Jonathan KindbergJonathan Kindberg

BNFO 301BNFO 301

04/24/201304/24/2013

Is there a correlation Is there a correlation between similar cluster between similar cluster phages’ tandem repeats phages’ tandem repeats within the tape measure within the tape measure protein and its location protein and its location

within that gene? within that gene?

Tape Measure ProteinTape Measure Protein Tail of a phage is used to inject it’s DNA into the Tail of a phage is used to inject it’s DNA into the

host bacterium, which is the beginning of lysis.host bacterium, which is the beginning of lysis.

The tape measure protein got its name because The tape measure protein got its name because the length of the corresponding gene is the length of the corresponding gene is proportional to the length of the phage's tail: a proportional to the length of the phage's tail: a fact shown by actually copying or splicing out fact shown by actually copying or splicing out parts of DNA in exemplar species [1].parts of DNA in exemplar species [1].

Tandem Repeats are the tell tale sign of the tape Tandem Repeats are the tell tale sign of the tape measure proteinmeasure protein

Tandem RepeatsTandem Repeats Tandem repeats occur when more than one Tandem repeats occur when more than one

nucleotide is repeated nucleotide is repeated

The nucleotide repeats lie adjacent to each other The nucleotide repeats lie adjacent to each other within the gene.within the gene.

TR example: ATGTAAGCTAAGCTAAGCTTGTR example: ATGTAAGCTAAGCTAAGCTTG

The tandem repeat consists of TAAGCThe tandem repeat consists of TAAGC

Experimental ProcedureExperimental Procedure

Phagesdb.org to look at similar cluster phages Phagesdb.org to look at similar cluster phages Look for tandem repeats in he genomes to find Look for tandem repeats in he genomes to find

the tmp gene with the use of the tmp gene with the use of PhAnToMe/BioBIKEPhAnToMe/BioBIKE

PhAnToMe/BioBIKE functions will include PhAnToMe/BioBIKE functions will include SEQUENCE-SIMILAR-TO and ALIGNMENT-OFSEQUENCE-SIMILAR-TO and ALIGNMENT-OF

Scatter plot of the phages tandem repeats vs. Scatter plot of the phages tandem repeats vs. location in their genome will be graphedlocation in their genome will be graphed

Analysis of experimental findingsAnalysis of experimental findings

Experimental ToolsExperimental Tools

Phagesdb.orgPhagesdb.org PhAnToMe/BioBIKEPhAnToMe/BioBIKE Tandem Repeat FinderTandem Repeat Finder BlastBlast Oracle Virtual MachineOracle Virtual Machine

Allows me to find phamerator maps of Allows me to find phamerator maps of annotated phages.annotated phages.

ResultsResults

TBDTBD

ReferencesReferences

1. The evolution of the tape measure protein: units, duplications and losses: Belcaid M, Bergeron A, Poisson G. BMC Bioinformatics. 2011 Oct 5;12 Suppl 9:S10. doi: 10.1186/1471-2105-12-S9-S10.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271669/

2. Length Determination in Bacteriophage Lambda Tails. Katsura, I and Hendrix, R. Cell, Vol . 39, 691-698, December 1984. http://ac.els-cdn.com/0092867484904768/1-s2.0-0092867484904768-main.pdf?_tid=46972fa4-9c69-11e2-b6bc-00000aab0f26&acdnat=1364998854_34031474c286eed57d3f1aadfd1a1d92

3. Mechanism of Length Determination in Bacteriophage Lambda Tail. Katsura, Isao. Department of Biology, College of Arts and Sciences, The University of Tokyo, Meguro-ku, Tokyo 153, Japan. Adv. Biophys., Vol. 26, pp. 1-18 (1990).