Introducing a novel, paired end, sequencing approach to NIPT Copenhagen 2017.pdf · 2017. 5. 5. · Paired End sequencing, determine if the fraction of short fragments was higher

$Page 1: Introducing a novel, paired end, sequencing approach to NIPT Copenhagen 2017.pdf · 2017. 5. 5. · Paired End sequencing, determine if the fraction of short fragments was higher$
© 2017 Illumina, Inc. All rights reserved. Illumina, HiSeq, MiSeq, NextSeq, Powered by Illumina, verifi, VeriSeq, VeriSeq NIPT Solution, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the US and/or other countries. All other names, logos, and other trademarks are the property of their respective owners.

Introducing a novel, paired end, sequencing approach to NIPT Lieve Page-Christiaens, MD, PhD, Associate Medical Director at Illumina

Copenhagen April 7th 2017

2

Disclosure and Disclaimer

I am an employee of and hold equity in Illumina, Inc.

The opinions expressed during this presentation are those of the speaker and may not represent the opinions of Illumina.

This slide deck was used to support an oral briefing. Thus, the slides themselves should not be relied upon solely on their own to support any conclusion of law or fact.

These slides are intended to provide general educational information and are not intended to convey medical advice and should not be used in lieu of a medical professional’s own exercise of their professional expertise.

3

Non-Invasive Prenatal Testing Whole Genome Sequencing

YX22212019181716151413121110987654321Chromosome

4

VeriSeq NIPT Solution A Revolution for “in-lab” Non-Invasive Prenatal Testing (NIPT)

Paired- End

PCR- Free

CE-IVD EU

•  cfDNA Fragment Length Determination •  Fetal Fraction Estimation (FFE) and New Analysis Methodology (iFACT;LLR1) •  Less total sequencing, more samples per batch (48;96), lower cost per sample •  Low Failure Rate

•  Turn Around Time ~26 hours cfDNA isolation through report2 •  Simplified workflow •  Lower cost per sample

•  IVD - Conform to EU IVD directive – applies to library prep and analysis/reporting software.

1individualized Fetal Aneuploidy Confidence Test; Log Likelihood Ratio 2Sehnert AJ, Rees, B et al Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood. Clin Chemistry 2011:57(7) 1042-1049

For In Vitro Diagnostic Use. Not available in all countries or regions.

5

VeriSeq NIPT Solution Paired End Sequencing

ATTTCCGCGATCTTCCCGTTCGACTGCAGACCTTCAGCGCGCATATATCGCTAGCATACCGTTATAC CGCTAGAAG GAAGTCGCG

Human Genome

Alignment Better accuracy

Fragment Size

determination

Fragment length

Higher portion of shorter

fragments are fetal in origin1

1Chan, Zhang, Hui, Wond, Lau, Leung, Lo, Huang and Lo. Size Distributions of maternal and fetal DNA in maternal plasma. Clin Chem 2004; 50 : 88-92 Kim, Hannum, Geis, Tynan, Hogg, Zhao, Jensen, Mazloom, Oeth, Ehrich, van den Boom and Deciu. Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts. Pren Diagn 2015; 35:1-6


6

VeriSeq NIPT solution Fetal Fraction Estimation

Fragment size distribution

Coverage profile1 FF from Chr Y

FF fr

om fr

ag s

ize

FF correlation


1 Kim et al. Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts. Pren Diagn 2015, 35:1-6

7

Test chromosome Normalizing chromosome(s)

VeriSeq NIPT Solution

Aneuploidy Scoring: General Principle

Standard methodology New methodology

Using counting statistics*, determine if more than the expected number of reads mapped to the target chromosome

Using counting statistics, determine if more than the expected number of reads mapped to the target chromosome Using fragment size statistics gained from Paired End sequencing, determine if the fraction of short fragments was higher on the target chromosome Combine the counts and fragment size statistics for scoring

Short fragments Long fragments


8

VeriSeq NIPT solution Quality Metric : iFACT1

Fetal fraction

Sam

pleC

over

age

(mill

ion

read

s)

•  Dots represent two samples at fixed fetal fraction but different coverage

•  Green dot has sufficient

coverage for given fetal fraction above iFACT cut-off

•  Result provided •  Red dot has insufficient

coverage for given fetal fraction and fails iFACT

•  No result reported, sample requeued or canceled

1iFACT individualized Fetal Aneuploidy Confidence Test


9

Aneuploidy classification depends on two primary metrics for each target

chromosome for each sample

Aneuploidy Score

Whole genome sequencing, counting

based method for determining over or

under representation of a target

chromosome

Fetal Fraction

An estimation of the amount of fetal

cfDNA in total cfDNA in a particular sample

VeriSeq NIPT Solution Final Aneuploidy Scoring

Fetal fraction

Ane

uplo

idy

scor

e

Expected distribution of affected samples

Expected distribution of unaffected samples


10 For In Vitro Diagnostic Use. Not available in all countries or regions

VeriSeq NIPT Results Overall performance metrics for autosomes

a CI based on Wilson’s score method. Data on file. Illumina, Inc. February 2017.

Trisomy 21 Trisomy 18 Trisomy 13

Sensitivity, % (n/N) 98.9% (90/91) 90.0% (18/20)

100.0% (8/8)

2-Side 95% CIa (94.0%,99.8%) (69.9%,97.2%) (67.6%,100.0%)

Specificity, % (n/N) >99.9% (2965/2966) 99.9% (3034/3037)

99.9% (3045/3049)

2-Side 95% CIa (99.8%,100.0%) (99.7%,100.0%) (99.7%,99.9%)

11 For In Vitro Diagnostic Use. Not available in all countries or regions

VeriSeq NIPT Results Positive and Negative Predictive Values

a CI based on Wilson’s score method. Data on file. Illumina, Inc. February 2017.

Trisomy 21 Trisomy 18 Trisomy 13

PPV, % (95%Cia) 98.9 (94.0, 99.8)

85.7 (65.4, 95.0)

66.7 (39.1, 86.2)

NPV, % (95% CIa) 100 (99.8, 100)

99.9 (99.8, 100)

100 (99.9, 100)

Observed Percent of Fetal Trisomy Affected

based on Clinical Reference Standard

(95% CIa)

2.98 (2.43, 3.64) 0.65 (0.42, 1.01) 0.26 (0.13, 0.52)

12

Isolation Extraction Library Prep Sequencing Analysis Report

VeriSeq NIPT Solution Conclusion

48-96 SAMPLE

BATCHES

Next Gen Sequencer

Server

8 hours per 48 sample batch <16 hours per 48 sample batch

Hamilton


13

The VeriSeq NIPT Solution Summary of technical innovations

Innovation Impact How Automated, PCR Free workflow

• Fastest workflow of any NIPT • Reduced CapEx, • Easier implementation

•  VeriSeq NIPT MicroLab Star •  VeriSeq NIPT Workflow Manager •  PCR Free VeriSeq NIPT Sample Prep Kits

PE Sequencing • High multiplexing per run, • Reduced cost per sample

•  PE information enables lower sequencing depth per sample while maintaining performance

•  Captures cfDNA fragment size information

iFACT • Reduced test failure rate relative to tests using fetal fraction cutoffs2,3

•  Assesses coverage and FFE to provide a dynamic confidence threshold

•  Allows results on low FF samples

LLR scoring •  Improved Aneuploidy Scoring •  NCV (Normalized Chromosome Value) ànd Fetal Fraction Estimate are used in LLR Scoring

1Cirigliano V et al. Performance of the Neobona test: a new paired-end massively parallel shotgun sequencing approach for cell-free DNA-based aneuploidy screening. Ultrasound Obstet Gynecol 2017;; DOI: 10.1002/uog.17386


Documents

Introducing a novel, paired end, sequencing approach to NIPT Copenhagen 2017.pdf · 2017. 5. 5. · Paired End sequencing, determine if the fraction of short fragments was higher