1

INTERACTION OF SYNTENIN-1 AND THE NG2 PROTEOGLYCAN IN MIGRATORY

OLIGODENDROCYTE PRECURSOR CELLS

Nivedita Chatterjee1*, Judith Stegmüller

1,2*, Philipp Schätzle

1, Khalad Karram

1, Michael Koroll

3,

Hauke B. Werner4, Klaus-Armin Nave

4, and Jacqueline Trotter

1

Molecular Cell Biology, Dept. of Biology, Johannes Gutenberg University of Mainz, Germany1, Present

address: Max-Planck-Institute of Experimental Medicine, Göttingen Germany 2, Max-Delbrück-Center for

Molecular Medicine, Berlin Germany3, Max-Planck-Institute of Experimental Medicine Department of

Neurogenetics, Göttingen Germany4

Running Title: Syntenin-1 binds NG2 in oligodendroglial progenitors

*These two authors contributed equally

Address correspondence to: J. Trotter, Molecular Cell Biology, Dept. of Biology, Bentzelweg 3, Johannes

Gutenberg University of Mainz 55128 Mainz, Germany

Tel (49) 6131 3920263; Fax (49) 6131 3923840; Email: trotter@uni-mainz.de

Migration of oligodendrocyte precursors

along axons is a necessary prerequisite for

myelination, but little is known about

underlying mechanisms. NG2 is a large

membrane proteoglycan implicated in

oligodendrocyte migration. Here we show

that a PDZ domain protein, termed syntenin-

1, interacts with NG2 and that syntenin-1 is

necessary for normal rates of migration. The

association of syntenin-1 with NG2, identified

in a yeast-2-hybrid screen, was confirmed by

co-localization of both proteins within

processes of oligodendroglial precursor cells

and by co-immunoprecipitation from cell

extracts. Syntenin-1 also colocalizes with NG2

in 'co-capping' assays, demonstrating a

lateral association of both proteins in live

oligodendrocytes. RNAi-mediated

downregulation of syntenin-1 in glial cells

results in a significant reduction of migration

in vitro, as does the presence of polyclonal

antibody against NG2. Thus Syntenin plays a

role in the migration of oligodendroglial

precursors, and we suggest that NG2-

syntenin-1 interactions contribute to this.

The NG2 proteoglycan is a type I

membrane protein that is expressed by a variety

of immature cells of several embryonic tissue

origins including glia, muscle progenitor cells,

and pericytes (1). In the central nervous system,

expression of NG2 was originally thought to

specify oligodendroglial progenitor cells (OPC),

but more recent data suggests that NG2-

expressing cells encompass a wider range of

immature glial cells in white and grey matter.

These include glia making synaptic-like contacts

to neurons in the hippocampus and cerebellum

(2) and glial cells specifically associated with

the nodes of Ranvier (3). Interestingly, many

NG2+ cells are both proliferative and motile or

exhibit local process motility (4,5). Antibodies

to the NG2 extracellular domain inhibit

migration of OPC and immature Schwann cells

in in vitro migration assays (5,6) and NG2 also

plays a role in cell spreading in melanoma

tumours which express the proteoglycan MCSP,

the human ortholog of NG2 (7). Identifying the

intracellular NG2 interacting proteins should aid

in elucidating the function of this multi-domain

protein in migratory cells of the oligodendrocyte

lineage.

The intracellular domain of NG2

consists of the C-terminal 76 amino acids and

has the PSD-95, Dlg and ZO-1 (PDZ)-binding

motif (QYWV) which can interact with PDZ-

domain containing proteins (8). In order to

define relevant intracellular partners of the

glycoprotein, we have carried out a yeast two

hybrid screen, using the complete intracellular

domain of NG2 as bait. One of the proteins that

we identified is syntenin-1 (also termed mda-9).

Syntenin-1 is a widely expressed PDZ protein

that is often overexpressed in highly migratory

metastatic tumors including melanoma (9).

Here we demonstrate that syntenin is

expressed by primary oligodendrocytes and

show functional studies using the

oligodendroglial precursor cell line Oli-neu. We

provide biochemical, morphological and

functional data demonstrating that NG2 and

syntenin-1 form a complex, which we suggest is

one component regulating oligodendroglial

precursor migration.

http://www.jbc.org/cgi/doi/10.1074/jbc.M706074200The latest version is at JBC Papers in Press. Published on January 24, 2008 as Manuscript M706074200

Copyright 2008 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

2

EXPERIMENTAL PROCEDURES

Animals- NMRI mice were obtained

from the Central Animal Facility of the

University of Mainz.

Antibodies- The following primary

antibodies were used: polyclonal (pc) against rat

syntenin-1 (10), against syntenin-1 generated

using a synthetic peptide corresponding to 286-

298 aa or 250-C-terminus in mouse (Synaptic

Systems, Göttingen, Germany / Abcam,

Cambridge, UK), against EGFP (BD

Biosciences ), against AN2 which recognize

mouse NG2 (5); monoclonal (mc) AN2

antibody(5), anti-GFAP (Glial Fibrillary Acidic

Protein, Boehringer, Mannheim, Germany), anti-

SMI-31 against neurofilament (Sternberger

Monoclonals Incorporated, Lutherville, USA),

anti-aa3 against PLP (M.B. Lees, Waltham,

MA), anti-8-18-C5 against MOG (C. Linington,

Aberdeen, Scotland), anti-SDL.3D10 against !-

tubulin isotype III (Sigma-Aldrich, Munich,

Germany) anti-11-5B against CNPase (Sigma-

Aldrich, Munich, Germany)

Cell Culture and Transfection-

HEK293T cells were cultured in DMEM with

10% Fetal Calf Serum and 2mM glutamine.

Primary oligodendrocyte cultures were prepared

from embryonic day 14-16 mice as described

previously (11). Cells were grown on poly-L-

lysine coated coverslips in modified Sato

medium (12) supplemented with B27, 10 ng/ml

platelet-derived growth factor, 5 ng/ml basic

fibroblast growth factor and 1% horse serum.

Proliferation of astrocytes was prevented by

treatment with Mitomycin C at 10"g/ml for 2.5h

(Sigma-Aldrich), when primary cells were used

for Western blot analysis. The Oli-neu cell line

was cultured according to Trotter and colleagues

(13) on poly-L-Lysine-coated coverslips in

SATO medium containing 1% Horse Serum.

Expression vectors were transfected by

conventional electroporation (20"g/300"l, 4x106

cells/ml). 2mM sodium-butyrate was added to

enhance expression of constructs with a CMV

promoter. Syntenin-1 directed synthetic siRNAs

(target sequences TACGTCAGCATAGTACA-

TTTA and CAGATTGCAGATATACTGTCA,

80 pmol each) and non silencing control siRNA

(target sequence AATTCTCCGAACGTGTCA-

CGT, 160 pmol) were purchased from Qiagen

and nucleofected into 106 Oli-neu cells using the

“AMAXA Basic Nucleofection Protocol for

Primary Mammalian Neural Cells”.

Coimmunoprecipitation- HEK293T

cells were transfected with EGFP-syntenin-1

(10) and the NG2del construct which contains

one-fourth of the extracellular domain and the

complete transmembrane and cytoplasmic tail of

NG2 (8). 24 hours after transfection cells were

washed with phosphate-buffered saline (PBS),

incubated for 1 h in methionine/cysteine-free

medium and were then metabolically labeled

with 100"Ci/ml [35S] Met/Cys for 4 h. Cells

were washed twice with HBSS fortified with

cold Met/Cys and then lysed on ice in 1% Triton

X-100, 50 mM Tris, pH 7.4, 150 mM NaCl and

a protease inhibitor cocktail of iodoacetamide

(18mg/ml in H2O), PMSF (100mM in

isopropanol), pepstatin (5mg/ml in DMSO),

antipain (1mg/ml in DMSO), aprotinin (1mg/ml

in water), benzamidine-HCl (26mg/ml in H2O,

leupeptin (5mg/ml in DMSO). The lysates were

chilled for 30 min and centrifuged at 300g for 5

min to remove nuclei. For immunoprecipitation

the following antibodies were used: rabbit pc

AN2, rabbit pc EGFP, rabbit pc syntenin-1

(Synaptic Systems). Lysates were pre-absorbed

with Protein A-Sepharose (Amersham

Biosciences) for 1 h at 4°C (preclear), followed

by incubation with primary antibodies overnight

at 4°C. Immunoprecipitations were obtained by

addition of Protein A-Sepharose beads and 1h

incubation on a head-over-tail rotator.

Precipitates were washed five times with radio-

immune precipitation assay buffer (RIPA, 0.1%

SDS, 1% Nonidet P-40, 1% sodium

deoxycholate, 150 mM NaCl, 50 mM Tris, pH

7) before adding sample buffer and resolving the

proteins by SDS-PAGE. Gels were dried,

exposed to screens, and evaluated with a

PhosphorImager (Raytest).

Coimmunoprecipitation of endogenous

NG2 with transfected EGFP-syntenin-1 and

endogenous syntenin-1 from Oli-neu cells was

carried out following an identical protocol.

Immunofluorescence Staining- Cells

were washed with PBS, fixed for 10 min with

4% paraformaldehyde (PFA), washed with PBS,

permeabilized for 5 min with 0.05% Triton X-

100, washed with PBS, and blocked with BME

and 10% Horse serum. Primary antibodies

(against syntenin (10)) were diluted in blocking

buffer and incubated for 1 h or overnight in a

humidified chamber. Cells were washed three

times with blocking buffer and incubated for 30

min with appropriate secondary Cy2- and Cy3-

conjugated secondary antibodies (Dianova,

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

3

Hamburg, Germany), diluted in blocking buffer.

In case of double labeling, primary antibodies

and their corresponding secondary antibodies

were separately added. Coverslips were washed

in distilled water and then mounted in Moviol

for analysis by confocal microscopy (Leica,

Germany).

Capping of Surface Molecules - Primary

oligodendrocytes (2 div = days in vitro) on

coverslips were incubated with mc AN2

antibody (1:10) for 10 min at 4°C. After washing

with PBS, cells were incubated with goat-anti-

rat-Cy2 antibody for 20 min at 37°C, or 4°C: the

latter for control cells. Subsequently, cells were

fixed for 5 min with 4% PFA, permeabilized

with 0.1% TritionX-100 (5 min), blocked with

BME/10%HS and incubated overnight with pc

syntenin-1 antibody. The secondary goat-anti-

rabbit-Cy3 antibody was added the next day,

before mounting the cells in moviol.

Western Blot Analysis- SDS-PAGE was

performed using 4-12% NuPage gels

(Invitrogen, Karlsruhe, Germany). Proteins were

blotted onto polyvinylidene difluoride

membranes (Hybond P, Amersham

Biosciences), blocked with 4% milk powder in

PBS and 0.1% Tween 20 (PBST). Proteins were

detected by sequential incubation with primary

antibodies for 2 hours at room temperature (RT)

and secondary horseradish peroxidase-

conjugated anti-species antibodies (Dianova) for

1 hour at RT. Blots were developed with

enhanced chemiluminescence (Pierce).

Isolation of syntenin-1 with Yeast Two

Hybrid Screen- The entire 76 amino acid

COOH-terminal region of mouse NG2 (NH2-

RKRNKT ... NGQYWV-COOH, GenBank

accession number AF352400) was fused to the

GAL4 binding domain by cloning it into the

pGBT9 vector (Clontech) with XbaI/HindIII.

The resulting bait construct was designated

pGBT9cyto. Using the lithium acetate method,

the yeast strain CG1945 was transformed

sequentially with pGBT9cyto and a 9-12 week

old postnatal mouse brain MATCHMAKER

cDNA library in pACT2 (Clontech). 33 x 106

transformants were screened. Transformants

were grown on SD medium-Leu-Trp-His plates;

5 mM 3-amino-1,2,4-triazole was added to the

medium to suppress leaky HIS3 reporter gene

expression. Positive clones were tested for beta-

galactosidase gene activity: yeast colonies were

grown on SD-Leu-Trp-His, transferred onto

reinforced nitrocellulose membrane, submerged

in liquid nitrogen, and placed on a Z-buffer/X-

gal-soaked Whatman (Z-buffer: 16.1 g/liter

Na2HPO4*7H2O, 5.5 g/liter NaH2PO4*H2O,

0.75 g/liter KCl, 0.246 g/liter MgSO4*7H2O,

pH 7; Z-buffer/X-gal solution: 100 ml of Z-

buffer, 0.27 ml of beta-mercaptoethanol, 1.67 ml

of 20 mg/ml X-gal stock solution). Blue color

was allowed to develop for 30 min-3 h. The

specificity of the NG2-syntenin-1 interaction

was confirmed by beta-galactosidase assay and

growth selection of cotransformed yeast cells

with pGBT9cyto and isolated library plasmids.

To map the PDZ binding motif at the C-terminus

of NG2, individual mutations of the 0, -1, -2,

and -3 positions of the C-terminal peptide

QYWV* were introduced by PCR, cloned into

pGBT9, and designated as NG2 0G (Val

mutated to Gly), NG2 1G (Trp to Gly), NG2 2G

(Tyr to Gly), NG2 2F (Tyr to Phe), NG2 3G

(Gln to Gly). Mutant NG2 constructs were

cotransformed with syntenin-1 f.l (full length)

and syntenin-1 PDZ1-2. Yeast cells were grown

on double dropout medium and assayed for beta-

galactosidase gene activity and additionally

selected for growth on triple dropout medium.

Scratch Migration Assay- Transfected

cells were plated on poly-L-lysine-coated

gridded coverslips (15 mm, Bellco Glass). Cells

were cultured until they reached 80-90%

confluence but were kept at least 16 h prior to

experimental manipulation. Cell-free areas were

generated by gently scratching the cell

monolayer with a sterile blue Gilson-pipette tip.

Coverslips were subsequently washed with PBS

and placed in 3 cm dishes containing

preconditioned Sato medium. Phase images (40x

magnifications) were captured approximately

every 6 hours over a period of 1.5 days. The

“magnetic pen tool” of Photoshop CS2 was used

to manually define the area covered by cells.

The marked (covered) areas were exported and

quantified using Image-Pro Plus software

(MediaCybernetics, MD). The software

calculated the marked area as a percentage of the

whole picture. The results at each time point

were normalized by subtracting the value of the

starting area covered by the cells. In this study

we have equated the percental increase of

marked areas with the migration of the cells.

RESULTS

Identification of syntenin-1 as an

intracellular partner of NG2 via yeast two

hybrid screening- To elucidate the mechanism

of NG2 function in migration, we sought to

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

4

identify novel NG2-interacting proteins using a

Yeast-Two-Hybrid analysis. The complete

mouse NG2 cytoplasmic region consisting of

76 amino acids (RKRN ... QYWV*,

* = translation stop codon) was used as a bait to

screen a postnatal mouse brain cDNA library

(Clontech). Screening of 33 x 106 transformants

identified several potential binding partners

including GRIP (8), and four independent

different library plasmids encoding the PDZ

protein syntenin-1 (14). Each plasmid contained

the entire syntenin-1 cDNA, which corresponds

to the published mouse sequence (14). The

interaction was verified by co-transforming

yeast cells with NG2 and syntenin-1. The

transformed yeast cells were viable on double

and triple dropout media and in addition were

tested positive in the ß-galactosidase assay

(Fig.1 A, row1). This finding suggests that

syntenin-1 is a novel interacting partner of NG2.

The C-terminus of NG2 displays a canonical

PDZ binding motif (QYWV). To validate the

requirement of the PDZ motif for the interaction

of NG2 with syntenin-1, we carried out point

mutation analyses and found that the terminal

three amino acid residues in the PDZ-

recognition site of NG2 are important for

binding to the PDZ domains of syntenin-1 (Fig1,

rows 2-6). These data demonstrate that NG2’s

PDZ binding motif QYWV is critical for the

binding to syntenin-1.

Syntenin-1 harbors a tandem repeat of

two PDZ domains. To determine which PDZ

domain is required for the interaction with NG2,

we carried out deletion analyses. Syntenin-1

deletion mutants were generated by PCR using

full length mouse Syntenin-1 as a template,

cloned into EcoRI/BamHI sites of the pACT2

vector and verified by sequencing. The

following deletion mutants were tested for

interaction with NG2: Syntenin-1-N-

terminus/PDZ1 (MSLYP-HKDSS), Syntenin-1-

PDZ1 (RAEIK-HKDSS), Syntenin-1-PDZ2

(FERTV-TIPEV*), Syntenin-1-PDZ1/2

(RAEIK-TIPEV*). Both PDZ domains were

required for binding to NG2 (Fig. 1B).

Syntenin-1 is expressed by immature

NG2-positive and by more mature

oligodendrocytes in vitro- We determined the

expression of syntenin-1 in primary

oligodendrocytes and the cell line Oli-neu (Fig.

2). Lysates of primary oligodendrocytes (2 div),

Oli-neu cells (Fig. 2 A, lane 2 and 3) and total

brain were subjected to Western blot analysis

using the syntenin-1 antibody. We found that

syntenin-1 is expressed in both primary

oligodendrocytes and Oli-neu cells (Fig. 2 A,

lanes 2 and 3). Total brain lysate served as a

positive control to validate the 36kD syntenin-1

band (lane 1). Interestingly, the highly migratory

Oli-neu cells reveal a high expression of

syntenin-1. These results show that syntenin-1 is

expressed in oligodendroglial cells.

Next, we characterized the

developmental profile of syntenin-1 in primary

oligodendrocytes during differentiation in vitro

(Fig. 2B). The expression of syntenin-1

increases with time in culture. The decrease of

NG2, which is expressed by immature

oligodendrocytes and the increase of PLP, a

marker for more mature oligodendrocytes,

suggests that the increase in syntenin-1

expression parallels oligodendrocyte maturation.

The possibility that the syntenin-1 signals arise

from neuronal and/or astrocytic contamination

was excluded by controlling for expression of

the neuronal protein neurofilament and the

asctrocyte-specific protein GFAP. We did not

observe detectable amounts of neurofilament,

and the low amount of GFAP expression did not

correlate with the increase of syntenin-1 over

time. These results suggest an increase in

syntenin-1 expression in cultures of maturing

oligodendrocytes.

To corroborate this finding, we

subjected cultured oligodendrocytes to

immunocytochemistry using stage-specific

markers for oligodendrocytes. We found

syntenin-1 expression at different stages of

oligodendrocyte differentiation (Fig 3). All

NG2-positive cells at 2 div expressed syntenin-

1. In addition, we found that many more mature

oligodendrocytes in the culture, identified by

CNP, MOG and PLP expression, also express

syntenin-1. These data demonstrate that

syntenin-1 is expressed by immature as well as

by differentiated oligodendrocytes. The

extensive syntenin-positive process outgrowth in

older cells may contribute to the increase in

syntenin-1 with time in culture.

Co-immunoprecipitation of NG2 and

syntenin-1- To validate the interaction of

syntenin-1 and NG2 biochemically, HEK293T

cells were cotransfected with a plasmid

encoding EGFP-syntenin-1 (Enhanced Green

Fluorescent Protein-syntenin-1; (10) and a

plasmid encoding NG2del (encompassing one-

fourth of the extracellular domain and the

complete transmembrane and cytoplasmic tail of

NG2, Fig.1C) (8). A complex of EGFP-

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

5

syntenin-1 and NG2 was isolated from the

transfected cells after metabolic radiolabelling

by precipitating with polyclonal AN2 antibodies

against NG2 which recognize NG2del (Fig. 4A

lane 3) or polyclonal antibodies against EGFP,

which target EGFP-syntenin-1 (lane 4). This

finding suggests that NG2 and EGFP-syntenin-1

co-associate. Next, we examined the association

of syntenin-1 and NG2 in Oli-neu cells. All Oli-

neu cells are NG2-positive. In cells, which had

been transfected with EGFP-syntenin-1,

precipitation with polyclonal AN2 antibodies

precipitated endogenous NG2 as well as the

62kD EGFP-syntenin-1 (Fig. 4 B lane 2).

Precipitation using polyclonal antibodies against

EGFP precipitated EGFP-syntenin-1 and

associated NG2 (lane 3). Polyclonal antibodies

against syntenin-1 pulled down EGFP-syntenin-

1, endogenous NG2 and gave a weak signal for

endogenous syntenin-1 (arrowhead, Lane 4).

Co-immunoprecipitation of endogenous

NG2 and endogenous syntenin-1 from native

Oli-neu did not yield a syntenin-1 signal: this

may be due to the difficulty of extracting NG2

and syntenin-1 from cytoskeletal-associated

components Syntenin-1 has been reported to be

difficult to extract from membrane fractions

with detergents, high salt, carbonate and freeze-

thawing (15) compatible with a cytoskeleton

association. Furthermore, it is likely that only a

small fraction of each protein is associated in a

complex.

NG2 colocalizes with syntenin-1 in

NG2-expressing primary glial cells in vitro-

Primary oligodendrocytes were double-labeled

with AN2 monoclonal antibody which

recognizes NG2, and polyclonal antibody

against syntenin-1 (Fig. 5 A-C). While NG2 was

predominantly localized at the cell surface, on

the cell body and processes, syntenin-1 is

expressed throughout the whole cell in a

punctate manner. Strikingly, we found that NG2

and syntenin-1 colocalize at the surface of the

cell as indicated by the yellow punctate

fluorescence in the overlay (Fig. 5A-C). The

colocalization is particularly intense at distinct

varicosities in the processes: these regions may

indicate points were branching has just started.

Capping of NG2 on glial cells causes a

parallel redistribution of syntenin-1- To

corroborate that NG2 and syntenin-1 form a

complex in primary oligodendrocytes, we

performed a co-capping assay (Fig. 5 D-I).

Clustering and parallel movement of NG2 and

syntenin-1 was explored by incubating live

oligodendrocytes (2 div) with AN2 monoclonal

antibody for 10 minutes at 4° C. This was

followed by addition of a fluorescent secondary

antibody and incubation at 37° C. A patching

and capping of NG2 was induced. A similar

redistribution of a population of the endogenous

syntenin-1 was observed resulting in clusters of

NG2 and syntenin-1 at or near the cell surface,

bolstering our finding that NG2 and syntenin-1

associate in oligodendrocytes.

Syntenin-1 promotes migration of Oli-

neu cells- NG2 has been implicated in spreading

and migration (4-6,16,17). If syntenin-1-NG2

binding were functionally important, loss of

syntenin-1 should reduce the migratory

behaviour of Oli-neu cells and primary NG2-

positive oligodendrocytes. We took a siRNA

approach to acutely knockdown syntenin-1 in

Oli-neu cells. Oli-neu cells were transfected with

either control siRNA or syntenin-1 siRNA. By

Western blot analysis, we found an efficient

knockdown of syntenin-1 in Oli-neu cells 16

hours after transfection as compared to control

siRNA-transfected cells (Fig.6, insert). Western

blot analysis at different times after transfection

demonstrated that the syntenin knockdown was

stable up to at least 54 hours after transfection

(data not shown), and thus maintained during the

whole time course of the migration assays.

Control and syntenin-1 siRNA-transfected Oli-

neu cells were then analyzed in a scratch assay:

knockdown of syntenin-1 significantly reduced

the migration of Oli-neu cells as compared to

control cells (Fig. 6C). Inclusion of polyclonal

AN2 antibody directed against the whole NG2

molecule which recognizes primarily the protein

core (5) reduced migration to a greater extent

than syntenin-1 siRNA alone (Fig. 6D). When

both these approaches were combined in the

assay, a stronger inhibition of migration was

found than with either syntenin-1 siRNA or AN2

antibodies alone, suggesting that the signaling

pathways in the migration promoting effects of

NG2 and syntenin are not completely

overlapping. These data demonstrate that

syntenin-1, like NG2, promotes migration of

Oli-neu cells.

DISCUSSION

PDZ proteins as partners of NG2- The

NG2 proteoglycan binds to several PDZ-domain

proteins with its C-terminal QYWV motif. This

has been shown for MUPPI 1 and GRIP (8,18).

PDZ domain proteins act as intracellular

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

6

scaffolds coordinating and compartmentalizing

molecules involved in signal transduction. The

majority of the PDZ-domain-containing proteins

are associated with plasma membrane proteins

and they are generally restricted to specific

subcellular domains such as synapses or cell-cell

contact points (19). Here, we characterize

syntenin-1 as an additional intracellular ligand

of NG2.

Expression of syntenin-1- Syntenin-1

was first identified as an adaptor protein binding

syndecan in focal adhesion complexes (14), and

later observed to be associated with a number of

membrane proteins as part of multi-protein

assemblies, notably at the pre- and post-synaptic

terminal (20-22). Syntenin-1 shows a

widespread tissue expression at both fetal and

adult stages (14) which is particularly high in

fetal kidney, liver, lung and brain (15). In the

nervous system, syntenin-1 has been shown to

bind the cell adhesion molecule neurofascin

(10). In vivo subpopulations of neurons have

been reported to express syntenin-1: cell bodies

and dendrites of pyramidal cells show a diffuse

expression of syntenin-1 (23).

Cloning of mouse and rat syntenin-1s

(also known as melanoma differentiation

associated gene-9 or mda-9) revealed that the

molecules are highly homologous (9): the rodent

and human mda-9/syntenin-1 is nearly identical

at the level of PDZ-1 and the COOH-terminal

domains. The N-terminal portion is the most

divergent: in humans this domain is 81% and

77% identical to the mouse and rat domains,

respectively. A second family member,

syntenin-2 also exists (10).

Cell lysates from cultured primary

oligodendrocytes, the cell line Oli-neu and

whole mouse brain homogenate all show

expression of syntenin-1 by Western

blotting and immunofluorescence. Both a

membrane-associated and a cytosolic

distribution of the protein were observed,

similar to observations in lymphocytes (24).

In both Oli-neu and primary cells the

intracellular staining at high resolution often

appeared punctated and may represent

vesicular association. Colocalization of NG2 and syntenin-1-

In primary oligodendrocyte cultures an intense

colocalization of NG2 and syntenin-1 at

varicosities in OPC processes was seen. Recent

work reported that in neurons overexpression of

syntenin-1 increased the number of dendritic

protrusions (25).

Subpopulations of syntenin-1 and NG2

co-cap. Syntenin-1 is a component of early

secretory pathways (26) and has been found to

be expressed by early apical recycling

endosomes (27) and to bind to the GTPase Rab 5

(28).

Only a sub-population of syntenin-1

colocalizes with NG2 further reiterating that

syntenin-1 (like NG2) has several binding

partners and only a subpopulation of syntenin-1

interacts with NG2 at any given time point.

Namely, it has been reported that NG2 can

interact with MUPP1 (18) or GRIP1(8). At

present, no experimental evidence exists that

MUPP1 or GRIP1 are involved in the migration

or process motility of NG2-positive glia or

oligodendrocyte progenitors. Our results suggest

that a subset of NG2 molecules cooperate with

syntenin-1 in a molecular complex required for

cellular motility, while the interaction with

MUPP1 or GRIP1 is important for other cellular

functions (discussed in(8,18). Our results are

similar to observations in T and B lymphocytes

where a subpopulation of syntenin-1 colocalizes

with the binding partner CD6 after capping (24).

CD6 like NG2 is a type I membrane

glycoprotein expressed by thymocytes, mature T

and B lymphocytes and in some neuronal

subpopulations in basal ganglia and cerebellar

cortex (29).

Molecular characteristics of the NG2

syntenin-1 binding- The interaction of syntenin-

1 with NG2 requires both PDZ domains; it has

not been ascertained whether the binding is

cooperative. Syntenin-1 has the capacity to

multimerize (10): this may explain the

observation that an endogenous syntenin-1 band

was detected in immunoprecipitates of Oli-neu

expressing EGFP-syntenin-1. PDZ domains

have the propensity to multimerize as homo-

multimers or hetero-multimers (30) and can

multimerize via PDZ-independent mechanisms

(31). Moreover, not all interactions with

syntenin-1 require both domains (32). A

syntenin-1-NG2 interaction does not thus

exclude simultaneous binding of other ligands.

The ability to form multimers further increases

the possibility of the simultaneous interaction

with several ligands.

Functional implications of the NG2-

syntenin-1 interaction- Actin-binding domains

have not been identified in the cytoplasmic tail

of NG2: however NG2 plays a role in migration,

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

7

metastasis and adhesion complexes. The

association of NG2 with downstream

cytoskeletal machinery must therefore be

mediated by linker proteins. The high expression

levels of both NG2 and syntenin-1 in immature

glia correlates with the motility of these cells as

well as localized motility of their processes.

Knockdown of syntenin-1 reduces migration of

Oli-neu cells. Syntenin-1 may be an adaptor

molecule which connects NG2 to downstream

components and may play a role in mediating

cytoskeletal changes during movement of NG2-

expressing cells and / or their processes.

However, in many cell types NG2 interacts in

cis with integrins, which may promote migration

independent of syntenin (33). Similarly,

syntenin-1 may additionally promote migration

by mechanisms independent of its interaction

with NG2. Syntenin can mediate cytoskeletal

dynamics at the plasma membrane: syntenin-1

overexpression induces the formation of long,

branching plasma membrane extensions (14). In

astrocytomas NG2 has been compartmentalized

with membrane cytoskeletal linkers such as

ERM proteins which interact with actin (16).

The expression of ERM proteins by

oligodendrocytes has not been reported.

Interestingly, immature Schwann cells express

NG2 and also the ERM protein

Merlin/Schwannomin which is a reported

binding partner of syntenin-1 (34).

The association of syntenin-1 with

endocytic compartments suggest that it may

regulate endocytosis and trafficking of NG2 as

has been shown for syndecan via an interaction

of syntenin-1 with phosphatidylinositol 4,5

bisphosphate (PIP2) (35,36).

In more mature oligodendrocytes, which

we show also express syntenin-1 but are NG2-

negative and non-migratory, syntenin-1 is likely

to have different binding partners and could

conceivably influence the massive membrane

remodeling involved in myelin sheet formation

(37).

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

8

REFERENCES

1. Nishiyama, A. (2007) Neuroscientist 13(1), 62-76

2. Bergles, D. E., Roberts, J. D., Somogyi, P., and Jahr, C. E. (2000) Nature 405(6783), 187-

191

3. Butt, A. M., Kiff, J., Hubbard, P., and Berry, M. (2002) J Neurocytol 31(6-7), 551-565

4. Eisenmann, K. M., McCarthy, J. B., Simpson, M. A., Keely, P. J., Guan, J. L., Tachibana,

K., Lim, L., Manser, E., Furcht, L. T., and Iida, J. (1999) Nat Cell Biol 1(8), 507-513

5. Niehaus, A., Stegmuller, J., Diers-Fenger, M., and Trotter, J. (1999) J Neurosci 19(12),

4948-4961

6. Schneider, S., Bosse, F., D'Urso, D., Muller, H., Sereda, M. W., Nave, K., Niehaus, A.,

Kempf, T., Schnolzer, M., and Trotter, J. (2001) J Neurosci 21(3), 920-933

7. Pluschke, G., Vanek, M., Evans, A., Dittmar, T., Schmid, P., Itin, P., Filardo, E. J., and

Reisfeld, R. A. (1996) Proc Natl Acad Sci U S A 93(18), 9710-9715

8. Stegmuller, J., Werner, H., Nave, K. A., and Trotter, J. (2003) The Journal of biological

chemistry 278(6), 3590-3598

9. Sarkar, D., Boukerche, H., Su, Z. Z., and Fisher, P. B. (2004) Pharmacol Ther 104(2),

101-115

10. Koroll, M., Rathjen, F. G., and Volkmer, H. (2001) The Journal of biological chemistry

276(14), 10646-10654

11. Kramer, E. M., Koch, T., Niehaus, A., and Trotter, J. (1997) The Journal of biological

chemistry 272(14), 8937-8945

12. Trotter, J., Bitter-Suermann, D., and Schachner, M. (1989) Journal of neuroscience

research 22(4), 369-383

13. Jung, M., Kramer, E., Grzenkowski, M., Tang, K., Blakemore, W., Aguzzi, A., Khazaie,

K., Chlichlia, K., von Blankenfeld, G., Kettenmann, H., and et al. (1995) Eur J Neurosci

7(6), 1245-1265

14. Grootjans, J. J., Zimmermann, P., Reekmans, G., Smets, A., Degeest, G., Durr, J., and

David, G. (1997) Proc Natl Acad Sci U S A 94(25), 13683-13688

15. Zimmermann, P., Tomatis, D., Rosas, M., Grootjans, J., Leenaerts, I., Degeest, G.,

Reekmans, G., Coomans, C., and David, G. (2001) Mol Biol Cell 12(2), 339-350

16. Makagiansar, I. T., Williams, S., Dahlin-Huppe, K., Fukushi, J., Mustelin, T., and

Stallcup, W. B. (2004) The Journal of biological chemistry 279(53), 55262-55270

17. Majumdar, M., Vuori, K., and Stallcup, W. B. (2003) Cell Signal 15(1), 79-84

18. Barritt, D. S., Pearn, M. T., Zisch, A. H., Lee, S. S., Javier, R. T., Pasquale, E. B., and

Stallcup, W. B. (2000) J Cell Biochem 79(2), 213-224

19. Sheng, M., and Sala, C. (2001) Annu Rev Neurosci 24, 1-29

20. Torres, R., Firestein, B. L., Dong, H., Staudinger, J., Olson, E. N., Huganir, R. L., Bredt,

D. S., Gale, N. W., and Yancopoulos, G. D. (1998) Neuron 21(6), 1453-1463

21. Lin, D., Gish, G. D., Songyang, Z., and Pawson, T. (1999) The Journal of biological

chemistry 274(6), 3726-3733

22. Hirbec, H., Perestenko, O., Nishimune, A., Meyer, G., Nakanishi, S., Henley, J. M., and

Dev, K. K. (2002) The Journal of biological chemistry 277(18), 15221-15224

23. Ohno, K., Koroll, M., El Far, O., Scholze, P., Gomeza, J., and Betz, H. (2004) Mol Cell

Neurosci 26(4), 518-529

24. Gimferrer, I., Ibanez, A., Farnos, M., Sarrias, M. R., Fenutria, R., Rosello, S.,

Zimmermann, P., David, G., Vives, J., Serra-Pages, C., and Lozano, F. (2005) J Immunol

175(3), 1406-1414

25. Hirbec, H., Martin, S., and Henley, J. M. (2005) Mol Cell Neurosci 28(4), 737-746

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

9

26. Fernandez-Larrea, J., Merlos-Suarez, A., Urena, J. M., Baselga, J., and Arribas, J. (1999)

Mol Cell 3(4), 423-433

27. Fialka, I., Steinlein, P., Ahorn, H., Bock, G., Burbelo, P. D., Haberfellner, M., Lottspeich,

F., Paiha, K., Pasquali, C., and Huber, L. A. (1999) The Journal of biological chemistry

274(37), 26233-26239

28. Tomoda, T., Kim, J. H., Zhan, C., and Hatten, M. E. (2004) Genes Dev 18(5), 541-558

29. Mayer, B., Funke, I., Seed, B., Riethmuller, G., and Weiss, E. (1990) J Neuroimmunol

29(1-3), 193-202

30. Srivastava, S., Osten, P., Vilim, F. S., Khatri, L., Inman, G., States, B., Daly, C., DeSouza,

S., Abagyan, R., Valtschanoff, J. G., Weinberg, R. J., and Ziff, E. B. (1998) Neuron 21(3),

581-591

31. Hsueh, Y. P., Kim, E., and Sheng, M. (1997) Neuron 18(5), 803-814

32. Xu, X. Z., Choudhury, A., Li, X., and Montell, C. (1998) J Cell Biol 142(2), 545-555

33. Karram, K., Chatterjee, N., and Trotter, J. (2005) J Anat 207(6), 735-744

34. Jannatipour, M., Dion, P., Khan, S., Jindal, H., Fan, X., Laganiere, J., Chishti, A. H., and

Rouleau, G. A. (2001) The Journal of biological chemistry 276(35), 33093-33100

35. Zimmermann, P., Meerschaert, K., Reekmans, G., Leenaerts, I., Small, J. V.,

Vandekerckhove, J., David, G., and Gettemans, J. (2002) Mol Cell 9(6), 1215-1225

36. Zimmermann, P., Zhang, Z., Degeest, G., Mortier, E., Leenaerts, I., Coomans, C., Schulz,

J., N'Kuli, F., Courtoy, P. J., and David, G. (2005) Dev Cell 9(3), 377-388

37. Simons, M., and Trotter, J. (2007) Curr Opin Neurobiol

Acknowledgements

We thank Lilia Niedens and Ulrike Stapf for excellent technical assistance, Reinhard Windoffer for advice

with the use of Image Pro Plus and the Gemeinnützige Hertie Stiftung, the Deutsche

Forschungsgemeinschaft (SPPs Cell Polarity and Glia-Synapse) and the European Union FP6 (Signalling

and Traffic) for financial support.

Figure 1. Syntenin-1 binds to NG2 via both PDZ domains

A, the amino acids tryptophan, tyrosine and valine in the PDZ-binding motif of NG2 are essential for

binding to syntenin-1. Yeast cells were transformed with full length syntenin-1 or a syntenin-1 deletion

mutant containing PDZ1-2 together with different PDZ binding motif mutants of NG2. These were then

tested for ß-galactosidase activity in triple amino acid deficient medium. nd = not determined

B, both PDZ domains of syntenin-1 are required for binding to NG2. Yeast were transformed with the

cytoplasmic tail of NG2 together with different syntenin-1 deletion mutants and tested for ß-galactosidase

activity and growth in triple-amino acid deficient medium.

C, Schematic diagram of Syntenin and NG2. PDZ indicates two PSD95/Discslarge/Zona Occludens-1

domains, LNS indicates two LamininG/Neurexin/Sex hormone-binding globulin domains, TM indicates

the transmembrane domain and the arrow indicates the position of the deletion (aa478-aa2164) in NG2del.

The amino acids QYWV represent the PDZ binding motif.

Figure 2. Syntenin-1 is expressed by oligodendrocytes in culture

A, Lysates from whole brain lysate (lane 1), cultured (2 div) primary oligodendrocytes (lane 2), and Oli-

neu (lane 3) were immunoblotted using the polyclonal syntenin-1 antibody.

B, Lysates from primary oligodendrocyte cultures were analyzed for expression of syntenin-1 at different

stages of maturity by western blotting. NG2 represents an early marker in the lineage, while PLP is

expressed by more matured cells. Probing for neurofilament and GFAP confirmed that the increase in

syntenin-1 expression is not due to neuronal or astrocytic proliferation.

Figure 3. Syntenin-1 expression in cultured glial cells

Oligodendrocyte cultures (2 div) were immunolabelled for syntenin (green, A, D, G, J, M) and either NG2

(red, B, Q), CNP (red, E), MOG (red, H), or PLP (red, K) identifying different stages of oligodendrocyte

development. Astrocyte contamination was visualized by staining for GFAP (red, N). Overlays show the

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

10

expression of syntenin in oligodendrocytes (C, F, I, L) and astrocytes (O). Arrow heads show single-

labeled cells and arrows show double-labeled cells. White boxes show enlarged areas of double-labeled

cells. The secondary antibody control for the Syntenin staining is shown in P (green). Scale bar equals 20

"m.

Figure 4. Syntenin-1 and NG2 form a complex in transfected HEK293 cells and in the OPC line Oli-

neu.

A, HEK293T cells were transfected with a plasmid encoding EGFP-tagged syntenin-1 together with the

NG2del plasmid, a deletion construct of NG2 missing most of the extracellular region but retaining the two

LamininG-Neurexin-Sex hormone-binding globulin (LNS) domains and the complete cytoplasmic tail (8).

The cells were metabolically labeled and lysates were subjected to immunoprecipitation with pc AN2

recognising NG2del and pc EGFP antibodies.

Lane 1: Pre-clear; Lane 2: Non-transfected cells, immunoprecipitation with pc AN2; Lane 3: Transfected

cells, immunoprecipitation with pc AN2; Lane 4: Transfected cells, immunoprecipitation with pc EGFP,

B, Oli-neu cells were transfected with the EGFP-syntenin-1 plasmid and lysates were subjected to

immunprecipitation. Lane 1: Untransfected cells, immunoprecipitation with pc AN2; Lane 2: Transfected

cells, immunoprecipitation with pc AN2; Lane 3: Transfected cells, immunoprecipitation with pc EGFP;

Lane 4: Transfected cells, immunoprecipitation with pc syntenin-1 antibodies.

Figure 5. Syntenin-1 and NG2 colocalize and co-cap in immature oligodendrocytes in culture

Cultured oligodendrocytes (2 div) were stained for syntenin-1 (A) and NG2 (B). An Overlay (C) shows

intense colocalization at the plasma membrane.

To demonstrate co-capping: Primary oligodendrocytes were incubated with the mc AN2 antibody at 4°C,

followed by incubation with fluorescent secondary anti-rat antibody at 4°C (D-F) or 37°C (G-I). The cells

were then fixed and permeabilized. Subsequently, the cells were subjected to immunocytochemistry with

the syntenin-1 antibody at room temperature. Single section confocal images show co-capping of NG2 and

syntenin-1 at 37°C in presence of mc AN2.

Scale bar equals 20"m.

Figure 6. RNAi knockdown of syntenin-1 affects migration of Oli-neu cells

Oli-neu cells were transfected with syntenin-1 siRNA and subsequently incubated for 16h. A scratch was

performed using a pipette tip. Images were taken at regular intervals over the course of 34 h. A, A’ and B,

B’ show an example for control as well as syntenin siRNA treated cells after 6h or 26h, respectively. Areas

which were covered by cells were manually marked and quantified at each time point. C, Oli-neu cells

with reduced syntenin-1 expression migrate less than the control siRNA treated cells. Error bars represent

the standard deviation of the mean (n=12). C insert, Western blot analysis of cells from the same

transfections used in the migration assays at 16 hours after transfection, verified the successful knockdown

of syntenin-1 protein. D, polyclonal AN2 antibody against NG2 reduces migration of Oli-neu cells.

Antibody and syntenin-1 siRNA together cause a stronger reduction in migration than either treatment

alone. Results are expressed as the mean of 20 different migration fronts with standard deviation (*** P

value <0,0001 by comparison with the control).

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A

B

beta-Galexpression

NG2 wt(QYWV*)

NG2 -0G(QYWG*)

NG2 -1G(QYGV*)

NG2 -3G(GYWV*)

NG2 -2F(QFWV*)

NG2 -2F0G(QFWG*)

NG2 -2G(QGWV*)

+

Construct

- Trp- Leu- His

- Trp- Leu- His

- Trp- Leu

- Trp- Leu

beta-Galexpression

Syntenin PDZ1+2Syntenin full length

+ + +

+ + + --

+ - + ---

+ - + ---

+ + + +

+ + nd ndnd

+ + nd ndnd

1

1 2

1

2

1 2

Syntenin, Mm, full length

Syntenin, Mm, N-terminus PDZ1

Syntenin, Mm, PDZ1

Syntenin, Mm, PDZ2

Syntenin, Mm, PDZ1+2

beta-Galexpression

- Trp- Leu

- Trp- Leu- His

+

+ -

+ -

+ -

+

-

-

-

+

+

1 299 aa

1 2327 aa

PDZ PDZ

LNS LNS TM

QYWV

NG2

Syntenin

C

Figure 1 by guest on M

ay 21, 2018http://w

ww

.jbc.org/D

ownloaded from

) 0 1 P ( n i a r B 2 4 7 11

Primary oligo- dendrocytes (div)

Syntenin (36 kDa)

NG2 (330 kDa)

PLP (25 kDa)

Neurofilament (200 kDa) GFAP (50 kDa)

Tubulin (50 kDa)

) 0 1 P ( n i a r B

v i d 2 . d o g i l o y r a m i r P

u e n - i l O

Syntenin (36 kDa)

Tubulin (50 kDa)

A B

1 2 3

Figure 2

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A B CMergeNG2Syntenin

MergeCNPaseD E F

MergeNG2Anti-rabbit-Cy2P Q R

Syntenin

MergeMOGG H I

Syntenin

MergePLPJ K L

Syntenin

M N OMergeGFAPSyntenin

Figure 3

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

A

NG2 (330 kD)

EGFP-syntenin (62 kD)

B

EGFP-syntenin (62 kD)

NG2 del (79 kD)

3 4 2 1 3 4 2 1

Syntenin-1 (36 kD)

Figure 4

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Figure 5

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

0

5

1 0

1 5

2 0

0 5 1 0 1 5 2 0 2 5 3 0 3 5 T i m e [ h r ]

M i g

r a t i o

n

c o n t r o l - s i R N A s y n t e n i n - s i R N A

Syntenin

Tubulin

A N

R i s - l o r t n o c

A N

R i s - n i n e t n y s

C

Control siRNA treated cells Syntenin siRNA treated cells

6 hr 26 hr

A B A' B'

6 hr 26 hr

D

c o n t r o l s y n t e n i n A N 2 A B s y n t e n i n s i R N A + A N 2 A B

M i g r a t i o n o f O l i - n e u c e l l s a f t e r 2 4 h

s i R N A

M i g

r a t i o

n

***

***

***

8

1 0

1 2

1 4

1 6

Figure 6

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Koroll, Hauke B. Werner, Klaus-Armin Nave and Jacqueline TrotterNivedita Chatterjee, Judith Stegmüller, Philipp Schätzle, Khalad Karram, Michael

precursor cellsInteraction of syntenin-1 and the NG2 proteoglycan in migratory oligodendrocyte

published online January 24, 2008J. Biol. Chem. 

  10.1074/jbc.M706074200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on May 21, 2018

http://ww

w.jbc.org/

Dow

nloaded from