ORIGINAL ARTICLE

Isolation, Expression, and Characterization of Blue LightReceptor AUREOCHROME Gene From Saccharina japonica(Laminariales, Phaeophyceae)

Yunyan Deng & Jianting Yao & Gang Fu & Hui Guo &

Delin Duan

Received: 14 March 2013 /Accepted: 20 July 2013 /Published online: 20 September 2013# Springer Science+Business Media New York 2013

Abstract Photosynthetic stramenopile have chloroplasts ofsecondary endosymbiotic origin and are significant as aquaticprimary productivity and biomass production. In marine en-vironments, many photosynthetic stramenopiles utilize bluelight to regulate growth, development, and organelle move-ment. Aureochrome (AUREO) is a new type blue lightphotoreceptor specific in photosynthetic stramenopiles.Previously, several AUREO orthologs were reported in ge-nomes of stramenopile members, but the full-length cDNAsequences were completed only in Vaucheria frigida(Xanthophyceae), Fucus distichus (Phaeophyceae), andOchromonas danica (Chrysophyceae). In this study, the full-length cDNA of AUREO from Saccharina japonica (desig-nated as SjAUREO) was isolated based on homologous clon-ing and the rapid amplification of cDNA ends (RACE). Itcharacterized by the full length of 1,013 bp with an openreading frame of 612 bp, which encoded a polypeptide of203 amino acids with predicted molecular weight of23.08 kDa and theoretical isoelectric point of 7.63. The de-duced amino acid sequence of SjAUREO contained one N-terminal basic region/leucine zipper (bZIP) transcription regu-lation domain and a single light-, oxygen-, or voltage-sensitive(LOV) domain near the C-terminus. Homologous analysisshowed that SjAUREO shared 40–92% similarities with thoseof other photosynthetic stramenopiles. Phylogenetic analysisrevealed close phylogenetic affinity between SjAUREO and

AUREO4 of brown alga Ectocarpus siliculosus. Real-timePCR detection revealed that the SjAUREO transcription wasmarkedly increased under BL exposure and dramaticallyupregulated in the 1-month juvenile sporophyte than those inthe 2 and 3-month materials, which indirectly reflected theSjAUREO associated with the BL-mediated photomorphogen-esis during the growth and early development of juvenile spo-rophytes. In vitro expression showed one distinct band existedat ∼27 kDa, and western blot detection proved that it waspositive to the anti-His antibody with high specificity. Ourresults enriched the knowledge of AUREO properties in S.japonica and provided clues to explore the mechanisms under-lying diverse physiological responses mediated by BL photore-ceptors AUREO in the photosynthetic stramenopiles.

Keywords Aureochrome . Blue light receptor . bZIP domain .

LOV domain . Saccharina japonica . Stramenopile

Introduction

Light is a ubiquitous environmental stimulus for almost all theorganisms, triggering various physiological processes. Manyorganisms possess various photoreceptors that bind differentchromophores to respond the different wavelengths of light(van der Horst and Hellingwerf 2004). For higher plants, twodistinct photoreceptor classes sense the blue light (BL; 390–500 nm): cryptochromes and phototropins (Banerjee andBatschauer 2005). Cryptochromes are participating in theplant photomorphogenesis (Ahmad and Cashmore 1993;Cashmore et al. 1999); while phototropins, the well-knownBL receptor for phototropism of green plant, are involvedwithlight dependent processes that serve to optimize the photosyn-thetic efficiency and promote plant growth (Briggs et al. 2001;Christie 2007).

Y. Deng : J. Yao :G. Fu :H. Guo :D. Duan (*)Institute of Oceanology, Chinese Academy of Sciences,Qingdao 266071, Chinae-mail: dlduan@qdio.ac.cn

H. GuoUniversity of the Chinese Academy of Sciences, Beijing 100049,China

Mar Biotechnol (2014) 16:135–143DOI 10.1007/s10126-013-9539-7

In marine environment, BL is predominant because shorterand longer light wavelengths could not penetrate sea water mass(Kirk 1994; Depauw et al. 2012). BL-induced phototropism andphotomorphogenesis were previously documented in algae(Hegemann 2008), however, less is known about the actualfunctions of algal BL receptor due to the complicated photosyn-thesis system in this class. Photosynthetic stramenopileincluded Phaeophyceae, Xanthophyceae, Bacillariophyceae,Chrysophyceae, and Raphidophyceae. Many photosyntheticstramenopiles such as yellow-green algae, brown algae, anddiatoms utilize BL to regulate growth and development andorganelle movement (Suetsugu and Wada 2013a). Phylo-genetically, they have chloroplasts of red algal secondaryendosymbiont origin (Cavalier-Smith 1986; Yoon et al.2002) and never possess phototropins (Takahashi et al.2007). Recently, AUREOCHROMES (AUREOs), the newtype of BL receptor, were verified and characterized in thestramenopile members Vaucheria frigida (Xanthophyceae)(Takahashi et al. 2007), Fucus distichus (Phaeophyceae),Ochromonas danica (Crysophyceae),Chattonella antiqua(Raphidophyceae; Ishikawa et al. 2009), and Phaeodactylumtricornutum (Bacillariophyceae; Bowler et al. 2008; Huysmanet al. 2013). But the full-length cDNA sequences were merelyisolated from V. frigida (VfAUREO1 and VfAUREO2)(Takahashi et al. 2007), F. distichus (FdAUREO2), and O.danica (OdAUREO1) (Ishikawa et al. 2009). Besides,AUREO-like sequences were also detected from the genomesof several stramenopile species Thalassiosira pseudonana(Bacillariophyceae), P. tricornutum (Bacillariophyceae),Aureococcus anophagefferens (Pelagophyceae), andEctocarpus siliculosus (Phaeophyceae) (Armbrust et al. 2004;Bowler et al. 2008; Ishikawa et al. 2009; Cock et al. 2010; Raykoet al. 2010), but it was not found in green plant. Therefore,AUREO was regarded as common BL receptor specific inphotosynthetic stramenopiles (Ishikawa et al. 2009).Structurally, all the AUREO sequences had one basic region/leucine-zipper (bZIP) domain and one light-, oxygen-, orvoltage-sensitive (LOV) domain. They were namedAUREOCHROMEs (AUREOs) because of the typical golden-yellow color of many stramenopile species (Takahashi et al.2007); Functionally, VfAUREO1 controlled branch develop-ment, whereasVfAUREO2 allowed development of a sex organ,which played similar role to that of higher plant for photomor-phogenesis (Takahashi et al. 2007). More recently, Huysmanet al. (2013) found another AUREO ortholog (AUREO1a) fromthe Pennate diatom P. tricornutum acted as BL-activated tran-scription factor for targeting dsCYC2 (diatom-specific cyclin 2),which triggered the G1-S phase for regulation of cell division.

Saccharina japonica (Areschoug) Lane, Mayes, Druehl andSaunders (Laminariales, Phaeophyta), is typical brown seaweedwhich niches on the substratum in sublittoral areas where BL ispredominant (Steneck et al. 2002). Previous reports showed thatBL stimulated Saccharina gametophyte growth and sporophyte

reproduction (Lüning and Dring 1972; Lüning 1975; Lüning1980; Dring 1989; Forster and Dring 1992; Forster and Dring1994). Although BL-mediated physiological responses andmorphogenesis changes have been observed in Saccharina(Shi et al. 2005; Wang et al. 2010), the properties of its BLreceptor gene and the molecular mechanisms underlying thephysiological responses were far from understanding. Recently,Deng et al. (2012) proved that the AUREO-like sequences andBL-specific responsive pathways existed in the S. japonicatranscriptome, which were inferred closely associated withgrowth, photomorphogenesis and early development of kelp.

In this study, based on the full-length cDNA sequenceisolation, transcription analysis and in vitro prokaryotic ex-pression of SjAUREO were carried out. Our aim was to verifythe AUREO gene in S. japonica and explore its functionsduring the kelp early development. Our results will help tounderstand the molecular basis of physiological responsesmediated by AUREO in the photosynthetic stramenopiles.

Materials and Methods

Blue light-emitting diodes (LEDs) of wavelength 460–475 nmand red LEDs of wavelength 620–635 nm (Ichia, Shanghai,Japan) were used as light sources. The detected irradiances of100–170 μmol photons m−2 s−1 were measured with a quan-tum photometer (LI-COR, LI-250, Nebraska, USA) before thealgae incubation.

Sample Collection and Treatment

Juvenile S. japonica sporophytes were collected from thecultivated rafts in Rongcheng, Shandong, China in March2011. After the collection, the algal samples were washedfor three times and precultured in darkness at 8 °C for 4 h,and then were transferred into BL illumination for 2 h.

For light treatments, fresh juvenile sporophytes of S. ja-ponica grew for 1 (2–3×15–25 cm), 2 (6–10×45–65 cm), and3 months (18–25×90–110 cm) were collected respectivelyfrom the cultivated rafts in Rongcheng, China fromNovember 2012 to January 2013. The healthy individualswere selected, rinsed with sterilized seawater for several timesto remove epiphytes and pre-cultured in the darkness for 4 h.Followed that, the algal materials were immersed in sterilizedseawater under darkness, red light (RL), and BL for 10 and30 min, and 1 and 2 h, respectively. Cultures were carried outat 8±1.0 °C. After treatments, all the materials were putimmediately in liquid nitrogen and stored at −80 °C.

RNA Extraction and cDNA Synthesis

Total RNA extraction was conducted according to cetyltri-methylammonium bromidemethods (Yao et al. 2009) and was

136 Mar Biotechnol (2014) 16:135–143

treated with RNase-free DNase I (TaKaRa, Dalian, China) toremove residual genomic DNA. The quantification of the totalRNA was determined with ultraviolet (UV) absorbance at260 nm. The first strand cDNA was prepared using thePrimeScript II cDNA synthesis kit (Takara, Tokyo, Japan)according to the manufacturer’s instructions.

SjAUREO cDNA Cloning

One pair of specific primers, SjAUREO-F and SjAUREO-R(Table 1), were designed based on the known AUREOs ofstramenopile algae for amplifying SjAUREO cDNA fragmentabout 330 bp. PCR was performed in a 25 μl reaction volume,which contained 12.5 μl 2×TransTaqTM High Fidelity (HiFi)PCR SuperMix (TransGen Biotech, Beijing, China), 1 μl ofcDNA of S. japonica , 1 μl of each primer (10 μM) and 9.5 μlof RNase free water. The amplification protocol was carriedout at 94 °C for 5 s, followed by 39 cycles of 95 °C for 30 sand 50 °C for 30 s, 72 °C 2 min, and a final extension at 72 °Cfor 10 min. The amplified products were migrated on 1 %agarose gel, and the objective bands were purified by agarosegel DNA fragment recovery kit (TaKaRa, ToKyo, Japan),subcloned into pMD-19 T vector (Takara, Tokyo, Japan) andsequenced (Sangon, Shanghai, China).

Rapid Amplification of SjAUREO cDNA Ends

Nested-PCR amplification was carried out to clone the 3′ endusing primers P1 and P2, while primers P3 and P4 were

applied to obtain the 5′ end (Table 1). Both 3′ and 5′ RACEwere carried out with SmartTM RACE cDNA AmplificationKit (Clontech) according to the manufacturer's instruction.Touchdown PCR method was used for RACE amplificationand the PCR products were resolved by electrophoresis on1 % agarose gel. The interest fragment was excised, purifiedby agarose gel DNA fragment recovery kit (TaKaRa, ToKyo,Japan), subcloned into pMD-19 T vector (TaKaRa, Tokyo,Japan) and sequenced (Sangon, Shanghai, China).

Analysis of SjAUREO Deduced Amino Acid Sequence

The yielded sequence was analyzed for theoretical molecularweight and isoelectric point with the deduced amino acidsequence using ORF Finder and ProtParam softwares(Gasteiger et al. 2005). The predicted function of ORF wasobtained by BLAST (Altschul et al. 1997) from the NCBIdatabase. The signal peptide of protein sequence was predict-ed by SignalP 4.0 Server (Petersen et al. 2011) and TMHMMServer version 2.0 program (Krogh et al. 2001) was used toanalyze transmembrane topological structure. SOPMA pro-gram (Geourjon and Deleage 1995) was applied to predictsecondary structure of SjAUREO.

Phylogenetic Analysis of SjAUREO

For phylogensis analysis, together with the other known 11AUREO sequences of stramenopile species, which includingPhaeophyceae: E. siliculosus (Accession: CBN77970.1 andCBJ30909.1), F. distichus subsp. evanescens (Accession:BAH80320.1and BAH80321.1); Xanthophyceae: V. frigida(Accession: BAF91488.1 and BAF91489.1); Chrysophyceae:O. danica (Accession: BAH80322.1); Raphidophyceae: C. ma-rina var. antiqua (Accession: BAH80324.1); Bacillariophyceae:T. oceanica (EJK75561.1, EJK65981.1 and EJK47540.1) wereadopted for the alignments by using the Clustal X 2.0 software

Table 1 List of primers used inthis study Primer name Sequences (5′→3′) Description

SjAUREO-F CGAATCAAAGGAACCGAACT Fragment amplification

SjAUREO-R CGGCAACGAAAAACTGGTTC Fragment amplification

P1 TTTTGGAACCAGTTTTTCGTTGCCG 3′ RACE-PCR

P2 GCGGGGGATGAGATGTGATGGCTGG 3′ RACE-PCR

P3 ATGAGGGCCTGCATCAGCTGGAAGTC 5′ RACE-PCR

P4 AGCAACAGGCAGTTCGGTTCCTTTGATTCG 5′ RACE-PCR

P5-F GAATCAAAGGAACCGAACTG q-PCR for SjAUREO

P5-R TAGCCCGTCAACGTCAAA q-PCR for SjAUREO

P6-F GACGGGTAAGGAAGAACGG q-PCR for β-actin

P6-R GGGACAACCAAAACAAGGGCAGGAT q-PCR for β-actin

P7-F ATGTCGGAGCAGCAGAAGCTGG ORF amplification

P7-R CCGCAGCCCCTGTACGGCAACGAAAAAC ORF amplification

Fig. 1 Schematic structure of SjAUREO. The bZIP and LOV domainsare highlighted in dark gray background . The length and predictedmolecular weight of deduced amino acids polypeptide are shown on theright

Mar Biotechnol (2014) 16:135–143 137

(Thompson et al. 1994; Larkin et al. 2007). The evolutionaryrelationship was inferred using the maximum likelihood methodby the software of MEGA5.05 (Tamura et al. 2011). The boot-strap consensus tree inferred from 1,000 replicates was taken torepresent the phylogenetic relationship of the taxa analyzed(Felsenstein 1985).

Transcriptional Profiles of SjAUREO with Quantitative PCRDetection

Real-time quantitative PCR was performed with the SYBR®Premix Ex TaqTM (TakaRa, Tokyo, Japan) on the TakaraTP800 Thermal Cycler Dice™ (TakaRa, Tokyo, Japan). First-strand cDNA synthesized from 2 μg total RNA was used astemplate. Based on the obtained SjAUREO sequence, a pair ofspecific primer, P5-F and P5-R (Table 1), was designed toamplify a 155 bp product. Another pair of primer, P6-F andP6-R (Table 1), was applied β-actin gene fragment of 184 bp asthe internal control (Deng et al. 2012). Real-time PCR wasperformed in volume of 25 μl, and cycling conditions were95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 50 °Cfor 30 s, and 72 °C for 30 s. Specificity of each pair of primerwaschecked by dissociation curve. The baseline was set automati-cally with the software for maintaining consistency. All reactionswere performed in biological triplicates, and the results wereexpressed relative to the expression levels of β-actin in eachsample by using the 2−△△Ct method (Schmittgen et al. 2000).

Prokaryotic In Vitro Expression of SjAUREO

The specific primers P7-F and P7-R (Table 1) were used forORF amplification of SjAUREO gene. After sequencing(Sangon, Shanghai, China), the objective sequence with ORFwas subcloned into the expression vector pEASY-E2 (TransGenBiotech, Beijing, China), which allowed for the generation offusion proteins with a His-tag. The recombinant plasmid wasthen transformed into E. coli expression strain Transetta (DE3;TransGen Biotech, Beijing, China) and the incubation solutionwas spread on lysogeny broth (LB) agar plates containedampicillin (0.1 mg/ml) for the positive clone selection.

About 1 ml solution was pre-cultured in LB medium over-night at 37 °C, then was transferred into 100 ml (1:100) of LBfresh medium for the incubation until OD600 value reached to0.5–0.7 (Biophotometer, Eppendorf, Germany). To induce therecombinant protein, different final concentrations (1.0, 2.0,3.0, and 4.0 mM, respectively) of IPTG (isopropyl-β -D-thio-galactopyranoside) were added into the medium for the opti-mization selection. The culture solutions were then centri-fuged and lysed by sodium dodecyl-sulfate (SDS) polyacryl-amide gel electrophoresis loading buffer. After boiled for10 min, the mixtures were migrated on the 15 % SDS-PAGE(ATTO, Tokyo, Japan). The empty vector expressions wereused as negative control.

Western Blot Analysis

Whole-cell lysates were resolved by 15 % SDS-PAGE andelectroblotted onto nitrocellulose membrane using the Ideaelectrophoresis system (Idea scientific, MN). The membranewas incubated in blocking solution (1×PBS, 0.1 % Tween-20and 5 % nonfat dry milk powder) for 2 h at room temperature.To detect the objective protein, primary anti-His mouse mono-clonal antibody (1:1,000; TransGen Biotech, Beijing, China)was incubated with the membrane under gentle agitation for 2 hat room temperature. After rinsing with TBST buffer, themembrane was transferred into the solution contained horse-radish peroxidase-conjugated secondary antibody (IgG goatanti-mouse; 1:2,000; TransGen Biotech, Beijing, China) for2 h at room temperature, the yielded protein bands were detect-ed with autoradiography.

Results

The Full-Length cDNA Sequence of SjAUREO

The 3′RACE product with primers P1 and P2was 420 bp, anda 309-bp fragment was amplified by 5′RACEwith primers P3and P4. The full-length cDNA sequence of SjAUREO of1,013 bp was obtained by overlapping of these two fragmentswith the 329 bp fragment obtained by primers SjAUREO-Fand SjAUREO-R. The complete sequence consisted of a 5′terminal untranslated region (UTR) of 23 bp, a 3′ UTR of378 bp with a poly (A) tail, and an open reading frame (ORF)of 612 bp. The cDNA sequence of SjAUREO was depositedin GenBank with accession number JX995109.

Characterization of the Deduced SjAUREO Protein Sequence

The ORF of SjAUREO (612 bp) encoded 203 amino acidspolypeptide with predicted molecular weight of 23.08 kDa andtheoretical isoelectric point of 7.63. Maximal values of theoriginal shearing site (C score), signal peptide (S score), andsynthesized shearing site (Y score) were 0.109, 0.117, and 0.187,respectively, which indicated that there was no signal peptide inthe deduced amino acid sequence. While to the transmembranetopological structure analysis, all the parts of the SjAUREOwerepresumed to be outside the membrane. Secondary structureprediction showed that the proportions of α-helix, extendedstrand, β-turn and random coil were 44.83 %, 17.73 %,7.39 %, and 30.05 % respectively, which presumed that α-helix and random coil were major components of SjAUREO.

Structural Prediction and Phylogenetic Analysis of SjAUREO

Homologous analysis found that SjAUREO shared 40–92 %similarities with other 11 known AUREOs of photosynthetic

138 Mar Biotechnol (2014) 16:135–143

stramenopiles. BLAST program analysis revealed that the de-duced amino acid sequence of SjAUREO had one N-terminalbasic bZIP transcription regulation domain and one LOV do-main near the C terminus (Fig. 1). In the bZIP domain, the DNAbinding motifs and 3 heptads leucine repeats were conserved,andα-helix was presumed as the major component of secondarystructure (Fig. 2a); while in the LOV domain, although lack 1

amino acid residue (Gln), SjAUREO have the other 10 con-served amino acid residues which were necessary for flavinmononucleotide (FMN) binding and cysteinyl adduct formation(Fig. 2b).

The phylogenetic tree was constructed with maximumlikelihood (ML) method from the two functional domains(70 amino acids for the bZIP domain and 113 amino acidsfor the LOV domain) of 12 AUREO sequences (Fig. 3). TheSjAUREO showed closer relationship with AUREO4 ofbrown alga E. siliculosus (EsAUREO4; CBJ30909.1) withfull node support. Contrary to average homologies with theother known 11 AUREO orthologs about 53 %, it exhibited92 % high similarities with the EsAUREO4.

Transcriptional Analysis of SjAUREO

For both SjAUREO and β-actin genes, there was only onemaximum at the corresponding melting temperature in thedissociation curve analysis, which indicated that the PCRwas specifically amplified. To the kelp materials of 3 growthstages (1, 2, and 3 months) and 4 irradiation times (10 min,30 min, 1 h, and 2 h), 12 combinations were yielded for the

Fig. 2 a , b Structure-basedmultiple alignments of SjAUREOand other 11 AUREOCHROMEsfrom stramenopiles. Thesecondary structures ofSjAUREO are shown abovealignments. Helix is representedas α-helix, and β-turn is markedwith arrow. a bZIP domain. Thenuclear localization signal (N-X7-R) is shown in dark graybackground; the heptad repeatedleucine residues are highlightedby boxes . b LOV domain. The 11amino acid residuesn associatedwith flavin binding arehighlighted on dark graybackground. Sj Saccharinajaponica , Es Ectocarpussiliculosus , Fd Fucus distichussubsp. evanescens, CmChattonella marina var. antique ,To Thalassiosira oceanica , OdOchromonas danica, VfVaucheria frigida

Fig. 3 Phylogenetic tree inferred from Aureochromes amino acid se-quences alignment using ML method. Bootstrap value was calculated for1,000 replicates (Support<50 % is shown as “-”)

Mar Biotechnol (2014) 16:135–143 139

test. For each combination, algal material was exposed to BL,RL and darkness, respectively. The SjAUREO transcriptionswere almost similar in RL and darkness, while remarkablyincreased under BL exposures (Fig. 4). The elevated transcriptabundances could be detected after 10 min BL irradiation, andreached the maximum at 1 h (Fig. 4). Besides, the 1-monthgrowth materials were more obviously influenced by the BLinduction, and the up-regulation level of SjAUREO reached4.1-fold at 10 min, 5.0-fold at 30 min, 7.3-fold at 1 h, and 4.5-fold at 2 h, respectively, compared with that in darkness(Fig. 4a); while less than 2-fold was found in all the juvenilesporophytes at 2 and 3-month growth stages (Fig. 4b, c).

In Vitro Expression of SjAUREO

The recombinant proteins were induced by IPTG of differentconcentration for 0–7 h to test optimal condition for SjAUREO

prokaryotic expression. One distinct band about 27 kDa wasdetected after induced by 2 mM IPTG for 4 h, which coincidedwith the presumed protein molecular weight, and no obviousexpression of 27 kDa was detected in the control test (withoutinduction of IPTG; Fig. 5a). Western blot analysis proved thatthe 27 kDa bandwas positive to the anti-His antibodywith highspecificity (Fig. 5b).

Discussion

Functional Deducing of SjAUREO

Like other AUREO orthologs in photosynthetic stramenopiles(Armbrust et al. 2004; Takahashi et al. 2007; Bowler et al.2008; Ishikawa et al. 2009; Cock et al. 2010; Rayko et al.2010), SjAUREO included one bZIP transcriptional domain

Fig. 4 Relative mRNAexpression of SjAUREO gene injuvenile sporophytes of 1-monthstage (a), 2-month stage (b), and3-month stage (c) exposed to BL(black bar), RL (white bar), anddarkness (gray bar), respectively.Values are mean±standarddeviation

140 Mar Biotechnol (2014) 16:135–143

and a single BL-sensing LOV domain (Fig. 1) and putativelyfunctioned as BL-activated transcription factor. The bZIP do-main are ubiquitously distributed in the transcriptional regula-tors, and could bind DNA as dimers by heptads repeat ofleucine or other bulky hydrophobic amino acids creating anamphipathic helix (Ehlert et al. 2006). The bZIP domainusually binds to DNA sequences with an ACGT core such asC-boxes (GACGTC) and G-boxes (CACGTG) (Jakoby et al.2002). And the nuclear localization signal (N–X7–R; com-posed of 9 amino acid residues) is important for DNA bindingin bZIP domain. Takahashi et al. (2007) showed that the bZIPdomain in VfAUREO1 preferentially bound to the sequenceTGACGT and the binding betweenVfAUREO1 with theTGACGT sequence was enhanced by BL and subsequentlyattenuated by prolonged periods of dark incubation (for25 min) following BL irradiation (Takahashi et al. 2007).More recently, Hisatomi et al. (2013) confirmed that the bZIPdomain was necessary for DNA binding in VfAUREO1, andbelieved that the bZIP DNA-binding motif and the disulfidelinkages played an important role in the formation and stabilityfor dimmer. BL induced α-helical unfolding in the LOVdomain might cause conformational changes in the bZIP and/or the linker of homodimer and enhanced the DNA binding(Hisatomi et al. 2013). The LOV domain is a subset of the largeand diverse Per-ARNT-Sim (PAS) domain superfamily andfunctionally conserved as the BL photosensory modules byforming a cysteinyl adduct to FMN upon BL irradiation(Crosson and Moffat 2001). It has been firstly described inphototropins and associated with many BL receptor moleculesincluding circadian clock regulators found in both plants (ZTL,

FKF1, LKP2) and fungi (WC-1, VVD; Cheng et al. 2003).Back to our results, the DNA binding motifs and 3 heptadleucine repeats were conserved; α-helix was predicted as themajor secondary component in bZIP domain, which was sup-posed to facilitate homodimer formation (Fig. 2a). TheSjAUREO-LOV domain had 10 of the 11 conserved residuesnecessary for the FMN binding (Fig. 2b). In the VfAUREO1-LOV domain, the cavity of the chromophore binding pocketwas largely lined with hydrophobic residues and the Gln 317attributed to the stabilization of isoalloxazine ring via hydrogenbonds (Mitra et al. 2012). Although the corresponding Gln 317was lack in SjAUREO-LOV domain, other residues (Cys 151,Arg 152,Gln 155,Arg168,Asn183,Asn193, Phe195) associatedwith formation and hydrophobic stabilization of the photoadductwere conserved, therefore, we presumed SjAUREO could func-tion as a BL photoreceptor.

Phylogenetic Characterization of SjAUREO

Phylogenetic topology revealed close phylogenetic affinity be-tween SjAUREO and EsAUREO4 (Fig. 3), which was consis-tent with the high homologies (92 %) shared between the twosequences, contrary to the 53 % average identities with the other11 AUREO orthologs. Phylogenetically, stramenopiles includednon-photosynthetic organisms (such as oomycetes andlabyrinthulas) and the photosynthetic organisms. Janouškovecaet al. (2010) inferred that the non-photosynthetic stramenopileshad lost plastids secondarily after the divergence from photosyn-thetic stramenopiles ancestor. The non-existences (or extinction)of AUREO in non-photosynthetic stramenopiles implied that thephylogenetic origin of AUREO was linked to the secondaryendosymbiosis at the beginning of the heterokont clade(Depauw et al. 2012).

Transcriptions Analysis of SjAUREO to Juvenile Sporophytes

To all the juvenile sporophytes, high transcriptions were detect-ed in BL treatments compared with that in RL and darknessconditions, which indicated that SjAUREO was positive to theBL induction. Greatly increased of SjAUREO (compared withthe expression level in darkness) were found in 1 month mate-rials (Fig. 4a), suggested that this growing stage were moresensitive to BL illumination than those in the other develop-mental stages. We inferred that SjAUREO was implicated inBL mediated photomorphogenesis of the juvenile sporophyte,especially during the early growing stage. It was hypothesizedthat, upon BL illumination, the LOV domain of SjAUREOwaschanged due to cysteinyl-FMN adduct formation, which in-duced conformational change in homodimer SjAUREO com-plex. The activated SjAUREO initiated BL signal transductionthrough interaction of its bZIP domain with different regulatoryelements to coordinately activate and repress of specific genes,which then resulted in synergistic onset of photomorphogenesis.

Fig. 5 SDS-PAGE (15 %) and western blot analysis of SjAUREOrecombinant protein a . SDS-PAGE analysis of the induced recombinantSjAUREO.M protein marker, lane 1 negative control (without inductionof IPTG), lane 2 induced expression of SjAUREO by 2 mM IPTG for4 h. b Western blot analysis of SjAUREO recombinant protein.M proteinmarker, lane 1 western blot result based on the sample after 4 h ofinduction. Note target protein at ∼27 kDa (arrow)

Mar Biotechnol (2014) 16:135–143 141

Nevertheless, detailed studies are needed to verify the elementsrelated to the SjAUREO binding and signal transduction, espe-cially the interaction of transcriptional factors to the SjAUREO;In vivo examination is also required to determine the actualfunctions of SjAUREO in S. japonica.

It is well known that the cell division in photosyntheticorganisms is tightly regulated by light, and the cell cycle ismainly regulated by the cyclin-dependent kinase (CDK) familyfor DNA replication, mitosis, and cytokinesis (Moulager et al.2007). Photoperiodic control of cell division was mediatedthrough the circadian clock in unicellular algal speciesChlamydomonas (Edmunds and Laval-Martin 1984), Euglena(Hagiwara et al. 2002; Bisova et al. 2005), and Ostreococcus(Moulager et al. 2007); however, no literature was focused on themechanism basis underlying kelp proliferation and growth.Morerecently, Huysman et al. (2013) proved that AUREO1a couldtarget dsCYC2 in P. tricornutum , and regulated cell division bycontrolling a G1-to-S cell cycle checkpoint. Based on our previ-ous transcriptome data (Deng et al. 2012), about 80 unigeneshomologous to the cyclin or CDK family members in higherplants or other algae were found, of which 66 sequencesexhibited elevated transcript abundance after BL exposure. Thisindirectly reflected that the progression of BL perception to kelpgrowth was probably mediated via cellular cyclin and CDKfactors, however, evidences are required for proving theassumption.

Prokaryotic Expression of SjAUREO

The SjAUREO recombinant protein was expressed in E. coli ,and reached maximum when induced by 2 mM IPTG for 4 h.Obvious band at ∼27 kDa appeared on the SDS-PAGEelectrophesis (15 %) and western blotting detection (Fig. 5),which was consisted with the theoretical molecular mass,demonstrated the successful heterologous expression ofSjAUREO . Further works are required to purify the recombi-nant SjaTPS protein and obtain bioactive product, and thus toprove the formation of the FMN- SjAUREO photo-adduct.

Acknowledgment This research was supported by National NaturalScience Foundation of China (No. 40976085) and Shandong AgricultureBreeding Engineering Biological Resources Innovation of Research Pro-ject. We sincerely thank Drs. Hironao Kataoka and Fumio Takahashi fortheir valuable comments and critical reading of the manuscript. Thanksare either due to Lin Xiao, Jin Zhao, and Ge Liu for their help with theexperiments. The authors acknowledged the anonymous reviewers for thecritical comments and suggestions for the manuscript.

References

Ahmad M, Cashmore AR (1993) HY4 gene of A. thaliana encodes aprotein with characteristics of a blue-light photoreceptor. Nature366:162–166

Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W,Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic Acids Res25:3389–3402

Armbrust EV, Berges JA, Bowler C, Green BR, Martinez D, Putnam NH,Zhou S, Allen AE, Apt KE, Bechner M, Brzezinski MA, Chaal BK,Chiovitti A, Davis AK, Demarest MS, Detter JC, Glavina T,Goodstein D, Hadi MZ, Hellsten U, Hildebrand M, Jenkins BD,Jurka J, Kapitonov VV, Kröger N, Lau WWY, Lane TW, LarimerFW, Lippmeier JC, Lucas S, Medina M, Montsant A, Obornik M,Parker MS, Palenik B, Pazour GJ, Richardson PM, Rynearson TA,Saito MA, Schwartz DC, Thamatrakoln K, Valentin K, Vardi A,Wilkerson FP, Rokhsar DS (2004) The genome of the diatomThalassiosira pseudonana: ecology, evolution, and metabolism.Science 306:79–86

Banerjee R, Batschauer A (2005) Plant blue-light receptors. Planta 220:498–502

Bisova K, Krylov DM, Umen JG (2005) Genome-wide annotation andexpression profiling of cell cycle regulatory genes inChlamydomonas reinhardtii . Plant Physiol 137:475–491

Bowler C, Allen AE, Badger JH, Grimwood J, Jabbari K, Kuo A,Maheswari U, Martens C,Maumus F, Otillar RP, Rayko E, SalamovA, Vandepoele K, Beszteri B, Gruber A, Heijde M, Katinka M,Mock T, Valentin K, Verret F, Berges JA, Brownlee C, Cadoret J-P,Chiovitti A, Choi CJ, Coesel S, De Martino A, Detter JC, Durkin C,Falciatore A, Fournet J, Haruta M, Huysman MJJ, Jenkins BD,Jiroutova K, Jorgensen RE, Joubert Y, Kaplan A, Kröger N, KrothPG, La Roche J, Lindquist E, LommerM,Martin-Jézéquel V, LopezPJ, Lucas S, Mangogna M, Mcginnis K, Medlin LK, Montsant A,Oudot-Le Secq M-P, Napoli C, Obornik M, Parker MS, Petit J-L,Porcel BM, Poulsen N, Robison M, Rychlewski L, Rynearson TA,Schmutz J, Shapiro H, Siaut M, Stanley M, Sussman MR, TaylorAR, Vardi A, Von Dassow P, Vyverman W, Willis A, Wyrwicz LS,Rokhsar DS, Weissenbach J, Armbrust EV, Green BR, Van De PeerY, Grigoriev IV (2008) The Phaeodactylum genome reveals theevolutionary history of diatom genomes. Nature 456:239–244

Briggs WR, Beck CF, Cashmore AR, Christie JM, Hughes J, Jarillo JA,Kagawa T, Kanegae H, Liscum E, Nagatani A, Okada K, SalomonM, Rudiger W, Sakai T, TakanoM, Wada M,Watson JC (2001) Thephototropin family of photoreceptors. Plant Cell 13:993–997

Cashmore AR, Jarillo JA, Wu YJ, Liu D (1999) Cryptochromes: bluelight receptors for plants and animals. Science 284:760–765

Cavalier-Smith TA (1986) In: Round FE, Chapman DJ (eds) Progress onphycological research. Biopress, Bristol

Cheng P, He Q, Yang Y, Wang L, Liu Y (2003) Functional conservationof light, oxygen, or voltage domains in light sensing. Proc Natl AcadSci U S A 100:5938–5943

Christie JM (2007) Phototropin blue-light receptors. Annu Rev Plant Biol58:21–45

Cock JM, Streck L, Rouze P, Scornet D, Allen AE, Amoutzias G,Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B,Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, BrownleeC, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E,Da Silva C, Delage L, Delaroque N, Dittami SM, Doulbeau S, EliasM, Farnham G, Gachon CM, Gschloessl B, Heesch S, Jabbari K,Jubin C, Kawai H, Kimura K, Kloareg B, Kupper FC, Lang D, LeBail A, Leblanc C, Lerouge P, Lohr M, Lopez PJ, Martens C,Maumus F, Michel G, Miranda-Saavedra D, Morales J, Moreau H,Motomura T, Nagasato C, Napoli CA, Nelson DR, Nyvall-Collen P,Peters AF, Pommier C, Potin P, Poulain J, Quesneville H, Read B,Rensing SA, Ritter A, Rousvoal S, Samanta M, Samson G,Schroeder DC, Segurens B, Strittmatter M, Tonon T, Tregear JW,Valentin K, von Dassow P, Yamagishi T, Van de Peer Y, Wincker P(2010) The Ectocarpus genome and the independent evolution ofmulticellularity in brown algae. Nature 465:617–621

Crosson S, Moffa K (2001) Structure of a flavin-binding plant photore-ceptor domain: insights into light-mediated signal transduction. ProcNatl Acad Sci U S A 98:2995–3000

142 Mar Biotechnol (2014) 16:135–143

Deng Y, Yao J, Wang X, Guo H, Duan D (2012) Transcriptome sequenc-ing and comparative analysis of Saccharina japonica (Laminariales,Phaeophyceae) under blue light induction. Plos ONE 7(6):e39704

Depauw FA, Rogato A, Ribera d’Alcalá M, Falciatore A (2012) Explor-ing the molecular basis of responses to light in marine diatoms. JExp Bot 63:1575–1591

Dring MJ (1989) Stimulation of light-saturated photosynthesis in Lami-naria (Phaeophyta) by blue light. J Phycol 25:254–258

Edmunds LN, Laval-Martin DL (1984) Cell division cycles and circadianoscillators in Euglena. Chronobiol Int 1:1–9

Ehlert A, Weltmeier F, Wang X, Mayer CS, Smeekens S, Vicente-Carbajosa J, Droge-Laser W (2006) Two-hybrid protein–proteininteraction analysis in Arabidopsis protoplasts: establishment of aheterodimerization map of group C and group S bZIP transcriptionfactors. Plant J 46:890–900

Felsenstein J (1985) Confidence limits on phylogenies: an approach usingthe bootstrap. Evolution 39:783–791

Forster RM, Dring MJ (1992) Interaction of blue light and inorganiccarbon supply in the control of light-saturated photosynthesis inbrown algae. Plant Cell Environ 15:241–247

Forster RM, Dring MJ (1994) Influence of blue light on the photosyn-thetic capacity of marine plants from different taxonomic, ecologicaland morphological groups. Eur J Phycol 29:21–27

Gasteiger E, Hoogland C, Gattiker A, Duvaud S,WilkinsMR,Appel RD,Bairoch A (2005) In: Walker JM (ed) The Proteomics ProtocolsHandbook. Humana Press, New Jersey

Geourjon C, Deleage G (1995) SOPMA: significant improvements inprotein secondary structure prediction by consensus prediction frommultiple alignments. Comput Appl Biosci 11:681–684

Hagiwara SY, Bolige A, Zhang Y, Takahashi M, Yamagishi A, Goto K(2002) Circadian gating of photoinduction of commitment to cell-cycle transitions in relation to photoperiodic control of cell repro-duction in Euglena . Photochem Photobiol 76:105–115

Hegemann P (2008) Algal sensory photoreceptors. Annu Rev Plant Biol59:167–189

Hisatomi O, Takeuchi K, Zikihara K, Ookubo Y, Nakatani Y, TakahashiF, Tokutomi S, KataokaH (2013) Blue light-induced conformationalchanges in a light regulated transcription factor, Aureochrome-1.Plant Cell Physiol 54:93–106

Huysman MJJ, Fortunato AE, Matthijs M, Costa BS, Vanderhaeghen R,Van den Daele H, SachseM, Inzé D, Bowler C, Kroth PG,WilhelmC,Falciatore A, VyvermanW,Veylder LD (2013) AUREOCHROME1a-mediated induction of the diatom-specific cyclin dsCYC2 controls theonset of cell division in diatoms (Phaeodactylum tricornutum). PlantCell. doi:10.1105/tpc.112.106377

Ishikawa M, Takahashi F, Nozaki H, Nagasato C, Motomura T, KataokaH (2009) Distribution and phylogeny of the blue light receptorsAureochromes in eukaryotes. Planta 230:543–552

Jakoby M, Weisshaar B, Dröge-Laserb W, Viconte-Carbajosa J,Tiedemann J, Kroj T, Parcye F (2002) bZIP transcription factors inArabidopsis. Trends Plant Sci 7:106–111

Janouškoveca J, Horáka A, OborníkbM, Lukešb J, Keelinga PJ (2010) Acommon red algal origin of the apicomplexan, dinoflagellate, andheterokont plastids. Proc Natl Acad Sci U S A 107:10949–10954

Kirk JTO (1994) Light and Photosynthesis in Aquatic Ecosystems, 2ndedn. Cambridge University Press, Cambridge

Krogh A, Larsson B, von Heijne B, Sonnhammer ELL (2001) Predictingtransmembrane protein topology with a hidden Markov model:application to complete genomes. J Mol Biol 305:567–580

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA,McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thomp-son JD, Gibson TJ, Higgins DG (2007) Clustal W and clustal Xversion 2.0. Bioinformatics 23:2947–2948

Lüning K, Dring MJ (1972) Reproduction induced by blue light infemale gametophytes of Laminaria saccharina . Planta 104:252–256

Lüning K (1975) Reproduction, growth and photosynthesis of gameto-phytes of Laminaria saccharina grown in blue and red light. MarBiol 29:195–200

Lüning K (1980) Critical levels of light and temperature regulating thegametogenesis of the three Laminaria species (Phaeophyceae). JPhycol 16:1–15

Mitra D, Yang X, Moffat K (2012) Crystal structures of Aureochrome1LOV suggest new design strategies for optogenetics. Structure 20:698–706

Moulager M, Monnier A, Jesson B, Bouvet R, Mosser J, Schwartz C,Garnier L, Corellou F, Bouget F-Y (2007) Light-dependent regula-tion of cell division in Ostreococcus : Evidence for a major tran-scriptional input. Plant Physiol 144:1360–1369

Suetsugu N,Wada M (2013a) Evolution of three LOV blue light receptorfamilies in green plants and photosynthetic stramenopiles:phototropin, ZTL/FKF1/LKP2 and Aureochrome. Plant Cell Phys-iol 54:8–23

Petersen TN, Brunak S, von Heijne G, Nielsen H (2011) SignalP 4.0:discriminating signal peptides from transmembrane regions. NatMethods 8:785–786

Rayko E, Maumus F, Maheswari U, Jabbari K, Bowler C (2010) Tran-scription factor families inferred from genome sequences of photo-synthetic stramenopiles. New Phytol 188:52–66

Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW(2000) Quantitative reverse transcription-polymerase chain reactionto study mRNA decay: comparison of endpoint and real-timemethods. Anal Biochem 285:194–204

Shi CJ, Kataoka H, Duan DL (2005) Effects of blue light on gametophytedevelopment of Laminaria japonica (Laminariales, Phaeophyta).Chin J Oceanol Limnol 23:323–329

Steneck RS, Graham MH, Bourque BJ, Corbett D, Erlandson JM, EstesJA, TegnerMJ (2002) Kelp forest ecosystems: biodiversity, stability,resilience and future. Environ Conservat 29:436–459

Takahashi F, Yamagata D, Ishikawa M, Fukamatsu Y, Ogura Y,Kasahara M, Kiyosue T, Kikuyama M, Wada M, Kataoka H(2007) AUREOCHROME, a photoreceptor required for pho-tomorphogenesis in stramenopiles. Proc Natl Acad Sci U S A104:19625–19630

Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: improvingthe sensitivity of progressive multiple sequence alignment throughsequence weighting, position-specific gap penalties and weight ma-trix choice. Nucleic Acids Res 22:4673–4680

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011)MEGA5: molecular evolutionary genetics analysis using maximumlikelihood, evolutionary distance, and maximum parsimonymethods. Mol Biol Evol 28:2731–2739

Van der Horst MA, Hellingwerf KJ (2004) Photoreceptor proteins, “staractors of modern times”: a review of the functional dynamics in thestructure of representative members of six different photoreceptorfamilies. Accounts Chem Res 37:13–20

Wang WJ, Sun XT, Wang FJ (2010) Effect of blue light on earlysporophyte development of Saccharina japonica (Phaeophyta).Mar Biol 157:1811–1817

Yao JT, FuWD,Wang XL, Duan DL (2009) Improved RNA isolation forLaminaria japonica Aresch (Laminariaceae, Phaeophyta). J ApplPhycol 21:233–238

Yoon HS, Jhackett JD, Bhattacharya D (2002) A single origin of theperidinin and fucoxanthin containing plastids in dinoflagellatesthrough tertiary endosymbiosis. Proc Natl Acad Sci U S A 99:11724–11729

Mar Biotechnol (2014) 16:135–143 143