© 2017 Illumina, Inc. All rights reserved. Illumina, HiSeq, MiSeq, NextSeq, Powered by Illumina, verifi, VeriSeq, VeriSeq NIPT Solution, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the US and/or other countries. All other names, logos, and other trademarks are the property of their respective owners.
Introducing a novel, paired end, sequencing approach to NIPT Lieve Page-Christiaens, MD, PhD, Associate Medical Director at Illumina
Copenhagen April 7th 2017
2
Disclosure and Disclaimer
I am an employee of and hold equity in Illumina, Inc.
The opinions expressed during this presentation are those of the speaker and may not represent the opinions of Illumina.
This slide deck was used to support an oral briefing. Thus, the slides themselves should not be relied upon solely on their own to support any conclusion of law or fact.
These slides are intended to provide general educational information and are not intended to convey medical advice and should not be used in lieu of a medical professional’s own exercise of their professional expertise.
3
Non-Invasive Prenatal Testing Whole Genome Sequencing
YX22212019181716151413121110987654321Chromosome
4
VeriSeq NIPT Solution A Revolution for “in-lab” Non-Invasive Prenatal Testing (NIPT)
Paired- End
PCR- Free
CE-IVD EU
• cfDNA Fragment Length Determination • Fetal Fraction Estimation (FFE) and New Analysis Methodology (iFACT;LLR1) • Less total sequencing, more samples per batch (48;96), lower cost per sample • Low Failure Rate
• Turn Around Time ~26 hours cfDNA isolation through report2 • Simplified workflow • Lower cost per sample
• IVD - Conform to EU IVD directive – applies to library prep and analysis/reporting software.
1individualized Fetal Aneuploidy Confidence Test; Log Likelihood Ratio 2Sehnert AJ, Rees, B et al Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood. Clin Chemistry 2011:57(7) 1042-1049
For In Vitro Diagnostic Use. Not available in all countries or regions.
5
VeriSeq NIPT Solution Paired End Sequencing
ATTTCCGCGATCTTCCCGTTCGACTGCAGACCTTCAGCGCGCATATATCGCTAGCATACCGTTATAC CGCTAGAAG GAAGTCGCG
Human Genome
Alignment Better accuracy
Fragment Size
determination
Fragment length
Higher portion of shorter
fragments are fetal in origin1
1Chan, Zhang, Hui, Wond, Lau, Leung, Lo, Huang and Lo. Size Distributions of maternal and fetal DNA in maternal plasma. Clin Chem 2004; 50 : 88-92 Kim, Hannum, Geis, Tynan, Hogg, Zhao, Jensen, Mazloom, Oeth, Ehrich, van den Boom and Deciu. Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts. Pren Diagn 2015; 35:1-6
For In Vitro Diagnostic Use. Not available in all countries or regions.
6
VeriSeq NIPT solution Fetal Fraction Estimation
Fragment size distribution
Coverage profile1 FF from Chr Y
FF fr
om fr
ag s
ize
FF correlation
For In Vitro Diagnostic Use. Not available in all countries or regions.
1 Kim et al. Determination of fetal DNA fraction from the plasma of pregnant women using sequence read counts. Pren Diagn 2015, 35:1-6
7
Test chromosome Normalizing chromosome(s)
VeriSeq NIPT Solution
Aneuploidy Scoring: General Principle
Standard methodology New methodology
Using counting statistics*, determine if more than the expected number of reads mapped to the target chromosome
Using counting statistics, determine if more than the expected number of reads mapped to the target chromosome Using fragment size statistics gained from Paired End sequencing, determine if the fraction of short fragments was higher on the target chromosome Combine the counts and fragment size statistics for scoring
Short fragments Long fragments
For In Vitro Diagnostic Use. Not available in all countries or regions.
8
VeriSeq NIPT solution Quality Metric : iFACT1
Fetal fraction
Sam
pleC
over
age
(mill
ion
read
s)
• Dots represent two samples at fixed fetal fraction but different coverage
• Green dot has sufficient
coverage for given fetal fraction above iFACT cut-off
• Result provided • Red dot has insufficient
coverage for given fetal fraction and fails iFACT
• No result reported, sample requeued or canceled
1iFACT individualized Fetal Aneuploidy Confidence Test
For In Vitro Diagnostic Use. Not available in all countries or regions.
9
Aneuploidy classification depends on two primary metrics for each target
chromosome for each sample
Aneuploidy Score
Whole genome sequencing, counting
based method for determining over or
under representation of a target
chromosome
Fetal Fraction
An estimation of the amount of fetal
cfDNA in total cfDNA in a particular sample
VeriSeq NIPT Solution Final Aneuploidy Scoring
Fetal fraction
Ane
uplo
idy
scor
e
Expected distribution of affected samples
Expected distribution of unaffected samples
For In Vitro Diagnostic Use. Not available in all countries or regions.
10 For In Vitro Diagnostic Use. Not available in all countries or regions
VeriSeq NIPT Results Overall performance metrics for autosomes
a CI based on Wilson’s score method. Data on file. Illumina, Inc. February 2017.
Trisomy 21 Trisomy 18 Trisomy 13
Sensitivity, % (n/N) 98.9% (90/91) 90.0% (18/20)
100.0% (8/8)
2-Side 95% CIa (94.0%,99.8%) (69.9%,97.2%) (67.6%,100.0%)
Specificity, % (n/N) >99.9% (2965/2966) 99.9% (3034/3037)
99.9% (3045/3049)
2-Side 95% CIa (99.8%,100.0%) (99.7%,100.0%) (99.7%,99.9%)
11 For In Vitro Diagnostic Use. Not available in all countries or regions
VeriSeq NIPT Results Positive and Negative Predictive Values
a CI based on Wilson’s score method. Data on file. Illumina, Inc. February 2017.
Trisomy 21 Trisomy 18 Trisomy 13
PPV, % (95%Cia) 98.9 (94.0, 99.8)
85.7 (65.4, 95.0)
66.7 (39.1, 86.2)
NPV, % (95% CIa) 100 (99.8, 100)
99.9 (99.8, 100)
100 (99.9, 100)
Observed Percent of Fetal Trisomy Affected
based on Clinical Reference Standard
(95% CIa)
2.98 (2.43, 3.64) 0.65 (0.42, 1.01) 0.26 (0.13, 0.52)
12
Isolation Extraction Library Prep Sequencing Analysis Report
VeriSeq NIPT Solution Conclusion
48-96 SAMPLE
BATCHES
Next Gen Sequencer
Server
8 hours per 48 sample batch <16 hours per 48 sample batch
Hamilton
For In Vitro Diagnostic Use. Not available in all countries or regions.
13
The VeriSeq NIPT Solution Summary of technical innovations
Innovation Impact How Automated, PCR Free workflow
• Fastest workflow of any NIPT • Reduced CapEx, • Easier implementation
• VeriSeq NIPT MicroLab Star • VeriSeq NIPT Workflow Manager • PCR Free VeriSeq NIPT Sample Prep Kits
PE Sequencing • High multiplexing per run, • Reduced cost per sample
• PE information enables lower sequencing depth per sample while maintaining performance
• Captures cfDNA fragment size information
iFACT • Reduced test failure rate relative to tests using fetal fraction cutoffs2,3
• Assesses coverage and FFE to provide a dynamic confidence threshold
• Allows results on low FF samples
LLR scoring • Improved Aneuploidy Scoring • NCV (Normalized Chromosome Value) ànd Fetal Fraction Estimate are used in LLR Scoring
1Cirigliano V et al. Performance of the Neobona test: a new paired-end massively parallel shotgun sequencing approach for cell-free DNA-based aneuploidy screening. Ultrasound Obstet Gynecol 2017;; DOI: 10.1002/uog.17386
For In Vitro Diagnostic Use. Not available in all countries or regions.