embedded in the corresponding alveoli of the mandible. All the cheek tooth were snuggly fitted in the mandibular alveoli and surrounded by closely knitted meshes of the cancellous tissue.

The result showed no significant difference between the morphometric and radiographic mean suggesting that the morphometric measurement was effective in the assessment of tooth measurements. In cadaver specimens and radiographic measurements can be employed in clinical conditions for making comparisons. Admitting as clinically acceptable a 0.5 mm discrepancy between the morphometric and radiographic estimated measurement and it was could be due to radiographic magnification bias, positioning errors and directions.

REFERENCES

Anthony, J. 2013. w.scilvet.ca/..scilful_Vet_Solutions_Newsletter_September_2013.pd

Archana, D.N. Sharma and R.L. Bharadwaj. 2000. Dental anatomy of yak (Bos qrunnies). Indian J. Anim. Sci., 70(11): 117-119.

Fidanoski, B. 2007. Digital Radiography. http://www.fidanoski .ca/dentis try/digi tal-dentalradiography.htm. Accessed February 1, 2007.

Haws, I.J. 2010. The evolution of oral radiography in veterinary medicine. Can. Vet. J., 51(8): 899-901.

Hegde, V., R.D. Kulkarni and G.S. Ajantha. 2007.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Haws IJ%5Bauth%5D


414

Biomedical waste management. Journal of Oral and Maxillofacial Pathology, 11(1): 5-9.

Ingle, J. and L. Bakland. 2002. Endodontics, 5th ed. Elsevier. Canada. 324-327.

Katz, A., A. Tamse and Y. Kaufman. 1991. Tooth length determination: A review. Oral Surgery, Oral Medicine, Oral Pathology, 72(2): 238-242.

Lozano, A., L. Forner and C. Liena. 2002. In vitro comparison of root-canal measurements with conventional and digital radiology. J. Int. Endod., 35(6): 542-550.

Mente, J., J. Seidel, W. Buchalla and M.J. Koch. 2002. Electronic determination of root canal length in primary teeth with and without root resorption. J. Int. Endod., 35(5): 447-452.

Shanmugaraj, M., R. Nivedha, R. Mathan and S. Balagopal 2007. Evaluation of working length determination methods: An in vivo/ ex vivo study. Indian Journal of Dental Research, 18(2): 60-62.


415

ABSTRACT

Effect of feed energy levels on semen quality and freezability of Murrah buffalo young bulls was investigated. Eighteen bulls (age ~24 mo and bwt ~428 kg) were randomly allotted to three groups of six in each. Group 1 was kept as control and bulls in this group were fed as per NRC (2001) recommendations, while feed of Group 2 and Group 3 bullswas same as in control andadditional 10% and 20% higher energy was provided through molasses to bulls of Group 2 and Group 3, respectively. Monthly feedintake of every bull was recorded. Semen was collected using AV technique at weekly interval; reaction time of bulls was recorded at collection. Ejaculate volume (ml), mass motility (0 to 5 scale), individual sperm motility (%), sperm concentration (m/ml); percent viability, acrosome integrity and morphological abnormality in fresh semen and post thaw sperm motility, viability and acrosome integrity in frozen semen were evaluated with microscopic methods. Results showed that the DM intake was higher (P<0.01) in Group 3 than Group 2 and control. Reaction time (second) was the lowest (P<0.01) in Group 2 followed by Group 1 and Group 3. Sperm concentration (m/ml) and mass motility was found to be higher (P<0.05) in Group 2 than Group 3 and

control. Similar trend (P<0.05) of percent sperm motility, viability and acrosome integrity amongthe groups was observed. Whereas, significantly (P<0.05) higher percent sperm abnormality was obtained in Group 3 followed by Group 1 and Group 2. Post-thaw percent sperm motility, viability and acrosome integrity were significantly higher (P<0.05) in Group 2 than control and Group 3. From this study it can be concluded that 10% higher energy provided to the bulls in Group 2 than the control improved quality significantly of fresh and frozen semenin comparison to the control and other treatment group.

Keywords: buffaloes, Bubalus bubalis, cryopreservation, feed energy, Murrah buffalo bulls, semen quality, reaction time

INTRODUCTION

Buffalo is main dairy animal in India. For enhancing its productivity further, superior quality male germplasm of high genetic potential can play a significant role. However, this is a matter of great concern the availability of sufficient quality buffalo male germplasm to achieve the desired progress. Artificial insemination is an important

Original Article

EFFECT OF FEED ENERGY LEVELS ON SEMEN QUALITY AND FREEZABILITY OF YOUNG MURRAH BUFFALO BULLS

Ajit Kumar1,*, P. Singh1, M. Bhakat1, S. Singh1, K. Nitharwal1 and A.K. Gupta2

1Livestock Production Management, National Dairy Research Institute, Karnal, Haryana, India, *E-mail: [email protected] of Animal Genetics Breeding, National Dairy Research Institute, Karnal, Haryana, India



416

tool for the improvement of milk productivity in buffalo by the multiplication of animal with high genetic potential (Baruselli and Carvalho, 2005). In recent decade, in view of high demand of buffalo germplasm in the country, emphasis for conservation and multiplication of superior Murrah buffalo germplasm has increased (Singh, 2009). In general, buffalo bulls start semen production at about 24.9 to 34.0 months of age (Ahmad et al., 1984; Sethi, 1999). However, poor libido and reduced semen quality are major causes of poor reproductive performance of young bulls and availability of buffalo germplasm. Therefore, to obtain quality frozen semen of young bulls is desirable to increase AI coverage and early sire evaluation. Energy is the major dietary element which is responsible for the utilization of other nutrients and in turn it enhances the growth and productivity of animal (Hosseini et al., 2008). High level of dietary energy intake influenced reproductive performance of young bulls through a direct effect on the age at puberty and growth of scrotal circumference (Pruitt and Corah, 1985). Bull’s diet deficient in protein and energy generally result in extreme weight loss which may adversely affect the libido and semen quality (Mecham et al., 1963). Feeding of high energy in diet to young bulls increased body growth and testicular development (Barth et al., 2008). The quality semen produced by individual bulls is the product of the bull inherent genetic makeup, less any detrimental influence induced by the environment in which the bull was reared and maintained (Coulter, 1994). Therefore, the optimum energy level for growth and sexual maturity of young buffalo male needs to be precisely understood, so that male attains puberty in time and startsproduction of quality semen at an early age.


Eighteen Murrah buffalo bulls (age ~24 mo and bwt ~428 kg) selected for the study and kept at Artificial Breeding Research Centre of National Dairy Research Institute, Karnal.They were randomly allotted to three groups of six bulls in each based on their body weight and age. Group 1 was kept as control and fed as per NRC (2001) recommendations while in Group 2 and Group 3 were fed same as in control plus 10 and 20% higher energy supplied through molasses. The ration containing concentrate mixture, green fodder (Berseem and Oats) and dry roughage (wheat straw) was supplied (DM basis) throughout the trial of five months. Dry matter intake was calculated at monthly interval by weighing offered and residual quantity of concentrate mixture, green fodder and roughages on two consecutive days and then DM intake was determined for whole month. Blood samples were collected by puncturing of jugular vein in vacutainer tube with heparin (20 IU/ml blood) of all the bulls at monthly interval for estimation of testosterone. The plasma was separated within one hour after sampling following centrifugation (3000 rpm for 20 minutes) at 4oC and stored at -20oC till the estimation of testosterone. Testosterone concentration was estimated with the Bovine Testosterone ELISA kit. For semen collection, bulls were thoroughly washed, cleaned, and dried before making semen collection in early morning. Semen was collected at weekly interval (single ejaculate) by using bovine Danish model artificial vagina (IMV model-005417) (41 to 42oC) over a dummy bull. Reaction time in seconds was recorded with the help of stop watch at the time of semen collection as described by Anzar et al. (1993) for buffalo bulls. Immediately after collection each ejaculate was placed in a water


417

bath (30oC) and standard laboratory tests for semen evaluationwere performed. Quality of fresh semen ejaculates was assessed for ejaculate volume (ml), sperm concentration (m/ml) (Haemocytometer, Improved Neubauer’s method), mass motility (0 to 5 scale), and individual motility (%) by using phase contrast microscope (Nikon Eclipse E600, Tokyo, Japan) with a heating stage. Live and dead sperm counts in semen sample were assessed by Eosin-Nigrosine modified method. Assessment of intact acrosome proportion of sperm in semen sample was performed by staining as described by Hancock (1952). Semen was processed for cryopreservation as per the standard protocol followed for buffalo semen processing and cryopreservation at the laboratory of Artificial Breeding Research Centre. Assessment ofpost thaw sperm motility was done by putting analiquot of 10 μl of thawed semen on a cleaned warmed slide and then covered it with a warmed cover slip. Spermmotility thenwas assessed under 200x magnification of a phase contrast microscope on a heating stage (37oC). Post-thaw sperm viability of every semen sample was determined using Eosin-Nigrosin stain and acrosome integrity of post-thaw spermatozoa was determined by Giemsa staining technique procedure as explained above under initial evaluation of semen.

Statistical analysisThe data obtained during this study was

analyzedusing ANOVA as described by Snedecor and Cochran (1967) and Tukey’s Studentized Range (HSD) between feed groups and compared means using DMRT using SAS (9.3) package at computer centre the institute.


Effect of feed energy levels on dry matter intake (dmi)

The mean DM intake (kg/100 kg bwt/day) was 2.16±0.02, 2.23±0.02, 2.29±0.20 in Group 1, Group 2 and Group 3, respectively, it was significantly (P<0.01) different among the groups (Table 1). Higher DM was found to be in higher feed energy groups (Group 3) this might be due to increased palatability of the feed with higher energy levels (Puri et al., 2004; Tovar- Luna et al., 2011). The lower DMI was obtained in Group 1 among the groups and it might be explained in the light of the fact that diet low in energy level reduced DMI because of their slow clearance from the rumen and passage through the digestive tract (Allen, 1997). These results are also in agreement with those obtained by Girdher et al. (2008) in Frieswal and Swanepoel et al. (2008) in Bonsmara and Patil (2013) in Murrah buffalo bull calves they found that the dry matter intake was significantly increased by increasing energy level in the ration. In the present study also the higher DM intake was recorded which could be again due to the increased palatability of the ration through the supplementation of molasses in the diets of the bulls of higher energy groups.

Effect of feed energy levels on testosterone profile

Testosterone concentration (ng/ml) was 1.29±0.32, 1.46±0.28 and 1.81±0.34 in Group 1, Group 2 and Group 3, respectively (Table 1). It showed significant (P<0.05) difference among the groups and higher value was obtained in Group 3 (1.81±0.34) followed by Group 2 (1.46±0.28) and Group 1 (1.29±0.32). High nutrition has effects


418

on hypothalamus-pituitary-testis axis through the influence on GnRH and LH pulse generator and direct effect on leydig cells in turn it increases IGF-1 production which then increases proliferation and differentiation of leydig cells then testosterone production increases (Cailleau et al., 1990). Additional nutrients intake also alters leydig cells function directly to increase serum testosterone production (Nolan et al., 1990). In the present study also significantly higher concentration of testosterone was found in the higher feed energy group (20% HE) than other two groups. The above results are in accordance with the findings (Brito et al., 2007a, c; Selvaraju et al., 2012; Shahzad et al., 2013); theyfound that bulls fed on high energy diets had higher level testosterone.

Effect of feed energy levels on reaction timeThe reaction time (second) was

80.13±13.26, 62.02±9.96 and 118.90±21.06 in Group 1, Group 2 and Group 3, respectively (Table 1). It showed a significant (P<0.01) difference among the groups. Group 2 bulls showed the lowest reaction time (62.02±9.96) where as Group 1 (80.13±13.26) and Group 3 (118.90±21.06) showed the higher reaction time. High feed energy diet in adult bulls tends to increase fat deposition which makes bull lethargic andmay reduce sex drive (Girdher et al., 2008). The above results are also in accordance with the findings of Morrow et al. (1981) and Pruitt et al. (1986), where higher dietary energy was found to reduce the reaction time. However, Chase et al. (1993) and Mandal et al. (2008) found that there was no effect of feed energy on reaction time or sexual behaviour in cross bred bulls. In the present findings, though no set trend of reaction time with dietary energy levels was obtained, however, shorter reaction time was recorded in the medium energy group (10% HE)

than the higher (20% HE) and control. Therefore, it could be due to species differenceas libido is mainly regulated by the genetics. As this trait has high heritability (h=0.6), hence there is little scope of effect of total environmental factors in regulation of reaction time, including nutrition.

Effect of feed energy levels on fresh semen quality:

Ejaculate volumeThe ejaculate volume (ml) was 2.02±0.20,

2.25±0.20 and 2.57±0.22 in Group 1, Group 2 and Group 3, respectively. Ejaculate volume showed no significant difference among the groups, however, higher volume was obtained in Group 3 as compared to other groups (Table 2). High energy diet might have increased the scrotal size, number of secretary tissue and testosterone production which then might have enhanced the ejaculate volume. Similar findings were also reported by Mandal et al. (2008); Girdhar et al. (2008); Azizunnesa-Zohara et al. (2013) and Shahzad et al. (2013) where increased ejaculate volumewas recorded. However there are contrary reports to the present findings, Lunstra and Coulter (1997) and Swanepoel et al. (2008) have found that feeding of high energy diet reduced the ejaculate volume.

Mass motilityMean value of mass motility was

2.13±0.20, 3.01±0.06 and 2.22±0.13 in Group 1, Group 2 and Group 3, respectively (Table 2). It showed a significant (P<0.05) difference among the groups and higher value was found to be in Group 2 as compared to other groups. The above results are in accordance with the findings by Fourie et al. (2004) in ram; Swanepoel et al. (2008) in beef bulls. In contrary to these results, findingsof


419

Mandal et al. (2008) and Azizunnesa et al. (2013) have reported increased in the mass motility. The mass motility, in the present findings, was found to be significantly higher in the 10% HE group than the 20% HE and control. This indicates that slightly higher feed energy than the control (NRC, 2001) has worked better and enhanced the semen quality in terms of mass motility in buffalo bulls. It could be because of the combined effect of lower scrotal size, higher IGF-1 and testosterone profiles in bulls of Group 2. Small size scrotum might have had better thermoregulation, and higher IGF and testosterone concentrations might have provided conductive milieu to sperms in the testis and hence Group 2 bulls gave significantly higher mass motility than other two groups.

Sperm concentrationThe sperm concentration (m/ml)

(Mean±SE) was 895.61±73.0, 1165.27±46.70 and 935.18±51.20 in Group 1, Group 2 and Group 3, respectively (Table 2). This showed significant (P<0.05) difference among the groups and higher value was obtained in Group 2 as compared to other groups. Sperm concentration (m/ml) obtained in this study was in the range as reported by different workers in Murrah buffalo bulls (Shukla and Mishra, 2005). The bulls of Group 2, medium energy (10%), produced higher sperm concentration then the higher energy (20%) and the control. From this, it appeared that feeding of higher energy did not give any benefit in terms of sperm concentration; however, the high energy group (Group 2) could produce higher sperms per ejaculate. Effect of feeding of high energy diets to increase the concentration of spermatozoa have been reported in beef bulls (Rekwot et al., 1997), dairy bulls (Mandal et al., 2008) and buffalo bulls (Shahzad et al., 2013). However, Seidel et al.

(1980) and Bester et al. (2004) have not found any significant effect of change in feed energy levels on sperm concentration in bulls. It has been found that feeding of high energy diet increases the deposition of fat in the neck of scrotum which impairs the thermoregulation and increased the scrotal temperature then reduced the sperm concentration (Lunstra and Coulter, 1997).

Sperm motilityPercent sperm motility in fresh semen was

46.36±4.66, 66.84±1.52 and 47.86±3.09 in Group 1, Group 2 and Group 3, respectively (Table 2). Sperm motility showed significant (P<0.05) difference among the groups and it was higher (66.84±1.52) in Group 2 followed by Group 3 (47.86±3.09) and Group 1 (46.36±4.66). The percent sperm motility obtained across the groups in the present study was similar to that reported by several workers (Mandal, 1998; Pandey, 2001; Shivahare, 2013) in Murrah buffalo bulls. Bulls in Group 2 showed significantly higher sperm motility as compared to the other two groups; the positive effect of higher energy in this group reflected in terms of higher mass motility. The possible reason for that has been explained under mass motility that it could be because of the combined effect of lower scrotal size and higher testosterone profiles in bulls of Group 2. In beef bulls increased dietary energy shown to enhance scrotal fat accumulation in scrotum neck and skin which affects the scrotal thermoregulation that increases the scrotal temperature and decreases the sperm motility (Coulter et al., 1997). Similar finding were also obtained in the previous studies in beef bulls (Swaneopoel et al., 2008), ram (Fourie et al., 2004) and bulls (Girdheret al., 2008) who have found that feeding of high energy diet reduced the spermmotility. In contrary to these findings, Mandal et al. (2008) have obtained highersperm


420

motility by feeding high energy diet to the bulls.

ViabilityThe percent value of sperm viability was

73.97±2.7, 81.59±0.75 and 74.92±1.59 in Group 1, Group 2 and Group 3, respectively (Table 2). Sperm viability showed significant (P<0.05) difference among the groups and higher value was obtained in Group 2 as compared to other feed groups. Values of sperm viability obtained in the present study in different groups were in accordance with the values reported by earlier researchers in Murrah buffalo bulls (Mandal, 1998; Pandey, 2001). The benefit of higher (10%) feed energy level, explained above, provided to the bulls of Group 2 has not only reflected in higher value of sperm concentration, mass motility and sperm motility in this group but in higher sperm viability also. The present results are also in agreement with the findings of Coulter (1997) and Swaneopoel et al. (2008) where they have observed higher sperm viability in the bulls fed with medium energy diets.

Acrosome integrityThe percent value of acrosome integrity

was 69.91±2.92, 81.26±0.91 and 74.26±1.77 in Group 1, Group 2 and Group 3, respectively (Table 2). Acrosome integrity showed significant (P<0.05) difference among the groups and higher value was obtained in Group 2 (81.26±0.91) followed by Group 3 (74.26±1.77) and Group 1 (69.91±2.92). The values of acrosome integrity observed in this study in buffalo sperm are accordance with reported by earlier workers in Murrah buffalo bulls (Pant et al., 2002; Shivahre, 2013). Like other sperm quality parameters (percent sperm motility and viability) sperm acrosome integrity of bulls in the Group 2 found to be significantly higher than other two groups.

Morphological sperm abnormalitiesThe percent head sperm abnormalities

were (6.84±0.48, 5.25±0.36 and 7.18±0.50), mid-piece (3.78±0.36, 3.55±0.37 and 5.03±0.42) and tail (4.73±0.58, 3.96±0.38 and 5.27±0.76) in Group 1, Group 2 and Group 3, respectively. The percent total sperm abnormality was 15.36±1.16, 12.78±0.83 and 17.48±1.33 in Group 1, Group 2 and Group 3, respectively. The total morphological sperm abnormalities showed significant (P<0.05) difference among the groups and higher value was obtained in Group 3 (17.48±1.33) followed by Group 1 (15.36±1.16) and Group 2 (12.78±0.83) show in (Table 2). Thevalues of percent sperm abnormality obtained in the this study in different groups is in accordance with the values reported by various researchers (Singh,1987; Shukla et al., 2005), whereas lower valueshave reported in Murrah buffalo bulls (Shivahre, 2013). In the present study also the percent value of all types of sperms abnormalities and total abnormality were lesser than the acceptable range in the bulls of Group 2, whereas, in other groups these wereslightly higher but they were also with the acceptable range. The higher values of total abnormities in Group 3 and control could be due the fact that bulls of these groups had higher scrotal size which might have affected thermoregulation of the scrotum required for normal sperm production. Deposition of highly insulative lipids within thescrotal tissue due to high energy diets and might have reduced the radiation of heat from the scrotal surface, impairs the thermoregulation of the testis there by increasing testicular temperature (Coulter and Kozub, 1989). Fat deposits maydecrease the capacity for counter current heat exchange within the testicularvascular cone (Cook et al., 1994), limit scrotal thermoregulation and causesubstantially more sperm abnormalities (Swanepoel et al.,


421

Table 1. Effect of feed energy levels on dry matter intake, testosterone and reaction time in Murrah buffalo bulls.

ParametersGroup 1 (Control)

Group 2 (10% HE)

Group 3 (20%HE)

DMI **(kg/day) 2.16±0.02 2.23±0.02 2.29±0.20Testosterone* (ng/ml) 1.29±0.32 1.46±0.28 1.81±0.34Reaction time** (sec) 80.13±13.26 62.02±9.96 118.9±21.06

Values with different superscripts in a row differ significantly (*P<0.05, **P<0.01).

Table 2. Effect of feed energy levelson fresh semen quality of Murrah buffalo bulls.

ParametersGroup 1(Control)

Group 2(10% HE)

Group 3(20%HE)

Ejaculate volume (ml) 2.02±0.2 2.25±0.2 2.57±0.22Mass motility* (0-5) 2.13±0.23 3.01±0.06 2.23±0.13Spermconcentration*(million/ml)

895.61±73.0 1165.27±46.70 935.18±51.20

Sperm motility *(%) 46.36±4.66 66.84±1.52 47.86±3.09Viability* (%) 73.97±2.7 81.59±0.75 74.92±1.59Acrosomal integrity* (%) 69.91±2.92 81.26±0.91 74.26±1.77Morphological abnormality* (%) 15.36±1.16 12.78±0.83 17.48±1.33

Values with different superscripts in a row differ significantly (*P<0.05).

Table 3. Effect of feed energy levelson frozen semen quality of Murrah buffalo bulls.

ParametersGroup 1(Control)

Group 2(10% HE)

Group 3(20%HE)

Post-thaw motility* (%) 46.44±1.74 53.37±1.13 44.55±1.06Viability* (%) 70.87±1.5 71.55±0.66 67.69±1.3Acrosome integrity* (%) 70.32±1.6 73.83±0.82 69.90±1.24

Values with different superscripts in a row differ significantly (*P<0.05).


422

2008). Similar findingwith significantly higher sperm abnormalities on high energy diets in buffalo bulls (Bhosrekaret al., 1988), in beef bulls (Kedbe et al., 2007; Swanepoel et al., 2008). However, non-significantly higher spermabnormalities were found on high energy diets fed to the bulls (Barth et al., 2008; Azizunnesa et al., 2013; Shahzad et al., 2013).

Effect of feed energy levels on post-thaw sperm motility, viability and acrosome integrity

The percent post-thaw sperm motility was 46.44±1.74, 53.37±1.13 and 44.55±1.06 in Group 1, Group 2 and Group 3, respectively (Table 3). Post-thaw motility showed significant (P<0.05) difference among the groups and higher value was found in Group 2 (53.37±1.13) followed by Group 1 (46.44±1.74) and Group 3 (44.55±1.06). Values of post-thaw sperm motility obtained in the present study in different groups were in accordance with the values reportedin Murrah buffalo bulls (Singh et al., 2013; Kumar et al., 2014).

The percent viability was 70.87±1.50, 71.55±0.66 and 67.69±1.30 in Group 1, Group 2 and Group 3, respectively (Table 3). Sperm viability showed significant (P<0.05) difference among the groups and higher value was obtained (71.55±0.66) Group 2 followed by Group 1 (70.87±1.50) and in Group 3 (67.69±1.30). Value of sperm viability before freezing was higher so it could maintainit after freezing also. Values of viability obtained in the present study in different groups were in accordance with the values reported in Murrah buffalo bulls (Singh et al., 2013; Kumar et al., 2014).

The percent acrosome integrity was 70.32±1.60, 73.83±0.82 and 69.90±1.24 in Group 1, Group 2 and Group 3, respectively (Table 3). Acrosome integrity showed significant (P<0.05)

difference among the groups and higher value was obtained (73.83±0.82) in Group 2 followed by (70.32±1.60) Group 1 and in Group 3 (69.90±1.24). Similar finding was also obtained in a study in Murrah buffalo bulls (Nitharwal, 2013). The benefit of higher (10%) feed energy level, in bulls of Group 2, has not only reflected in higher sperm motility, viability and acrosome integrity in fresh semen but also in post-thaw frozen semen. As in general, there is a positive relationship between the qualities of fresh semen sample with the post-thaw quality.

CONClUSION

From the findings of the present study, it can be concluded that the buffalo bulls provided with higher energy (10%) than the recommended level in their diet, not only produced superior quality fresh semen but also maintained it even after cryopreservation as compared to other groups, thereby suggesting the scope of its incorporation in management of high genetic merit bulls for quality germplasm production.

ACKNOWlEDGEMENT

Authors are thankful to Director, NDRI to provide the necessary funds to carry out the research programme.

REFERENCES

Ahmad, M.L.M., M.Q. Ahmad, N. Sahir and M. Arsian. 1984. Age related changes in body


423

weight, scrotal size and plasma testosterone levels in buffalo bulls (Bubalus bubalis). Theriogenology, 22(6): 651-656.

Allen, M.S. 1997. Relation between fermentation acid production and gonadotropins concentrations in the ram. Anim. Prod., 34: 265-277.

Anzar, M., M. Ahmad, M. Nazir, N. Ahmad and I.H. Shah. 1993. Selection of buffalo bulls: Sexual behaviour and its relationship to semen production and fertility. Theriogenology, 40: 1187-1198.

Azizunesa-Zohara, F.B., F.Y. Bari and S.G. Alam. 2013. Effects of concentrate supplementation on reproductive performances and semen quality of indigenous rams in Bangladesh. J. Emb. Trans., 28(4): 325-335.

Barth, A.D., L.F.C. Brito and J.P. Kastelic. 2008. The effects of nutrition on sexual development of bulls. Theriogenology, 70: 485-494.

Baruselli, P.S. and N.A.T. Carvalho. 2005. Biotechnology of reproduction in buffaloes (Bubalus bubalis). Brazilian J. Anim. Breed., 29(2): 4-17.

Bester, N., L.M.J. Schwallbach, H.J.V. Merwe, J.P.C. Greyling and M.D. Fair. 2004. The influence of dietary concentrations on scrotal, testicular and semen characteristics of young Dorper rams. S. African J. Anim. Sci., 34(2): 53-55.

Bhosrekar, M.R., J.R. Purohit, A.B. Pande and B.R. Mangurkar. 1988. Effect of different seasons on frozen semen production in Murrah buffalo bulls. Indian J. Anim. Sci., 58: 1073-1074.

Brito, L.F.C., A.D. Barth, N.C. Rawlings, R.E. Wilde, D.H.Jr. Crews, P.S. Mir and J.P. Kastelic. 2007a. Effect of improved nutrition

during calfhood and peri-pubertal period on serum metabolic hormones, gonadotropins, and testosterone concentrations and on sexual development in bulls. Domest. Anim. Endocrin., 33(1): 1-18.

Brito, L.F.C., A.D. Barth, N.C. Rawlings, R.E. Wilde, D.H.Jr. Crews, P.S. Mir and J.P. Kastelic. 2007c. Effect of improved nutrition during calfhood on serum metabolic hormones, gonadotropins and testosterone concentrations and on testicular development in bulls. Domest. Anim. Endocrin., 33(4): 460-469.

Cailleau, J., S. Vermeire and G. Verhoeven. 1990. Independent control of the production of insulin-like growth factor-1 and its binding protein by cultured testicular cells. Mol. Cell Endocrinology, 69: 79-89.

Chase, C.C., R.E. Larsen, A.C. Hammond and R.D. Randel. 1993. Effect of dietary energy on growth and reproductive characteristics of Angus and Senepol bulls during summer in Florida. Theriogenology, 40: 43-63.

Cook, R.B., G.H. Coulter and J.P. Kastelic. 1994. The testicular vascular cone, scrotal thermoregulation and their relationship to sperm production and seminal quality in beef bulls. Theriogenology, 41: 653-671.

Coulter, G.H. 1994. Beef bull fertility: Factors affecting seminal quality, p. 307-315. In Michael, J.F. and S.S. Robert (eds.) Factors Affecting Calf Crop. CRC Press. Boca Raton London, New York, Washington, D.C., Florida, USA.

Coulter, G.H. and G.C. Kozub. 1989. Efficacy of methods used to test fertility of beef bulls used for multiple-sire breeding under range conditions. J. Anim. Sci., 67: 1757-1766.

Coulter, G.H., R.B. Cook and J.P. Kastelic. 1997.


424

Effects of dietary energy on scrotal surface temperature, seminal quality and sperm production in young beef bulls. J. Anim. Sci., 75: 1048-1052.

Fourie, P.J., L.M. Schwalbach, E.W.C. Neser and C.V. Westhuizen. 2004. Scrotal, testicular and semen characteristics of young dorper rams managed under intensive and extensive conditions. Small Rumin. Res., 54: 53-59.

Girdher, N., R. Prasad, M. Kumar and K. Singh. 2008. Effect of different planes of nutrition and mineral supplementation on nutrient utilization and semen quality of Frieswal bulls. Indian J. Anim. Sci., 78(7): 764-768.

Hancock, J.L. 1952. The morphology of bull spermatozoa. J. Exp. Biology, 29: 445-453.

Hosseini, S.M., S.M. Akbary, N. Maherisis and A.M. Aghsaghali. 2008. Effect of different energy levels of diet on feed efficiency, growth rate and carcass characteristics of fattening lambs. Iranian J. Anim. Vet. Adv., 7: 1551-1554.

Kebede, M., J.P.C. Greylimg and L.M.J. Schwalbach. 2007. Effect of season and supplementation on percent live sperm and sperm abnormalities in Horro (Zebu) bulls in sub-humid environment in Ethiopia. Tropical Animal Health and Production, 39(2): 149-154.

Kumar, P., D. Kumar, P. Singh, P.S. Yadav and S.K. Sarkar. 2014. Characteristics of frozen thawed semen in predicting the fertility of buffalo bulls. Indian J. Anim. Sci., 84: 389-392.

Lunstra, D.D. and G.H. Coulter. 1997. Relationship between infrared scrotal temperature pattern and natural mating fertility in beef bulls. J. Anim. Sci., 75: 767-774.

Mandal, D.K., K. Singh and S. Tyagi. 2008. Effect of

plane of nutrition on body growth, testicular characteristics and sexual behaviour of young Frieswal bulls. J. Remount Vet. Corps., 47: 227-242.

Mandal, D.K. 1998. Effect of surface cooling on reproductive performance of Murrah buffalo bulls. Ph.D. Thesis, National Dairy Research Institute, Deemed University, Karnal, India.

Meacham, T.N., T.J. Cunha, A.C. Warnick, J.F. Hentges and D.D. Hargrove. 1963. Influence of low protein rations on growth and semen characteristics of young beef bull. J. Anim. Sci., 22: 115-120.

Morrow, R.E., R.G. Elmore and A.L. Brooks. 1981. Growth and reproductive development of beef bulls tested on two levels of energy. J. Anim. Sci., 53: 188-204.

Nitharwal, K. 2013. Post thaw sperm functions of Murrah buffalo bull semen frozen during various seasons. M.V.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, Haryana, India.

Nolan, C.J., D.A. Necendorf and R.W. Godfrey. 1990. Influence of dietary energy intake on prepubertal development of Brahman bulls. J. Anim.Sci., 68: 1087-1096.

NRC. 2001. Nutrient Requirements of Dairy Cattle, 7th ed. National Dairy Research Institute.

Pandey, A.K. 2001. Effect of blood serum and caffeine on cryopreservation of buffalo spermatozoa. M.V.Sc. Thesis, Govind Ballabh Pant University of Agriculture and Technology, Pantnagar, India.

Pant, H.C., L.R. Barot, R. Kabiraj, A.K. Mishra and J.H. Prabhakar. 2002. Acrosomal integrity of buffalo spermatozoa and its relationship to fertility. Indian J. Anim. Reprod., 23(2): 110-112.


425

Patil, L.N. 2013. Effect of feed energy level on nutrient utilisation and growth in buffalo male calves. M.V.Sc. Thesis, National Dairy Research Institute, Deemed University, Karnal, Haryana, India.

Pruitt, R.J. and L.R. Corah. 1985. Effect of energy intake after weaning on the sexual development of beef bulls. Semen characteristics andserving capacity. J. Anim. Sci., 61: 1186-1193.

Pruitt, R.J., L.R. Corah and J.S. Stevenson. 1986. Effect of energy intake after weaning on the sexual development of beef bulls. II Age of first mating, age at puberty, testosterone and scrotal circumference. J. Anim. Sci., 63: 579-585.

Puri, J.P., S.S. Grewal, S. Sindhu and M.K. Rose. 2004. Effect of feeding of protected protein supplemented with urea treated straw on performance of buffalo calves. Indian J. Anim. Sci., 74: 319-320.

Rekwot, P.I., E.O. Oyedipe, P.M. Dawuda and V.O. Sekoni. 1997. Age and hourly related changes of serum testosterone and spermiogram of prepubertal bulls fed two levels of nutrition. Vet. J., 153: 341-347.

Seidel, G.E., B.W. Jr. Pickett, C.O. Wilsey and S.M. Seidel. 1980. Effect of high level of nutrition on reproductive characteristics of Angus bulls. In Proceeding of the 9th International Congress on Animal Reproduction and Artificial Insemination, Madrid, Spain.

Selvaraju, S., T. Sivasubramani, B.S. Raghavendra, P. Raju, S.B.N. Rao, D. Kumar and J.P. Ravindra. 2012. Effect of dietary energy on seminal plasma insulin-like growth factor-1 (IGF-1), serum IGF-1 and testosterone levels, semen quality and fertility in adult rams. Theriogenology, 78(3): 646-655.

Sethi, R.K. 1999. Breeding for higher genetic improvement. National Symposium, Animal Production in Next Millennium, CIFMA, Bangalore, India.

Shahzad, A., M. Sajjad, N. Ullah, A. Shamim, I. Khan and M. Khan. 2013. Serum testosterone level, scrotal circumference and semen characteristics in Nili-Ravi buffalo bulls fed two levels of feed. International Livestock Nutrition Conference, Pakistan.

Shivahre, P.R. 2013. Disposal pattern analysis and evaluation of Murrah buffalo males on the basis of conventional semen evaluation and in vitro fertility tests. M.V.Sc. Thesis, National Dairy Research Institute, Karnal, Haryana, India.

Shukla, M.S. and A.K. Mishra. 2005. Correlation between seminal characteristics in Murrah bulls. Indian J. Anim. Sci., 75(3): 263-266.

Shukla, M.K., A.K. Mishra and H.P. Gupta. 2005. Studies on the biochemical constituents of Murrah buffalo seminal plasma, p. 23. Souvenir 21st Annual Convention of ISSAR and National Symposium.

Singh, I. 2009. Buffalo reproduction an Indian perspective. Rev. Bras. Repro. Anim. Sup. Belo Horizonte, 6: 91-97.

Singh, N.P. 1987. Studies on cryopreservation of buffalo semen in relation to various extenders and initial freezing temperature. M.Sc. Thesis, National Dairy Research Institute, Karnal, Haryana, India.

Singh, P., D. Kumar, P. Kumar, I. Singh and P.S. Yadav. 2013. Cryopreservation and quality assessment of buffalo bull semen collected from farmer`s doorstep. Agric. Res., 2(2): 148-152.

Snedecor, G.W. and Cochran, W.G. 1967. Statistical Methods. Iowa State University


426

Press, Ames, USA.Swanepoel, F.J.C., G.J. Taylor, E.C. Webb and

A. Stroebel. 2008. Effect of nutrition on testicular traits of tropically adapted yearling beef bulls. Aust. J. Exp. Agr., 48: 950-953.

Tovar-Luna, I., R. Puchala, T. Sahlu, H.C. Freetly and A.L. Goetsch. 2011. Effect of level of feeding on energy utilisation by Angora goat. J. Anim. Sci., 89(1): 142-149.


427

ABSTRACT

The present study was accomplished to determine the prevalence and risk factors of coccidiosis in cattle and buffaloes of Ravi River region, Lahore from October, 2012 to September, 2013. A total of 500 fecal samples (cattle n=250; buffaloes n=250) were randomly collected and coccidial oocysts were identified using Direct Smear Method and Salt Floatation Techniques. Data regarding each sampled animal was entered in a data capture form. The Eimeria spp. were identified on the basis of variation in shape, size, texture, color of oocyst wall, polar cap and presence or absence of micropyle of oocysts using taxonomic key. Overall prevalence of coccidiosis in cattle and buffaloes was recorded as 57.2% and 58.8%, respectively. Seven Eimeria species identified from cattle were E. zuernii (56.64%), E. bovis (41.25%), E. ellipsoidalis (33.56%), E. canadensis (26.57%), E. cylindrical (21.67%), E. alabamensis (17.48%), and E. subspherica (10.45%). On the other hand, common Eimeria spp. found in buffaloes were E. bovis (52.38%), E. zurnii (46.93%), E. canadensis (31.29%), E.

ellipsoidalis (23.12%), E. alabamensis (15.64%) and E. cylindrical (11.56%). Coccidial infection was significantly higher (P<0.05) in females compared to males in both species. Prevalence of Emeria was significantly higher (P<0.05) in <6 m of age cohorts (cattle, 66.66%; buffaloes, 70.31%) as compared to ≥1 year animals (cattle, 44.87%; buffaloes, 48.91%). Peak prevalence was recorded in August. A significant difference (P<0.05) in prevalence was observed in stall feeding confined animals compared to animals with grazing having outdoor access. Prevalence had significantly increased (P<0.05) in animals with poor and weak body condition than healthy. A significant difference (P<0.05) in prevalence was observed in diarrheic animals compared to normal feces. It is concluded that coccidial infestation is severe in both species and bovine coccidiosis is widely distributed in Ravi River region Lahore. It is suggested that an integrated strategies should be implemented for the effective prevention and control of coccidiosis in cattle and buffaloes in this region.

Keywords: buffaloes, Bubalus bubalis, cattle, Bos taurus, coccidiosis, Pakistan

PREVALENCE AND RISK FACTORS OF COCCIDIOSIS IN BUFFALOES AND CATTLE FROM RAVI RIVER REGION, LAHORE, PAKISTAN

M.S. Jahanzaib1, M. Avais1,*, M.S. Khan1, F.A. Atif2, N. Ahmad3, K. Ashraf3 and M.U. Zafar1

1Department of Clinical Medicine and Surgery, University of Veterinary and Animal Sciences, Lahore, Punjab, Pakistan, *E-mail address: [email protected] of Animal Sciences, University College of Agriculture, University of Sargodha, Punjab, Pakistan3Department of Parasitology, University of Veterinary and Animal Sciences, Lahore, Punjab, Pakistan

Original Article


428

INTRODUCTION

Bovine coccidiosis is a common and worldwide disease of cattle and buffaloes characterized by decreased growth rate, bloody diarrhea and sometimes death, associated with substantial economic losses to the beef and dairy industries (Daugschies and Najdrowski, 2005 and Dedrickson, 2006). This disease is more sever in early-weaned animals, but may occur frequently in calves between six to twelve months of age (Kennedy, 2006). The disease may affect adult animals as well. The calves at six months of age have 100% infestation rate but less than 5% show clinical signs (Dedrickson, 2006). Cicek et al. (2007) reported that younger animals have higher prevalence of coccidial infections (27.23%) than older animals (15.65%). Several other species including sheep, goats, cats, dogs, poultry and rabbits are also susceptible to this infection (Nalbantoglu et al., 2008). Although, coccidiosis is host specific, every host may be infected with several species of coccidia at the same time (Andrews, 2002).

Stressed conditions like poor hygiene, poor nutrition and overcrowding reduce animal resistance, which may enhance coccidial infections (Oluwadare et al., 2010). Coccidiosis is more likely to occur in animals kept under overcrowded and confined areas (Abebe et al., 2008). Fecal contaminated feed and water are also the main causes of Eimeria transmission (Taylor et al., 2007). Diarrhoea and dehydration is the usual outcome of coccidiosis. If weight loss and dehydration are severe enough, cattle may die from coccidiosis (Pilarczyk and Balicka-Ramisz, 2004). Moreover, it results in failure of young stock to gain weight and grow to their full potential (Radostits et al., 2007).

The subclinical cases usually remain undiagnosed and cause great production and economic losses to milk and beef industry worldwide (Abebe et al., 2008). Ravi River banks of Lahore Municipality are the densely populous region of cattle and buffalo population. Information on the determinants of bovine coccidiosis is extremely lacking. Most of the work has been done on coccidiosis in poultry but little work has been done on coccidiosis of cattle and buffaloes in Pakistan. Therefore, keeping in view of its importance the current study was planned to determine the prevalence and risk factors of coccidiosis in cattle and buffaloes in Ravi River region of Lahore Municipality.


Study areaThe current study was conducted in Ravi

River region, Lahore. This city is located at Pakistan India border, close to Ravi River. Its geographical coordinates are, 31°33’ North and 74°20’ East with an altitude of 214 m (702 ft) from sea. The Northern side is watered by Ravi River originating from India with dense cattle and buffaloes population around river banks. The city of Lahore experiences extreme limits of temperature, though the rainy season is a pleasing time. The climate of the city is a hot semi-arid with wet, long and very hot summers, dry winters, dust storms and heavy rains in monsoon. Weather of city is extreme throughout May, June and July, when the temperature rises to 40 to 48 oC. The winter months from December to February are the coldest with the mercury level dropping down to may drop to -1oC.

http://en.wikipedia.org/wiki/Semi-arid_climate

http://en.wikipedia.org/wiki/Dust_storms

http://en.wikipedia.org/wiki/Monsoon


429

AnimalsA total of 500 animals (n=250 cattle;

n=250 buffaloes) were examined for the presence of Eimeria oocysts to find out the prevalence of coccidiosis in Ravi River region, Lahore. The data regarding each animal including identification (owner name, address), animal characterization (age, sex, breed), description of home environs (confined/outdoor access, if confined, either paved/dirt yard), feeding system (stall feeding, grazing, both), Body condition score (1=poor, 2=weak, 2.5=medium, 3=good, 4=fat), fecal score (1=normal, 2=soft/does not hold form, 3=runny/spreads easily, 4=devoid of solid matter) was recorded on a Proforma during sampling.

Collection of fecal samplesAbout 5 grams of fecal sample was

collected directly from the rectum of each animal after wearing disposable plastic gloves from October, 2012 to September, 2013. Fecal samples were then transferred into self-sealing polythene bags, labeled and preserved in ice before transporting to Medicine Laboratory at University of Veterinary and Animal Sciences, Lahore. The samples were refrigerated at 4oC in the Laboratory for maximum 2 days for further processing.

Processing of fecal samplesThe fecal samples were first examined

by Direct Smear Method and then the negative samples were further processed for the presence or absence of the coccidial oocysts by Salt Floatation Technique (Zajac and Conboy, 2006).

Identification of Eimeria speciesEimeria species were identified on the

basis of morphology of Eimeria oocysts (shape, size, texture, color of oocyst wall, polar cap and

presence or absence of micropyle) using taxonomic key (Daugschies and Najdrowski 2005, Levine 1985).

The prevalence of coccidiosis was determined using the formula:

Prevalence (%) = Number of infected individuals (n) x 100 Total number of sampled individuals (N)

Statistical analysis The data on prevalence was analyzed by

Chi-Square test using statistical software package “SPSS, version 17”. A probability level of P<0.05 was considered as statistically significantly different.

RESUlTS

Out of 250 fecal samples each from cattle and buffaloes 143 (57.2%) and 147 (58.8%) were positive for coccidiosis, respectively. Statistically, the difference in prevalence was found non-significant (P>0.05) in both species (Table 1). Prevalence of coccidiosis was 45.23% and 59.61% in male and female cattle, respectively. Similarly, prevalence of coccidiosis was 48.8% and 60.36% in male and female buffaloes, respectively. Statistically, the prevalence of coccidiosis was non-significant (P>0.05) in male and female animals (Table 2). When prevalence of coccidiosis according to breed of cattle and buffaloes was compared non-significant difference (P>0.05) was recorded (Table 3). Prevalence of coccidiosis in cattle and buffaloes was significantly high (P<0.05) in animals below 6 m of age than >1 year of age (Table 4). Month-wise prevalence of coccidiosis in cattle and buffaloes is given in Table 5. Significantly higher (P<0.05) prevalence of coccidiosis was found in August as compared to September October and July.


430

Table 1. Prevalence of coccidiosis in cattle and buffaloes in Ravi River region, Lahore.

Animal No. of samples Examined No. of samples positive Prevalence (%) P-valueCattle 250 143 57.2a

0.3585Buffalo 250 147 58.8ab

Values in same column having similar superscript letters are non-significantly (P>0.05) different.

Table 2. Sex-wise prevalence of coccidiosis in cattle and buffaloes in Ravi River region, Lahore.

Animal Sex Samples examined Samples positive Prevalence (%) P-value

CattleMale 42 19 45.23a

0.08587Female 208 124 59.61ab

BuffaloMale 33 16 48.48a

0.1966Female 217 131 60.36ab

Values in same column havingsimilar superscript letters are non-significantly (P>0.05) different.

Table 3. Breed-wise prevalence of coccidiosis in cattle and buffaloes.

Animal Breed Samples examined Samples positive Prevalence (%) P-value

Cattle

Sahiwal 76 44 57.89a

0.8572Friesian 29 16 55.17ab

Jersey 37 19 51.35abc

Crossbred 108 64 59.26abcd

BuffaloNili Ravi 228 135 59.21a

0.6734Kundi 22 12 54.54ab

Values in same column havingsimilar superscript letters are non-significantly (P>0.05) different.

Table 4. Age-wise prevalence of coccidiosis in cattle and buffaloes in Ravi River region, Lahore.

Animal Age Samples Examined Samples Positive Prevalence (%) P-Value

Cattle< 6 m 93 62 66.66a

0.015926 m - 1 year 79 46 58.22b

>1 year 78 35 44.87c

Buffalo< 6 m 64 45 70.31a

0.025426 m - 1 year 94 57 60.63b

>1 year 92 45 48.91c

Values in same column having different superscript letters are significantly different (P<0.05)


431

Table 5. Month wise prevalence of coccidiosis in cattle and buffaloes in Ravi River region, Lahore.

Animal Month Samples examined Samples positive Prevalence (%) P-value

Cattle

July 63 30 47.62a

0.03148August 74 52 70.27b

September 66 38 57.57c

October 47 23 48.93d

Buffalo

July 68 34 50.00a

0.01689August 63 47 74.60b

September 71 42 59.15c

October 48 24 50.00d Values in same column for each species having different superscript letters are significantly different (P<0.05).

Table 6. Prevalence of different Eimeria species in cattle in Ravi River region, Lahore.

Eimeria specie Positive cases out of 143 Prevalence (%)E. bovis 81 56.64E. zurnii 59 41.25E. ellipsoidalis 48 33.56E. canadensis 38 26.57E. cylindrica 31 21.67E. alabamensis 25 17.48E. subspherica 15 10.45

Table 7. Different Eimeria species prevalent in buffaloes in Ravi River region, Lahore.

Eimeria specie Positive cases out of 147 Prevalence (%)E. bovis 77 52.38E. zurnii 69 46.93E. canadensis 46 31.29E. ellipsoidalis 34 23.12E. alabamensis 23 15.64E. cylindrica 17 11.56


432

Seven Eimeria species were identified from positive fecal samples of cattle viz. E. zuernii, E. bovis, E. canadensis, E. ellipsoidalis, E. alabamensis, E. canadensis and E. cylindrica. Out of them, E. zuernii and E. bovis were highly prevalent species with the prevalence of 56.64% and 41.25%, respectively, followed by E. ellipsoidalis (33.56%), E. canadensis (26.57%), E. cylindrica (21.67%), E. alabamensis (17.48%) and E. subspherica (10.45%, Table 6). Likewise, six Eimeria species were identified from positive buffalo fecal samples viz. E. bovis, E. zurnii, E. ellipsoidalis, E. alabamensis, E. Cylindrica and E. canadensis. E. bovis and E. zurnii. Most prevalent species among them with the highest prevalence of 52.38% and 46.93% respectively, followed by E. canadensis (31.29%), E. ellipsoidalis (23.12%), E. alabamensis (15.64%) and E. cylindrica (11.56%, Table 7). The prevalence of coccidiosis in both the species was significantly higher (P<0.05) in animals housed in confined and dirt yard compare to animals housed on paved floor with outdoor access (Table 8 and Table 9). Data on prevalence of coccidiosis in cattle and buffaloes according to feeding system is given in Table 10. A strong association was found between Eimeria infestation and animal feeding systems. Prevalence was higher among stall fed animals in both cattle (71.64%) and buffaloes (73.68%). Grazing animals were infested minimum with the prevalence of 28.58% and 31.91% in cattle and buffaloes, respectively.

Data on prevalence of coccidiosis according to body condition score in cattle and buffaloes are shown in Table 11 and Table 12. Eimeria infestation had strong association (P<0.05) with body condition score. Animals with Poor body condition (score 1) were observed to have highest prevalence in both cattle and buffaloes, compared to higher body condition score. Fecal score also had

strong association (P<0.05) with coccidiosis both species. Similarly, highest (82.35% and 84.21%) (Table 13) prevalence was found in the diarrheic animals whereas, lowest (36.19% and 42.85%) prevalence was observed in animals with normal fecal score in cattle and buffaloes respectively. Prevalence of coccidiosis between normal and diarrheic feces was found statistically significant (P<0.05) in cattle and buffaloes.

DISCUSSION

Bovine coccidiosis is a common and worldwide disease of cattle and buffaloes and usually associated with decreased growth rate, bloody diarrhea and sometimes death. The disease is caused by intracellular protozoan ‘coccidia’ which reside in cell linings of intestine, mostly affecting calves resulting in substantial economic losses all over the world to the beef and dairy production. In present study, overall prevalence of coccidiosis in cattle and buffaloes was recorded as 57.2% and 58.8%, respectively. Previously, Afzal (1996) and Rehman et al. (2011) mentioned the prevalence as 17% and 47.09% in Pakistan. The findings of the present study are congruent with other researchers from India, 50%, (Harpreet and Daljit, 2008), South Africa, 52% (Matjila and Penzhorn, 2002) and Kenya, 61.4% (Waruiru et al., 2000. Similar findings were also reported in Poland (Klockiewicz et al., 2007), Turkey (Nalbantoglu et al., 2008; Hatice et al., 2007), in Argentina (Sanchez et al., 2008; Pilarczyk et al., 2000; Romaniuk et al., 2004) and Ethiopia (Ferid et al., 2012). Our results are not in agreement with Klockiewicz et al. (2007) and Nalbantoglu et al. (2008) and Hatice et al. (2007), Sanchez et al. (2008), Pilarczyk et al. (2000), Romaniuk et al.


433

Table 8. Prevalence of coccidiosis in cattle according to housing system.

Housing system Samples examined Samples positive Prevalence (%) P-value

ConfinedPaved 53 31 58.49a

0.01447Dirt yard 61 44 72.13b

Outdoor access 136 68 50.00c

Values in same column having different superscript letters are significantly different (P<0.05).

Table 9. Prevalence of coccidiosis in buffaloes according to housing system.

Housing system Samples examined Samples positive Prevalence (%) P-value

ConfinedPaved 49 30 61.22a

0.01299Dirt yard 58 43 74.13b

Outdoor access 143 74 51.74c


Table 10. Prevalence of coccidiosis in cattle and buffaloes according to feeding system.

AnimalFeeding system

Samplesexamined

Samples positive

Prevalence (%) P-value

CattleStall feeding 67 48 71.64a

0.00004706Grazing 42 12 28.58b

Both 141 83 58.86c

BuffaloStall feeding 76 56 73.68a

0.00002712Grazing 47 15 31.91b

Both 127 76 59.84c

Values in same column having different superscript letters are significantly different (P<0.05)

Table 11. Prevalence of coccidiosis in cattle according to body condition score.

Body condition score Samples examined Samples positive Prevalence (%) P-value1 (Poor) 26 19 73.07a

0.0046172 (Weak) 81 54 66.66b

2.5 (Medium) 74 43 58.10c

3 (Good) 48 18 37.5d

4 (Fat) 21 9 42.85e



434

Table 12. Prevalence of coccidiosis in buffaloes according to body condition score.

BCS Samples Examined Samples Positive Prevalence (%) P-value1 (Poor) 25 18 72.00a

0.12402 (Weak) 45 31 68.88ab

2.5 (Medium) 84 50 59.52abc

3 (Good) 67 32 47.76d

4 (Fat) 29 16 55.17cde


Table 13. Prevalence of coccidiosis in cattle according to fecal score.

Animals Fecal scoreSamples

examinedSamples positive

Prevalence (%)

P-value

Cattle

1 (Normal) 105 38 36.19a

0.0000001202 (Soft) 89 60 67.41b

3 (Runny) 39 31 79.48c

4 (Devoid of solid matter)

17 14 82.35cd

Buffalo

1 (Normal) 112 48 42.85a

0.000014082 (Soft) 83 54 65.06b

3 (Runny) 36 29 80.55c

4 (Devoid of solid matter)

19 16 84.21cd

Values in the same column bearing different superscript letters are statistically significantly different (P<0.05).


435

(2004) and Ferid et al. (2012). The variations are attributed to seasonal, climatic and geographical differences, management and husbandry practices in different countries.

Our study demonstrated significantly higher (P<0.05) prevalence of coccidiosis in <6 months age cohorts as compared to >1 year of age. According to Waruiru et al. (2000), Cicek et al. (2007), Abebe et al. (2008), Priti et al. (2008), Lassen et al. (2009) and Rehman et al. (2011) calves are more susceptible to coccidiosis than adults due to immature immune system (Khan et al., 2013). Our findings suggested that coccidiosis is more common in August. Similar findings were reported by Kphara and singh (1986) and Woji et al. (1994). An increase in prevalence of Eimeria in Moon Soon (rainy season) and post-Moon Soon season could be due to increase in high rain fall and temperature favoring the development of oocysts (Soulsby, 2006). Waruiru et al. (2000) reported higher occurrence of coccidiosis in calves in wet season than dry season. Lower prevalence in hot and cold seasons as depicted by McKellar (2008) as summer and winter coccidiosis attributed to severe weather stress.

When breed-wise prevalence of coccidiosis in cattle and buffaloes were compared, it was found that breed is not a risk factor for coccidiosis. Similar findings were reported by Rehman et al., 2011 and Jäger et al. (2005). Seven Eimeria species were identified from fecal samples of cattle and six from buffaloes in the study area. The E. bovis and E. zuernii were found to be most prevalent species among them. Results of the current study were strongly justified by Rehman et al. (2011), Klockiewicz et al. (2007), Koutny et al. (2012), Samson-Himmelstjerna et al. (2006) and others (Ernst et al., 1984; Kennedy and Kralka, 1987). Cornelissen et al. (1995) reported highest prevalence

of E. bovis followed by E. zurnii in both species. The E. bovis and E. zuernii are the most pathogenic species of cattle and buffaloes (Levine, 1985). The prevalence of coccidiosis in both the species was significantly higher (P<0.05) in confined animals kept at dirt yard compare to animals reared on paved floor with outdoor access because it is easy to clean paved floor than dirt yard. These results are very much similar to Rehman et al. (2011) and Ernst et al. (1987) who reported coccidiosis in cattle is more common in confined herds than animals kept on pastures. In present study, a strong association was found between Eimeria infestation and animal feeding systems. Likewise, coccidiosis was more prevalent in stall fed animals compare to free pasture grazing animals. These results are in agreement with the recommendations of McKellar (2008) and Rehman et al. (2011) to adopt feeding system to avoid fecal contamination of feed. Coccidiosis was comparatively more prevalent in animals with poor body condition than in animals with good body condition. Similar findings were reported by Rehman et al. (2011) they mentioned that Eimeriosis is higher in animals with poor body condition than good body condition. Eimeria infestation in cattle and buffaloes was observed to be highly influenced (P<0.05) by fecal score in present study. Coccidiosis was found more prevalent in diarrheic animals compare to animals with normal feces in both the species. These results were strongly justified by Bangoura et al. (2011). They mentioned that high E. zurnii and E. bovis oocysts were recovered in diarrheic animals than animals with normal feces.

In conclusion, coccidiosis is widely distributed in cattle and buffaloes of Ravi River region, Lahore. Risk factors significantly associated with coccidiosis are age, month, housingand feeding systems, body condition score and fecal


436

score.

REFERENCES

Abebe, R., A. Wossene and B. Kumsa. 2008. Epidemiology of Eimeria infections in calves in Addis Ababa and DebreZeit dairy farms, Ethiopia. Int. J. Appl. Res. Vet. Med., 6: 24-30.

Afzal, M. 1996. Taxonomy and prevalence of Eimeria species infecting young buffalo and cattle calves and their effect on various blood components. M.Sc. Thesis, University Agriculture Faisalabad, Pakistan.

Andrews, T. 2002. UK Coccidiosis survey in calves. Vet. Times., 34(32): 22.

Bangoura, B., H.C. Mundt, R. Schmäschke, B. Westphal and A. Daugschies. 2011. Prevalence of Eimeria bovis and Eimeria zuernii in German cattle herds and factors influencing oocyst excretion. Parasitol. Res., 1: 129-138.

Cicek, H., F. Sevimli, E. Kozan, M. Köse, M. Eser and N. Doğan. 2007. Prevalence of coccidia in beef cattle in western Turkey. Parasitol. Res., 101: 1239-1243.

Cornelissen, A.W., R. Verstegen, H. Van den Brand, N.M. Perie. M. Eysker, T.J. Lam and A. Pijpers. 1995. An observational study of Eimeria species in housed cattle on Dutch dairy farms. Vet. Parasitol., 56: 7-16.

Daugschies, A. and M. Najdrowski. 2005. Eimeriosis in cattle: current understanding. J. Vet. Med. B., 52: 417-427.

Dedrickson, B.J. 2006. Coccidiosis in Beef Calves. Alpharma. Animal Health Division Fort Lee, U.S.A.

Ernst, J.V., H. Ciordia and J.A. Stuedemann. 1984.

Coccidia in cows and calves on pasture in North Georgia, U.S.A. Vet. Parasitol., 15: 213-221.

Ferid, D., Y. Amede and M. Bekele. 2012. Calf coccidiosis in selected dairy farms of dire dawa, eastern Ethiopia. Glob. Veterinaria, 9: 460-464.

Harpreet, K. and K. Daljit 2008. Prevalence of gastrointestinal parasites in domestic animals of Patiala and its adjoining areas. J. Vet. Parasitol., 22: 13-17.

Jäger, M., M. Gualy, C. Bauer, K. Failing, G. Erhardt and H. Zahner. 2005. Endoparasites in calves of beef cattle herds: management systems dependent and genetic influences. Vet. Parasitol., 131: 173-191.

Khan, M.N., Tauseef-ur-Rehman, M.S. Sajid, R.Z. Abbas, M.A. Zaman, A. Sikandar and M. Riaz. 2013. Determinants influencing prevalence of coccidiosis in Pakistani buffaloes. Pak. Vet. J., 33: 287-290.

Kennedy, J.M. 2006. Coccidiosis in cattle. Alberta Feedlot, Management guide.

Kennedy, M.J. and A. Kralka. 1987. A survey of Eimeria spp. İn cattle in central Albertia. Can. Vet. J., 3: 124-125.

Klockiewicz, M., J. Kaba, K. Tomczuk, E. Janecka, A.B. Sadzikowski, K. Rypuła, M. Studzinska and J. Małecki-Tepicht. 2007. The epidemiology of calf coccidiosis (Eimeria spp.) in Poland. Parasitol. Res., 101: 121-128.

Koutny, H., A. Joachim, A. Tichy and W. Baumgartner. 2012. Bovine Eimeria species in Austria. Parasitol. Res., 110: 1893-1901.

Kphara, S.S. and J. Singh. 1986. Coccidiosis in buffalo-calves and its treatment. Buffalo Bull., 5: 9-16.

Lassen, B., A. Viltrop, K. Raaperi and T. Jarvis

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Bangoura B%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Mundt HC%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Schm%C3%A4schke R%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Westphal B%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Daugschies A%22%5BAuthor%5D


437

2009. Eimeria and Cryptosporidium in Estonian dairy farms in regard to age, species, and diarrhea. Vet. Parasitol., 166: 212-219.

Levine, N. 1985. Veterinary Protozoology. The Iowa State University Press, Iowa. USA.

Matjila, P.T. and B.L. Penzhorn. 2002. Occurrence and diversity of bovine coccidia at three localities in South Africa. Vet. Parasitol., 2: 93-102.

McKellar, A.Q. 2008. Gastrointestinal parasites of ruminants. In Kahn, C.M., S. Line and S.E. Aiello (eds.) The Merck Veterinary Manual, Whitehouse Station, NJ, USA.

Nalbantoglu, S., B. Sari1, H. Cicek and Z. Karaer. 2008. Prevalence of Coccidian species in the water buffalo (Bubalus Bubalis) in the province of Afyon, Turkey. Acta Vet. BRNO, 77: 111-116.

Oluwadare, A.T., J.A. Ajayi, O.O. Ajayi, B.A. Ogwurike, O. Olaniyan and N.I. Ogo. 2010. Studies on some aspects of the bionomics of bovine coccidiosis in plateau State, Nigeria. Nigerian Annals of Natural Science, 10: 9-27.

Pilarczyk, B. and A. Balicka-Ramisz. 2004.Occurrrence of protozoa Eimeria and Cryptosporidium in calves from west pomerania. Acta Sci. Pol. Zootechnica., 3: 49-56.

Priti, M., S.R.P. Sinha, S. Sucheta, S.B. Verma, S.K. Sharma and K.G. Mandal 2008. Prevalence of bovine coccidiosis at Patna. J. Vet. Parasitol., 22: 5-12.

Radostits, O.M., C.C. Gay, K.W. Hinchcliff and P.D. Constable. 2007. Veterinary Medicine: A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs and Goats, 10th ed. Elsevier Health Sciences, Philadelphia, PA, USA.

p. 1498-1506.Rehman, T.U., M.N. Khan, M.S. Sajid, R.Z. Abbas,

M. Arshad, Z. Iqbal and A. Iqbal. 2011. Epidemiology of Eimeria and associated risk factors in cattle of district Toba Tek Singh. Pakistan Parasitology Research, 108: 1171-1177.

Romaniuk, K., K. Reszka and E. Lasota. 2004. Influence of animal breeding, manner on the occurrence of internal parasites. Wiad. Parazytol., 50(3): 647-651.

Soulsby, E.J.L. 2006. Helminths, Arthropods and Protozoa of Domesticated Animals. Baillier Tindall, UK.

Sanchez, R.O., J.R. Romero and R.D. Founroge. 2008. Dynamics of Eimeria oocyst excretion in dairy calves in the Province of Buenos Aires (Argentina), during their first 2 months of age. Vet. Parasitol., 151: 133-138.

Samson-Himmelstjerna, G.V., C. Epe, N. Wirtherle, V.V.D. Heyden, C. Welz, I. Radeloff, J. Beening, D. Carr, K. Hellmann, T. Schnieder and K. Krieger. 2006. Clinical and epidemiological characteristics of Eimeria infections in first-year grazing cattle. Vet. Parasitol., 136: 215-221.

Taylor, M.A., R.L. Coop and R.L. Wall. 2007. Veterinary Parasitology, 3rd ed. Blackwell Science Ltd., Oxford. UK.

Waruiru, R.M., N.C. Kyvsgaard, S.M. Thamsborg, P. Nansen, H.O. BÖgh, W.K. Munyua and J.M. Gathuma. 2000. The prevalence and intensity of helminth and coccidial infections in dairy cattle in central Kenya. Vet. Res. Commun., 24: 39-53.

Woji, A.Y., D.A. Little and O.A. Ikwuegbu. 1994. Prevalence of coccidial infections in the west African dwarf goat in the subhumid

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Rehman TU%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Khan MN%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Sajid MS%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Abbas RZ%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Arshad M%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Iqbal Z%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Iqbal A%22%5BAuthor%5D


438

zone of Nigeria. Trop. Anim. Health Prod., 26: 1-6.

Zajac, A.M. and G.A. Conboy. 2006. Veterinary Clinical Parasitology. Blackwell publishing, USA.


439

ABSTRACT

As a breed conservation measure in Toda buffaloes, a unique, ferocious, semi wild breed of Nilgiris district of Tamilnadu, whose population is dwindling over the years, an attempt has been made towards the collection and cryopreservation of embryos. Toda buffalo cows (10) and Toda bulls (3) used for the study were representative samples of the breed sourced from Toda hamlets in the breeding tract and maintained under organized farm conditions. The response for superovulation was 93.33% (28/30) and 82.14% (23/28) of the animals were flushed. A total of 39 embryos were recovered, of this 26 viable embryos were cryopreserved. The viable embryo recovery rate per animal flushed was 1.13. buffaloes administered with 400 mg of FSH responded higher than those administered with 600 mg. Buffaloes with bigger superovulatory corpus luteum (SOV CL) had significantly higher ovulation rate (3.50 ± 0.26) and viable embryo recovery (1.46 ± 0.49) than animals with medium or small SOV CL. The viable embryo recovery rate was higher on 10th day SOV (1.35 ± 0.36) than on 9th day (0.75 ± 0.75) of starting of FSH treatment. Donors in standing estrum yielded a significantly higher number of total embryos (2.00 ± 0.41 vs 0.60 ± 0.30) and viable embryos (1.33 ± 0.36 vs 0.40 ± 0.40) than the donors with non standing estrum.

Keywords: buffaloes, Bubalus bubalis, Toda buffalo, conservation, superovulation, embryo cryopreservation

INTRODUCTION

The Toda buffaloes, a unique breed traditionally maintained by the Toda tribes of Nilagiri district, has a long history as it was first described by Finicio in 1603 (cited by Rivers, 1906). Usually a herd of Toda buffaloes consists of a few females with rarely one or two males. Toda bulls are known to stay in dense forests and will come out during the breeding season. Toda buffaloes are known for a very high fat (8.00%) content of milk (Karthikeyan, 1995). Toda buffaloes are very hardy and they survive and flourish on pasture alone, without additional feed/fodder. They are well adapted to harsh climate of Nilgiris.

The breed is associated with the Toda tribals economically and socially. With the change in the living pattern of the Todas, the breed has lost its economic importance but still it has a cultural / religious relation with their owners. A recent census (2013) indicated that the Toda buffalo population in Nilgiris district has decreased from 3314 in 1994 to 1320 in 2013. In addition the natural habitats of Toda buffaloes are fast disappearing; the grass land

SUPEROVULATORY RESPONSES AND EMBRYO RECOVERY IN GERMPLASM CONSERVATION OF SEMI WILD TODA BUFFALOES OF NILGIRIS

R. Anil Kumar1,*, M. Iyue1, D.V. Patel2 and R. Kasiraj2

1Sheep Breeding Research Station, Tamilnadu Veterinary and Animal Sciences University,Sandynallah, Ooty, The Nilgiris, *E-mail: [email protected] 2Sabarmati Ashram Gaushala, Bidaj Farm, PO- Lali, Dist, Kheda, Gujarat, India

Original Article



440

have come down by a factor of six from 29,875 ha in 1849 to about 4700 ha and in few areas of the district there is 100 percent reduction in grass land (Kumar, 1997). Hence intense species management becomes highly essential for the Toda buffaloes. The oocyte and embryo related technologies for enhancing reproduction has been used significantly in livestock, laboratory animals and humans (Farstad, 2000; Sharkey et al., 2001; Squires et al., 2003; Baldassarre and Karatzas, 2004 and Devroey and Van Steirteghem, 2004). However, embryo transfer and IVF had a negligible impact on conservation of endangered and wild animals. This project with the aim of conservation of germ cell in the form of embryos in Toda buffaloes was carried out as a collaborative project between Sabarmati Ashram Gaushala-SAG (managed by National Dairy Development Board- NDDB) and Sheep Breeding Research Station, Tamil Nadu Veterinary and Animal Sciences University (TANUVAS), Chennai.


Toda buffaloes Characteristically, the Toda buffaloes are

medium size animals; body is fairly long with a broad and deep chest. They have short, strong and sturdy legs. They have two characteristic white to light brown chevron markings, one around the jowl and other anterior to the brisket. The horns are typically long, set wide apart curved outward, slightly downward and upward with the points recurved inward forming a crescent shape or semi circle. They have chromosomal complement of 50 and the morphology resembles (first 5 pairs were submetacentric and the remaining 19 pairs were acrocentric) that of the river buffaloes (Murali et al., 2009).

Selection of animalsTen buffalo cows with typical Toda buffalo

characteristics were purchased from Toda hamlets in the breeding tract. The animals have calved at least once and have completed 1-4 lactations. All the animals were checked per-rectally before purchase to ascertain the normalcy of the reproductive organs and all the animals were found to have normal reproductive organs. All the cows were dry and non pregnant at the time of purchase. Three Toda bulls at an age of 4 to 5 years were purchased by transfer on closure of an earlier conservation project of Toda buffaloes by Indian Council of Agricultural Research (ICAR) - National Bureau of Animal Genetic Resources (NBAGR) Karnal. The bulls were maintained in the research station from the age of 10 to 12 months under the above project.

Housing and management All the animals were housed at Sheep

Breeding Research Station, Sandynallah, The Nilgiris district, Tamil Nadu, India. During the day time animals were allowed for grazing on natural pastures of farm land and were housed in pucca sheds during night hours. The females were ferocious as they have been brought up under isolation. Initially it was very difficult to handle the female herd as they were never used to be tethered or handled (except milking). They have been applied with halter and few of them were applied with nose rope for better control and were trained for handling and casting in trevis. Towards the end of the project period, most the buffaloes could easily be handled. Few nervous animals were tranquilized during the flushing procedure. Although these animals are ferocious in nature, they never attacked any of the handler or the scientist during the procedure.


441

FeedingThe female Toda buffaloes being purchased

from Toda tribes have been maintained under zero concentrate feeding. Hence, they were very reluctant to take concentrate feed. But, gradually they were accustomed to concentrate feeding and were fed with 2 kg concentrate / day. The feeding rate was increased to 3 kg of concentrate ration during the superovulation and embryo collection programmes. The bulls were reared from a young age and were accustomed to concentrate feeding and handling. The bulls were fed with 2 kg concentrate and supplemented with 3 to 4 kg of paddy straw.

Estrous synchronization and SuperovulationThe females were routinely observed for

exterior symptoms of regular estrum. The estrum was synchronized with either a single or two injections of Prostagladin (PG:- inj. Iliren – Dinoprost, 0.750 mg, Hoechst, India - i/m). The animals were checked per-rectally at 72 h for presence of follicle on the ovary, uterine tone and discharge. The animals reporting for estrum were selected for superovulation and were checked for the presence and quality of corpus luteum (CL) before FSH treatment. The animals were superovulated using either 300 mg or 400 mg or 600 mg of NIH-FSH-p (Folltorpin-V, Vetrepharm, Ontario, Canada). The superovulatory treatment was started on day 9 or 10 of the estrus cycle. FSH was given in 10 tapering doses for 5 days at 8.30 a.m and 8.30 p.m. Luteolysis was induced with two PG injections along with 7th and 8th FSH dose. All the animals reporting to estrum (at 48 h post PG) were bred by the bulls. In the second and subsequent programmes, GnRH 5 ml was injected along with 10th dose of FSH to increase the ovulation.

Embryo collection and cryopreservationThe superovulated animals were flushed

on day 5.5 or 6 after breeding. The number of corpora lutea was counted per-rectally before flushing. Flushing was carried out as per the standard procedures (Misra et al., 1990) using 18 gauge Rusch catheter (Minitub, Germany) and DPBS media (IMV, France). All the recovered embryos were evaluated as per standards given by International Embryo Transfer Society Manual (IETS) and viable embryos were frozen in 1.4 M Glycerol (Misra et al., 1992) using Planer R-204 cell freezer (Planer products Ltd, Sunbury-on-Thames, England).

Statistical analysisThe mean and standard error for all

variables were calculated and presented. Difference between the batches of flushing (I, II, III and IV) was tested by Student ‘t” test. Similarly the effect of dose rate of FSH (300, 400 and 600 mg), size of SOV CL (Big, Medium and Small), day of starting of SOV (9th, 10th, 11th and 12th day) and quality of estrus (Standing and Non-standing) on the ovulation rate, total embryo and viable embryo recovery was assessed by ‘t” test.


Conservation of Toda buffaloes, a semi wild and endangered animal in the form of cryopreservation of embryos was attempted in this study. During this project 30 animals (repeated flushings) were programmed, 93.33 percent (28/30) of the animals responded and 82.14% (23/28) of the animals were flushed. Total embryo recovery was 39 and out of this 26 viable and good quality embryos were cryopreserved. The total embryo recovery rate was 60.00% (39/65) when calculated based on the number of CL observed in these animals. The


442

viable embryo recovery rate per animal flushed was 1.13. There were 9 unfertilized ova (UFO) and empty zonas and four degenerated embryos.

Total embryo recovered and viable embryo recovered per flush in the present study was 1.70 and 1.13 respectively, which were well below the response in cattle. Most of the embryo collection studies in buffaloes throughout the world have observed a lower superovulatory response than cattle (reviewed by Perera, 2008). The lower response was attributed to the fewer number of recruitable follicles in ovary (Madan et al., 1996 and Manik et al., 2000) and relatively low rate of transfer of oocytes to the oviduct and impaired transport of ova and embryo in the reproductive tract (Baruselli et al., 2000).

The response for superovulation was 93.33 percent (28/30). One of the two animals that has not responded had a small SOV CL and was programmed on 12th day of the estrous cycle. The follicular wave not matching to the day of start of superovulation may be the reason for the animal not responding.

Only 23 animals could be flushed out of the 28 animals superovulated because there was handling damage to the cervix in four animals and one animal was highly non-cooperative. Few of the animals which were known to be non-cooperative and furious were given tranquilizer Xylazine hydrochloride (Xylaxin, Indian Immunologicals) at the dose rate of 10-15 mg per animal just before the start of flushing, still there were sudden violent movements during flushing and hence one animal was not flushed during the first batch of flushing. The embryo recovery rate (60.00%) observed in this study was in agreement with the finding of Misra et al. (1994). Out of the total embryo recovered (39) one third of them were not useful, in which seven were empty zona. In addition there were 10

embryos at blastocyst stage during this programme, which showed early ovulations or fast development of embryos in the superovulated animals. Further investigations are needed to clarify the problem.

Batch of flushing The total embryo recovery rate was higher

in II and IV batch of flushing (Table 1). First batch of flushing was during peak winter (January- having inadequate and poor quality pasture), when the condition of most the animals were poor and also the animals were subjected to synchronization and superovulation for the first time. The II and IV batch of flushing were carried out after giving a rest for 20 to 25 days from I and III batch of flushing. Hence the increase in the embryo recovery rate during the II and IV batch may be due to the availability of active CL of previous flushing. Dose of FSH

Total number of CL, total follicles and total embryo recovery were similar in Toda buffaloes treated with 300 mg, 400 mg or 600 mg of FSH. But there was significant increase in viable embryo recovery in animals administered with 400 mg than 600 mg of FSH. In buffaloes a higher dose of FSH (600 mg) has been widely used for superovulation (Misra et al., 1994 and Madan et al., 1996). However, results from the present study suggest that lower dose rates of FSH can be successfully administered in Toda buffaloes with better results. Similar results were obtained in Pandharpuri buffaloes at SAG, Gujarat (personnel communication).

The quality of SOV Cl and day of start of SOVThe quality of SOV CL had significant

effect on the ovulation rate and viable embryo recovery. Buffaloes with big SOV CL had


443

Table 1. Flushing report of Toda buffaloes.

Sr. No. Particulars I Batch

(Jan-06)II Batch (Mar-06)

III Batch (Sep-06)

IV Batch (Oct-06) Cumulative

1No. of animals selected for programming

8 8 8 9 33

2 No. of animals Programmed 7 (87.5%) 8 (100%) 8 (100%) 7 (77.8%) 30 (90.90%)3 No. of animals responded 7 (100%) 8 (100%) 7 (87.5%) 6 (85.7%) 28 (93.33%)4 No. of animals flushed 5 (71.4%) 7 (87.5%) 5 (71.4%) 6 (100%) 23 (82.14%)

5Total no. of CL (Includes all responders)

14 (2.0) 25 (3.13) 16 (2.29) 20 (3.33) 75 (2.69)

5aTotal no. of CL (Flushed animals)

11 (2.2) 22 (3.14) 12 (2.4) 20 (3.33) 65 (2.83)

6Total Follicles/ Cysts (Includes all responders)

8 (1.14) 8 (1.00) 11 (1.57) 9 (1.5) 36 (1.29)

6aTotal Follicles/ Cysts (Flushed animals)

6 (1.2) 8 (1.00) 10 (2.0) 9 (1.5) 33 (1.43)

7 Total Embryo Recovery 5 (1.0) 14 (2.00) 8 (1.6) 12 (2.0) 39 (1.70)8 Viable Embryo Recovery 3 (0.6) 10 (1.43) 5 (1.0) 8 (1.33) 26 (1.13)9 UFO / Zona 1 4 2 2 9

10 Degenerated Embryos 1 0 1 2 411 Total Embryos Frozen 3 10 5 8 26

significantly higher ovulation rate (3.50±0.26) and viable embryo recovery (1.46±0.49) than animals with medium (1.79±0.29) or small SOV CL (1.75±0.31) (Table 2). Similarly the day of SOV also had significant difference in the viable embryo recovery at 9th and 10th day compared to 11th day. Although there was response to superovulation started on day 11 or more, the embryo recovery rate was zero. Out of three animals started SOV on 11th day, two responders could not be flushed due to very thin cervix which got damaged while handling, while one animal of 12th day SOV didn’t respond to FSH.

Nature of estrumThe group of animals reporting to standing

SOV estrum showed a non significant increase in the total ovulations and total follicles than in animal

having non standing estrum. However, there was significant increase in total embryo recovery (2.00 ± 0.41 vs 0.60 ± 0.30) and viable embryos (1.33 ± 0.36 vs 0.40 ± 0.40) in animals showing standing estrum than non standing estrum.

The Toda buffaloes though known to be semi wild and ferocious can be tamed and reared under semi intensive system of management under farm conditions, if they were trained from a young age. Superovulation results shows that with the improved protocols like giving GnRH injections prior to SOV and inclusion of LH during SOV heat (Tatham, 2000), still better results can be achieved. On 6th day embryo flushing procedure adopted in the present study, more number of blastula stage embryo / empty zona was recovered. Hence, for arriving at the correct time of ovulation specific to this breed,


444

flushing studies with more number of animals are required.

ACKNOWlEDGEMENTS

We are thankful to National Dairy Development Board and Sabarmati Asharam Gaushala and Tamilnadu Veterinary and Animal Sciences University for sanctioning the project. We are also thankful to Dr. R. Venkatramanan, Assistant

Professor and Dr. C. Sreekumar, Professor, PGRIAS, Kattupakkam, for their help in routine activities during the programme.

REFERENCES

Baldassarre, H. and C.N. Karatzas. 2004. Advanced assisted reproduction technologies (ART) in goats. Anim. Reprod. Sci., 82-83: 255-266.

Barusellli, P.S., E.H. Madureira, J.A. Visintin, R.

Table 2. Mean (± SE) of superovulatory response and embryo recovery in female Toda buffalo.

Details No. of animals

flushed (responded)

Average no. of CL (Total)

Average no. of follicle (Total )

Embryo recovered

(Total)

Viable embryo recovered (Total)

BatchBatch I 5 (7) 2.00±0.30 (14) 1.14±0.32 (8) 1.00±0.77 (5) 0.60±0.60 (8)Batch II 7 (8) 3.13±0.43 (25) 1.00±0.22 (8) 2.00±0.69 (14) 1.43±0.72 (10)Batch III 5 (8) 2.13±0.30 (17) 1.38±0.38 (11) 1.60±0.51 (8) 1.00±0.45 (5)Batch IV 6 (7) 3.00±0.39 (21) 1.29±0.24 (9) 2.00±0.94 (12) 1.33±0.67 (8)

Dose300 mg 3 (3) 2.67±0.60 (6) 1.00±0.48 (3) 1.67±1.20 (5) 1.00±1.00a (3)400 mg 10 (13) 2.77±0.34 (36) 1.00±0.16 (13) 2.20±0.63 (22) 1.80±0.55a (18)600 mg 10 (14) 2.36±0.19 (33) 1.43±0.26 (20) 1.20±0.39 (12) 0.50±0.22 b (5)

SOV ClBig 13 (14) 3.50±0.26 a (49) 1.43±0.25a (20) 2.08±0.58 (27) 1.46±0.49 a (19)

Medium 5 (8) 1.79±0.29b (14) 1.00±0.26ab (8) 1.60±0.24 (8) 1.20±0.37 b (6) Small 5 (8) 1.75±0.31b (7) 1.00±0.22b (5) 0.80±0.37 (4) 0.20±0.20 b (1)

SOV Day9 4 (5) 2.00±0.42 (10) 1.40±0.42 (7) 2.00±0.91a (8) 0.75±0.75 b (3)10 17 (20) 2.85±0.24 (57) 1.25±0.19 (25) 1.76±0.42 a (30) 1.35±0.36 a (23)11 2 (3) 2.33±0.43 (7) 1.30±0.30 (4) 0.50±0.50b (1) 0 b (0)12 0 (2) 1.5±0.29 (3) - - -

Nature of EstrumStanding 18 (20) 2.75±0.24 (55) 1.45±0.19 (29) 2.00±0.41 a (36) 1.33±0.36 a (24)

Non Standing 5 (10) 2.20±0.27 (22) 0.70±0.21 (7) 0.60±0.40b (3) 0.40±0.40 b (2) Means in the same column within categories with different superscript differ significantly (P<0.05).


445

Porto-Filho, N.A.T. Carvalho, G. Campanile and L. Zicarelli. 2000. Failure of oocytes entry into oviduct in superovulated buffalo. Theriogenology, 53: 491.

Beg, M.A., P.C. Sanwal and M.C. Yadav. 1996. Steroid hormone profile and superovulatory response following priming and GnRH treatment in buffaloes. Anim. Reprod. Sci., 44: 33-39.

Devroey, P. and A. Van Steirteghem. 2004. A review of ten years experience of ICSI. Hum. Reprod. Update, 10: 19-28.

Farstad, W. 2000. Assisted reproductive technology in canid species. Theriogenology, 53: 175-186.

Finicio, Y. 1603. Letter to the Jesuit Vice-provincial in Calicut (in Portugese) British Museum. Add. Ms. 9853. (Translated by A. De Alberti) Reprinted in : The Todas (ed.) Rivers, W.H.R. (1906). Macmillan and Co. Ltd., England. 727p.

International Embryo Transfer Society Manual. Chapter 9: certification and identification of the embryo by Irma Robertson and Richard E. Nelson, 103-134.

Karthikeyan, M.K. 1995. Evaluation of production and preproduction performance of Toda buffalo. M.V.Sc. Thesis, Tamil Nadu Veterinary and Animal Sciences University, India.

Kumar, S. 1997. Survey and mapping of shola forests and grass lands in the upper Nilgiri Plateau and assessment of human utilization of the vegetation. Report submitted to World Wild Fund for Nature, India.

Madan, M.L., S.K. Das and P. Palta. 1996. Application of reproductive technology to buffaloes. Anim. Reprod. Sci., 42: 299-306.

Manik, R.S., M.S. Chauhan, V. Gupta, S.K. Singla

and P. Palta. 2002. Folliculogeneis in buffalo (Bubalus bubalis): A review. Reprod. Fertil. Dev., 14: 315-325.

Misra, A.K., B.V. Joshi, P.L. Agarwal, R. Kasiraj, S. Siviah, N.S. Rangareddy and M.U. Siddique. 1990. Multiple ovulation and embryo transfer in Indian buffaloes (Bubalus bubalis). Theriogenology, 33: 1131-1142.

Misra, A.K., B.V. Joshi, P.L. Agarwala, R. Kasiraj, S. Sivaiah, N.S. Rangareddi and M.U. Siddiqui. 1992. Cryopreservation of Bubaline embryos. Buffalo Journal, 3: 297-303.

Misra, A.K., R. Kasiraj, M. Mutha Rao, N.S. Ranga Reddy and B.V. Joshi. 1994. Embryo transfer in buffalo in India: Progress in the last five years. In Proceedings of 4th World Buffalo Congress, 3: 501-504.

Murali, N., P. Devendran and K. Panneerselvam. 2009. Cytogentic studies on the chromosomes of Toda buffaloes. Buffalo Bull., 28(2): 95-100.

Perera, B.M.A.O. 2008. Reproduction in domestic buffalo. Reprod. Dom. Anim., 43(Suppl. 2): 200-206.

Sharkey, S., R.J. Callan, R. Mortimer and C. Kimberling. 2001. Reproductive techniques in sheep. Vet. Clin. North Am. Food Anim. Pract., 17: 435-455.

Squires, E.L., E.M. Carnevale, P.M. McCue and J.E. Bruemmer. 2003. Embryo technologies in the horse. Theriogenology, 59: 151-170.

Tatham, B. 2000. Increasing buffalo production using reproduction technology. In A report for the rural industries research and development corporation. www.rirdc.gov.au.

http://www.sciencedirect.com/science/journal/03784320

http://www.rirdc.gov.au

http://www.rirdc.gov.au



447

ABSTRACT

Toda buffaloes are the endangered species of the Nilgiri Hills of South India. Successful attempts have been made in cryopreservation of semen of Toda bulls. Thawed semen samples from Toda buffalo bulls were used to analyze the spermatozoal morphometry by Computer assisted semen analyzer (CASA). Head length (major axis), width (minor axis), area, perimeter, elongation and tail length were the morphometrical characteristics measured. The mean (±SE) length, width, area, perimeter, elongation percentage and tail length were 7.38±0.02 µm, 4.68±0.02 µm, 28.53±0.17 µm2, 20.32±0.19 µm, 62.95±0.22% and 52.93±0.41 µm respectively. Overall spermatozoal abnormality was 30.75% and coiled tail was the most common (50.49%) abnormality. The spermatozoal morphometry reported in this study may form a preliminary data in Toda buffalo semen analysis and helps for comparison with other breeds and can complement sperm motility assessment.

Keywords: buffaloes, Bubalus bubalis, Toda buffalo, cryopreserved semen, morphometry, CASA

INTRODUCTION

Toda buffaloes are semi wild and endangered group of buffaloes traditionally maintained by the Toda tribes of Nilgiris district of South India. Toda buffaloes are closely associated with the Toda tribal population economically and socially. Usually the herd consists of a few females with rarely one or two males. Toda bulls are known to stay in dense forests and will come out during the breeding season. In most of the herds no calvings have been reported for the past 5 to 6 years due to paucity of bulls. The breedable female population has also decreased over time. A project was carried out with the aim of collection and cryopreservation of Toda semen. Semen was successfully collected using buffaloes in estrum by intervening during natural service by AV method and cryopreserved.

Motility of the sperm (qualitative trait) and the concentration (quantitative trait) of the spermatozoa are the most commonly evaluated sperm parameters, which provide limited information regarding the potential fertility of sires (Rodriquez-Martinez and Larsson, 1998 and Brahmkshtri et al., 1999). Assessment of spermatozoal morphology reflects the testicular,

MORPHOLOGICAL STUDIES OF CRYOPRESERVED TODA BUFFALO SPERMATOZOA BY CASA

R. Anilkumar1,*, M.N. Sundararaman3, D.V. Patel2, M. Iyue1 and R. Kasiraj2

1Sheep Breeding Research Station, Tamilnadu Veterinary and Animal Sciences University, Sandynallah, Ooty, The Nilgiris, Tamilnadu, India2Sabarmati Ashram Gaushala, Bidaj Farm, PO- Lali, Dist, Kheda, Gujarat, India3Department of Animal Genetics and Breeding, Madras Veterinary College, Chennai, India, *E-mail: [email protected]

Original Article



448

epididymal and accessory glands physiology and pathology and also the functioning and handling of semen during cryopreservation (Rodriquez-Martinez, 2003). In addition the sperm head morphology has been suggested as an indicator of fertility (Ombelet et al., 1995; Casey et al., 1997 and Hirai et al., 2001). However, it is not used in regular assessment of semen.

Computer assisted semen analysis has been used for analysis of spermatozoa morphology in several species (Gravance et al., 1996; Sundararaman and Edwin, 2004; Sundararaman, et al., 2006; Aggarwal et al., 2007; Sundararaman, et al., 2007; Roy et al., 2008) including buffalo, which gives a clear picture about the shape and size of the spermatozoa. Recently Aggarwal et al. (2007) have studied the sperm biometry of eight breeds (Murrah, Surti, Tarai, Mehsana, Jafferbadi, Bhadawari, Pandharpuri and Nili Ravi) of Indian buffaloes. The aim of the present study was to characterize the sperm morphology using CASA and to assess the morphological abnormality in semi wild Toda buffaloes.


Three Toda bulls were raised under organized farm conditions from a young age of 10 to 12 months to about 4 to 5 years at Sheep Breeding Research Station, Sandynallah, The Nilgiris district, Tamil Nadu, India. Semen collected using artificial vagina (AV) was diluted in Tris based diluent and cryopreserved in 0.25 ml straws using French straw technique.

Morphological characteristics of spermatozoa assessed by CASA

The frozen semen samples were transferred

to the Semen Bank of the Department of Animal Genetics and Breeding, Madras Veterinary College, Chennai-7 for analysis with computer assisted semen analyzer. The samples were thawed at 37oC for 30 seconds and further extended to minimize the sperm concentration for analysis by CASA.

Staining of semen slidesSemen slide was prepared by placing 4

µl of frozen thawed and diluted semen sample on a grease free glass slide. The slide was air dried and stained, using STAT III andrology stain (Mid- Atlantic Diagnostics Inc., NJ). Fixation of dried slide was done by immersing in methanol for 30 seconds. After air-drying, the slide was dipped in Thiazine dye mixture for 60 seconds. The excess stain on edges was blotted during staining operation and finally the slide was washed with distilled water and air dried. Several such slides were prepared from each sample.

CASA analysisHamilton Thorne Integrated Visual

Optical System (HT-IVOS) version 10.9 was the computer assisted semen analyzer (CASA) used for morphology evaluation. The semen slide was loaded in the CASA system. Using 60 x objective, the sperm morphometrics were measured. From each slide, only properly digitized sperm heads were considered for morphometric measurement. A total of 992 properly digitized spermatozoa were analyzed. By using the metric software option of CASA, the morphological classification of sperm was made as normal / abnormal based on the morphometric traits of head and tail. Length (Major axis) and width (Minor axis) of the spermatozoal head, head area, perimeter, elongation and tail length were the morphometric traits studied in the present investigation. The spermatozoal tail


449

abnormality and other abnormalities of head were noted and analyzed.

Statistical analysisThe mean and standard error for all variables

were calculated and presented. Differences between the bulls and ejaculates were tested by least squares procedure (Harvey, 1990). All possible interactions with a set of fixed effects were fitted initially and insignificant interaction effects were omitted. The linear statistical model was used for analysis of various traits. The differences between the least squares means for subclasses under a particular effect were tested by Duncan’s multiple range test modified by Kramer (1957).


For the first time, semen collection was achieved from the wild and endangered Toda buffalo bulls for cryopreservation and to use it as a method of conservation of the breed, which facilitated this first ever report on morphology of Toda spermatozoa. The average length (major axis) and width (minor axis) of the spermatozoa were 7.38±0.02 µm and 4.68±0.02 µm (Table 1) and were similar to the reports by Kodagali et al. (1973) in Surti buffaloes (7.62±0.22 and 4.59±0.51 µm), Harapanhalli and Mukherjee (1973) in Murrah buffaloes (7.32 and 4.90 µm) and Roy et al. (2008) in Murrah (7.59±0.01 and 4.91±0.01 µm) buffaloes. However, the spermatozoal head length was higher in all the eight Indian breeds of buffaloes (Aggarwal et al., 2007). The width of the sperm head was narrower in Toda bulls than in other breeds as reported earlier (Aggarwal et al., 2007) except Murrah buffaloes (4.75 µm).

The area of the spermatozoal head of Toda buffaloes was similar to those reported by Kodagali et al. (27.21±2.78 µm2 : 1973) and Harapanhalli and Mukherjee (28.96 µm2 : 1973). Aggarwal et al. (2007) observed a larger area in eight Indian breeds of buffaloes and Roy et al. (24.41±0.05 µm2: 2008) observed smaller head area than the present study.

Significant difference (P<0.01) among the bulls were observed in all the parameters studied. Bull TM3 has longer major axis, larger area and higher perimeter, whereas, bull TM2 has broader minor axis and higher elongation percentage. For bull TM8, the mean values for all the parameters were the lowest except for elongation.

Spermatozoa with normal morphology were significantly longer (major axis) (7.42±0.02 vs. 7.35±0.03). However, elongation percentage was higher in spermatozoa with abnormal morphology (62.30±0.23 vs. 63.60±0.28).

The perimeter observed in the present study was equivalent to those observed by Roy et al. (19.65±0.02 µm; 2008) for Murrah buffaloes. The values were lower than the values observed by Aggarwal et al. (2007) for the eight Indian breeds of buffaloes.

The tail length (52.93±0.41 µm) observed in this study was similar to the tail length in Pandarpuri buffaloes (Aggarwal et al., 2007). The length of the tail was less than those studied by Kodagali et al. (1973) in Surti buffaloes, Aggarwal et al. (2007) for other seven Indian breeds of buffaloes Roy et al. (2008) for Murrah buffaloes.

The elongation percentage of the head of Toda buffalo spermatozoa was 62.95±0.22 percent. The length was comparatively lower than all the breeds of buffaloes studied and width was similar to Murrah buffaloes giving the sperm an oblong shape.


450

Table 1. Morphometry of the Toda buffalo spermatozoa.

Effect NMorphometrical parameters of the head of sperm

Tail length (µm)

Major axis (µm)

Minor axis (µm)

Elongation (%)

Area (µm2)

Perimeter (µm)

2 521 7.29±0.02a 4.76±0.15 b 64.67±0.22 b 28.70±0.14 b 20.33±0.08 b 54.43±0.37 (60)3 64 7.65±0.05b 4.64±0.04 a 60.17±0.52 a 29.33±0.40 b 20.65±0.25 b 52.04±0.81 (11)

8 407 7.20±0.02a 4.64±0.04 a 64.01±0.25 b 27.57±0.19 a 19.98±0.11 a 52.31±0.43 (88)I 431 7.38±0.03 4.69±0.02 62.93±0.27 28.55±0.20 20.29±0.12 53.20±0.39 (77)II 446 7.39±0.02 4.67±0.02 62.95±0.22 28.66±0.17 20.34±0.10 53.68±0.34 (75)III 115 7.38±0.04 4.68±0.04 62.97±0.42 28.39±0.32 20.32±0.19 51.90±0.45 (7)

Normal 687 7.42±0.02b 4.66±0.02 62.30±0.23 a 28.48±0.18 20.26±0.10 52.68±0.41 (125) Abnormal 305 7.35±0.03a 4.70±0.02 63.60±0.28 b 28.59±0.21 20.38±0.13 53.18±0.52 (34)

Overall 992 7.38±0.02 4.68±0.02 62.95±0.22 28.53±0.17 20.32±0.19 52.93±0.41 (159)

N : Number of spermatozoa Means bearing different superscripts within each set of columns (effect) differ significantly (P≤0.01X Figures in parenthesis indicate number of observations.

Table 2. Spermatozoal abnormalities in cryopreserved Toda buffalo semen.

EffectsTotal

Abnormalities (%)Abnormalities of the tail (%) Other defects

(%)Bent tail Coiled tail Absent tailBulls

2 39.92 b (208/521) 4.41 (23/521) 20.73 (108/521) 4.03 (21/521) 10.75 (56/521)3 21.88 a (14/64) 0.00 (0/64) 15.63 (10/64) 3.13 (2/64) 3.13 (2/64)8 20.39 a (83/407) 4.18 (17/407) 8.85 (36/407) 1.72 (7/407) 5.65 (23/407)

Ejaculate numberI 25.75 a (111/431) 3.71 (16/431) 8.35 (36/431) 3.94 (17/431) 9.745 (42/431)II 28.92 a (129/446) 3.36 (15/446) 16.82 (75/446) 2.24 (10/446) 6.50 (29/446)III 56.52 b (65/115) 7.83 (9/115) 37.39 (43/115) 2.61 (3/115) 8.70 (10/115)

Overall 30.75 (305/992) 4.03 a (40/992) 15.52 c (154/992) 3.02 a (30/992) 8.17 b (81/992)

Figures in parenthesis indicate number of observations. Means bearing different superscripts within each set of columns (effect) differ significantly (P≤0.01).


451

Overall spermatozoal abnormality percentage in the Toda buffalo bulls was 30.75 percent (Table 2). Bull TM2 had significantly higher percentage of abnormality (39.92 percent) than the other two bulls (21.88 and 20.39 percent in TM-3 and TM-8 respectively). Similarly semen obtained by third ejaculate has more abnormal spermatozoa (56.62%) than the first (25.75%) and second (28.92) ejaculates.

Coiled tail was the most (15.52%) common abnormality observed. Bent tail and tail absent were the least to occur. The coiled tail defect was predominant in all bulls and ejaculates with bull TM2 having a higher coiled tail defect than other (20.73%) bulls. Several studies (Nordin et al.,1990 and Koonjaenak et al., 2007) has shown that spermatozoal abnormality in buffaloes used for AI should not exceed 15 percent and a healthy buffalo should not have >10% of tail defects. In the present study the spermatozoal abnormalities were higher.

Semen was collected from the wild Toda buffalo bulls during the embryo collection programme when all the bulls were allowed for natural breeding several times in that week. In addition semen was collected more than twice in a day when she buffaloes in estrum were available as dummy. Attempts have been made to collect and cryopreserve as much semen samples as possible for future use. More frequent collection of semen samples and allowing the bulls for natural service in between collections may be the reason for more tail defects in these samples. Bull TM-2 gave watery semen, the percentage of motility and concentration were lower in this bull and has also contributed for more abnormalities. More than 50% of the abnormality was contributed by coiled tail.

The spermatozoal morphometry reported in this study may form a preliminary data in Toda

buffalo semen analysis and helps for comparison with other breeds. Similarly it can complement sperm motility assessment. Correlation between fertility and sperm morphology has been observed in human (Ombelet et al., 1995), stallion (Casey et al., 1997), boars (Hirai et al., 2001) and bulls (Januskauskas et al., 1995). In addition, the head area and shape affect the sperm freezability and cryoresistance (Estero et al., 2006). Thus the sperm morphometry may form the basis for formulating the fertility index in these bulls.

ACKNOWlEDGEMENTS

We are thankful to National Dairy Development Board and Sabarmati Asharam Gaushala and Tamilnadu Veterinary and Animal Sciences University for sanctioning the project. We also than the Project Manager and staff of Nucleus Jersey and Stud Farm and Staff of Semen Bank, Madras Veterinary College Chennai-7 for their help in carrying out the study. We are also thankful to Dr. R. Venkatramanan, Assistant Professor and Dr. C. Sreekumar, Professor, Sheep Breeding Research Station, Sandynallah, for their help in routine activities during the programme.

REFERENCES

Aggarwal, R.A., S.P. Ahlawat, Y. Kumar, P.S. Panwar, K. Singh and M. Bhargava. 2007. Biometry of frozen-thawed sperm from eight breeds of Indian buffaloes (Bubalus bubalis). Theriogenology, 68(4): 682-686.

Brahmkshtri, B.P., M.J. Edwin, M.C. John, A.M. Nainar and A.R. Krishnan. 1999. Relative efficacy of conventional sperm parameters


452

and sperm penetration bioassay to assess bull fertility in vitro. Anim. Repro. Sci., 54: 159-168.

Casey, P.J., C.G. Gravance, R.O. Davis, D.D. Chabot and I.K.M. Liu. 1997. Morphometric differences in sperm head dimensions of fertile and sub-fertile stallions. Theriogenology, 47: 575-582.

Esteso, M.C., A.J. Soler, M.R. Fernandez-Santos, A.A. Quintero-Moreno and J.J. Gardle. 2006. Functional significance of the sperm head morphometric size and shape for determining freezability in Iberian Red Deer (Cervus elaphus hispanicus) epididymal sperm samples. J. Androl., 27: 662-670.

Gravance, C.G., I.K.M. Liu, R.O. Davis, J.P. Hughes and P.J. Casey. 1996. Quantification of normal head morphometry of stallion spermatozoa. J. Reprod. Fertil., 108: 41-46.

Harvey, W.R., 1990. Mixed Model Least-squares and Maximum Likelihood Computer Programme. PC-2 version. Ohio State University, Columbus.

Harapanhalli, M.D. and D.P. Mukherjee. 1973. Effect of different diluents on the cytomorphology of the buffalo spermatozoa. Indian J. Anim. Prod., 4: 128-135.

Hirai, M., A. Boersma, A. Hoeflich, E. Wolf, J. Foll and R. Aumuller. 2001. Objectively measured sperm motility and sperm head morphometry in boars (Sus scrofa): relation to fertility and seminal plasma growth factors. J. Androl., 22: 104-110.

Januskauskas, A., J. Gil, H. Rodriguez-Martinez, L. Soderquist and N. Lundeheim. 1995. Effects of a brief elevation of scrotal temperature on the post thaw viability of bull semen. Reprod. Domest. Anim., 30: 271-277.

Koonjaenak, S., V. Chanatinart, H. Ekwall and H.

Rodriguez-Martinez. 2007. Morphological features of spermatozoa of swamp buffalo AI bulls in Thailand. J. Vet. Med. A., 54: 169-178.

Kramer, C.Y. 1957. Extension of multiple range tests to group correlated adjusted means. Biometrics, 13: 13-18.

Kodagali, S.B., B.K. Bhavsar and A.D. Deshpande. 1973. Biometrics of Surti buffalo spermatozoa. Indian Vet. J., 50: 50-54.

Nordin, W., M. Hilmi and T.A. Bongso. 1990. Semen characteristics related to age in growing swamp buffalo (Bubalus bubalis). Buffalo Journal, 2: 161-166.

Ombelet, W., R. Menkveld, T.F. Kruger and O. Steeno. 1995 Sperm morphology assessment: historical review in relation to fertility. Hum. Reprod. Update, 1(6): 543-557.

Ostermeier, G.G., G.A. Sargeant, B.S. Yandell, D.P. Evenson and J.J. Parrish. 2001. Relationship of bull fertility to sperm nuclear shape. J. Androl., 22: 595-603.

Rodriquez-Martinez, H. 2003. Laboratory semen assessment and prediction of fertility: still utopia?. Reprod. Domest. Anim., 38: 312-318.

Rodriquez-Martinez, H. and B. Larsson. 1998. Assessment of sperm fertilizing ability in farm animals. Acta. Agric. Scand. Suppl., 29: 12-18.

Roy, B., P.K. Nagpaul, P.K. Pankaj, T.K. Mohanty, V.S. Raina and A. Mishra. 2008. Studies on biometry of sperm of Murrah buffalo bulls (Bubalus bubalis). Buffalo Bull., 27: 161-164.

Sundararaman, M.N. and M.J. Edwin. 2004. Morphometric evaluation of caprine spermatozoa by HT-IVOS system at


453

pre-freeze and post-thaw stages of cryopreservation. Indian J. Anim. Reprod., 25: 91-93.

Sundararaman, M.N., K.S. Subramanian, A. Meenakshisundaram and M.J. Edwin. 2006. Computer automated analysis of morphometric characteristics of epididymal spermatozoa of spotted deer (Axis axis). Indian J. Anim. Reprod., 27: 77-79.

Sundararaman, M.N., J. Kalatharan and K. Thilak Pon Jawahar. 2007. Analyses of morphological and morphometrical deviations of bull spermatozoa by computer assisted semen analysis technique. Asian J. Anim. Vet. Adv., 2: 196-204.

Instructions for Authors

Buffalo Bulletin is published by International BuffaloInformation Center under the authorization of Office of UniversityLibrary, Kasetsart University, Thailand. Contributions on any aspectof research or development, progress report of projects and news onbuffalo will be considered for publication in the bulletin.

General editorial policies

Authorship criteriaAuthorship is restricted to those who (1) have contributed

substantially to one or more of the following aspects of the work and (2)are willing to assume public responsibility for the validity of thework.Copyright

Copyright to published manuscripts becomes the soleproperty of International Buffalo Information Center.

Criteria for manuscript acceptanceManuscript acceptability is based on clarity of objectives;

originality; appropriateness of the experimental design, methods andstatistical analysis; substance of the results; thoroughness with which theresults are discussed; and appropriateness of the conclusions.

Following acceptance of a paper and prior to publication, theauthor will be received the acceptance letter.

Manuscript requirements

Manuscripts preparationManuscripts on original research in English language should

include at least the following elements.Title

• Full title (be concise)• Name(s) of author(s) and the first author

affiliation with complete address.Abstract

• An abstract not exceeding 250 words; allacronyms and abbreviations defined; noreferences cited. State what, where and how itwas done, major results.

• Five key words.Introduction. Review pertinent work, cite key references,explain importance of the research, and state objectives ofyour work.

Materials and Methods. Provide sufficient detail so workcan be repeated. Describe new methods in detail; acceptedmethods briefly with references.

Use of trade names. Trade names are to beavoided in defining products whenever possible.

Use of abbreviations and acronyms. At first textuse, define in parentheses. Do not use abbreviations andacronyms in titles.Results and discussion. Present results concisely usingfigures and tables as needed. Do not present the sameinformation in figures and tables. Discuss principles andrelationship, point out exception. Show agreement withpublished research work. The significances of work orconductions should be presented in the end of discussion.Tables. Number each table with Arabic numerals. Place adescriptive caption at the top of each table.

Figures. (graphs, charts, line drawings, photographs)Number each figure with Arabic numerals under theillustration. Lettering, data lines and symbols must besufficiently large so as to be clearly visible when the figureis reduced to a size commonly used in the journal.References. List only those references cited in the text.Required format of described below.

Reference cited format

Manuscripts should follow the name-year reference format.Cite only necessary publications. Primary rather than secondaryreferences should be cited, when possible. It is acceptable to cite workthat is “in press” (i.e., accepted but not yet published) with the pertinentyear and volume number of the reference.

In text. Cite publications in text with author name andyear. Three or more authors use “et al.”. In parenthetical citations,separate author and year with a comma. Use suffixes a, b and c toseparate publications in same year by the same author. Semi-colonseparate citations of different authors. Cite two or more publicationsof different authors in chronological sequence, from earliest to latest.For example:….used liquid nitrogen vapour freezing technique from Verma et al.(1975)….liquid nitrogen vapour freezing technique (Verma et al., 1975)…and buffaloes (Singh et al., 1983; Shah et al., 1987; Misra, 1996;Pant et al., 2002)In reference cited. List only those literature cited in the text.References should be listed alphabetically by the first author’s lastname. Single author precedes same author with co-authors. Typereferences flush left as separate paragraphs. Do not indent manually.Write the name of book or journal in italic letters. Use the followingformat.• Journal articles: Author(s). Year. Article title. Journal title,

volume number: inclusive pages.Example: Citation in text: Chaudhary et al. (1981)

Choudhary, P.C., B. Prasad and S.K. Misra. 1981. Note on the use of rumen liquor in the treatment of chronic alkaline indigestion in cows. Indian J. Anim. Sci., 51: 356-360.

• Books: Author(s) or editor(s). Year. Title. Publishername,Placeof publication. Number of pages.Example: Citation in text: Snedecor and Cochram. (1980)Snedecor, G.W. and W.G. Cochram. 1980. Statistical Methods, 7th ed.

The Iowa State University Press, Ames, Iowa, USA. 593p.Sattar, A. 1995. Studies on the effect of immunopotentiation of vaccinated pregnant buffaloes and cows on neonatal antibody titre and hematological profile. Ph. D. thesis, University of Agriculture, Faisalabad, Pakistan. 208p.• Chapter: Author(s) of the chapter. Year. Title of the chapter,pages of the chapter. In author(s) or editor(s). Title of the book.Publisher name, Place of publication.Example: Citation in text: Sloss and Dufty. (1980)Sloss, V. and J.H. Dufty. 1980. Disorders during pregnancy, p. 88-97. In Sloss, V. and J.H. Dufty (eds.) Handbook of Bovine Obstetrics. Williams and Wilkins, Baltimore, U.S.A.Sabrani, M., K. Diwyanto and M. Winugroho 1994. A critical review of buffalo research and development activities in

Indonesia. Past performanceand future strategies, p. 78-89. InProceedings of 1st Asian Buffalo Association Congress,Thailand.

Submission manuscriptSubmit the following items.Cover letter. Identify the corresponding author and provide his/herfull name, address, numbers for telephone and fax, and e-mail address.Manuscript. In 12 point Times or Times New Roman. Type on oneside of A4 paper. Use one inch margins. Number all pages. Send anoriginal manuscript and 1 photocopy.Disk. Include an IBM-formatted, 3-1/2" disk or 4-3/4" CD-ROM,containing the manuscript in Microsoft Word.Mail manuscript to:By post: International Buffalo Information Center

Office of University LibraryKasetsart University,50 Pahonyothin Road, Chatuchak,Bangkok 10900, ThailandTel. 66-2-942-8616

By e-mail: [email protected]

BUFFALO BULLETIN

IBIC, KASETSART UNIVERSITY, P.O. BOX 1084

BANGKOK 10903, THAILAND

URL : http://ibic.lib.ku.ac.th

E-mail : [email protected]

Tel : 66-2-9428616 ext. 344

Fax : 66-2-9406688


Documents

International Buffalo Information Center (IBIC)ibic.lib.ku.ac.th/e-Bulletin/36-2.pdf · International Buffalo Information Center (IBIC) Buffalo Bulletin . ISSN: 0125-6726 (Print),