Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology

j ourna l homepage: www.e lsev ie r.com/ locate /y jmcc

Original article

Mesoangioblasts from ventricular vessels can differentiate in vitro into cardiacmyocytes with sinoatrial-like properties

Andrea Barbuti a,b,⁎, Beatriz G. Galvez c, Alessia Crespi a, Angela Scavone a, Mirko Baruscotti a,b,Chiara Brioschi a, Giulio Cossu c,d, Dario DiFrancesco a,b

a Department of Biomolecular Sciences and Biotechnology, The PaceLab, University of Milano, via Celoria 26, 20133 Milan, Italyb Centro Interuniversitario di Medicina Molecolare e Biofisica Applicata (CIMMBA), University of Milan, Italyc Stem Cell Research Institute, San Raffaele Hospital, via Olgettina, 20132 Milan, Italyd University of Milano, Department of Biology, via Celoria 26, 20133 Milan, Italy

⁎ Corresponding author. Department of BiomoleculUniversity of Milano, Via Celoria 26, 20133 Milan, Italy+39 02 50314932.

E-mail address: andrea.barbuti@unimi.it (A. Barbuti)

0022-2828/$ – see front matter © 2009 Elsevier Ltd. Adoi:10.1016/j.yjmcc.2009.10.006

a b s t r a c t

a r t i c l e i n f o

Article history:Received 17 June 2009Received in revised form 7 September 2009Accepted 2 October 2009Available online 22 October 2009

Keywords:Adult stem cellsMesoangioblastsPacemaker myocytesFunny currentHCN channels

Cardiac mesoangioblasts (MABs) are a class of vessel-associated clonogenic, self-renewing progenitor cells,recently identified in the post-natal murine heart and committed to cardiac differentiation. Cardiomyocytesgenerated during cardiogenesis from progenitor cells acquire several distinct phenotypes, corresponding todifferent functional properties in diverse structures of the adult heart. Given the special functional relevanceto rhythm generation and rate control of sinoatrial cells, and in view of their prospective use in therapeuticalapplications, we sought to determine if, and to what extent, cardiac mesoangioblasts could also differentiateinto myocytes with properties typical of mature pacemaker myocytes. We report here that a subpopulationof cardiac mesoangioblasts, induced to differentiate in vitro into cardiomyocytes, do acquire a phenotypewith specific mature pacemaker myocytes properties. These include expression of the HCN4 isoform ofpacemaker (“funny”, f-) channels and connexin 45 (Cx45), as well as reduced expression of inwardly-rectifying potassium channels. Furthermore, MAB-derived myocytes form agglomerates of pacing cellsdisplaying stable rhythmic activity, and as in native cardiac pacemaker cells, f-channel modulation byautonomic transmitters contributes to control of spontaneous rate in differentiated mesoangioblasts. Thesedata represent the first evidence for in vitro generation of pacemaker-like myocytes from proliferating non-embryonic stem/progenitor cells.

© 2009 Elsevier Ltd. All rights reserved.

1. Introduction

During cardiac embryogenesis, common early cardiac precursorsdifferentiate into diverse cardiovascular cell types according tospecific gene programs [1,2], and some of the transcriptionalnetworks whose activation is linked to specification of differentcardiomyocytes have been elucidated [3,4].

Study of embryonic stem (ES) cell differentiation, which recapi-tulates early cardiac development, has shown generation of multiplecardiac phenotypes from common progenitors [5,6]. Adult cardiacstem cells, on the other hand, generate cardiomyocytes of the workingmuscle [7], but their ability to give rise to multiple cardiac phenotypeshas not yet been demonstrated.

MABs are vessel-associated, progenitor cells originally isolated inthe embryonic aorta as clonogenic, self-renewing and multipotentcells [8]. Recently, similar cells have been identified in adult skeletal

ar Science and Biotechnology. Tel.: +39 02 50314941; fax:

.

ll rights reserved.

[9] and cardiac muscle [10], where they were shown to differentiatemainly to skeletal and cardiac myocytes, respectively.

In this latter study, we have shown that ventricle-derived and aorta-derived MABs can differentiate spontaneously into contracting cardio-myocytes expressing cardiac-specific proteins and ion channels. Duringdevelopment cardiac precursors acquire different phenotypes, withspecific functional features [11–13]. An important distinction existsbetween cells of the cardiac pacemaker/conduction tissue, whosecontribution is mainly electrical (i.e. generation and propagation of theaction potential) and theworkingmyocardium, whosemain function isto respond to electrical stimuli with a contraction.

An obvious question arising from the finding that cardiac MABsexpress typical cardiac progenitor markers and have a high prolifera-tive potency, is whether their differentiation gives rise to multiplecardiac phenotypes. We specifically asked if, and to what extent,MABs could differentiate into cardiomyocytes with a maturepacemaker/conduction tissue phenotype. Our investigation wasprompted by the preliminary observation that spontaneous activitywas often seen to arise in a fraction of differentiating MABs.

We found that in both ventricle-derived and aorta-derived MABclones, expanded under suitable culture conditions and driven to

416 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

differentiate in vitro into cardiomyocytes, a subpopulation of cellsdoes possess features typical of mature pacemaker myocytes, such asspontaneous electrical activity, expression of HCN channels andconnexin 45 (Cx45) and lack of the inward rectifying IK1 current.

2. Materials and methods

2.1. Isolation and expansion of stem cells from murine ventricular vessels

The methods used for the identification, isolation, expansion ofcardiacmesoangioblastswere as previously described [10]. Briefly, 2- to4-week-old C57 mice were sacrificed and the hearts quickly removed.Ventricles were kept in DMEM without FCS and cut into small piecesincluding large vessels. Pieces were placed in 1% gelatin B (Sigma)-coated 35 mm petri dishes and kept in DMEM solution supplementedwith 20% FBS, 5 mmol/L L-glutamine and 100 U/mL penicillin,0.07 mmol/L streptomycin at 37 °C (5% CO2). After 2–3 weeks, on topof a layer of fibroblast–like cells, small, round, phase-bright cells wereidentifiable. These cells were collected and progressively expanded asseparate clones in 10% FBS-DMEMmaintaining medium.

All experimental protocols conformed to guidelines for the careand use of laboratory animals as established by State (D.L. 116/1992)and European directives (86/609/CEE).

2.2. Differentiation

Spontaneous differentiation was induced by lowering serum (FCS)concentration in the growth medium (DMEM) from 10% to 2%. After5 days of culture in differentiating medium most clones showed a highdegree of cardiac differentiation based on myosin staining, and a fewclones displayed several foci of spontaneously beating cells. Twoventricle-derived clones (dubbed J2, J8) and an aorta-derived clone (I4)were selected for further analysis due to their high rate of differentiationinto autorhythmic cells; all data presented here refer to these clones.

2.3. RT-PCR analysis

RT-PCR analysis was carried out in both undifferentiated anddifferentiated MABs; in the latter case cells were kept in differenti-ation conditions for at least 5 days and the appearance ofspontaneously beating cells assessed under the microscope beforeRNA isolation. Total RNA was isolated with TRIzol protocol (Invitro-gen, Carlsbad, CA) and reverse transcribed (Platinum Taq DNApolymerase, Invitrogen). RT-PCR was performed using primers andconditions as described previously [10]. Forward and reverse primersused for Tbx3 were CCCGAAGAAGAGGTGGAGGACGAC and GATGGA-GACAGCAGGAGAGGAT, respectively.

2.4. Plasmid preparation and cell transfection

GATA-6 is a transcription factor activated early during cardiogen-esis in vertebrates [14,15]. An upstream regulatory element of thisgene (GATA-6 enhancer) becomes active prior to formation of thelinear heart tube and is inactivated in prospective ventricular cellsprior to E9.5 [14]. Although there is a low degree of homologybetween the 1.5-kb sequence of the chicken GATA-6 enhancer and themouse genome, previous work has demonstrated that the regulatorymechanism underlying cardiac restricted expression is conservedbetween chicken and mouse [14–16]; expression of the reportergenes LacZ or GFP driven by the chicken GATA-6 enhancer specificallyhighlights the developing atrioventricular conduction system in vivo,in transgenic mice [14,15] or in vitro, in mouse ES cell-derivedpacemaker cells [17].

The chicken GATA-6 (cGATA-6) proximal enhancer sequence wasexcised using SalI/BamHI from the vector pPD46.21 and inserted,using the same restriction enzymes, into the MCS of the pEGFP-N1

vector (Invitrogen). The constitutive promoter PCMV was thenremoved (AseI/XhoI) to obtain the promoterless cGATA-6/GFP vector.

Undifferentiated cardiac mesoangioblasts were transfected bylipofectamine reagents (following manufacturer instructions) withthe GATA6-GFP vector. Since GFPwould be expressed only in cells thatactively transcribe the GATA-6 gene, cells were co-transfected withthe pIREs2a-DsRed2 plasmid in order to evaluate transfectionefficiency.

2.5. Immunofluorescence and confocal analysis

For immunofluorescence analysis, cells were grown onto 1%gelatin-coated glass coverslips and fixed in formaldehyde (4%) for10min on ice, and then rinsed for 20minwith PBS containing 0.1mol/Lglycine. The cells were permeabilized in PBS solution containing 1%BSA and 0.3% Triton X-100 and incubated overnight at 4 °C withprimary antibodies (anti-myosin slow 1:500, Sigma; anti-GATA-61:100, Abcam; anti-connexin 43 1:50, Chemicon; anti-connexin 451:50, Chemicon; anti-HCN1-4, 1:100, Alomone Labs, anti-β1 and anti-β2 adrenergic receptors 1:200 and anti-muscarinic M2 receptors1:200, Santa Cruz). Coverslips were thenwashed in PBS and incubatedfor 1 hour with fluorophore-conjugated secondary antibodies (antimouse-TRITC, anti rabbit-FITC, 1:1000, Molecular Probes; anti mouse-Cy5, 1:1000, Chemicon). When needed, rhodamin–phalloidin (1 U/coverslip, Molecular Probes) was added and the cells were incubatedfor 30 min at room temperature. Primary and secondary antibodieswere diluted in PBS. After a final washout with PBS, coverslips weremounted with Vectashield mounting medium with DAPI (Vector).Fluorescence staining was analyzed by Video Confocal microscopy(ViCo Nikon). To test whether HCN2 and HCN1 antibodies werefunctional, controls were performed in CHO cells transfected with themouse HCN2 isoform and in murine ES cell-derived cardiomyocytes,respectively, and results were positive; control experiments withsecondary antibodies only were also carried out for all types ofantibodies used, and resulted in no staining (data not shown).

2.6. Electrophysiology and data analysis

Action potentials were recorded from uniformly beating cellagglomerates or single cells superfused with Tyrode solution contain-ing (mmol/L): 140 NaCl, 5.4 KCl, 1.8 CaCl2, 1 MgCl2, 5.5 D-glucose, 5Hepes-NaOH; pH 7.4. Temperature was 36 °C. Patch-clamp pipetteshad resistances of 3–6 MΩ when filled with an intracellular-likesolution containing (mmol/L) 130 K-aspartate, 10 NaCl, 5 EGTA-KOH,2 CaCl2, 2 MgCl2, 2 ATP (Na-salt), 5 creatine phosphate, 0.1 GTP (Na-salt), 10 Hepes-KOH; pH 7.2. Isoproterenol and acetylcholine (Sigma)were added to the Tyrode solution at the desired concentration fromconcentrated stock solutions (1 mmol/L).

For single-cell voltage-clamp experiments, MABs-derived cardio-myocyteswere dispersed by trypsin, plated at a low density on 35mmgelatin (1%)-coated petri dishes and allowed to settle overnight. Thefollowing day, cells were placed on the stage of an invertedmicroscope and superfused with Tyrode solution at 36 °C. To betterdissect the If current, 1 mmol/L BaCl2 and 2 mmol/L MnCl2 wereadded to normal Tyrode during voltage-clamp recordings.

If was activated by hyperpolarizing test steps to the range−45/−125mV from a holding potential of−35mV, followed by 1.5 s steps to−125 mV for full activation [18]. Each test step was long enough toreach steady-state current activation. Normalized tail currentsmeasured at −125 mV were used to plot activation curves, whichwerefitted to the Boltzmanndistribution:y=(1/(1+exp((V−V1/2)/s),whereV is voltage,y fractional activation,V1/2 the half-activation voltage,and s the inverse-slope factor. Time constants of current activation wereobtained by fitting current traceswith a single exponential function afteran initial delay. Fully-activated current–voltage relations were obtainedas previously described [18].

Fig. 1.MABs of the J2 clone express cardiacmarkers. RT-PCR analysis of undifferentiated(U) and differentiated (D) MABs of the J2 clone showing expression of markers of earlycardiac differentiation and of the housekeeping gene β-tubulin. Data from RT-PCRanalysis of RNA extracted frommature cardiomyocytes (CMC), undifferentiated ES cells(ESC), fibroblasts and human microvascular endothelial cells (HMEC) were included inthe analysis as positive or negative controls.

417A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Shifts of the If activation curve induced by neurotransmitters wereobtained by a previously described protocol [19].

The inwardly rectifying K+ current (IK1) was measured as theBa2+ -sensitive current andwasobtainedby applying 4 s voltage rampsin the range−100/−25mV, fromaholdingpotential of−80mV,withand without 2 mmol/L BaCl2 in the extracellular solution.

2.7. Flow cytometry

MABs co-transfected with the cGATA-6/GFP and pIREs2a-DsRed2plasmid vectors (see above) were detached with PBS containing5 mmol/L EDTA and analyzed in a FACSCalibur flow cytometer(Becton Dickinson) as previously described [10].

3. Results

3.1. Identification of a subpopulation of cardiac mesoangioblasts withsinoatrial-like/conduction tissue markers

We have reported previously that mesoangioblasts isolated fromventricular vessels can differentiate in vitro into cardiomyocyteseither when co-cultured with newborn ventricular myocytes orspontaneously, when the serum concentration in the culture mediumis lowered [10].We noticed that with certainMAB clones, switching tolow serum differentiating medium induced in most cells a change ofmorphology accompanied by the appearance of several foci ofspontaneous activity. Although we concentrated our analysis on aparticular ventricle-derived clone (dubbed J2), sinoatrial-like prop-erties were also investigated in two additional clones, a ventricle-derived clone (J8) and an aorta-derived clone (I4).

We have previously reported that MABs express both stem cellmarkers and early cardiac markers [10]; here we have confirmed thatboth undifferentiated (Fig. 1U) and spontaneously differentiated (Fig.1D) J2 MABs express several early cardiac markers such as Nkx2.5,GATA-4, TBX5, Cx43 and ANF. They express also the transcriptionfactors GATA-6, ISL-1 and TBX2, known to be specifically involved inearly phases of the cardiac conduction system differentiation [2,14–17,20,21] and TBX3, a transcriptional repressor that specificallydelineates the SAN and the conduction system during heartdevelopment [3].

For all transcripts, RT-PCR control runs were carried out also incardiomyocytes (CMC) and ES cells (ESC). Furthermore, RT-PCRanalysis of transcripts (Nkx2.5, GATA-6 and TBX2) expressed in all theabove cell types was performed also onmurine fibroblasts and humanmicrovascular endothelial cells (HMEC) as negative controls.

Figs. 2A–D show phase contrast (A) and immunofluorescencesections (B–D) of representative undifferentiated (left) and differen-tiated MABs (right).

While myosin (red) is not expressed in undifferentiated cells, itforms a contractile system organized in striated, sarcomeric-likestructure in cells after differentiation (Fig. 2B). As shown in Fig. 2C,the Cx43 protein (cyan) was not expressed to a detectable level inundifferentiated cells but was widely expressed in differentiatedMABs. Enlargements shown in panel D show that the actincytoskeleton (red) was not organized in sarcomeric structures inundifferentiated MABs, while differentiated cells presented a welldeveloped sarcomeric structure and a strong Cx43 signal localizedto membrane regions delimiting contact areas between adjacentcells.

To verify the presence of a subpopulation of MABs committed todifferentiate into sinoatrial-like/conduction tissue myocytes, cellswere labelled with an anti-GATA-6 antibody and with phalloidin.Fig. 3 shows that a fraction of cells displayed GATA-6 staining(green) both before (Fig. 3A) and after differentiation (Fig. 3B); asexpected GATA-6 staining was localized mostly in nuclei and afterdifferentiation, it was expressed in cells which had developed an

organized sarcomeric structure (red). On average, the fractions ofundifferentiated (28.2±10.2%, n=4 independent experiments) anddifferentiated (30.0±4.1%, n=4 independent experiments) MABspositive for GATA-6 staining were not significantly different(Student t-test).

Expression of GATA-6 in a fraction of cells was further confirmedby co-transfecting undifferentiated cells with a plasmid containing anenhancer region of the GATA-6 gene driving GFP expression (GATA-6/GFP, see also Materials and methods) and a control plasmid whichconstitutively expresses the DsRed fluorescent protein. Flow-cyto-metry analysis indicated that about 27% of transfected cells expressedGFP (Fig. S1) as shown in a representative confocal image in Fig. 3C.Furthermore, some GFP-positive transfected MABs could acquirespontaneous activity when grown in differentiating medium (Sup-plementary video 1).

These data support the hypothesis that a subpopulation of cardiacMABs is committed to differentiate towards a mature pacemaker/conduction tissue phenotype. Cells displaying spontaneous activitywill be referred to below as Mesoangioblast-derived PacemakerCells (Md-PCs).

3.2. Properties of If current expressed by Md-PCs

To determine the electrophysiological properties of Md-PCs,single cells or small cell agglomerates showing spontaneous activitywere investigated by patch-clamp analysis. Spontaneous activityrecorded from isolated Md-PCs revealed action potentials charac-terized by a clear slow “diastolic” depolarization phase (Fig. 4A and

Fig. 2. Properties of differentiated vs. undifferentiated MABs. (A) Morphology ofundifferentiated (left) and differentiated cardiac MABs (right) in phase contrastimages. Undifferentiated cells were small and elongated, while differentiated cells werebigger and had an irregular shape. (B–D) Single confocal immunostaining sections.Differentiated MABs displayed an organized contractile system visible by staining formyosin (red, B) and F-actin (labelled with rhodamine-conjugated phalloidin, red, D)and expressed Cx43 in regions of cell-to-cell contact (cyan, C). Neither an orderedcontractile system nor Cx43were expressed in undifferentiatedMABs (B–D left). Nucleilabeled by DAPI (blue) in all sections. Bars 20 μm in A to C, 10 μm in D.

418 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Supplementary video 2) typical of sinoatrial myocytes [22]. Sincesinoatrial myocytes are characterized by the expression of thepacemaker “funny” (If) current, we investigated the presence andthe properties of this current in Md-PC derived from the J2 and J8ventricle-derived clones and from the I4 aorta-derived clone. In Fig.4B, the If current was recorded from the same cell shown in Fig. 4Aduring a protocol used to measure the voltage-dependence ofactivation (range −35/−125 mV). The If current was recorded in allspontaneously beating Md-PCs showing a clear pacemaker depolar-ization phase (n=10).

Analysis from n=16 cells from clone J2 yielded a mean Ifactivation curve with a half activation voltage (V1/2) of −72.5±2.1 mV and an inverse slope factor of 7.7±0.5 mV when fitted to aBoltzmann distribution curve (Fig. 4C). The mean time constant of

activation was 756±107 ms at −85 mV (n=16) and was stronglyvoltage-dependent (Fig. 4D). Taking into account that reported valuesof If kinetics are subject to large variability, the kinetics recorded inMd-PCs were in a range compatible with data in SAN tissues fromdifferent species [23], although they differed slightly from publishedmurine SAN data [24]. The mean fully-activated I/V relation (Fig. 4E)was approximately linear in the range −115 to −5 mV with areversal potential of −17.5 mV, in agreement with data from SANrecordings [18]. The If current of Md-PCs was blocked by extracellularCs+ (2 mmol/L CsCl), a known blocker of native f- and HCN channels[18] (not shown).

The mean cell capacitance of Md-PCs was 91.2±8.8 pF and the Ifcurrent density measured at −115 mV was 3.1±0.5 pA/pF (n=16),a value lower than that reported in murine SANmyocytes (18±9 pA/pF as mean±SD at −120 mV; cell capacitance 24±2 pF) [24].

Analysis of If current recorded from spontaneously beating J8 andI4 MABs yielded a mean V1/2 of −74.3±3.3 (n=3) and −71.3±4.5 mV (n=5) and mean current densities of 2.9±0.6 (n=4) and2.1±0.4 pA/pF (n=5), respectively; values not different from thoseof clone J2. Interestingly, differentiated MABs presenting a stableresting potential but able to fire action potentials when electricallystimulated, were characterized by a significantly smaller If density(0.25±0.2 pA/pF at −115 mV, n=8; pb0.05) than Md-PCs. Meancell capacitance of these quiescent cells was 33.9±5.3 pF, a valuesignificantly smaller than that of Md-PCs, providing further evidencethat Md-PCs represent a distinct population of MABs-derivedmyocytes. We did not find evidence for any detectable If current inundifferentiated MABs (n=13).

3.3. Identification of HCN isoforms expressed by Md-PCs

In order to identify themolecular components of f-channels inMd-PCs, we investigated the expression of all four HCN isoforms (HCN1-4)by immunofluorescence staining. In Fig. 5, representative singlesections of Md-PCs labelled with anti-HCN1–4 antibodies are shown(A to H).

Signals of either HCN1 or HCN2 isoforms were never observed atdetectable levels (Figs. 5A, B, E and F), and signals of HCN3 weredetected in only a few cells (Figs. 5C and G). On the other hand, wedetected strong membrane signals of HCN4 (Figs. 5D and H) in 27% ofcells (39 out of 142). HCN staining was only detected in those Md-PCswhich expressed an organized contractile system, as verified by F-actin staining (red in Figs. 5E–H). Control immunofluorescenceexperiments using the secondary antibodies only were run to testsignal specificity; furthermore, controls were also performed bytransfecting HEK or CHO cells with HCN1 and HCN2 channels, whichconfirmed the efficiency of anti HCN1 and HCN2 antibodies (data notshown). According to electrophysiological data, we did not findexpression of any HCN isoforms in undifferentiated MABs (data notshown). These data clearly indicate that HCN4 is the main HCNisoform in differentiated MABs.

In Fig. 5D above we have shown that HCN4 is the most highlyexpressed isoform in differentiated MABs. HCN4 is the main isoformexpressed in the cardiac pacemaker tissues of different species[25,26], and is considered as a marker of SAN differentiation[3,27,28]. We therefore investigated whether there is a correlationbetween expression of HCN4 and GATA-6 in Md-PCs. An analysisconducted in differentiated MABs by double staining with anti-HCN4and anti-GATA-6 antibodies revealed that in n=102 cells, 28 out of34 cells expressing GATA-6 (red) also expressed HCN4 (green)(82.4%; see representative cell in Fig. 6A), while of the remaining 68GATA-6 negative cells, one only expressed HCN4 (1.5%, not shown).This indicates that HCN4 is expressed essentially only within theGATA-6 positive subpopulation. These data further support theevidence for a subpopulation of MABs with a sinoatrial-like/conduction tissue phenotype.

Fig. 3. A subpopulation of MABs expresses GATA-6. Single confocal sections of MABs showing GATA-6 staining (green, right) in a fraction of both undifferentiated (A) anddifferentiated cells (B); in the latter case, GATA-6 was expressed in cells with a developed sarcomeric structure; F-actin (Phalloidin) is shown in red. (C) Single confocal image ofMABs co-transfected with c-GATA-6/GFP and pIREs2a -DsRed2 vectors (red, left) showing that in a portion of cells the GATA-6 enhancer was active (green, right). Nuclei labeled byDAPI (blue) in all sections. Bars 20 μm.

419A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

3.4. Lack of IK1 current and expression of connexin 45

Additional properties typical of pacemaker cells of the SAN are theexpression of Cx 45 [29,30] and the lack of the inwardly rectifying K+

current (IK1). While Cx43 is the most abundant connexin isoformexpressed in the heart, the cardiac conduction tissue and specificallythe SAN tissue expresses, among others, the low-conductance isoformCx45 [31–33]. As illustrated in Fig. 6B, differentiated MABs werepositive for anti-Cx45 antibodies (cyan) in regions of contact amongadjacent cells displaying a clear sarcomeric structure (red). No Cx45signal was detected in undifferentiated cells (not shown). We alsofound no evidence for Cx40, a connexin isoform typical of atrial tissue[3,33,31], in either undifferentiated or differentiated cells (notshown).

Lack of IK1 keeps sinoatrial cells at relatively depolarized voltages,such that a moderate activation of If provides the inward current flownecessary for normal diastolic depolarization to develop.

We therefore evaluated whether expression of If and IK1 wereinversely correlated. In Figs. 6C, D representative current tracesrecorded by a ramp protocol in the range−100 to−25 mV in Tyrodeand during perfusion of 2 mmol/L Ba2+ from a Md-PC not expressing(C, left) or expressing If (D, left) are shown. Mean I/V relations for IK1in Md-PCs expressing no If (C, right) and in Md-PCs expressing If (D,right) show a clear difference in current density; at−100mV this was−1.93±0.49 (n=10) and −0.175±0.04 pA/pF (n=5) in cellswithout (C) and with If (D), respectively (significantly different,pb0.05). The IK1 density in cells not expressing If was close to that

previously reported in cardiac MABs (−2.4 pA/pF at −100 mV)[10].

3.5. Spontaneous activity and autonomic modulation of rate

A fundamental function of cardiac pacemaker cells is ratemodulation by neurotransmitters. A major role in mediating auto-nomic rate control is played by cAMP-dependent modulation off-channels [34]. To verify whether in Md-PCs spontaneous rate ismodulated, action potentials were recorded from rhythmically andsynchronously contracting cell agglomerates whose rates were stablefor longer than one minute. Cells were superfused with the controlsolution to which either isoproterenol (Iso, 1 μmol/L) or acetylcholine(ACh, 0.1 μmol/L) were added. In Figs. 7A, B (upper panels),superimposed action potentials recorded from two representativeMd-PC clumps before (solid line) and during agonist stimulation(dashed line) are shown as indicated. The mean percent changes ofrate, relative to control, were +32±8.2% (Iso 1 μmol/L, n=7) and−7.3±2% (ACh 0.1 μmol/L, n=4); both changes were significant(pb0.05).

To determine the If contribution to neurotransmitter-mediatedrate changes, we investigated the actions of Iso and ACh on If byapplying hyperpolarizing two-step protocols as in Figs. 7A, B (lowerpanels). Iso (1 μmol/L) increased If during the first step (to mid-activation voltage) but decreased it during the second step (to full-activation voltage) as expected for a positive shift of the activationcurve with no substantial alteration of the fully activated current [18];

Fig. 4. Spontaneous activity of Md-PCs and expression of the funny current. (A)Spontaneous pacemaker-like action potentials recorded from anMd-PC showing a clear“diastolic” depolarization phase in the approximate range −65 to −55 mV. Thefrequency in this cell calculated over a period of 30 s was 126 bpm. (B) If current tracesrecorded from the same cell during a protocol for measurement of the activation curve,consisting of hyperpolarizing steps from a holding potential of −35 mV to the range−45/−125 mV, followed by a fully activating step to −125 mV (see Materials andmethods). (C) Mean If activation curve; individual curves (n=16 cells) were fitted tothe Boltzmann equation and averaged, and mean V1/2 and s parameters used to plot thebest fitting curve (full line, values in text). (D) Mean voltage dependence of timeconstants of activation from n=14 cells. (E) Mean fully-activated I/V relation of Ifcurrent density (normalized to cell capacitance) from n=6 cells; linear regression (fullline) yielded a reversal potential of −17.5 mV and a conductance of 0.0327 mS/μF.

420 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

ACh had the opposite action, indicating a negative shift of theactivation curve [35]. Mean shifts of the If activation curve were6.0±0.5 mV (n=6) and −4.4±0.2 mV (n=5) for 1 μmol/L Iso and0.1 μmol/L ACh, respectively.

These data show that rate of electrically coupled Md-PCs can bemodulated by autonomic agonists, implying that at this stage ofdifferentiation, Md-PCs already possess the functional signal trans-duction pathways necessary for a physiological control of heart rate.

Expression of β-adrenergic and muscarinic receptors able tocouple adrenergic and cholinergic transmitters to f- channels wasverified by immunolocalization analysis. In Fig. S2A-C, single confocalsections from differentiated MABs show that β1 and β2 adrenergicand M2 muscarinic receptors are all expressed.

4. Discussion

Cardiac MABs are vessel-associated clonogenic, self-renewableprogenitor cells committed to cardiac differentiation [10]. Whencultured in low-serum medium, these cells differentiate intocardiomyocytes that express typical cardiac ion channels [10].Distinctive features of cardiac MABs, not previously described inother adult cardiac stem cells, are the co-expression of earlyendothelial (CD34, CD31), pericyte (alkaline phosphatase, NG2,smooth α actin) and cardiac markers (Nkx2.5, GATA-4) and the

high spontaneous rate of cardiac differentiation of these progenitorswhich allows the prospective use of these cells for systemic deliveryand in vivo transplantation. Whether this means that cardiac MABsrepresent newly discovered progenitors or that they represent adifferent developmental stage of a more undifferentiated cell type isat the moment difficult to establish. Indeed, the various cardiacprogenitors so far isolated are characterized by a high phenotypicvariability, possibly related to differences in isolation protocols andculture conditions.

Upon differentiation, cardiac MABs often displayed spontaneousactivity suggesting that at least a fraction of these cells becomepacemaker myocytes, capable of self-generating action potentials.During normal cardiac development, progenitor cells committed tobecome mature pacemaker myocytes appear as early as at embryonicday E7.5 and then develop further to form the mature sinoatrial node(SAN) and conduction system [36]. The proper development andpreservation of these structures is essential since mice lackingtranscription factors specifically involved in the development of theSAN, present severe cardiac morphological and functional abnormal-ities (hypoplastic SAN and severe bradycardia) and die before birth[37,38].

As a means to identify sinoatrial-like MABs, we proceeded to firstverify the expression of conduction tissue-specific markers, and thento characterize the electrophysiological properties of beating cells.

Cardiac MABs express several factors involved in early cardiacdifferentiation (see also[10]); among these, factors such as ISL-1,TBX2, TBX3, GATA-6 are especially relevant to the development of theSAN and cardiac conduction system [2,3,14,15,17,39].

ISL-1 controls the differentiation of cells of the second heart fieldduring heart development; ISL-1+ cells differentiate into manycardiac cell types and contribute significantly to the formation ofthe SAN [2,40]. It is important to note also that ISL-1+ cells persist ascardiac precursors in the postnatal heart [13,41].

TBX2 and its homologous TBX3 are transcriptional repressorswidely expressed in cardiac precursors. During development, TBX3 isexpressed only in regions committed to form the SAN/conductionsystem, and is downregulated elsewhere. Interestingly, ectopicexpression of TBX3 can induce pacemaker properties in atrialmyocytes [37].

We used GATA-6, which marks the cardiac conduction system[14,15,17], to identify a subpopulation of cardiac MABs geneticallypredisposed to become pacemaking cells. About 28% of undifferenti-ated and 30% of differentiated MABs expressed this transcriptionfactor. Undifferentiated MABs were also transfected with a constructcarrying the GFP gene under the cGATA-6 proximal enhancer. FACSanalysis of transfected cells yielded a 27% of GFP-positive cellsconfirming the presence of a viable subpopulation of GATA-6 positivecells (Supplementary video 1). The fact that the fraction of GATA-6+

cells is similar to that of differentiated MABs expressing thepacemaker current If (34.5%) or the HCN4 isoform (27%), confirmsthat about one third of all MABs are precursors committed todifferentiation towards a sinoatrial-like phenotype.

Synchronous beating of cell agglomerates is possible only if cellsare electrically coupled by gap junction-forming connexins. In themammalian heart, the threemost highly expressed connexin isoformsare Cx43, Cx45 and Cx40. Cx43 is widely expressed throughout theheart; Cx40 is expressed abundantly throughout atria and theventricular conduction system while Cx45 is highly expressedspecifically in the SAN and conduction system [31–33]. We found byimmunofluorescence analysis that differentiated cardiac MABs ex-press both Cx43 and Cx45 (Figs. 2, 6) but not Cx40 (data not shown).While RT-PCR data indicate the presence of Cx43 (see Fig. 1), nostaining was detected, in undifferentiated cells, for this or any of theabove connexin isoforms, suggesting that Cx43 expression is eitherunder the level of detection or is prevented by cellular mechanismscontrolling mRNA processing.

Fig. 5. Expression of HCN isoforms in Md-PCs. (A–D) Single-section confocal images of Md-PCs labelled with anti-HCN1, HCN2, HCN3 and HCN4 antibodies, as indicated (green).(E–H) Higher magnification images of Md-PCs co-labeled with anti-HCNs antibodies and phalloidin or anti-myosin antibodies (red), to show sarcomeric structures. HCN1 and HCN2stainings were never observed and the HCN3 signal was detected rarely. The HCN4 signal was strong and distributed in spots on cell membranes in a substantial fraction of cellsanalysed (39 out of 142). Bars 20 μm.

421A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

Along with the marker expression data discussed above, electro-physiological analysis also provided evidence for sinoatrial-likeproperties in a subpopulation of cardiac MABs.

Hallmarks of cardiac pacemaker myocytes from the SAN are actionpotentials with a phase 4 depolarization, the lack of IK1 current andthe functional expression of the pacemaker current If [18,22,29]. Wefound that single cells retaining rhythmic activity after enzymaticdissociation from differentiated MAB cultures (Md-PCs) are charac-terized by SAN-like action potentials with a clear phase 4 depolariza-tion (Fig. 4). A large fraction of spontaneously beatingMd-PCs (68.3 %)expressed the If current; furthermore, cells expressing If showed asignificantly reduced IK1 current. Kinetic properties of If recorded inMD-PCs are similar to those of If recorded from ES cell-derivedpacemaker-like cells [42] and from HCN4-transfected COS cells [43]under similar experimental conditions; these data, together with

immunostaining data on the expression of HCN isoforms, indicate thatHCN4 is the main isoform contributing to the If current in MD-PCs,with small or no contributions from the other HCN isoforms. A furtherconfirmation that Md-PCs represent a distinct peculiar population ofmyocytes comes from capacitance data which clearly show that Md-PCs are significantly bigger than quiescent MABs (91.2 vs. 33.9 pF,respectively).

The detailed analysis of HCN subunit distribution revealed thatdifferentiated MABs express mostly HCN4, the predominant isoformin the SAN of several species [19,25–28,30]. Since HCN4 is expressedvery early during cardiac development/differentiation in the pro-genitors which also express the transcription factors TBX3, ISL-1 andGATA-6 [3,17,36,40] and since our data show a strong correlationbetween the expression of HCN4 and GATA-6, we can conclude thatthe subpopulation of GATA-6+ MABs are effectively committed to

Fig. 6. Sinoatrial-like features ofMd-PCs. (A) RepresentativeMd-PC showing coexpression of HCN4 (green) and GATA-6 (red). (B) Single-section image ofMd-PCs labelledwith the anti-Cx45 antibody (cyan). Staining was localized to the region of contact between adjacent cells; the sarcomeric structure was detected by phalloidin staining (red). In all panels nuclei werelabelled with DAPI (blue). Bars, 20 μm. (C, D) Left panels show plots of membrane currents recorded upon application of a ramp protocol (see Materials and methods) before and duringperfusion with 2 mmol/L Ba2+ from a representative Md-PC expressing no If (C) and from one expressing If (D). Right panels show mean steady-state I–V relations of the Ba-sensitiveinwardly rectifying current (IK1) obtained from n=10 If -laking (C) and n=5 If -expressing cells (D). Average data are plotted as mean±SEM values (dotted lines).

422 A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

acquire a sinoatrial-like phenotype, and upon differentiation expressmolecular features typical of these cells.

β-adrenergic receptors stimulation activated If by shifting thecurrent activation voltage-dependence to more positive voltages and

Fig. 7. β- adrenergic and muscarinic cholinergic modulation of spontaneous activity and If in MMd-PCs before (solid line) and during superfusion of 1 μmol/L isoproterenol (A, dashed line) orprotocol consisting of a 4.4 s step to−70mV, activating approximately 50% of the current, follodecreased it at−125mV, leaving unaltered the fully-activated current; this demonstrates thatthe If conductance [18,34]. (B) Lower panel: in the same cell, an identical protocol showed tha

correspondingly accelerated the rate of spontaneously beating Md-PCs, while muscarinic stimulation had the opposite effect on If andslowed spontaneous rate. These effects are analogous to those exertedby If-mediated autonomic modulation of SAN rate [18,22,34], and

d-PCs. (A, B) Action potentials (top panels) and If current (bottom panels) recorded from0.1 μmol/L acetylcholine (B, dashed line). (A) Lower panel: If was activated by a two-stepwed by a 1-s step to−125mV to activate the current fully. Iso increased If at−70mV butIso activates If by shifting the activation curve tomore positive voltageswithoutmodifyingt ACh inhibits If by a negative shift of the activation curve [35].

423A. Barbuti et al. / Journal of Molecular and Cellular Cardiology 48 (2010) 415–423

suggest that Md-PCs possess the whole cellular machinery involved inthe physiological response of pacemaker channels to neurotransmit-ter stimulation. In agreement with this hypothesis, immunofluores-cence data confirmed the expression of β1-, β2- and muscarinic M2-receptors on the membrane of Md-PCs (Fig. S2).

In conclusion, vessel-derived mesoangioblasts represent the firstnon-pluripotent stem/progenitor cell shown to differentiate intodifferent cardiac phenotypes; here in particular we have characterizeda subpopulation of MABs (Md-PCs) which spontaneously differentiateinto sinoatrial-like myocytes. The expression of HCN channels under-lying spontaneous activity and the sensitivity to autonomic modulationof rate are features especially suitable to a potential use of these cells as asubstrate for developing biological pacemakers. However some ques-tions related toMD-PCs suchas thepossibility to isolate them fromothercardiomyocytes, the long-term stability of the MD-PCs phenotype andthe absence of proliferation after cell differentiation need furtherevaluation. Moreover, the possibility to isolate mesoangioblast fromhuman heart biopsies is a required element for a prospective use of thiscell substrate as a therapeutic tool.

Acknowledgments

The chicken GATA-6 (cGATA-6) proximal enhancer sequence waskindly provided by Dr Burch, Fox Chase Cancer Center, Philadelphia,PA.

This work was supported by grants from Cariplo Foundation (1451/10.4878), EU (Normacor CT2006-018676) and MIUR (RBLA035A4X;2006055828) to DD, and from EU (Heart repair CT2005-018630),Leducq Foundation and MIUR (2005058334) to GC.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.yjmcc.2009.10.006.

References

[1] Cheng G, Litchenberg WH, Cole GJ, Mikawa T, Thompson RP, Gourdie RG.Development of the cardiac conduction system involves recruitment within amultipotent cardiomyogenic lineage. Development 1999;126:5041–9.

[2] Moretti A, Caron L, Nakano A, Lam JT, Bernshausen A, Chen Y, et al. Multipotentembryonic isl1+ progenitor cells lead to cardiac, smooth muscle, and endothelialcell diversification. Cell 2006;127:1151–65.

[3] Mommersteeg MT, Hoogaars WM, Prall OW, Gier-de Vries C, Wiese C, Clout DE,et al. Molecular pathway for the localized formation of the sinoatrial node. Circ Res2007;100:354–62.

[4] Srivastava D, Ivey KN. Potential of stem-cell-based therapies for heart disease.Nature 2006;441:1097–9.

[5] Hescheler J, Fleischmann BK, Lentini S, Maltsev VA, Rohwedel J, Wobus AM, et al.Embryonic stem cells: a model to study structural and functional properties incardiomyogenesis. Cardiovasc Res 1997;36:149–62.

[6] Kattman SJ, Adler ED, Keller GM. Specification of multipotential cardiovascularprogenitor cells during embryonic stem cell differentiation and embryonicdevelopment. Trends Cardiovasc Med 2007;17:240–6.

[7] Kajstura J, Urbanek K, Rota M, Bearzi C, Hosoda T, Bolli R, et al. Cardiac stem cellsand myocardial disease. J Mol Cell Cardiol 2008;45:505–13.

[8] Minasi MG, Riminucci M, De Angelis L, Borello U, Berarducci B, Innocenzi A, et al.The mesoangioblast: a multipotent, self-renewing cell that originates from thedorsal aorta and differentiates into most mesodermal tissues. Development2002;129:2773–83.

[9] Dellavalle A, Sampaolesi M, Tonlorenzi R, Tagliafico E, Sacchetti B, Perani L, et al.Pericytes of human skeletal muscle are myogenic precursors distinct from satellitecells. Nat Cell Biol 2007;9:255–67.

[10] Galvez BG, Sampaolesi M, Barbuti A, Crespi A, Covarello D, Brunelli S, et al. Cardiacmesoangioblasts are committed, self-renewable progenitors, associated withsmall vessels of juvenile mouse ventricle. Cell Death Differ 2008;15:1417–28.

[11] Boyett MR, Honjo H, Kodama I. The sinoatrial node, a heterogeneous pacemakerstructure. Cardiovasc Res 2000;47:658–87.

[12] Buckingham M, Meilhac S, Zaffran S. Building the mammalian heart from twosources of myocardial cells. Nat Rev, Genet 2005;6:826–35.

[13] Cai CL, Liang X, Shi Y, Chu PH, Pfaff SL, Chen J, et al. Isl1 identifies a cardiacprogenitor population that proliferates prior to differentiation and contributes amajority of cells to the heart. Dev Cell 2003;5:877–89.

[14] Davis DL, Edwards AV, Juraszek AL, Phelps A, Wessels A, Burch JB. A GATA-6 geneheart-region-specific enhancer provides a novel means to mark and probe adiscrete component of the mouse cardiac conduction system. Mech Dev2001;108:105–19.

[15] Adamo RF, Guay CL, Edwards AV, Wessels A, Burch JB. GATA-6 gene enhancercontains nested regulatory modules for primary myocardium and the embeddednascent atrioventricular conduction system. Anat Rec A Discov Mol Cell Evol Biol2004;280:1062–71.

[16] He CZ, Burch JB. The chicken GATA-6 locus contains multiple control regions thatconfer distinct patterns of heart region-specific expression in transgenic mouseembryos. J Biol Chem 1997;272:28550–6.

[17] White SM, Claycomb WC. Embryonic stem cells form an organized, functionalcardiac conduction system in vitro. Am J Physiol, Heart Circ Physiol 2005;288:H670–9.

[18] DiFrancesco D, Ferroni A, Mazzanti M, Tromba C. Properties of the hyperpolariz-ing-activated current (if) in cells isolated from the rabbit sino-atrial node. J Physiol1986;377:61–88.

[19] Barbuti A, Terragni B, Brioschi C, DiFrancesco D. Localization of f-channels tocaveolae mediates specific beta2-adrenergic receptor modulation of rate insinoatrial myocytes. J Mol Cell Cardiol 2007;42:71–8.

[20] Christoffels VM, Hoogaars WM, Tessari A, Clout DE, Moorman AF, Campione M.T-box transcription factor Tbx2 represses differentiation and formation of thecardiac chambers. Dev Dyn 2004;229:763–70.

[21] Christoffels VM, Mommersteeg MT, Trowe MO, Prall OW, Gier-de Vries C, SoufanAT, et al. Formation of the venous pole of the heart from an Nkx2-5-negativeprecursor population requires Tbx18. Circ Res 2006;98:1555–63.

[22] DiFrancesco D. Pacemaker mechanisms in cardiac tissue. Annu Rev Physiol1993;55:455–72.

[23] Baruscotti M, Bucchi A, DiFrancesco D. Physiology and pharmacology of thecardiac pacemaker ("funny") current. Pharmacol Ther 2005;107:59–79.

[24] Mangoni ME, Nargeot J. Properties of the hyperpolarization-activated current(I(f)) in isolated mouse sino-atrial cells. Cardiovasc Res 2001;52:51–64.

[25] Marionneau C, Couette B, Liu J, Li H, Mangoni ME, Nargeot J, et al. Specific patternof ionic channel gene expression associated with pacemaker activity in the mouseheart. J Physiol 2005;562:223–34.

[26] Shi W, Wymore R, Yu H, Wu J, Wymore RT, Pan Z, et al. Distribution andprevalence of hyperpolarization-activated cation channel (HCN) mRNA expres-sion in cardiac tissues. Circ Res 1999;85:e1–6.

[27] Liu J, Dobrzynski H, Yanni J, Boyett MR, Lei M. Organisation of the mousesinoatrial node: structure and expression of HCN channels. Cardiovasc Res2007;73:729–38.

[28] Brioschi C, Micheloni S, Tellez JO, Pisoni G, Longhi R, Moroni P, et al. Distribution ofthe pacemaker HCN4 channel mRNA and protein in the rabbit sinoatrial node. JMol Cell Cardiol 2009;47:221–7.

[29] Irisawa H, Brown HF, Giles W. Cardiac pacemaking in the sinoatrial node. PhysiolRev 1993;73:197–227.

[30] Yamamoto M, Dobrzynski H, Tellez J, Niwa R, Billeter R, Honjo H, et al. Extendedatrial conduction system characterised by the expression of the HCN4 channel andconnexin45. Cardiovasc Res 2006;72:271–81.

[31] Dobrzynski H, Boyett MR. What do we learn from double Cx40/Cx45-deficientmice about cardiac morphogenetic defects and conduction abnormalities? J MolCell Cardiol 2006;41:774–7.

[32] Boyett MR, Inada S, Yoo S, Li J, Liu J, Tellez J, et al. Connexins in the sinoatrial andatrioventricular nodes. Adv Cardiol 2006;42:175–97.

[33] van Veen AA, van Rijen HV, Opthof T. Cardiac gap junction channels: modulationof expression and channel properties. Cardiovasc Res 2001;51:217–29.

[34] DiFrancesco D, Tortora P. Direct activation of cardiac pacemaker channels byintracellular cyclic AMP. Nature 1991;351:145–7.

[35] DiFrancesco D, Tromba C. Inhibition of the hyperpolarization-activated current(if) induced by acetylcholine in rabbit sino-atrial node myocytes. J Physiol1988;405:477–91.

[36] Garcia-Frigola C, Shi Y, Evans SM. Expression of the hyperpolarization-activatedcyclic nucleotide-gated cation channel HCN4 during mouse heart development.Gene Expr Patterns 2003;3:777–83.

[37] Hoogaars WM, Engel A, Brons JF, Verkerk AO, de Lange FJ, Wong LY, et al. Tbx3controls the sinoatrial node gene program and imposes pacemaker function onthe atria. Genes Dev 2007;21:1098–112.

[38] Espinoza-Lewis RA, Yu L, He F, Liu H, Tang R, Shi J, et al. Shox2 is essential for thedifferentiation of cardiac pacemaker cells by repressing Nkx2-5. Dev Biol2009;327:376–85.

[39] Hoogaars WM, Tessari A, Moorman AF, de Boer PA, Hagoort J, Soufan AT, et al. Thetranscriptional repressor Tbx3 delineates the developing central conductionsystem of the heart. Cardiovasc Res 2004;62:489–99.

[40] Sun Y, Liang X, Najafi N, Cass M, Lin L, Cai CL, et al. Islet 1 is expressed in distinctcardiovascular lineages, including pacemaker and coronary vascular cells. Dev Biol2007;304:286–96.

[41] Laugwitz KL, Moretti A, Lam J, Gruber P, Chen Y, Woodard S, et al. Postnatal isl1+cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 2005;433:647–53.

[42] Barbuti A, Crespi A, Capilupo D, Mazzocchi N, Baruscotti M, DiFrancesco D.Molecular composition and functional properties of f-channels in murineembryonic stem cell-derived pacemaker cells. J Mol Cell Cardiol 2009;46:343–51.

[43] Ishii TM, Takano M, Ohmori H. Determinants of activation kinetics in mammalianhyperpolarization-activated cation channels. J Physiol 2001;537:93–100.