TECHNICAL NOTE

Isolation and characterization of sixteen microsatellite lociof a blind cavefish, Triplophysa xiangxiensis

Yanhong Yao • Deng Qiang Wang •

Li He • Lai Ning Yu

Received: 23 September 2011 / Accepted: 20 October 2011 / Published online: 8 November 2011

� Springer Science+Business Media B.V. 2011

Abstract The blind loach, Triplophysa xiangxiensis, is an

endemic fish in feihu cave of western Hunan Province of

China. In this study, we describe the isolation and char-

acterization of sixteen polymorphic microsatellite loci for

T. xiangxiensis. The polymorphism of these markers was

determined from 36 individuals. The number of alleles per

locus ranged from 2 to 9. The observed and expected

heterozygosity ranged from 0.3625 to 0.8918 and from

0.5386 to 0.8915, respectively. The data thus suggest their

potential use as genetic markers for assessment of germ-

plasm diversity and linkage analysis of T. xiangxiensis.

Keywords Microsatellite markers � Genetic analysis �Triplophysa xiangxiensis � Cave fish

The cavefish Triptophysa xiangxiensis is a species of loach

belonging to family Cobitidae, order Cypriniformes. It is

endemic to Feihu cave of western Hunan Province of China

and first described in 1986 by Yang et al. T.xiangxiensis

shares characters with other cave-adapted animals such as

the reduction of eyes and pigmentation (Chen et al. 2004; He

et al. 2006), and can be a good model organism for examining

regressive evolution and adaptation to living in caves (Juan

et al. 2010). In this study, we present sixteen polymorphic

microsatellite loci for T. xiangxiensis that can be used to

study the genetic diversity and genetic structure.

All the samples of the caudal fin tissues were kept in 95%

alcohol,from which genomic DNA was extracted following

the salt extraction protocol as outlined by Aljanabi and

Martinez (1997). The microsatellite enriched library was

obtained from a single T. xiangxiensis using the fast isolation

by amplified fragment length polymorphism (AFLP) of

sequences containing repeats (FIASCO) protocol (Zane et al.

2002) using a biotinylated (AC)15 probe. The genomic DNA

was digested with Mse I restriction enzyme, and ligated to

Mse I AFLP adapters (Vos et al. 1995) using T4 DNA ligase

(TaKaRa). The ligated DNA was then amplified with AFLP

adaptor-specific primers (Zane et al. 2002). The PCR product

was separated on a 1.5% agarose gel and DNA bands of

400–1,000 bp in size were excised from the gel and purified

using Gel Extraction Kit (Omega, Canada). The purified

DNA was hybridized with 50-biotinylated oligonucleotides

(AC)15 in a total volume of 100 ll of 6 9 SSC and 0.1%

SDS. The mixture was denatured at 95�C for 5 min, and then

cooled slowly (20 min) to room temperature. The DNA

product was captured by using DNA mate and CH3COONa

(TaKaRa), and re-amplified with Mse I adaptor-specific

primers (Zane et al. 2002). The PCR products were ligated

with the pEASY-T1 cloning Vector (Tansgene) for 5 min at

25�C and transferred into Escherichia coli Trans1-T1

Competent Cells (Tansgene). Recombinant colonies were

amplified using M13 forward primer and (AC)15 biotin-free

primer to detect positive clones.

A total of eighty positive clones was sequenced using

M13 forward and reverse primers, 61 (76.25%) of which

Y. Yao � L. N. Yu (&)

Fisheries College, Huazhong Agricultural University,

Wuhan 430070, People’s Republic of China

e-mail: yulaininghb@gmail.com

Y. Yao

e-mail: yaoyh123@yahoo.com.cn

Y. Yao � D. Q. Wang � L. He � L. N. Yu

Yangtze River Fisheries Research Institute, Chinese Academy

of Fisheries Sciences, Wuhan 430223,

People’s Republic of China

e-mail: wondq@tom.com

L. He

e-mail: heli@yfi.ac.cn

123

Conservation Genet Resour (2012) 4:371–373

DOI 10.1007/s12686-011-9551-z

containing repeats. Finally, thirty-three primer pairs

flanking the repeat region of interest were created using

software PRIMER 3.0 (Rozen and Skaletsky 2000) and

used to test the polymorphism in the wild population of T.

xiangxiensis.

Microsatellite loci were tested using DNA of 36 individ-

ual samples of T. xiangxiensis. For the PCR amplification, a

final volume of 20 ll was used containing: 50–100 ng of

genomic DNA, 100 nM of each forward and reverse primers,

100 lM dNTPs, 1.5 mM MgCl2, 1 9 PCR buffer (TaKa-

Ra), and 1 units of Taq DNA polymerase (TaKaRa). The

PCR profile was used as follows: Pre-denature of 94�C for

5 min, followed by 30 cycles of denature at 94�C for 45 s,

annealing for 1 min with indicated temperature (Table 1),

and extension at 72�C for 1 min. Amplified fragments were

size-fractionated on 8% non-denaturing polyacrylamide gel

electrophoresis (PAGE), and visualized by silver staining. A

10 bp DNA ladder marker (TaKaRa) was used as a reference

marker for allele size determination.

Parameters as numbers of allele, heterozygosity, poly-

morphic information content (PIC) and tests for Hardy–

Weinberg equilibrium (HWE) were obtained by Popgene

v1.32 (Yeh et al. 2000). Of the thirty-three primer pairs, we

established PCR protocols for sixteen polymorphic

Table 1 Characterization of sixteen microsatellite loci for T. xiangxiensis

Locus.

accession

no.

Primer sequence (50–30) Repeat motif Ta(�)

Size

range

(bp)

NA HO HE PIC PHW

Trx1 F:CGCTACAATACTATAGTGCAGC (AC)9 55 207–156 5 0.8694 0.8015 0.5173 0.382

JN696735 R:GGATTCCCTACACTGGTTTGTG

Trx2 F:TTTATTAGAGTCGTGACACAGGC (CA)10 57 238–181 4 0.5432 0.7250 0.6861 0.828

JN696736 R:CGAACACCTGTCAAATACCG

Trx3 F:TGAGGCGTATGGCGTATGT (AC)17(CA)13 53 176–135 5 0.6382 0.7511 0.4865 0.135

JN696737 R:CAATGGCCCAATGAGTGTT

Trx4 F:TTTACAGCCGACAGAAGC (CA)8 51 218–162 4 0.7842 0.7600 0.7717 0.871

JN696738 R:CAGTGACGGAACTCAAAGATA

Trx5 F:AAGGGGCTTTGTTCCAGTA (TG)23 56 246–203 6 0.8276 0.8915 0.5690 0.664

JN696739 R:CGAGAAAATCCGATACCCA

Trx6 F:GTGCCTTGGAGTGGACAGA (TG)25 52 197–169 7 0.8918 0.8216 0.6735 0.072

JN696740 R:CGCAGCCTAAATGACAGAG

Trx7 F:TTCTGCCAAGATCATTGTCTG (AC)30 56 248–190 2 0.36250 0.5386 0.3497 0.055

JN696741 R:GATTTTCCGATTTCTTACCGT

Trx8 F:ACACGAAATGAAGTATTCCTCT (AC)31 53 188–150 5 0.7667 0.6831 0.5371 0.213

JN696742 R:AATCTCTTGCAGCACACCC

Trx9 F:CAGGCTGTCTGAAGGTCCA (CT)9(AC)9(GCGCAC)7 51 153–178 8 0.9070 0.8738 0.5867 0.541

JN696743 R:GGTCATCTGAGTAGGACATTT

Trx10 F:CATTTTTCACAGTGTAAGGC (TG)4(TTG)3 51 135–196 3 0.6830 0.7062 0.5238 0.261

JN696744 R:GGAGGTAAAGATGCGGATT

Trx11 F:ACAGGATACAGAAGAAACAGG (GT)16(TTA)5 49 278–182 7 0.8570 0.7395 0.7244 0.557

JN696745 R:TCAGAGACAGAGAATAATAAA

Trx12-1 F:AACAGGAAGTGCACAAGTG (TG)5(AC)12 51 117–169 6 0.7102 0.7678 0.7211 0.171

JN696746 R:TTTGACTGCGCTTCTGTG

Trx12-2 F:ATGAAACAAACAGACATACAGT (AC)19 49 109–138 4 0.9465 0.8033 0.3032 0.457

JN696746 R:TGTGTGAGATTTCAGAAGATC

Trx13 F:AAACAGCTTCAAGATGCCCATCG (AC)37 52 221–186 5 0.8732 0.8814 0.4681 0.035*

JN696747 R:TATCTGAGTAGGTTGCAGCA

Trx14 F:ATCTCTGCTAGTCTGCTGG (AC)34 52 256–221 9 0.5237 0.6432 0.5558 0.937

JN696748 R:TTATACCGTACCTTTCCTTTG

Trx15 F:GCTCATTGTGGTGTTATTT (TG)9 48 265–229 6 0.8796 0.9065 0.7818 0.009*

JN696749 R:ATGTGCATCTACAGTAGGC

Ta optimal annealing temperature, NA number of alleles observed, HO observed heterozygosity, HE expected heterozygosity, PIC polymorphic

information content

* Means significant deviation from Hardy–Weinberg equilibrium (HWE) (PHW \ 0.05)

372 Conservation Genet Resour (2012) 4:371–373

123

microsatellite loci that produce reliable and consistent

results with two to nine alleles (Table 1). The observed and

expected heterozygosity ranged from 0.3625 to 0.8918 and

from 0.5386 to 0.8915, respectively. Two loci significantly

deviated from Hardy–Weinberg equilibrium.

In summary, these microsatellite loci described here will

be useful for analyzing the genetic diversity and genetic

structure analysis of T. xiangxiensis in the future.

Acknowledgments We thank Professor Guan Pin Yang from Ocean

University of China for the help of technology.

References

Aljanabi SM, Martinez I (1997) Universal and salt-extracted of high

quality genomic DNA for PCR-based techniques. Nucleic Acids

Res 25:4692–4693

Chen XY, Cui GH, Yang JX (2004) A New Cave-dwelling fish

species of genus Triplophysa (Balitoridae) from Guangxi. China

Zoo Res 25(3):227–231

He L, Wang XG, Cheng QC, Xiang JC (2006) Morphologic

description on Triptophysa xiangxiensis. China Freshwater Fish

36(4):56–58

Juan C, Guzik MT, Jaume D, Cooper SJB (2010) Evolution in caves:

Darwin’s’ wrecks of ancient life’ in the molecular era. Mol Ecol

19:3865–3880

Rozen S, Skaletsky H (2000) Primer 3 on the WWW for general users

and for biologist programmers. In: Krawetz S, Misener S (eds)

Bioinformatics methods and protocols: methods in molecular

biology. Humana Press, Totowa, pp 365–386

Vos P, Hogers R, Bleeker M et al (1995) AFLP: a new technique for

DNA fingerprinting. Nucleic Acids Res 23:4407–4414

Yang GR, Yuang FX, Liao RM (1986) A new blind Cobitidae fish

from the subterranean water in Xiangxi. China J Huazhong Agric

Univ 5(3):219–223

Yeh FC, Yang R, Boyle TJ, Ye Z, Xiyan JM (2000) POPGENE 32:

microsoft windows-based freeware for population genetic anal-

ysis. 1.32. Molecular biology and biotechnology centre. Univer-

sity of Alberta, Edmonton

Zane L, Bargelloni L, Patamello T (2002) Strategies for microsatellite

isolation: a review. Mol Ecol 11:1–16

Conservation Genet Resour (2012) 4:371–373 373

123