Journal of Heredity doi:10.1093/jhered/est095 or ...narightwhale.nrdpfc.ca/wp-content/uploads/2014/01/jan22014.pdf · a combination of cloning, direct sequencing, and auto-mated fluorescent

Journal of Hereditydoi:10.1093/jhered/est095

© The American Genetic Association 2013. All rights reserved. For permissions, please e-mail: [email protected]

1

Characterization of Class I– and Class II–Like Major Histocompatibility Complex Loci in Pedigrees of North Atlantic Right WhalesRoxanne M. Gillett, BRent W. MuRRay, and BRadley n. White

From the Natural Resources DNA Profiling and Forensic Centre, Department of Biology, Trent University, 2140 East Bank Drive, Peterborough, Ontario K9J 7B8, Canada (Gillett and White); and the Natural Resources and Environmental Studies Institute, University of Northern British Columbia, Prince George, British Columbia, Canada (Murray).

Address correspondence to Roxanne M. Gillett at the address above, or e-mail: [email protected].

Data deposited at Dryad: http://dx.doi.org/doi:10.5061/dryad.4d789

AbstractNorth Atlantic right whales have one of the lowest levels of genetic variation at minisatellite loci, microsatellite loci, and mito-chondrial control region haplotypes among mammals. Here, adaptive variation at the peptide binding region of class I and class II DRB-like genes of the major histocompatibility complex was assessed. Amplification of a duplicated region in 222 individuals revealed at least 11 class II alleles. Six alleles were assigned to the locus Eugl-DRB1 and 5 alleles were assigned to the locus Eugl-DRB2 by assessing segregation patterns of alleles from 81 parent/offspring pedigrees. Pedigree analysis indi-cated that these alleles segregated into 12 distinct haplotypes. Genotyping a smaller subset of unrelated individuals (n = 5 and 10, respectively) using different primer sets revealed at least 2 class II pseudogenes (with ≥ 4 alleles) and at least 3 class I loci (with ≥ 6 alleles). Class II sequences were significantly different from neutrality at peptide binding sites suggesting loci may be under the influence of balancing selection. Trans-species sharing of alleles was apparent for class I and class II sequences. Characterization of class II loci represents the first step in determining the relationship between major histocompatibility complex variability and factors affecting health and reproduction in this species.Key words: DRB like, Eubalaena glacialis, haplotype, MHC, North Atlantic right whale, pedigree analysis

The North Atlantic (Eubalaena glacialis), North Pacific (Eubalaena japonica), and southern right whales (Eubalaena australis) were hunted extensively (Aguilar 1986; Reeves and Mitchell 1986; Ellis 1991; Reeves 2001; Reeves et al. 2007) until granted international protection from whaling in 1935 (Brownell et al. 1986). Currently, the North Atlantic right whale population is increasing at a rate of ~2.5% per year (Knowlton et al. 1994) and is estimated to number ~500 indi-viduals (Pettis 2012). Despite numerous conservation and recovery efforts (Kraus and Rolland 2007), the population growth rate is significantly lower than their southern coun-terparts (~7% per year; Brandão A, Best P, Butterworth D, unpublished data; Carroll et al. 2013). The slow growth rate has been partially attributed to increased levels of human-associated mortality resulting from ship strikes and entan-glements in fishing gear (Kraus 1990; Knowlton and Kraus 2001; Kraus et al. 2005; Moore et al. 2005, 2007).

In addition to the direct anthropogenic threats, some degree of reproductive dysfunction is suggested by a repro-ductive rate that is significantly lower than expected when compared with the southern right whale (Frasier, Hamilton, et al. 2007; Kraus et al. 2007). This low reproductive rate has been attributed in part to this species extreme variability in female reproductive performance (Kraus et al. 2001, 2007). Between 1989 and 2003, 17 known/presumed calf mortali-ties in 208 live births were documented, and additional 28 calves were assumed to be lost based off of the sightings histories of reproductive females (Browning et al. 2010). Additionally, several signs of poor health are evident, which may be playing a role in the reduced reproductive perfor-mance. These include a notable decline in body condition, an increase in skin lesions, high parasite loads, and exposure to environmental neurotoxins (Pettis et al. 2004; Hamilton and Marx 2005; Hughes-Hanks et al. 2005; Doucette et al. 2012).

Journal of Heredity Advance Access published December 31, 2013 by guest on January 2, 2014

http://jhered.oxfordjournals.org/D

ownloaded from

mailto:[email protected]

http://dx.doi.org/doi:10.5061/dryad.4d789

http://jhered.oxfordjournals.org/


Journal of Heredity

2

Low levels of genetic diversity in threatened and endan-gered species can decrease their evolutionary potential, com-promise their reproductive fitness, and/or increase their risk of extinction (Spielman et al. 2004). Therefore, characteriz-ing genetic diversity in threatened and endangered species is important for assessing the probability of long-term persis-tence. Differential rates of recovery between North Atlantic and southern right whales have prompted several compara-tive studies of their genetic diversity. These studies have focused on determining the levels of genetic diversity at neu-tral markers and have indicated that the North Atlantic right whale exhibits significantly less variation at minisatellite loci (Schaeff et al. 1997), microsatellite loci (Waldick et al. 2002; Frasier et al. 2006), and mitochondrial control region haplo-types (Malik et al. 2000) when compared with the southern right whale. However, assessing diversity at genes that play important roles in fitness, such as those of the major histo-compatibility complex (MHC) (Bernatchez and Landry 2003; Eizaguirre et al. 2009; Sepil et al. 2013), are also important as variation at these genes have a direct effect on adaptive potential.

The MHC is composed of a family of genes that code for cell surface glycoproteins involved in the initiation of the body’s immune response (Klein 1986). Class I loci code for glycoproteins that are on the surface of all nucleated cells and are responsible for presenting endogenous antigens to cytotoxic T cells (Klein 1986). Comparatively, class II loci mainly code for glycoproteins that are found on the sur-face of antigen presenting cells of the immune system and present exogenous antigens to helper T cells to initiate an immune response (Klein 1986). The MHC is the most poly-morphic coding complex in the vertebrate genome that has been identified to date (Parham et al. 1989; Bernatchez and Landry 2003; Piertney and Oliver 2006). It is thought that this high degree of polymorphism is maintained by balanc-ing selection that is driven by pathogen/host or parasite/host interactions and/or factors intrinsic to vertebrate reproduc-tion (Bernatchez and Landry 2003; Milinski 2006; O’Farrell et al. 2012; Oliver and Piertney 2012).

Recently it has been reported that North Atlantic right whale fertilizations and/or pregnancies are more successful when the alleles inherited from a father are genetically dis-similar from alleles present in a mother (Frasier et al. 2013).

This suggests that fertilization patterns are not random and may be partially responsible for unsuccessful pregnan-cies (Frasier 2005; Frasier, McLeod, et al. 2007; Frasier et al. 2013). It also suggests that there may be a selective advantage for offspring that are genetically dissimilar from their parents. To determine the amount of adaptive genetic variability in North Atlantic right whales and to test whether there is a correlation between adaptive genetic variability, reproductive success, and health, we first characterized alleles of class I– and class II–like loci of the MHC. The right whale samples used in this study represented 81 pedigrees consisting of a mother, father, and calf, allowing us to determine the trans-mission patterns of the alleles at these loci.

Materials and MethodsSample Collection and Amplification of MHC Loci

Skin samples have been collected from photo-identified individuals since the 1980s using a crossbow with a modi-fied bolt and tip following Brown et al. (1991). DNA was extracted from these samples following Shaw et al. (2003). Two hundred and twenty-two samples, representing 81 right whale pedigrees, were used in this study. Pedigrees consisted of a mother, father, and calf. Individual right whales are identifiable based on a combination of callosity patterns and other markings present on their bodies (Kraus et al. 1986; Hamilton et al. 2007). As right whale calves stay with their mother throughout most of their first year of life (Hamilton et al. 1995), mother–calf relationships were determined behaviorally from these associations (Knowlton et al. 1994; Kraus et al. 2001). Maternity was confirmed and paternity inferred through genetic exclusions using 28 microsatellite loci as described by Frasier, Hamilton, et al. (2007).

MHC class I and class II sequences were amplified from genomic DNA using 4 primer sets (Table 1). Three primer sets were used to amplify class II beta chain sequences. The first primer set (DRB-5c; Allen 2000 and DRB-3c; Murray and White 1998) was used to survey all 222 samples. These primers amplified a 185-bp fragment of MHC class II exon 2. DRB-5c is located on the 5′ end of exon 2, just within the intron/exon boundary, whereas DRB-3c is located on the 3′ end of exon 2 (see Supplementary Material online). The

Table 1 Conditions for amplification of the MHC class I–like and class II–like loci

Primer Sequence (5′–3′) n Size (bp) Ta (°C) Concentration (µM) Reference

DRB-5c TCAATGGGACGGAGCGGGTGC 222 185 56 0.45 Allen (2000)DRB-3c CCGCTGCACAGTGAAACTCTC Murray and White (1998)DRB-5b CCCACAGCACGTTTCTTG 5 240 60 0.45 Tsuji et al. (1992)DRB-3b CTCGCCGCTGCACAGTGAAAC Ammer et al. (1992)DQB1 CTGGTAGTTGTGTCTGCACAC 11 172 52 0.45 Tsuji et al. (1992)DQB2 CATGTGCTACTTCACCAACGG Tsuji et al. (1992)MHCIex2F TACGTGGMCGACACGSAGTTC 10 147 55 1.00 Flores-Ramirez et al. (2000)MHCIex2R CTCGCTCTGGTTGTAGTAGCS Flores-Ramirez et al. (2000)

Included are primer names, primer sequence, the number of individuals screened (n), the size of the amplified product in base pairs (bp), the annealing temperature (Ta), the primer concentration used (µM), and the original reference for the primer.

by guest on January 2, 2014http://jhered.oxfordjournals.org/

Dow

nloaded from

http://jhered.oxfordjournals.org/lookup/suppl/doi:10.1093/jhered/est095/-/DC1



Gillett et al. • North Atlantic Right Whale MHC Characterization

3

second primer set (DRB-5b; Tsuji et al. 1992 and DRB-3b; Ammer et al. 1992) was used to screen 5 unrelated indi-viduals to determine if additional MHC variation could be captured. These primers amplified a 240-bp fragment of MHC class II exon 2. DRB-5b is located at the 5′ end of the DRB-5c primer covering the intron/exon boundary, whereas DRB-3b is located at the 3′ end of exon 2. The third primer set (DQB1 and DQB2, Tsuji et al. 1992) was screened using 11 individuals, representing 2 right whale pedigrees (consist-ing of a mother and 3 calves) and 3 unrelated individuals. These primers amplified a 172-bp fragment of MHC class II exon 2 and were both located within exon 2. A final primer set (MHCIex2F and MHCIex2R; Flores-Ramirez et al. 2000) was used to survey for variation of class I sequences in 10 unrelated individuals. These primers amplified a 147-bp frag-ment of the α1 domain of the class I MHC.

Amplifications for the DQB1/DQB2 primer set fol-lowed Murray et al. (1995) using an annealing temperature of 53 °C. Amplifications for the remaining primer sets con-sisted of a 15 µL reaction (1× Q-solution [Qiagen], 1× poly-merase chain reaction [PCR] buffer (200 mM Tris–HCl (pH 8.4), 500 mM KCl), 0.2 mM of each dNTP, 1.5 mM MgCl2, 0.45–1 µM of each primer (Table 1), 0.05 U/µL Taq DNA polymerase, and 20 ng of DNA) with the following cycling conditions: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, Ta for 1 min (Table 1), 72 °C for 1 min; followed by a final exten-sion of 60 °C for 45 min. Q-solution was not included for class I MHC amplifications.

Allele Characterization and Genotyping

Alleles were characterized and samples genotyped using a combination of cloning, direct sequencing, and auto-mated fluorescent single-stranded conformation polymor-phism (SSCP; Lento et al. 2003). Cloning of the exon 2 region of class II–like alleles and cloning of the α1 domain of class I–like alleles were carried out with a TOPO TA Cloning Kit (Invitrogen) following the manufacturer’s instructions. Inserts of the proper size were sequenced using a MegaBACE™ DYEnamic™ ET dye terminator kit (Amersham). Sequenced PCR product was electrophoresed and visualized on a MegaBACE™ 1000 and analyzed with MegaBACE™ Sequence Analyzer 3.0 software. Direct sequencing of PCR product from genomic DNA was also performed in this manner. PCR products amplified with the DQB1/DQB2 primer set were cloned and sequenced follow-ing Murray et al. (1995). Edited sequences were aligned with ClustalX (Thompson et al. 1994). In order to avoid confusing cloning artifacts with true alleles, alleles were only accepted if the same sequence was identified on multiple occasions in more than 1 individual.

Sequence variation and genotyping using the DRB5c/3c primer set was also assessed through automated fluorescent SSCP. Forward and reverse primers labeled with 6-FAM and HEX, respectively, were used to amplify genomic DNA with the previously indicated conditions (Table 1). Samples were prepared by mixing 1 µL of a 1:2 and 1:3 dilution of the PCR product with 3 µL of deionized formamide, 0.5 µL of

100 mM NaOH, and 0.5 µL of blue dextran ethylenediamine-tetraacetic acid (EDTA) (50 mM EDTA and 50 mg/mL blue dextran). Samples were denatured (95 °C, 3–5 min) and imme-diately placed in an ice water bath (3–5 min). Before loading, 1 µL of GeneScan™ 500 ROX™ size standard (Applied Biosystems) was added to each sample. Amplified product was size separated and visualized using the ABI PRISM 377 automated DNA sequencer. Samples (2 µL) were electro-phoresed through a nondenaturing acrylamide gel (40 mL gel containing 10% acrylamide [39 acrylamide: 1 bis-acrylamide], 8.5% glycerol, 1× tris-borate-EDTA; 200 µL 10% ammonium persulphate, 25 µL tetramethylethylenediamine) and run for 12–14 h (60 W). Temperature was maintained at 10 °C for the duration of the run using an external refrigerated bath circulator (Neslab Instruments Inc.; RTE-111). SSCP gels were analyzed using the ABI Prism Genotyper 2.5 software (Perkin-Elmer Corp.). Known alleles were run on all SSCP gels as mobility controls (see Supplementary Material online).

Allelic Nomenclature, Locus Designation, and Data Archiving

Allelic nomenclature was based on the proposed rules of Klein et al. (1990). Standard nomenclature is represented by a 4 letter species code (Eugl for the North Atlantic right whale), a locus code, an asterisk, and a 2 digit allele code. The primer sets used to characterize class II–like sequences (DRB5c/3c and DQB1/2) simultaneously amplified 2 dis-tinct loci (see Discussion). These sequences were assigned to the locus Eugl-DRB1 or Eugl-DRB2 by visually following the transmission patterns of the alleles from parents to off-spring in the 81 known right whale pedigrees available for this study. The remaining class II–like sequences amplified with the DRB5b/3b primer set and the class I–like sequences amplified with the MHCIex2F/MHCIex2R primer set were screened in 5 and 10 unrelated individuals, respectively. Although these primer sets also simultaneously amplified multiple loci (see Discussion), they could not be related to specific loci. As such, they were assigned to a MHC type and not to a specific locus (e.g., Eugl-DRB or Eugl-I). For archi-val purposes, all characterized alleles identified in this study were submitted to GenBank and all supplementary material has been submitted to the Dryad electronic repository (Baker 2013).

Statistical and Phylogenetic Analysis

Class II–like sequences (sequences with orthology to exon 2 of previously identified MHC class II sequences in other spe-cies) were initially aligned with previously identified cow (Bos taurus, Mikko et al. 1999) and beluga sequences (Delphinapterus leucas, Murray et al. 1995) using Clustal X (Thompson et al. 1994). Class I–like sequences were aligned against cow (GenBank Accession Number DQ190937) and gray whale (Eschrichtius robustus, Flores-Ramirez et al. 2000) sequences using the same program. Amino acid sequences were inferred using the translation function in MEGA 3.1 (Kumar et al. 2004). The average number of nonsynonymous (dN) and syn-onymous (dS) substitutions per site and the standard errors


Dow

nloaded from




Journal of Heredity

4

were calculated using the modified Nei and Gojobori (1986) model for the Eugl-DRB1 and Eugl-DRB2 locus as well as the 3 identified class-I MHC alleles. The Jukes–Cantor correction was used to correct for multiple substitutions at the same site. The ratio of nonsynonymous to synonymous substitutions (dN/dS) was tested for departure from neutral expectations using the z-statistic in MEGA 3.1. Standard errors were com-puted using 1000 bootstrap replicates. Nucleotide diversity (π; Nei 1987) was calculated for each locus using the program DnaSP 4.5 (Rozsa et al. 2003). Genepop 3.1 (Raymond and Rousset 1995) was used to calculate allele and haplotype fre-quencies, observed (Ho) and expected heterozygosity (He), and deviations from Hardy–Weinberg Equilibrium (HWE) from identified class II DRB-like loci (Eugl-DRB1 and Eugl-DRB2). Genepop 3.1 was also used to detect evidence of linkage disequilibrium between Eugl-DRB1 and Eugl-DRB2 using the log likelihood ratio statistic (dememorization num-ber of 10 000, 1000 batches, 10 000 iterations per batch). Maximum-likelihood phylogenies of all identified class I and class II variants were performed. Phylogenies were recon-structed using PhyML 3.0.1 (Guindon and Gascuel 2003; Guindon et al. 2010) and contained representative primate, ungulate, and cetacean sequences. Genetic distances were adjusted using the best-fit model of nucleotide substitution indicated by the Bayesian Information Criterion using the pro-gram jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Phylogenetic trees were visualized using Dendroscope 3 (Huson and Scornavacca 2012).

ResultsCharacterization of MHC-II-Like Alleles

Ten sequences corresponding to codons 26–86 relative to exon 2 of cow DRB3-like genes were characterized in 222 samples using the DRB5c/3c primer set (Figure 1; Eugl-DRB1*01 to Eugl-DRB1*06 and Eugl-DRB2*01 to Eugl-DRB2*04; GenBank Accession Numbers: KF137593–KF137605). Up to 4 sequences were identified in each individual indicating the primers were amplifying 2 loci. By following transmis-sion patterns from known pedigrees (Figure 2), 6 alleles were assigned to the locus Eugl-DRB1. The remaining 4 alleles were assigned to a second locus (Eugl-DRB2). Alleles at these loci were characterized by a single base pair change at codon 51 from ACC, coding for threonine in Eugl-DRB1 to AGC, coding for serine in Eugl-DRB2 (Figure 1). The genotypes at Eugl-DRB1 were resolved for all 222 samples. Eugl-DRB1 was in HWE and had 1 common allele (Eugl-DRB1*01) that was found in 86% of the individuals (Table 2; see Supplementary Material online).

Due to the similarity in some of the Eugl-DRB2 sequences, several of the alleles had very similar SSCP mobil-ity patterns. This made it more difficult to resolve genotypes for this locus. Because of this, clear genotypes were only resolved for 45 of the 222 samples and genotypes could not be resolved for 136 samples. No amplification for Eugl-DRB2 was apparent for the remaining 41 samples, indicating the presence of a null allele(s) at this locus. All 41 samples

Figure 1. Inferred amino acid sequences of the North Atlantic right whale (Eugl) MHC class II–like sequences (GenBank Accession Numbers: KF137593–KF137605) based on an alignment to previously published cow (BoLA; U77067.1, NM_001034668) and beluga (Dele; AF012931, U16990) DRB and DQB sequences. Translations inferred from nucleotide sequences in reading frame with the cow. Translations of pseudogenes are shown for comparative purposes. Stop codons of pseudogenes are indicated (▲). Amino acid sequences start at position 9 relative to the cow DRB exon 2. Codons that face the peptide binding groove or are implicated in the recognition of foreign peptides are indicated with an asterisk (*) following Brown et al. (1993) and Stern et al. (1994). Note: Eugl-DRB*03 and Eugl-DRB*04 remain tentative until confirmed across additional individuals.


Dow

nloaded from






5

Figure 2. Representative transmission patterns of DRB1 and DRB2 alleles for 2 North Atlantic right whale matrilines. Inferred haplotypes of offspring indicated by a dash (-) and alleles of parents by an ampersand (&). Haplotypes in the offspring that were inherited from the mother are in bold and haplotypes in the offspring that were inherited from the sire are underlined. Double lines indicate mating pairs. Diamonds indicate an animal of unknown sex. Alleles 2*01 and 2*02 had similar SSCP mobilities and only differed by 1 bp, making differentiation through direct sequencing difficult. Unresolved alleles are separated by a backslash (/). Panel A: Matriline of Eg#1135: individuals profiled using DRB3c/5c and DQB1/2 primer sets. Transmission patterns of Eg#1406 could not be determined because this individual contained the same alleles as the mother. Panel B: Matriline of Eg#1001: individuals profiled using the DRB3c/5c primer set that were used to infer DRB1-DRB2 haplotypes. The Eugl-DRB2 allele(s) that did not amplify is represented by the 2*05 allele. In this matriline, 3 calves Eg#1301, Eg#1603, and Eg#1911 were sired by 3 different males (Eg#1033, Eg#1156, and Eg#1279, respectively). In the second generation, two of these half-sibs (Eg#1603 and Eg#1911) successfully mated.

Table 2 Summary of allele frequencies, haplotype frequencies, observed heterozygosity (Ho), and expected heterozygosity (He) of MHC class II–like loci characterized in the North Atlantic right whale

Locus/ haplotype n Alleles/haplotypes He (Ho)

Eugl -DRB1

222 01 02 03 04 05 06 0.60 (0.59)0.589 0.048 0.057 0.021 0.112 0.174

Eugl -DRB1

57 01 02 03 04 05 060.781 0.009 0.070 0.018 0.000 0.123

Eugl -DRB2

57 01 02 03 04 05 0.54 (0.54)0.105 0.026 0.123 0.099 0.659

DRB1/ DRB2

57 A B C D E F G H I J K L 0.54 (0.54)(01-02) (01-03) (01-04) (01-05) (02-01) (03-01) (03-03) (04-01) (06-01) (06-02) (06-03) (06-04)0.01 0.04 0.08 0.66 0.01 0.06 0.01 0.02 0.02 0.02 0.08 0.01

Allele and haplotype designations are indicated in bold. Eugl-DRB2*05 represents the allele(s) that was not amplifying using the DRB5c/3c primer set. Genotypes for the Eugl-DRB1 locus are available for all 222 profiled individuals. Eugl-DRB2*05 was inferred through transmission analysis of known family groups. Due to the inability to differentiate between some of the alleles at the DRB2 locus and the fact that this locus did not amplify in 41 of the samples, only frequencies for Eugl-DRB1 for all 222 individuals are presented. The frequencies for Eugl-DRB2 and the DRB1/DRB2 haplotypes (and for comparative purposes, Eugl-DRB1) were calculated using 57 individuals (45 individuals with clear genotypes and an additional 12 individuals with the inferred Eugl-DRB2*05 allele).


Dow

nloaded from



Journal of Heredity

6

with no apparent Eugl-DRB2 amplification were homozy-gous for Eugl-DRB1*01, suggesting Eugl-DRB1*01 and the Eugl-DRB2 null allele(s) were being inherited together (see Haplotype Analysis). Through haplotype analysis and infer-ence of the null allele(s) in known pedigrees, 12 additional Eugl-DRB2 genotypes were resolved resulting in complete genotypes being available for 57 samples for Eugl-DRB2.

Seven sequences corresponding to sites 21–77 relative to exon 2 of cow DRB3-like genes were identified in 11 whales using the DQB1/2 primer set. Up to 4 sequences were found in each individual, indicating the primers were ampli-fying at least 2 loci. Six of the 7 sequences (Eugl-DRB1*01 to Eugl-DRB1*06 and Eugl-DRB2*01 to Eugl-DRB2*04; Figure 1) were identical to the Eugl-DRB1 and Eugl-DRB2 alleles characterized using the DRB5c/3c primer set in the same individuals indicating these primers amplified the same loci. By following transmission patterns of pedigrees pro-filed with both primer sets, the previously unidentified allele (Eugl-DRB2*05; Figure 1; GenBank Accession Number: KF137603) was assigned to the Eugl-DRB2 locus (Figure 2). This allele also exhibited a single base pair change at codon 51 of AGC, coding for serine, which was characteristic of the Eugl-DRB2 locus (Figure 1). With the inclusion of the null allele identified with the DQB1/2 primer set, this locus was found to be in HWE (Table 2).

Five unrelated individuals were screened for variation using the DRB5b/3b primer set. Four sequences (Eugl-DRB*01 to Eugl-DRB*04; GenBank Accession Numbers: KF137604–KF137605) corresponding to codons 9–70 of the cow DRB3 molecule were identified (Figure 1). The sequences aligned with previously characterized cow and beluga DRB alleles, but contained a 2-bp indel, resulting in a change in reading frame leading to a premature stop codon. Up to 3 sequences were identified per sample, indicating the primers were amplifying at least 2 loci. Eugl-DRB*01 was present in all individuals. This sequence was identical to EuauWA9511-DRB*1c, a pseudogene previously iden-tified in the southern right whale (Baker et al. 2006). The remaining 3 sequences (Eugl-DRB*02, Eugl-DRB*03, and Eugl-DRB*04) were 1 bp different from Eugl-DRB*01. Eugl-DRB*03 and Eugl-DRB*04 were seen in independent PCRs

in 2 clones from the same individual and therefore remain tentative until confirmed in additional individuals.

Haplotype Analysis

Alleles at locus Eugl-DRB1 and Eugl-DRB2 were in tight link-age disequilibrium (P = 0.001), suggesting the genotypes at Eugl-DRB1 are not independent from the genotypes at Eugl-DRB2 and are being inherited en bloc. EuglDRB1-DRB2 hap-lotypes were inferred based on the segregation of Eugl-DRB1 and Eugl-DRB2 genotypes from parents to their calves (see Figure 2 for examples of two of the pedigrees represent-ing multiple generations that were used in the transmission analysis). The individuals used for this analysis represented 4 matrilines and 6 patrilines, which contained multiple calves across 1 or 2 generations. Analysis of 64 parental chromo-somes revealed 9 haplotypes (Table 2). Three additional haplotypes were identified in 2 family groups not contained within these matrilines or patrilines. Over half of the haplo-types identified were EuglDRB1*01-DRB2*05 (haplotype D; Table 2), representing the most common Eugl-DRB1 allele and the null Eugl-DRB2 allele(s) that was not amplifying with the DRB5c/3c primer set. One matriline and 4 patrilines, where the mother and father were heterozygous at both loci, were informative for recombination analysis. However, no evidence of recombination between Eugl-DRB1 and Eugl-DRB2 was observed.

Evidence of Selection

Eugl-DRB1 and Eugl-DRB2 alleles were in open reading frame when aligned with previously characterized cow DRB3 and beluga alleles (Figure 1). A BLAST search in GenBank indi-cated that the alleles had high similarity to previously identi-fied DRB and DQB alleles of other cetaceans and even-toed ungulates. Eugl-DRB1 alleles contained the highest number of variable sites, in both the total sequence and in the codons thought to be involved in the recognition of foreign peptides (Table 3). Pairwise comparisons of both the total sequence and codons thought to be involved in the recognition of for-eign peptides of Eugl-DRB1 and Eugl-DRB2 indicated that dN was greater than dS. These were significantly different

Table 3 Allelic richness (k) and nucleotide diversity (π) across the whole MHC class II–like and α1 MHC class I–like sequences and across only those sites implicated in the peptide binding region (PBR) that have been implicated in peptide binding

k var. a.a. π dN (SE) dS (SE)

Eugl-DRB1 6 Overall 29/185 15/62 0.075 0.09 (0.02) 0.05 (0.02) PBR 23/69 11/23 0.166 0.22 (0.07)** 0.11 (0.06)Eugl-DRB2 5 Overall 15/185 12/62 0.052 0.07 (0.02)*** 0.00 (0.00) PBR 13/69 10/23 0.133 0.18 (0.05)*** 0.00 (0.00)Eugl-I 3 Overall 3/147 3/49 0.009 0.01 (0.01) 0.00 (0.00) PBR 3/66 3/22 0.020 0.03 (0.02) 0.00 (0.00)

The number of variable sites (var.), amino acid (a.a.) changes, and average number of nonsynonymous (dN) and synonymous substitutions (dS) per site are indicated. Identified pseudogenes are not included in these analyses. Significant differences between dN and dS are indicated; **P < 0.05; ***P < 0.01. SE, standard error.


Dow

nloaded from




7

from neutrality at the 0.05 level for Eugl-DRB2 alleles and approached significance for Eugl-DRB1 alleles. However, both loci were significantly different from neutrality when only sites implicated in peptide binding were considered (Table 3).

Phylogenetic Reconstructions

The DRB-5c/3c, DQB1/2, and DRB-5b/3b primer sets appear to be amplifying regions similar to exon 2 of ungu-late and primate DRB and DQB genes (Figure 3). A phyloge-netic analysis based on 160 bp of primate and ungulate DRB and DQB sequences, combined with all known class II–like sequences from the North Atlantic right whale, southern right whale, and bowhead whale confirmed similarity of all balaenid class II–like sequences with ungulate and primate DRB and DQB sequences. The DQB- and DRB-like bal-aenid sequences were interspersed among each other and grouped together with moderately strong bootstrap support (74%); primate/ungulate DQB sequences grouped together with moderate bootstrap support (75%); and primate/ungu-late DRB1, DRB2, and DRB3 alleles and 1 southern right whale allele grouped together with moderate bootstrap sup-port (74%). Although specific alleles from the same locus (Eugl-DRB1 or Eugl-DRB2) seemed closely related (e.g., Eugl-DRB2*04 and *05 [89%]; Eugl-DRB1*03 and *04 [60%]),

there was no clear separation between Eugl-DRB1 and Eugl-DRB2 alleles within the balaenid clade. However, all sequences identified as being pseudogenes grouped together with strong bootstrap support (99%) within the balaenid clade. The phylogenetic reconstruction also revealed that the North Atlantic right whale sequences were interspersed among previously characterized southern right whale and bowhead whale DRB/DQB exon 2–like alleles. For exam-ple, alleles Eugl-DRB1*03 and Eugl-DRB1*04 grouped with moderately strong bootstrap support (60%) with the previ-ously characterized expressed allele Euau-DQB*8 that was isolated from the southern right whale (Heinzelmann et al. 2009). Identified pseudogenes grouped strongly (99%) with the southern right whale pseudogene EuauWA9511-DRB*1c. Interestingly, the pseudogene identified in the southern right whale (EuauWA9511-DRB*1c; Baker et al. 2006) was identical to the North Atlantic right whale pseudogene Eugl-DRB*01.

To determine the relationship between North Atlantic right whale sequences with DRB and DQB sequences identi-fied from other cetaceans, a phylogenetic analysis was per-formed based on the same 160 bp of primate and ungulate DRB and DQB sequences and with known class II–like sequences from select baleen whales (Figure 4). Primate and ungulate DQB, DRB1, and DRB3 sequences grouped together in moderately supported (64% and 56%) mono-phyletic clades. All DQB and DRB cetacean sequences were

Figure 3. Maximum-likelihood tree of 160 bp of North Atlantic right whale (Eugl), southern right whale (Euau), and bowhead whale (Bamy) MHC class II beta chain exon 2–like sequences with respect to ungulate and primate DRB and DQB genes. Genetic distances were adjusted using the best-fit model TRN+G (=0.645) indicated by the Bayesian Information Criterion in jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Numbers adjacent to internal nodes indicate relevant bootstrap values calculated from 1000 resampling events. Eugl-DRB1 alleles are indicated using bold font, Eugl-DRB2 alleles are indicated using bold-italicized font, and Eugl-DRB pseudogenes are indicated using bold-underlined font.


Dow

nloaded from



Journal of Heredity

8

interspersed among each other forming a weakly supported (42%) monophyletic clade and appeared more closely related to each other than to the primate and ungulate DQB or DRB sequences included in the phylogeny (Figure 4).

Characterization of MHC-I-Like Loci

Ten unrelated individuals were genotyped using the MHCIex2F/MHCIex2R primer set (Table 1). Six sequences corresponding to sites 33–81 relative to the α1 domain of the cow MHC-I were characterized (Figure 5; GenBank Accession Numbers: KF137606–KF137611). Between 2 and 5 sequences were identified per sample, suggesting at least 3 loci were being amplified. Two sequences were present in all sampled individuals. Both sequences were in open read-ing frame with previously characterized cow and gray whale MHC-I sequences. However, one sequence coded for an uninterrupted amino acid sequence (Eugl-I*01), whereas the other contained a 1-bp indel, resulting in a change in reading frame leading to the formation of a premature stop codon (Eugl-I*02). The 4 remaining sequences were each confirmed from 2 whales with at least 2 clones. Two of the sequences

(Eugl-I*03 and Eugl-I*04) were similar to Eugl-I*01 and were in open reading frame with previously characterized alleles, whereas the remaining 2 sequences (Eugl-I*05 and Eugl-I*06) contained the same 1-bp indel as found in Eugl-I*02. A BLAST search in GenBank indicated that the alleles most closely resembled previously identified MHC-I sequences of other cetaceans and even-toed ungulates. As the class I alleles were only screened using unrelated individuals, there was no transmission analysis for these loci.


The Eugl-I alleles that were in open reading frame with previ-ously published MHC-I sequences contained fewer variable sites in both the overall sequence (3/147) and in the codons thought to be involved in the recognition of foreign peptides (3/66) than characterized Eugl-DRB1 and Eugl-DRB2 alleles (Table 3). Although not significantly different from neutral-ity, pairwise comparisons of both the overall sequence and codons thought to be involved in the recognition of foreign peptides of Eugl-I alleles indicated that dN was greater than dS (Table 3).

Figure 4. Maximum-likelihood tree of 160 bp of cetacean MHC class II beta chain exon 2–like sequences with respect to ungulate and primate DRB and DQB genes. Cetaceans include the North Atlantic right whale (Eugl), southern right whale (Euau), bowhead whale (Bamy), humpback whale (Meno), gray whale (Esro), fin whale (Baph), blue whale (Bamu), minkie whale (Baac and Babo), beluga whale (Dele), sperm whale (Phma), short-finned pilot whale (Glma), narwhal (Momo), bottlenose dolphin (Tuad and Tutr), Indo-pacific humpbacked dolphin (Soch), Yangtze River dolphin (Live), Dall’s porpoise (Phda), and Indo-Pacific finless porpoise (Neph). Genetic distances were adjusted using the best-fit model F81+G (=0.404) indicated by the Bayesian Information Criterion in jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Numbers adjacent to internal nodes indicate relevant bootstrap values calculated from 1000 resampling events. Eugl-DRB1 alleles are indicated using bold font, Eugl-DRB2 alleles are indicated using bold-italicized font, and Eugl-DRB pseudogenes are indicated using bold-underlined font.


Dow

nloaded from




9

Phylogenetic Reconstructions

To determine the relationship between North Atlantic right whale alleles and alleles of other cetaceans, a phylogeny based on 147 bp of ungulate and cetacean MHC-I sequences was performed. The reconstructed right whale MHC-I-like sequences grouped with MHC-I sequences of other ceta-ceans. There was moderately strong (73%) bootstrap support for a cetacean-specific clade that was distinct from ungulate MHC-I sequences. Within the cetaceans there appeared to be 3 distinct clades. There was low bootstrap support (55%) for a clade containing the Eugl-I alleles with previously identified gray whale alleles. There was strong bootstrap support (96%) for a clade containing only dolphin and porpoise alleles. The third clade had weak support (bootstrap values less than 50%) and contained the Eugl-I pseudogenes, gray whale, Yangtze River dolphin, Indo-pacific humpbacked dolphin, and finless porpoise alleles (Figure 6).

DiscussionDRB-Like and MHC-I-Like Characterization

Amplification of duplicated MHC class II–like or triplicated MHC class I–like loci have been documented in several

cetaceans including the beluga whale (Murray and White 1998), humpback whale (Baker et al. 2006), southern right whale (Baker et al. 2006; Heinzelmann et al. 2009), Eastern gray whale (Flores-Ramirez et al. 2000), bottlenose dolphin (Yang et al. 2007), Hectors dolphin (Heimeier et al. 2009), Yangtze River dolphin (Xu et al. 2008), and finless porpoise (Xu et al. 2007). In all cases, except beluga, the identified alleles have not been linked back to individual loci. Characterization of specific MHC sequences is useful for studies assessing selection, phylogenetic relationships, and association-based studies. However, it is less useful for population studies requiring the assignment of alleles to specific loci or for testing specific hypotheses addressing health and reproduc-tion. The presence of long-term North Atlantic right whale pedigree information allowed for relating of alleles back to specific loci and the identification of MHC haplotypes in this species (Figure 2). This novel tool for assessing MHC vari-ability in cetaceans revealed the presence of 2 DRB-like loci (Eugl-DRB1 and Eugl-DRB2) and 12 Eugl-DRB1-DRB2 hap-lotypes (Table 2; see Supplementary Material online). Alleles at these loci were in open reading frame with previously pub-lished DRB sequences (Figure 1).

Eugl-DRB1 and Eugl-DRB2 were in strong linkage disequi-librium (P = 0.001), suggesting they were being inherited en

Figure 5. Inferred amino acid sequences of the North Atlantic right whale (Eugl) MHC-I-like sequences (GenBank Accession Numbers: KF137606–KF137611) based on alignment to previously published gray whale (Esro, AF149223.1), cow (BoLA, AB008626) Hector’s dolphin (Cehe, EU024812.1), finless porpoise (Neph, DQ843626.1), Indo-pacific humpbacked dolphin (Stco, EU698991.1), common dolphin (Deca, EU698980.1), Yangtze River dolphin (Live, DQ851848.1), and La Plata dolphin (Pobl, EU698987.1) MHC-I sequences. Translations inferred from nucleotide sequences in reading frame with representative cow (Bola), gray whale (Esro), Hector’s dolphin (Cehe), finless porpoise (Neph), Chinese white dolphin (Stco), common dolphin (Deca), Yangtze River dolphin (Live), and La Plata dolphin (Pobl) sequences. Translations of pseudogenes are shown for comparative purposes. Stop codons of pseudogenes are indicated (). Amino acid sequences start at position 33 relative to the α1 domain of the human MHC-I gene. Amino acids implicated in the recognition of foreign peptides are indicated with an asterisk (*) following Lafont et al. (2003).


Dow

nloaded from




Journal of Heredity

10

bloc. The 12 identified haplotypes displayed no evidence of recombination (Table 2; see Supplementary Material online). Haplotype D exhibited the highest frequency (0.66), whereas all other haplotypes were present at lower frequencies (0.01–0.08; Table 2). The resulting L-shaped frequency distribution is similar to that seen in microsatellite markers used to profile the extant population (Frasier, Hamilton, et al. 2007; McLeod et al. 2010) and is consistent with the interpretation that this population has not gone through a genetic bottleneck in the last 40–80 generations (McLeod et al. 2010). Although data from the MHC are consistent with this interpretation, look-ing specifically at the MHC is problematic because these alleles are likely to be under the influence of selection.

Eugl-DRB1*02, 03, 04, 05, and 06 appeared to segregate with Eugl-DRB2*01, 02, 03, or 04. However, the null allele(s) Eugl-DRB2*05 segregated exclusively with Eugl-DRB1*01. In the short term, this high frequency haplotype may have a selective advantage as these alleles may offer resistance toward a specific disease or pathogen (Milinski 2006). However, in the long term, this high frequency haplotype may lower the species’ ability to respond quickly to emerging diseases and (or) pathogens. The primary feeding, calving, and nursery areas for the right whale are in shallow coastal waters (Winn et al. 1986; Gaskin 1991; Kraus and Kenney 1991; Kenney

et al. 1995, 2001). Therefore, this species may be exposed to more pathogens and parasites than noncoastal species. North Atlantic right whales currently exhibit the highest parasite loads of Cryptosporidium spp. and Giardia spp. of any cetacean described to date (Hughes-Hanks et al. 2005). The strains present in right whales have not been identified. However, human and agricultural strains have been found in marine waters, suggesting contamination of coastal waters through discharge of municipal wastewater, wastewater from boats, or agricultural runoff may be of concern (Graczyk et al. 1999; Deng et al. 2000; Morgan et al. 2000; Fayer et al. 2002).

This high frequency haplotype may also be affecting this species’ reproductive performance. Previous studies have shown that mating pairs with similar MHC have reduced reproductive performance (Knapp et al. 1996; Ober et al. 1998; Hviid 2006). The high frequency of this one haplo-type in the population may be resulting in increased genetic similarity between mating pairs, which may negatively affect reproduction. Transmission analysis of right whale pedigrees using 35 neutral microsatellite markers suggests offspring exhibit significantly higher levels of genetic diversity than expected if matings were random. This appears to occur because fertilizations and/or pregnancies are more success-ful when the inherited paternal alleles are more different

Figure 6. Maximum-likelihood tree of 147 bp of cetacean MHC class I–like sequences with respect to ungulate genes. Cetaceans include the gray whale (Esro), Hector’s dolphin (Cehe), Stripped dolphin (Sten), common dolphin (Deca), Yangtze River dolphin (Live), La Plata dolphin (Pobl), Indo-pacific humpbacked dolphin (Soch), and the finless porpoise (Neph). Genetic distances were adjusted using the best-fit model K80+G (=0.842) indicated by the Bayesian Information Criterion in jModelTest 0.1.1 (Guindon and Gascuel 2003; Posada 2008). Numbers adjacent to internal nodes indicate relevant bootstrap values calculated from 1000 resampling events. Eugl-I alleles are indicated using bold font and Eugl-I pseudogenes are indicated using bold-underlined font. by guest on January 2, 2014

http://jhered.oxfordjournals.org/D

ownloaded from





11

from the maternal alleles than expected by chance (Frasier 2005; Frasier, McLeod, et al. 2007; Frasier et al. 2013). This suggests that there may be a selective advantage for offspring that are genetically dissimilar from their parents. The identi-fication of haplotypes and transmission analysis of known pedigrees presented here is the first step in determining how variation at the MHC is affecting health and repro-duction in this species. Preliminary analysis based on data from Eugl-DRB1 suggests that there is not a preference for MHC disassortative mating patterns or increased levels of heterozygosity in the surviving offspring. However, there is a trend for biased allele inheritance patterns based on het-erozygosity (Gillett 2009; Frasier et al. 2013). As this analysis has only been performed using 1 MHC locus, and the num-ber of pedigrees meeting the analysis requirements was lim-ited (n = 8), these studies will be continued as more pedigrees and loci become available.


The allelic diversity at the Eugl-DRB1 and Eugl-DRB2 loci was 5.5 ± 0.7. The level of allelic diversity identified at these 2 loci is greater than 65% (n = 23/35) of previously screened microsatellite loci (3.8 ± 2.32; Frasier et al. 2006; Frasier, Hamilton, et al. 2007). Further, the observed heterozygo-sity of Eugl-DRB1 and Eugl-DRB2 (Ho = 0.60 and 0.54) is greater than 80% (n = 28/35) of the same microsatellite loci (Ho = 0.31 ± 0.28; Frasier et al. 2006; Frasier, Hamilton, et al. 2007). Increases in the level of variation between neutral microsatellite and MHC loci have been interpreted as evi-dence of contemporary selection (Boyce et al. 1997; Landry and Bernatchez 2001; Hambuch and Lacey 2002; Wegner et al. 2003; Wilson et al. 2003). Therefore, the higher level of genetic diversity at the DRB-like loci compared with pre-viously characterized neutral microsatellites suggests that, in addition to neutral evolutionary forces (e.g., mutation and genetic drift), selection may be playing a role in shaping and/or increasing extant variation at these loci.

It is generally accepted that balancing selection helps shape levels of genetic diversity at the MHC (Bernatchez and Landry 2003). Balancing selection on class II MHC loci has been found to be weaker and more variable in marine mammals when compared with their terrestrial counterparts (Villanueva-Noriega et al. 2013). However, sequence analyses of several species of cetacean have found evidence of bal-ancing selection, as indicated by high levels of nonsynony-mous substitutions in the peptide binding region (Hayashi et al. 2003; Yang et al. 2005, 2007, 2008, 2010, 2012; Baker et al. 2006; Xu et al. 2007, 2008, 2009; Heimeier et al. 2009; Vassilakos et al. 2009). Our finding that the number of non-synonymous substitutions per site is significantly greater than the number of synonymous substitutions per site at codons thought to be involved in the recognition of foreign peptides is consistent with these results (Table 3). Further, as found in other phylogenetic studies of cetacean MHC (Hayashi et al. 2003; Baker et al. 2006; Yang et al. 2008; Heimeier et al. 2009; Xu et al. 2009), evidence of trans-species allele sharing was apparent (Figures 3 and 4). If these allelic lineages have been

maintained across speciation events, it would further support the hypothesis that balancing selection is acting on these loci.

Recent work by Heinzelmann et al. (2009) found the expression of alleles amplified using the DQB1/2 primer occurs in southern right whales, implying genes ampli-fied by these primers (and consequently the DRB-5c/3c primer set that amplified the same loci) are functional. The North Atlantic right whale alleles, Eugl-DRB1*03 and Eugl-DRB1*04, grouped with moderately strong bootstrap sup-port (60%) with the previously characterized expressed allele Eugl-DQB*8. If these primers are amplifying the same locus in the southern and North Atlantic right whale, the Eugl-DRB1 locus identified here may also be functional. However, studies looking at expression in this species are needed to confirm this hypothesis.

Identification of DRB-Like and MHC-I-Like Pseudogenes

Five unrelated individuals were screened for variation using the primer pair DRB-5b/3b. Up to 3 sequences were present in each individual, suggesting that these primers amplified at least 2 loci. All 4 characterized sequences (Eugl-DRB*01 and *02 and the tentative sequences Eugl-DRB*03 and *04) contained a 2-bp indel, which resulted in a premature stop codon (Figure 1). Similarly, between 2 and 5 MHC-I-like sequences were identified in the 10 unrelated individuals screened using the MHCIex2F/MHCIex2R primer pair, sug-gesting the amplification of at least 3 loci. Three of the 6 characterized MHC-I-like sequences (Eugl-I*02, *05, and *06) contained a 1-bp indel, which also resulted in a premature stop codon (Figure 5). The presence of the premature stop codon in these alleles suggests that they represent pseudo-genes (Balakirev and Ayala 2003). As these primer sets were only screened using unrelated individuals, transmission analy-sis was not possible.

To our knowledge, no MHC pseudogenes have been identified in odontocetes. However, amplification of class II pseudogenes is common in baleen whales (Baker et al. 2006). This study showed that the southern right whale pseudogene EuauWA9511-DRB*1c (Baker et al. 2006) is identical to the North Atlantic right whale pseudogene Eugl-DRB*01. Allele sharing of MHC class II pseudogenes in cetaceans has not been documented. However, previous studies have identified class II allele sharing between primate, ungulate, rodent, and cetacean species from the same genus or family (Hayashi et al. 2003; Doxiadis et al. 2006; Cutrera and Lacey 2007; Radwan et al. 2007; Xu et al. 2008, 2009). Selective pressures acting on the MHC make it possible for alleles within this complex to be maintained across speciation events (Doxiadis et al. 2006; Xu et al. 2008, 2009). However, they may also be shared as a result convergent evolution (Xu et al. 2008) or through introgressive hybridization between species (Xu et al. 2009). North Atlantic and southern right whales are reproductively isolated (Rosenbaum et al. 2000; Gaines et al. 2005) and have no range overlap (Best et al. 2001). Therefore, sharing alleles via introgressive hybridization is unlikely. Alleles can persist across allelic lineages at functional MHC loci for at least 40 million years if they are being maintained through positive


Dow

nloaded from



Journal of Heredity

12

selective pressures (Klein et al. 1993). Studies have suggested that allelic diversity brought about through trans-species evo-lution of MHC predated the divergence of toothed whales that occurred 33.52–35.43 mya (Xiong et al. 2009; Xu et al. 2009). This may imply that the sharing of this allele predates the divergence between the North Atlantic and southern right whale that occurred 3–12 mya (Malik et al. 2000; Rosenbaum et al. 2000; Gaines et al. 2005; Sasaki et al. 2005).

DRB and DQB Convergence

The phylogenetic reconstructions presented here based on relatively short class II sequences did not show the expected pattern of orthology for DQB and DRB (Figure 4). Instead these analyses indicate that all DQB and DRB cetacean sequences are interspersed in a weakly supported monophyl-etic clade, and the cetacean sequences are more closely related to each other than to their presumably orthologous primate and ungulate DQB or DRB counterparts. These results are consistent with previous phylogenetic analyses using similar fragment sizes of class II MHC DRB and DQB-like exon 2 sequences in baleen whales (Baker et al. 2006). Baker et al. (2006) identified a baleen whale DRB-like clade that exhib-ited moderate bootstrap support (59%), and another more weakly supported cetacean clade containing both DRB- and DQB-like sequences. They suggested that convergent evo-lution may be a possible explanation for the observed pat-tern of presumably orthologous DRB and DQB genes being grouped together and hypothesized that small intergenic gene conversions in exon 2 was the most likely mechanism.

We also observed a nesting of whale DRB-like and DQB sequences within our phylogeny. Several additional lines of evidence in our data support the theory of convergence between DRB and DQB exon 2 sequences in cetaceans. First, the “universal” DRB and DQB (DRB-5c/3c and DQB1/2) primers amplified the same sets of sequences. Second, our phylogenetic analyses indicated that specific alleles from locus Eugl-DRB1 (Eugl-DRB1*01 and Eugl-DRB1*06) group with alleles from the baleen whale DRB clade identified in Baker et al. (2006). Third, other Eugl-DRB1 alleles were interspersed throughout the rest of the clade and were more closely related to previously identified DQB-like alleles (e.g., Eugl-DRB1*03 and Eugl-DRB1*04 group with Euau DQB*8 with 71% bootstrap support; Figure 4). Finally, alleles of known cetacean DRB and DQB orthologs were interspersed within the cetacean class II clade. Phylogenetic reconstruc-tions of full-length expressed DQB and DRB gene prod-ucts from bottlenose dolphins show strong evidence of their respective othologous relationship to other mammalian DQB and DRB genes (Yang et al. 2007). In contrast, the truncated exon 2 sequences obtained from the gene prod-ucts included in our phylogenetic analysis cluster within the monophyletic cetacean clade (Figure 4). Although we have clearly identified individual loci, and the sequences identified appear to have more similarity to previously published DRB alleles, the putative orthology of these loci to DRB or DQB remains uncertain. Full-length coding sequences or locus-specific intron sequences will be required to determine the

relationship between known whale class II sequences with the class II types in other mammals.

Supplementary MaterialSupplementary material can be found at http://www.jhered.oxfordjournals.org/.

FundingPenzance Foundation through the Woods Hole Oceanographic Institution Ocean Life Institute Right Whale Initiative (agreement number A-100374); Natural Sciences and Engineering Research Council of Canada. Discovery grant awarded to B.N.W.; Natural Sciences and Engineering Research Council Canadian Graduate Scholarship awarded to R.M.G. (CGSD3-316704-2005).

AcknowledgmentsAccess to data on pedigrees used throughout this study was provided by the North Atlantic Right Whale Consortium and Dr T. R. Frasier. A special thanks to Dr C. Wilson and Dr T. R. Frasier for their helpful comments and improvements on this manuscript.

ReferencesAguilar A. 1986. A review of old Basque whaling and its effect on the right whales (Eubalaena glacialis) of the North Atlantic. Report of the International Whaling Commission (Special Issue). 10:191–199.

Allen CN. 2000. Major histocompatibility complex DRbeta allele affiliation and reproductive parameters in North Atlantic right whales (Eubalaena glacia-lis) [M.A. thesis]. [Boston (MA)]: Boston University. 140 p.

Ammer H, Schwaiger FW, Kammerbauer C, Gomolka M, Arriens A, Lazary S, Epplen JT. 1992. Exonic polymorphism vs intronic simple repeat hyper-variability in MHC-DRB genes. Immunogenetics. 35:332–340.

Baker CS. 2013. Journal of Heredity adopts joint data archiving policy. J Hered. 104:1. doi:10.1093/jhered/ess137.

Baker CS, Vant MD, Dalebout ML, Lento GM, O’Brien SJ, Yuhki N. 2006. Diversity and duplication of DQB and DRB-like genes of the MHC in baleen whales (suborder: Mysticeti). Immunogenetics. 58:283–296.

Balakirev ES, Ayala FJ. 2003. Pseudogenes: are they “junk” or functional DNA? Annu Rev Genet. 37:123–151.

Bernatchez L, Landry C. 2003. MHC studies in nonmodel vertebrates: what have we learned about natural selection in 15 years? J Evol Biol. 16:363–377.

Best PB, Brandão A, Butterworth DS. 2001. Demographic parameters of south-ern right whales off South Africa. J Cet Res Manage (Special Issue). 2:161–169.

Black WC 4th, Krafsur ES. 1985. A FORTRAN program for the calculation and analysis of two-locus linkage disequilibrium coefficients. Theor Appl Genet. 70:491–496.

Boyce WM, Hedrick PW, Muggli-Cockett E, Kalinowski S, Penedo MCT, Rammey RR II. 1997. Genetic variation of major histocompatibility complex and microsatellite loci: a comparison in Bighorn sheep. Genetics. 145:421–433.

Brown J, Jardetzky T, Gorga J, Stern L, Urban R, Strominger J, Wiley D. 1993. Three-dimensional structure of the human class II histocompatibility antigen HLA-DR. Nature. 364:33–39.

Brown MW, Kraus SD, Gaskin DE. 1991. Reactions of North Atlantic right whales, Eubalaena glacialis, to skin biopsy sampling for genetic and pollutant analysis. Report of the International Whaling Commission (Special Issue). 13:81–89.


Dow

nloaded from






13

Brownell RL, Best PB, Prescot KH. 1986. Right whales: past and present status. Reports of the International Whaling Commission (Special Issue). 10:1–289.

Browning CL, Rolland RM, Kraus SD. 2010. Estimated calf and perinatal mortality in western North Atlantic right whales (Eubalaena glacialis). Mar Mam Sci. 26:648–662.

Carroll EL, Childerhouse SJ, Fewster RM, Patenaude NJ, Steel D, Dunshea G, Boren L, Baker CS. 2013. Accounting for female reproductive cycles in a superpopulation capture-recapture framework. Ecol Appl. 23:1677–1690.

Cutrera AP, Lacey EA. 2007. Trans-species polymorphism and evidence of selection on class II MHC loci in tuco-tucos (Rodentia: Ctenomyidae). Immunogenetics. 59:937–948.

Deng MQ, Peterson RP, Cliver DO. 2000. First findings of Cryptosporidium and Giardia in California sea lions (Zalophus californianus). J Parasitol. 86:490–494.

Doucette GJ, Mikulski CM, King KL, Roth PB, Wang Z, Leandro LF, DeGrasse SL, White KD, De Biase D, Gillett RM, et al. 2012. Endangered North Atlantic right whales (Eubalaena glacialis) experience repeated, concur-rent exposure to multiple environmental neurotoxins produced by marine algae. Environ Res. 112:67–76.

Doxiadis GG, Rouweler AJ, de Groot NG, Louwerse A, Otting N, Verschoor EJ, Bontrop RE. 2006. Extensive sharing of MHC class II alleles between rhesus and cynomolgus macaques. Immunogenetics. 58:259–268.

Eizaguirre C, Yeates SE, Lenz TL, Kalbe M, Milinski M. 2009. MHC-based mate choice combines good genes and maintenance of MHC polymor-phism. Mol Ecol. 18:3316–3329.

Ellis R. 1991. Men and whales. New York: The Lyons Press.

Fayer R, Trout JM, Lewis EJ, Xiao L, Lal A, Jenkins MC, Graczyk TK. 2002. Temporal variability of Cryptosporidium in the Chesapeake Bay. Parasitol Res. 88:998–1003.

Flores-Ramirez S, Urban-Ramirez J, Miller RD. 2000. Major histocompat-ibility complex class I loci from the gray whale (Eschrichtius robustus). J Hered. 91:279–282.

Frasier TR. 2005. Integrating genetic and photo-identification data to assess reproductive success in the North Atlantic right whale (Eubalaena glacialis) [PhD thesis]. [Hamilton (ON)]: McMaster University. 197 p.

Frasier TR, Gillett RM, Hamilton PK, Brown MW, Kraus SD, White BN. 2013. Postcopulatory selection for dissimilar gametes maintains het-erozygosity in the endangered North Atlantic right whale. Ecol Evol. 3:3483–3494.

Frasier TR, Hamilton PK, Brown MW, Conger LA, Knowlton AR, Marx MK, Slay CK, Kraus SD, White BN. 2007. Patterns of male reproduc-tive success in a highly promiscuous whale species: the endangered North Atlantic right whale. Mol Ecol. 16:5277–5293.

Frasier TR, McLeod BA, Gillett RM, Brown MW, White BN. 2007. Right whales past and present as revealed by their genes. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 200–231.

Frasier TR, Rastogi T, Brown MW, Hamilton PK, Kraus SD, White BN. 2006. Characterization of tetranucleotide microsatellite loci and develop-ment and validation of multiplex reactions for the study of right whale spe-cies (genus Eubalaena). Mol Ecol Notes. 6:1025–1029.

Gaines CA, Hare MP, Beck SE, Rosenbaum HC. 2005. Nuclear markers confirm taxonomic status and relationships among highly endangered and closely related right whale species. Proc Biol Sci. 272:533–542.

Garnier-Gere P, Dillmann C. 1992. A computer program for testing pairwise linkage disequilibria in subdivided populations. J Hered. 83:239.

Gaskin DE. 1991. An update of the status of the right whale, Eubalaena glacialis, in Canada. Can Field Nat. 105:295–309.

Gillett RM. 2009. MHC genotypes and reproductive success in the North Atlantic right whale (Eubalaena glacialis) [PhD thesis]. [Peterborough (Canada)]: Trent University. 149 p.

Graczyk TK, Thompson RC, Fayer R, Adams P, Morgan UM, Lewis EJ. 1999. Giardia duodenalis cysts of genotype A recovered from clams in the Chesapeake Bay subestuary, Rhode River. Am J Trop Med Hyg. 61:526–529.

Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010. New algorithms and methods to estimate maximum-likelihood phy-logenies: assessing the performance of PhyML 3.0. Syst Biol. 59:307–321.

Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to esti-mate large phylogenies by maximum likelihood. Syst Biol. 52:696–704.

Hambuch TM, Lacey EA. 2002. Enhanced selection for MHC diversity in social tuco-tucos. Evolution. 56:841–845.

Hamilton PK, Knowlton AR, Marx MK. 2007. Right whales tell their own stories: the photo-identification Catalog. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 75–104.

Hamilton PK, Marx MK. 2005. Skin lesions on North Atlantic right whales: categories, prevalence and change in occurrence in the 1990s. Dis Aquat Organ. 68:71–82.

Hamilton PK, Marx MK, Kraus SD. 1995. Weaning in North Atlantic right whales. Mar Mam Sci. 11:386–390.

Hayashi L, Nishida S, Yoshida H, Goto M, Pastene LA, Koike H. 2003. Sequence variation of the DQB allele in the cetacean MHC. Mammal Study. 28:89–96.

Heimeier D, Baker CS, Russell K, Duignan PJ, Hutt A, Stone GS. 2009. Confirmed expression of MHC class I and class II genes in the New Zealand endemic Hector’s dolphin (Cephalorhynchus hectori). Mar Mam Sci. 25:68–90.

Heinzelmann L, Tavares M, Ott PH, Moreno IM, Chies JAB. 2009. MHC class II expression in skin biopsies from the franciscana dolphin Pontoporia blainvillei and the southern right whale Eubalaena australis. J Mar Biol Assoc UK. 89:1009–1013.

Hughes-Hanks JM, Rickard LG, Panuska C, Saucier JR, O’Hara TM, Dehn L, Rolland RM. 2005. Prevalence of Cryptosporidium spp. and Giardia spp. in five marine mammal species. J Parasitol. 91:1225–1228.

Huson DH, Scornavacca C. 2012. Dendroscope 3: an interactive tool for rooted phylogenetic trees and networks. Syst Biol. 61:1061–1067.

Hviid TVF. 2006. HLA-G in human reproduction: aspects of genetics, func-tion and pregnancy complications. Hum Reprod Update. 3:209–232.

Kenney RD, Mayo CA, Winn HE. 2001. Migration and foraging strategies at varying spatial scales in western North Atlantic right whales: a review of hypotheses. J Cet Res Manage (Special Issue). 2:251–260.

Kenney RD, Winn HE, Macaulay MC. 1995. Cetaceans in the Great South Channel 1979–1989: right whale (Eubalaena glacialis). Cont Shelf Res. 15:385–414.

Klein J. 1986. Natural history of the major histocompatibility complex. New York: John Wiley & Sons Inc.

Klein J, Bontrop RE, Dawkins RL, Erlich HA, Gyllensten UB, Heise ER, Jones PP, Parham P, Wakeland EK, Watkins DI. 1990. Nomenclature for the major histocompatibility complexes of different species: a proposal. Immunogenetics. 31:217–219.

Klein J, Satta Y, O’hUigin C. 1993. The molecular descent of the major his-tocompatibility complex. Annu Rev Immunol. 11:269–295.

Knapp LA, Ha JC, Sackett GP. 1996. Parental MHC antigen sharing and pregnancy wastage in captive pigtailed macaques. J Reprod Immunol. 32:73–88.

Knowlton AR, Kraus SD. 2001. Mortality and serious injury of northern right whales (Eubalaena glacialis) in the western North Atlantic Ocean. J Cet Res Manage (Special Issue). 2:193–208.

Knowlton AR, Kraus SD, Kenney RD. 1994. Reproduction in North Atlantic right whales (Eubalaena glacialis). Can J Zool. 72:1297–1305.

Kraus SD. 1990. Rates and potential causes of mortality in North Atlantic right whales (Eubalaena glacialis). Mar Mam Sci. 6:278–291.


Dow

nloaded from



Journal of Heredity

14

Kraus SD, Brown MW, Caswell H, Clark CW, Fujiwara M, Hamilton PK, Kenney RD, Knowton AR, Landry S, Mayo CA, et al. 2005. North Atlantic right whales in crisis. Science. 309:561–562.

Kraus SD, Hamilton PK, Kenney RD, Knowlton AR, Slay CR. 2001. Reproductive parameters of the North Atlantic right whale. J Cet Res Manage (Special Issue). 2:231–236.

Kraus SD, Kenney RD. 1991. Information of right whales (Eubalaena glacialis) in three proposed critical habitats in United States waters of the western North Atlantic Ocean. Reports to Marine Mammal Commission, Washington, DC, Contract Nos T-75133740 and T-75133753. 65 pp.

Kraus SD, Moore KE, Price CA, Crone MJ, Watkins WA, Winn HE, Prescott JH. 1986. The use of photographs to identify individual North Atlantic right whales (Eubalaena glacialis) in the western North Atlantic. Report of the International Whaling Commission (Special Issue). 10:139–144.

Kraus SD, Pace RM III, Frasier TR. 2007. High investment, low return: the strange case of reproduction in Eubalaena glacialis. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 172–199.

Kraus SD, Rolland RM. 2007. Right whales in the urban ocean. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 1–38.

Kumar S, Tamura K, Nei M. 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment briefings. Bioinformatics. 5:150–163.

Lafont BA, Buckler-White A, Plishka R, Buckler C, Martin MA. 2003. Characterization of pig-tailed macaque classical MHC class I genes: implica-tions for MHC evolution and antigen presentation in macaques. J Immunol. 171:875–885.

Landry C, Bernatchez L. 2001. Comparative analysis of population structure across environments and geographical scales at major histocompatibility complex and microsatellite loci in Atlantic salmon (Salmo salar). Mol Ecol. 10:2525–2539.

Lento GM, Baker CS, David V, Yuhki N, Gales NJ, O’Brien SJ. 2003. Automated single-strand conformation polymorphism reveals low diversity of a major histocompatibility complex class II gene in the threatened New Zealand sea lion. Mol Ecol Notes. 3:346–349.

Malik S, Brown MW, Kraus SD, White BN. 2000. Analysis of mitochondrial DNA diversity within and between North and South Atlantic right whales. Mar Mam Sci. 16:545–558.

McLeod BA, Brown MW, Frasier TR, White BN. 2010. DNA profile of a sixteenth century western North Atlantic right whale (Eubalaena glacialis). Conserv Genet. 11:339–345.

Mikko S, Røed K, Schmutz S, Andersson L. 1999. Monomorphism and poly-morphism at Mhc DRB loci in domestic and wild ruminants. Immunol Rev. 167:169–178.

Milinski M. 2006. The major histocompatibility complex, sexual selection, and mate choice. Annu Rev Ecol System. 37:156–186.

Moore MJ, Knowlton AR, Landry S, Mayo CA, McLellan WA, Bonde RK. 2005. Morphometry, gross morphology and available histopathology in North Atlantic right whale (Eubalaena glacialis) mortalities (1970–2002). J Cet Res Manage. 63:199–214.

Moore MJ, McLellan WA, Daoust P-Y, Bonde RK, Knowlton AR. 2007. Right whale mortality: a message from the dead to the living. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 358–379.

Morgan UM, Xiao L, Hill BD, O’Donoghue P, Limor J, Lal A, Thompson RC. 2000. Detection of the Cryptosporidium parvum “human” genotype in a dugong (Dugong dugon). J Parasitol. 86:1352–1354.

Murray BW, Malik S, White BN. 1995. Sequence variation at the major histo-compatibility complex locus DQ beta in beluga whales (Delphinapterus leucas). Mol Biol Evol. 12:582–593.

Murray BW, White BN. 1998. Sequence variation at the major histocom-patibility complex DRB loci in beluga (Delphinapterus leucas) and narwhal (Monodon monoceros). Immunogenetics. 48:242–252.

Nei M. 1987. Molecular evolutionary genetics. New York: Columbia University Press.

Nei M, Gojobori T. 1986. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 3:418–426.

Ober C, Hyslop T, Elias S, Weitkamp LR, Hauck WW. 1998. Human leuko-cyte antigen matching and fetal loss: results of a 10 year prospective study. Hum Reprod. 13:33–38.

O’Farrell B, Dennis C, Benzie JA, McGinnity P, Carlsson J, de Eyto E, Coughlan JP, Igoe F, Meehan R, Cross TF. 2012. Balancing selection on MHC class I in wild brown trout Salmo trutta. J Fish Biol. 81:1357–1374.

Oliver MK, Piertney SB. 2012. Selection maintains MHC diversity through a natural population bottleneck. Mol Biol Evol. 29:1713–1720.

Parham P, Lawlor DA, Lomen CE, Ennis PD. 1989. Diversity and diversifi-cation of HLA-A,B,C alleles. J Immunol. 142:3937–3950.

Pettis HM. 2012. North Atlantic Right Whale Consortium 2012 Annual Report Card. Report to the North Atlantic Right Whale Consortium, November 2012.

Pettis HM, Rolland RM, Hamilton PK, Brault S, Knowlton AR, Kraus SD. 2004. Visual health assessment of North Atlantic right whales (Eubalaena glacialis) using photographs. Can J Zool. 82:8–19.

Piertney SB, Oliver MK. 2006. The evolutionary ecology of the major histo-compatibility complex. Heredity. 96:7–21.

Posada D. 2008. jModelTest: phylogenetic model averaging. Mol Biol Evol. 25:1253–1256.

Radwan J, Kawałko A, Wójcik JM, Babik W. 2007. MHC-DRB3 variation in a free-living population of the European bison, Bison bonasus. Mol Ecol. 16:531–540.

Raymond M, Rousset F. 1995. An exact test for population differentiation. Evolution. 49:1280–1283.

Reeves RR. 2001. Overview of the catch history, historic abundance and distribution of right whales in the western North Atlantic and in Cintra Bay, West Africa. J Cet Res Manage (Special Issue). 2:187–192.

Reeves RR, Mitchell ED. 1986. American pelagic whaling for right whales in the North Atlantic. Report of the International Whaling Commission (Special Issue). 10:201–220.

Reeves RR, Smith TD, Josephson E. 2007. Near annihilation of a species: right whaling in the North Atlantic. In: Kraus SD, Rolland RM, editors. The urban whale: North Atlantic right whales at the crossroads. Cambridge (MA): Harvard University Press. p. 39–74.

Rosenbaum HC, Brownell RL, Brown MW, Schaeff C, Portway V, White BN, Malik S, Pastene LA, Patenaude NJ, Baker CS, et al. 2000. World-wide genetic differentiation of Eubalaena: questioning the number of right whale species. Mol Ecol. 9:1793–1802.

Rozsa J, Sanchez-DelBarrio C, Messeguer X, Rozas R. 2003. DNASP, DNA polymorphism analysis by the coalescent and other methods. Bioinformatics. 19:2496–2497.

Sasaki T, Nikaido M, Hamilton H, Goto M, Kato H, Kanda N, Pastene L, Cao Y, Fordyce R, Hasegawa M, et al. 2005. Mitochondrial phylogenetics and evolution of mysticete whales. Syst Biol. 54:77–90.

Schaeff CM, Kraus SD, Brown MW, Perkins JS, Payne R, White BN. 1997. Comparison of genetic variability of North and South Atlantic right whales (Eubalaena), using DNA fingerprinting. Can J Zool. 75:1073–1080.

Sepil I, Lachish S, Sheldon BC. 2013. Mhc-linked survival and lifetime repro-ductive success in a wild population of great tits. Mol Ecol. 22:384–396.

Shaw CN, Wilson PJ, White BN. 2003. A reliable molecular method of gen-der determination for mammals. J Mammal. 84:123–128.


Dow

nloaded from




15

Spielman D, Brook BW, Frankham R. 2004. Most species are not driven to extinction before genetic factors impact them. Proc Natl Acad Sci USA. 101:15261–15264.

Stern LJ, Brown JH, Jardetzky TS, Gorga JC, Urban RG, Strominger JL, Wiley DC. 1994. Crystal structure of the human class II MHC pro-tein HLA-DR1 complexed with an influenza virus peptide. Nature. 368:215–221.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673–4680.

Tsuji K, Aizawa M, Sasazuki T. 1992. Proceedings of the eleventh inter-national histocompatibility workshop and conference. Oxford: Oxford University Press.

Vassilakos D, Natoli A, Dahlheim M, Hoelzel AR. 2009. Balancing and directional selection at exon-2 of the MHC DQB1 locus among populations of odontocete cetaceans. Mol Biol Evol. 26:681–689.

Villanueva-Noriega MJ, Baker CS, Medrano-González L. 2013. Evolution of the MHC-DQB exon 2 in marine and terrestrial mammals. Immunogenetics. 65:47–61.

Waldick RC, Kraus S, Brown M, White BN. 2002. Evaluating the effects of historic bottleneck events: an assessment of microsatellite variability in the endangered, North Atlantic right whale. Mol Ecol. 11:2241–2249.

Wegner KM, Reusch TBH, Kalbe M. 2003. Multiple parasites are driving major histocompatibility complex polymorphism in the wild. J Evol Biol. 16:224–232.

Wilson PJ, Grewal S, Rodgers A, Rempel R, Saquet J, Hristienko H, Burrows F, Peterson R, White BN. 2003. Genetic variation and population struc-ture of moose (Alces alces) at neutral and functional DNA loci. Can J Zool. 81:670–683.

Winn HE, Price CA, Sorensen PW. 1986. The distributional biology of the right whale (Eubalaena glacialis) in the western North Atlantic. Report of the International Whaling Commission (Special Issue). 10:129–138.

Xiong Y, Brandley MC, Xu S, Zhou K, Yang G. 2009. Seven new dolphin mitochondrial genomes and a time-calibrated phylogeny of whales. BMC Evol Biol. 9:20.

Xu S, Chen B, Zhou K, Yang G. 2008. High similarity at three MHC loci between the baiji and finless porpoise: trans-species or convergent evolu-tion? Mol Phylogenet Evol. 47:36–44.

Xu S, Sun P, Zhou K, Yang G. 2007. Sequence variability at three MHC loci of finless porpoises (Neophocaena phocaenoides). Immunogenetics. 59:581–592.

Xu SX, Ren WH, Li SZ, Wei FW, Zhou KY, Yang G. 2009. Sequence polymor-phism and evolution of three cetacean MHC genes. J Mol Evol. 69:260–275.

Yang G, Yan J, Zhou K, Wei F. 2005. Sequence variation and gene duplica-tion at MHC DQB loci of baiji (Lipotes vexillifer), a Chinese river dolphin. J Hered. 96:310–317.

Yang WC, Chou LS, Hu JM. 2007. Molecular characterization of major his-tocompatibility complex class II DQB and DRB genes in bottlenose dol-phins (Tursiops truncates and T. aduncus) from the Western Pacific. Zool Stud. 46:664–679.

Yang WC, Chou LS, Hu JM. 2012. Sequence analysis of MHC class II genes in cetaceans. In: Abdel-Salam B, editor. Histocompatibility. InTech. Shanghai, China. ISBN: 978-953-51-0589-3. doi: 10.5772/35761. Available from: http://www.intechopen.com/books/histocompatibility/sequence-analysis-of- mhc-class-ii-genes-in-cetaceans.

Yang WC, Hu JM, Chou LS. 2008. Sequence variation of MHC class II DQB gene in bottlenose dolphin (Tursiops truncatus) from Taiwanese waters. Taiwania. 53:42–50.

Yang WC, Hu JM, Chou LS. 2010. Phylogenetic analyses of MHC class II genes in bottlenose dolphins and their terrestrial relatives reveal pathogen-driven directional selection. Zool Stud. 49:132–151.

Received July 1, 2013; First decision September 19, 2013; Accepted November 21, 2013

Corresponding Editor: C. Scott Baker


Dow

nloaded from

http://www.intechopen.com/books/histocompatibility/sequence-analysis-of-mhc-class-ii-genes-in-cetaceans





Documents

Journal of Heredity doi:10.1093/jhered/est095 or ...narightwhale.nrdpfc.ca/wp-content/uploads/2014/01/jan22014.pdf · a combination of cloning, direct sequencing, and auto-mated fluorescent