Krüppel-like factor 15 activates hepatitis B virus gene expression and replication

Kruppel-like Factor 15 Activates Hepatitis B VirusGene Expression and Replication

Jie Zhou,1,2* Thomas Tan,1,2* Yongjun Tian,3 Bojian Zheng,4 J.-H. James Ou,3

Eric J. Huang,1,2 and T.S. Benedict Yen1,2

Hepatitis B virus (HBV) is a small DNA virus that requires cellular transcription factorsfor the expression of its genes. To understand the molecular mechanisms that regulateHBV gene expression, we conducted a yeast one-hybrid screen to identify novel cellulartranscription factors that may control HBV gene expression. Here, we demonstrate thatKruppel-like factor 15 (KLF15), a liver-enriched transcription factor, can robustly activateHBV surface and core promoters. Mutations in the putative KLF15 binding site in theHBV core promoter abolished the ability of KLF15 to activate the core promoter in lucif-erase assays. Furthermore, the overexpression of KLF15 stimulated the expression of HBVsurface antigen (HBsAg) and the core protein and enhanced viral replication. Conversely,small interfering RNA knockdown of the endogenous KLF15 in Huh7 cells resulted in areduction in HBV surface- and core-promoter activities. In electrophoretic mobility shiftand chromatin immunoprecipitation assays, KLF15 binds to DNA probes derived fromthe core promoter and the surface promoter. Introduction of an expression vector forKLF15 short hairpin RNA, together with the HBV genome into the mouse liver usinghydrodynamic injection, resulted in a significant reduction in viral gene expression andDNA replication. Additionally, mutations in the KLF15 response element in the HBV corepromoter significantly reduced viral DNA levels in the mouse serum. Conclusion: KLF15is a novel transcriptional activator for HBV core and surface promoters. It is possible thatKLF15 may serve as a potential therapeutic target to reduce HBV gene expression and viralreplication. (HEPATOLOGY 2011;54:109-121)

Hepatitis B virus (HBV) is an enveloped hepa-totropic virus that can cause liver cirrhosisand hepatocellular carcinoma. This virus

chronically infects approximately 350 million people

worldwide and causes approximately 500,000 to 1 mil-lion deaths annually. HBV is a small DNA virus witha circular and partially double-stranded genome ofapproximately 3.2 kilobases. The HBV genome

Abbreviations: BSA, bovine serum albumin; C/EBP, CCAAT enhancer-binding protein; ChIP, chromatin immunoprecipitation; COUP-TF, chicken ovalbuminupstream promoter transcription factor; DAPI, 40,6-diamidino-2-phenylindole; ECL, enhanced chemiluminescence; EDTA, ethylenediaminetetraacetic acid; EIA,enzyme immunoassay; ELISA, enzyme-linked immunosorbent assay; EMSA, electrophoretic mobility shift assay; GFP, green fluorescent protein; HBsAg, HBV surfaceantigen; HBV, hepatitis B virus; hGH, human growth hormone; HNF1, hepatocyte nuclear factor 1; HRP, horseradish peroxidase; Ig, immunoglobulin; KLF15,Kruppel-like factor 15; NF-Y, nuclear transcription factor Y; PBS, phosphate-buffered saline; pgRNA, pregenomic RNA; qRT-PCR, quantitative real-timepolymerase chain reaction; rKLF15, recombinant KLF15; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; RNAi, RNA interference; SEAP,secreted alkaline phosphatase; shRNA, short-hairpin RNA, siRNA, short interfering RNA; Sp1, specificity protein 1; TBE, Tris/Borate/EDTA.From the 1Department of Pathology, University of California San Francisco, San Francisco, CA; 2Pathology Service 113B, Veterans Affairs (VA) Medical Center, San

Francisco, CA; 3Department of Molecular Microbiology and Immunology, University of Southern California, Los Angeles, CA; and 4Department of Microbiology, TheUniversity of Hong Kong, Hong Kong, China.Received September 8, 2010; accepted April 5, 2011.This work was supported by National Institutes of Health grants R01CA55578 (to T.S.B.Y.), R21RR024229 (to T.S.B.Y.), and P01CA123328 (to T.S.B.Y.

and J.H.J.O.), a VA Merit Review Award (to T.S.B.Y.), and an American Cancer Society postdoctoral fellowship (to T.T.).*These authors contributed equally to this work.Current address for Jie Zhou: Department of Microbiology, The University of Hong Kong, Hong Kong, China; Current address for Thomas Tan: CytoDesign,

Inc., Sunnyvale, CA.Address reprint requests to: Eric J. Huang, M.D., Ph.D., Department of Pathology, UCSF and Pathology Service 113B, VA Medical Center, San Francisco, CA

94121. E-mail: [email protected]; fax: 415-750-6947.CopyrightVC 2011 by the American Association for the Study of Liver Diseases.View this article online at wileyonlinelibrary.com.DOI 10.1002/hep.24362Potential conflict of interest: Nothing to report.Additional Supporting Information may be found in the online version of this article.

109

contains four genes: S, C, X, and P. The S gene codesfor the large, middle, and major surface antigens(HBsAgs), which are three related viral envelope pro-teins. The C gene codes for the precore protein, whichis the precursor of the e antigen found in the sera ofpatients with HBV, and the core protein, which is theviral capsid protein. The P gene codes for the viralDNA polymerase, and the X gene codes for a regula-tory protein. The expression of these HBV genes iscontrolled by four promoters and two enhancers thatdepend on host factors for transcriptional regulation.1,2

The preS1 promoter controls the expression of thelarge surface antigen, and the major surface promoter(also known as the surface promoter) controls theexpression of the middle and small surface antigens.The core promoter dictates the expression of the HBVe antigen, core protein, and DNA polymerase. The Xpromoter controls the transcription of the X RNA.After its synthesis, the core protein packages the coreRNA, which is larger than the genome size and is alsoknown as the pregenomic RNA (pgRNA), to form thecore particle. The pgRNA then serves as the templateto direct the synthesis of the partially double-strandedviral DNA genome, using the viral DNA polymerasethat is also packaged. The core RNA plays a pivotalrole in the HBV life cycle and its increased expressionhas been shown to enhance viral replication.3,4

The identification of host factors that interact withthe HBV DNA genome has made significant contribu-tions to our understanding of mechanisms that regu-late HBV gene expression. Indeed, both liver-enrichedand ubiquitous transcription factors, such as hepato-cyte nuclear factor 1 (HNF1), HNF3, HNF4, CCAATenhancer-binding protein (C/EBP), chicken ovalbuminupstream promoter transcription factor (COUP-TF),nuclear transcription factor Y (NF-Y), and specificityprotein 1 (Sp1), have been shown to regulate theexpression of the S and C genes.5-13 The liver specificityof the preS1 promoter, the major surface promoter, andthe core promoter is attributed to the need of liver-enriched transcription factors for their activities.10,14-18

In this study, we used a yeast one-hybrid screen toidentify additional transcription factors that could acti-vate the major surface promoter. Using cDNA librariesprepared from the human hepatoma cell line, Huh7,and mouse liver, we identified several members of theKruppel-like factor (KLF) family as potential activatorsof the surface promoter (T. Tan and T.S.B. Yen,unpublished data). KLF family members are character-ized by their three carboxy-terminal C2H2 zinc fingersand share a high degree of homology with Sp1-likeproteins. At least 21 Sp1/KLF proteins have been

identified in the human genome. They have highlyconserved DNA-binding domains, but show significantvariations in the transactivation domain in their aminoterminus.19,20 Kruppel-like factor 15 (KLF15) has beenshown to regulate the expression of a number of genesinvolved in many aspects of physiological homeostasis,including glucose uptake and adipogenesis.21-25 More-over, KLF15 is highly expressed in the human liver.25

These observations led us to hypothesize that KLF15might be a potential activator for HBV gene expression.Indeed, our results indicate that KLF15 can activate theexpression of the HBV S and C genes both in vitro andin vivo. Our results thus uncovered previously unrecog-nized functions of KLF15 in HBV gene expression.

Materials and Methods

Plasmids. The reporter plasmids, pCP, pS1-Luc,26

pCCD1 (cyclin D1 luciferase construct),27 and pRL-TK, as well as the expression plasmids, pHBV1.3D28

and pXGH,29 have been previously described. The re-porter plasmids, pS1Z1/Z2mut-Luc and pS1M2mut-Luc, were made by polymerase chain reaction (PCR)amplifying from pS1Z1þ2mutCAT and pS1M2mut-CAT and cloning into pS1-Luc digested with BglIIand HindIII. The plasmids, pAAV-HBV1.2, pCP1.3x/Luc, and pKLF15, were obtained from P.J. Chen(National Taiwan University, Taipei, Taiwan), Y. Shaul(The Weizmann Institute of Science, Rehovot, Israel),and S. Gray (Harvard Medical School, Boston, MA),respectively. pLive-SEAP (secreted alkaline phospha-tase) (Mirus Bio, Madison, WI), which expressessecreted human placental alkaline phosphatase, wasused to monitor the efficiency of plasmid delivery afterhydrodynamic injections. pCPm1, pCPm2, andpCP2m were generated from pCP with primer pairsCPm1-s/as, CPm2-s/as, and CP2m-s/as, respectively,and pAAV-HBV1.2-CPm2 was generated from pAAV-HBV1.2 with the primer, CPm2-60 (Table 1), usingthe QuikChange Lightning site-directed mutagenesiskit (Stratagene, La Jolla, CA).Cell Transfection, Messenger RNA Analysis, and

Protein Assays. HepG2 and Huh7 cells were culturedat 37�C in Dulbecco’s modified Eagle’s medium sup-plemented with 10% fetal bovine serum and penicil-lin-streptomycin in 7% CO2. Cells in a 12-well platewere transfected with 800 ng of DNA plasmids, using2.4 lL of FugeneHD (Roche Diagnostics, Indianapolis,IN), and harvested at specific time points after transfec-tion. pRL-TK, which expresses the Renilla luciferasereporter under the control of the herpes simplex virusthymidine kinase promoter, or pXGH, which expresses

110 ZHOU ET AL. HEPATOLOGY, July 2011

the human growth hormone (hGH) reporter under thecontrol of the mouse metallothionein promoter, wasused for cotransfection to monitor transfection effi-ciency. The hGH enzyme-linked immunosorbent assay(ELISA) kit (Roche Diagnostics, Indianapolis, IN) wasused to detect hGH in the culture medium.Stealth Select RNA interference (RNAi) short inter-

fering RNA (siRNA) (Invitrogen, Carlsbad, CA) wasused for RNAi studies in Huh7 cells. For experimentsinvolving cotransfection of siRNA (50 nM) andpHBV1.3D, Lipofectamine 2000 (Invitrogen) wasused according to the manufacturer’s protocol. ForRNAi experiments in luciferase assays, siRNA (50 nM)was transfected using Lipofectamine RNAiMAX (Invi-trogen). Luciferase reporter plasmids were transfected24 hours after siRNA transfection. Luciferase activitieswere measured using the Dual-Glo Luciferase assaysystem (Promega, Madison, WI).RNA extraction and reverse transcription were per-

formed using the RNeasy Mini kit and the SuperScriptIII first-strand synthesis system (Invitrogen), respec-tively. The SYBR green master mix (Roche Diagnos-tics) was used for quantitative real-time PCR (qRT-PCR) for analysis of the KLF15 RNA. Mouse 36B4RNA (Table 1) was also analyzed to serve as an inter-nal control. The primer pairs for KLF15 and 36B4RNA analysis are shown in Table 1.To measure HBV core protein levels, transfected

HepG2 cells in a 12-well plate were lysed with200 lL of RIPA buffer (50 mM Tris HCl, pH 7.5,

150 mM NaCl, 1 mM ethylene diamine tetraaceticacid [EDTA], 1% Nonidet P-40, 0.1% sodium do-decyl sulfate [SDS], 10% glycerol, and 0.5% deoxy-cholic acid). Samples were subjected to electrophoresisin a 15% SDS-PAGE (polyacrylamide gel electropho-resis) gel and then transferred to a polyvinylidene fluo-ride membrane (Millipore, Billerica, MA). One-half ofthe membrane was probed with the rabbit anti-HBcAgantibody (1:300 dilution; US Biological, Marblehead,MA), followed by incubation with horseradish peroxi-dase (HRP)-conjugated goat anti-rabbit antibody(1:3000 dilution; Santa Cruz Biotechology, SantaCruz, CA). The other half of the membrane wasprobed with the mouse antiactin primary antibody(1:40,000 dilution; Calbiochem, San Diego, CA) andthe HRP-conjugated goat anti-mouse immunoglobulinM (IgM) secondary antibody (1:5000 dilution). Theenhanced chemiluminescence (ECL) Plus Westernblotting detection system (Amersham Biosciences,Pittsburgh, PA) was used to develop the signals.HBsAg levels in culture media and mouse sera weremeasured by the HBs enzyme immunoassay (EIA) kit(International Immuno-Diagnostics, Foster City, CA).Expression of Recombinant KLF15 and Electro-

phoretic Mobility Shift Assays. pKLF15, whichexpresses mouse KLF15 with a C-terminal FLAG tag,was transfected into 293T cells using FugeneHD. Theculture medium was changed to Opti-MEM 10 hoursposttransfection. After further incubation for 48 hours,cells were harvested for protein purification usingEZview Red ANTI-FLAG M2 Affinity Gel (Sigma-Aldrich, St. Louis, MO), according to the manufac-turer’s instruction. Purified recombinant KLF15(rKLF15) protein was analyzed by Western blot usinganti-FLAG M2 (Sigma-Aldrich) and anti-KLF15(ab2647; Abcam, Cambridge, UK) antibodies. Dou-ble-stranded synthetic oligonucleotides were prepared byannealing the two DNA strands in 10 � buffer (200mM Tris, 100 mM MgCl2, and 250 mM NaCl), fol-lowed by cooling from 65�C to 37�C. The double-stranded oligonucleotides were labeled with [c-32P]ATP(PerkinElmer, Waltham, MA), using T4 polynucleotidekinase (Roche Diagnostics). Unincorporated [c-32P]ATPwas removed using the Auto-Seq G-50 dye terminatorremoval kit (Amersham). Nucleotide sequences of theDNA probes used in this study, CP35, CLCK1, MLTF,and SP70, are listed in Table 1.For the electrophoretic mobility shift assay (EMSA)

reaction, 2 lL of rKLF15 (100 ng/lL) were mixedwith 25 fmol of labeled probe and 4 lL of 5� gelshiftbuffer (Promega), in a total volume of 20 lL, andincubated at 37�C for 30 minutes. The reaction

Table 1. Sequences of Primers and Probes in This Study

Name Nucleotide Sequence (50 to 30)

CPm1-s GGGAGGAGCTGGTGGAGTATATTAGGTTAAAGGTC

CPm1-as GACCTTTAACCTAATATACTCCACCAGCTCCTCCC

CPm2-s GGGAGGAGCTGGGTGATGATATTAGGTTAAAGGTC

CPm2-as GACCTTTAACCTAATATCATCACCAAGCTCCTCCC

CP2m-s ACTGTGTTTAAGGACTGTGAGTACCTGGTGGAGTATATTAGG

CP2m-as CCTAATATACTCCACCAGGTACTCACAGTCCTTAAACACAGT

CPm2-60 CTAATACAAAGACCTTTAACCTAATATCATCACCAA

GCTCCTCCCAGTCCTTAAACACAC

HBV1644F AAGGTCTTACATAAGAGGAC

HBV1805R TGCGCAGACCAATTTATGC

HBV22R AGCTTGGTGGAAGGCAGTGG

RV3 CTAGCAAAATAGGCTGTCCC

MKLF15-F CCCAATGCCGCCAAACCTAT

MKLF15-R GAGGTGGCTGCTCTTGGTGTACATC

36B4-F GGCCCTGCACTCTCGCTTTC

36B4-R TGCCAGGACGCGCTTGT

HBV DNA-F GGAAACCACACGTAGCGCATCAT

HBV DNA-R TGCCCCATGCTGTAGCTCTTG

CP-35 GGGAGGAGCTGGGGGAGGAGATTAGGTTAAAGGTC

CLCK1 AGCCGGGGAGGGGGAGGGGAGGGTGTTG

MLTF GATCCGCGGGGCGCGTGACTATGCGTGGGCTGGA

SP70 CAATTCCTCCTCCTGCCTCCACCAATCGGCAGTCAGG

AAGGCAGCCTACTCCCATCTCTCCACCTCTAAG

HEPATOLOGY, Vol. 54, No. 1, 2011 ZHOU ET AL. 111

mixtures were loaded on a 6% polyacrylamide gel andsubjected to electrophoresis in 0.5� Tris/Borate/EDTA(TBE) buffer at 200 V for 2�3 hours. The gel wasdried and analyzed by a Typhoon phosphorimager(GE Healthcare, Waukesha, WI). For the supershiftassay using the anti-KLF15 antibody, rKLF15 wasincubated with a labeled probe at 37�C for 30minutes, followed by incubation with either anti-KLF15 or control antibody at room temperature for40 minutes.Chromatin Immunoprecipitation Assay. The chro-

matin immunoprecipitation (ChIP) assay was con-ducted using the EZ-Magna ChIP G ChromatinImmunoprecipitation Kit (Millipore). Briefly, HepG2cells in 10-cm dishes were cotransfected with 4.8 lg ofpKLF15 and 1 lg of the reporter construct, pCP, orpS1-Luc or the mutated constructs, pCP-2m, pS1Z1/Z2mut-Luc, and pS1M2mut-Luc. Forty-eight hoursafter transfection, cells were crosslinked with formalde-hyde and harvested for immunoprecipitation. An ali-quot of the cell lysates was saved to serve as the inputDNA control. After the reversal of crosslinking with 5M of NaCl, ChIP samples were subjected to PCR usingthe primer pair, HBV1644F/HBV1805R (for the corepromoter), and primer pair RV3/HBV22R (for the sur-face promoter). Antibodies used in ChIP assays includedKLF15 (Abcam), NF-Y (Thermo Fisher Scientific, Wil-mington, MA), Sp1 (Abcam), rabbit control IgG, andgoat control IgG (Abcam) antibodies.HBV DNA Assay. HepG2 cells cotransfected with

pHBV1.3D and pKLF15 or its control vectorpcDNA3.1 were harvested in 600 lL of lysis buffer(50 mM Tris-HCl, pH 7.0, and 0.5% Nonidet P-40)96 hours after transfection. Ninety microliters of celllysates or culture medium were mixed with 1 lL ofTURBO DNase (Ambion, Austin, TX) and 10�DNase buffer and incubated at 37�C for 30 minutes.After, DNase was inactivated by heating at 75�C for10 minutes. The mixtures were subsequently processedwith the virus extraction column (QIAamp MinEluteVirus Spin Kit; Qiagen, Germantown, MD), followingthe manufacturer’s instruction. Viral genome thus puri-fied was quantified by RT-PCR, using the SYBR greenmaster mix and the HBV DNA-F/R primer pair (Table1). To extract the encapsidated viral DNA from themouse serum, 25 or 100 lL of mice serum was used.Animal studies. Experiments involving mice were

approved by the Institutional Animal Care and UseCommittee (IACUC) of the San Francisco VA MedicalCenter. Male C57BL/6J mice were purchased from theJackson Laboratory (Bar Harbor, ME) and used at 6-7weeks of age. To study the effects of KLF15 on HBV

viral protein expression and DNA replication, 5 lg ofpAAV-HBV1.2, 5 lg of pLive-SEAP, and 30 or 50 lgof miR RNAi constructs were injected into the mousetail vein by hydrodynamic injection in a volume ofphosphate-buffered saline (PBS) equivalent to 8% ofthe mouse body weight. Mouse sera were assayed forHBsAg and capsid-associated HBV DNA at the indi-cated time points after injection. The SensoLyte FDPSEAP Reporter Gene Assay kit (AnaSpec, Fremont,CA) was used to detect SEAP activity in mouse sera.For immunofluorescence staining of the HBV core

antigen, mouse livers were fixed with 4% formalinovernight, cryoprotected in 30% sucrose, and sec-tioned at a thickness of 10 lm, using Leica cryostat(Leica Microsystems, Buffalo Grove, IL), and mountedon Superfrost glass slides (Thermo Fisher Scientific).Sections were incubated with the primary antibody(anti-HBc; US Biological) overnight, followed by incu-bation with the goat anti-rabbit secondary antibodyconjugated with Alexa Fluor 568 (Invitrogen). Slideswere subsequently counterstained with 40,6-diamidino-2-phenylindole (DAPI). Images were captured using aZeiss LSM 510 Meta Confocal Microscope (Carl ZeissGmbH, Jena, Germany). For Western blot analysis ofthe HBV core protein, approximately 120 mg of themouse liver was rinsed with cold buffer A (50 mMTris-HCl, pH 7.0, 2 mM EDTA, and 150 mM NaCl)and homogenized in buffer B (50 mM Tris-HCl, pH7.0, 10% glycerol, 5 mM MgCl2, 0.2 mM EDTA, 1mM dithiothreitol, and 1 � protease inhibitor cocktail).The homogenates were centrifuged at 15,000g for 30minutes twice to pellet the cell debris. Next, 150 lg oftotal proteins were analyzed in 15% SDS-PAGE, usingthe same protocol described above for HepG2 cell lysates.BLOCK-iT Pol II miR RNAi expression vectors (Invi-

trogen) were used to knock down the expression ofKLF15 in mice. To analyze the expression level of KLF15in miR RNAi-transfected hepatocytes, mice were anesthe-tized and their livers were perfused with collagenase 3days after hydrodynamic injection to obtain hepatocytes,which were subsequently sorted by flow cytometry to sep-arate transfected (i.e., green fluorescent protein [GFP]-positive) hepatocytes from untransfected (i.e., GFP-nega-tive) hepatocytes. To analyze the effect of KLF15 on viralgene expression, 10 lg of pAAV-HBV1.2 or pAAV-HBV1.2-CPm2 and 5 lg of pLive-SEAP were coinjectedinto mice through the tail veins. All of the plasmids usedfor hydrodynamic injection were prepared using theEndoFree plasmid preparation kit (Qiagen).Statistic Analysis. The Student t test and Mann-

Whitney U test were used to analyze data. A value ofP < 0.05 was regarded as statistically significant.


Results

KLF15 Transactivates HBV Surface and CorePromoters. To identify host factors that can promoteHBV gene expression, we initiated a yeast one-hybridassay to screen for transcription factors that could bindthe HBV major surface promoter. Multiple screenspulled out the previously identified NF-Y transcriptionfactor, as well as a few members of the KLF family oftranscription factors12 (T. Tan and T.S.B. Yen, unpub-lished data). We chose to focus on KLF15 for ourstudies, as this transcription factor is enriched in theliver.25 Using a luciferase reporter, which was drivenby the HBV surface promoter, we found that KLF15increased luciferase activity in a dose-dependent man-ner by up to 80-fold (Fig. 1A and Supporting Fig. 1).This transactivation effect of KLF15 was specific tothe HBV surface promoter, because it had little effecton the cyclin D1 promoter (Fig. 1B). Previously, weand others found that the NF-Y binding site (CCAATbox, designated as the M2 site) and two flanking Sp1factor binding sites (Z1/Z2 sites) are critical for HBVsurface promoter activity.1,10,12,30 As shown in Fig.1C, the transactivation effect of KLF15 on the surfacepromoter was dramatically reduced to approximatelyfour-fold by the mutations in the Z1/Z2 site and com-pletely abolished by the mutation in the M2 site (Fig.1C and Supporting Fig. 1). These results indicate thatKLF15 is a potent activator for the HBV surface pro-moter, and that its optimal activity on the surface pro-moter requires intact Z1/Z2 and M2 sites.Because the HBV core promoter is activated by Sp1

and/or Sp1-like factor,34 we thought KLF15 might

also be involved in its regulation. To determinewhether KLF15 could also activate the HBV core pro-moter, two different core promoter reporters, pCP1.3xand pCP, were used for the studies. pCP1.3x was gen-erated from an HBV genomic DNA fragment, inwhich a luciferase open-reading frame substituted thecore open-reading frame in the parental construct,whereas the pCP contains only a 162–base pair HBVcore promoter fragment. In both reporter constructs,the expression of the luciferase was under the controlof the core promoter. As shown in Fig. 2A,B, KLF15could also activate the core promoter in a dose-dependent manner similar to the effect on the surfacepromoter (Fig. 1). Notably, we identified a sequencewithin the 162–base pair core promoter in pCP thatmatched exactly the KLF15 consensus binding sequence(GGGGNGGNG) reported by Uchida et al.25 More-over, this sequence matched an Sp1 or Sp1-like factorbinding site (C region, site 3) identified by McLa-chlan’s group in the HBV core promoter.34 To deter-mine whether this consensus sequence could be recog-nized by KLF15, we generated two mutant luciferasereporters, pCPm1 and pCPm2, in which two guano-sine residues in the KLF15 consensus sequence werechanged to thymidine (Fig. 2C). These two constructswere designed to disrupt possible KLF15 binding tothe core promoter. In addition, the CPm2 sequencewas designed to maintain the overlapping HBV X(HBx) protein-coding sequence. Hence, the exact samemutations can be introduced into the HBV genome tostudy their effects on HBV gene expression withoutthe confounding effect of HBx mutations.28,31,32 Con-sistent with our predictions, mutations in the KLF15

Fig. 1. KLF15 activates the HBV surface promoter. (A) Dose-dependent effect of KLF15 on the HBV surface promoter. pS1-Luc, which containsthe luciferase reporter under the expression control of the surface promoter, was cotransfected with pKLF15 or its control vector, pcDNA3.1 intoHuh7 cells. pRL-TK, which expresses Renilla luciferase, was also included to monitor transfection efficiency. (B) Lack of effect of KLF15 on thecyclin D1 promoter (CCD1). The CCD1 reporter construct was cotransfected with pKLF15 or its control vector into Huh7 cells. The CCD1 promoteractivity in the absence of pKLF15 was arbitrarily defined as one. (C) Effects of KLF15 on the surface promoter with mutations in the Z1/Z2 orM2 site. In the experiments, the relative luciferase activities were determined by comparing the luciferase activities expressed by the surface pro-moter in the presence of KLF15 to that in the absence of KLF15. The results represent the mean 6 standard deviation of three independentexperiments.


consensus sequence abolished the ability of KLF15 totransactivate CPm1 and CPm2 (Fig. 2D). Therefore,these results support the notion that KLF15 activatesthe HBV core promoter via the consensus KLF15-binding sequence embedded in this promoter.KLF15 Increases HBV Gene Expression and Viral

DNA Replication. To further investigate the possibleeffect of KLF15 on HBV gene expression from theHBV genome, we cotransfected pKLF15 or its controlvector with pHBV1.3D, which contains the 1.3-merHBV genome, into HepG2 and Huh7 cells. Ourresults showed that the coexpression of KLF15 led to aseven-fold increase of the HBsAg level in the culturemedium of HepG2 cells (Fig. 3A). Such an increase inHBsAg production was even more prominent in Huh7cells, which was up to nearly 20-fold (Fig. 3B). Simi-larly, KLF15 also increased the core protein expressionlevel in HepG2 cells (Fig. 3C). When the culture me-dium and cell lysates from transfectants were analyzedfor encapsidated HBV DNA by RT-PCR, we foundthat the coexpression of KLF15 increased the extracel-lular encapsidated HBV DNA level by approximatelytwo-fold and also slightly increased the intracellularencapsidated HBV DNA level (Fig. 3D). Taken to-gether, our results indicated that, in the context of theHBV genome, KLF15 could enhance the expression ofHBsAg and the core protein, as well as HBV DNAreplication.Suppression of Endogenous KLF15 Expression

Reduces HBsAg Production and HBV Surface andCore Promoter Activities. To determine whether en-

dogenous KLF15 would also regulate HBV geneexpression, we used siRNA to reduce the expression ofendogenous KLF15. As shown in Fig. 4A, the transfec-tion of KLF15 siRNA into Huh7 cells resulted in anapproximately 70% reduction of the KLF15 messengerRNA (mRNA) level. This reduction of KLF15 expres-sion led to an approximately 50% reduction in HBsAgexpression from the HBV genome (Fig. 4B). Consist-ent with this result, KLF15 siRNA also reduced theluciferase activities of the HBV core promoter and thesurface promoter by approximately 50% and 30%,respectively (Fig. 4C and 4D). Thus, the results shownin Fig. 4 indicated that endogenous KLF15 also posi-tively regulates HBV surface and core promoters.KLF15 Binds to HBV Core and Surface Pro-

moters in EMSAs and ChIP Assays. To characterizethe mechanism by which KLF15 binds to core andsurface promoters, the FLAG-tagged KLF15 proteinwas expressed in 293T cells and purified with an anti-FLAG affinity gel (Fig. 5A). Although the crude celllysates also contained Sp1 and NF-Y that are knownto interact with the S promoter (Fig. 5A, lane 1), thesetwo protein factors were found only in the unboundfraction (Fig. 5A, lane 2) and not in the affinity-puri-fied KLF15 fraction (Fig. 5A, lane 3), indicating thespecificity of this purification. Using EMSAs, weshowed that rKLF15 was able to bind to labeled corepromoter probe CP35 (Fig. 5B). KLF15-DNA bindingwas specific, as the addition of 100-fold nonlabeledCP35 disrupted the protein-DNA complex (Fig. 5B,lane 2). It has been very well demonstrated that a

Fig. 2. KLF15 activates the HBV core pro-moter. (A, B) Dose-dependent effect of KLF15 onthe HBV core promoter. (A) and (B) represent theeffect of KLF15 on pCP1.3x and pCP, respec-tively. The experiments were conducted asdescribed in the Fig. 1 legend. (C) Schematicdiagram of the luciferase reporter CP and its twomutant constructs, CPm1 and CPm2. Themutated nucleotides in CPm1 and CPm2 areshown with lowercase letters. (D) Effects ofKLF15 on CP-wt, CPm1, and CPm2.


functional KLF15 binding site is present in theCLCK1 gene promoter.25 As shown in the same panel,this KLF15-DNA complex could also be removed bythe unlabeled CLCK1 oligonucleotide (lane 3), butnot by a nonspecific oligonucleotide MLTF (lane 4),indicating the specificity of this binding (Fig. 5B).Moreover, the addition of the anti-KLF15 antibodyresulted in a supershift, whose intensity positively cor-related with the amount of the anti-KLF15 antibodyused (lanes 5 and 6). It is noteworthy that the additionof the control antibody could increase the binding ofKLF15 to the DNA probe. In addition, despite theappearance of the supershifted signal, the intensity ofthe original KLF15-DNA complex did not diminishaccordingly, which was also observed in another studyusing the same antibody.24 The reason why the addi-tion of the antibodies increased the binding of KLF15to the DNA probe is unclear. It may have been relatedto stabilization by protein (antibody or bovine serumalbumin [BSA] in the antibody storage buffer) or othercomponents in the antibody storage buffer. To deter-mine whether KLF15 binding to CP35 would be spe-cific, we synthesized CP35-2m, which had mutationsin the two potential KLF15-binding sites (SupportingFig. 1). As shown in Fig. 5C, KLF15-DNA complexwas decreased by the nonlabeled CP35 competitor in adose-dependent manner, whereas CP35-2m failed to

compete for KLF15 binding (Fig. 5C). To further con-firm that the binding of KLF15 to DNA woulddepend on the KLF15 consensus sequence embeddedin the core promoter, we performed ChIP assays usingcells cotransfected with pKLF15 and the core pro-moter reporter, pCP, or its mutant, pCP-2m. Ourresults showed that the anti-KLF15 antibody couldefficiently precipitate pCP, but not pCP-2m (Fig. 5F,upper panel), indicating that KLF15 could, indeed,bind to pCP, and this binding was dependent on theintact KLF15 consensus sequence.To determine whether KLF15 could also bind to

the surface promoter, we performed similar EMSAassays. As shown in Fig. 5D, the incubation ofrKLF15 with the labeled surface promoter probe,SP70, resulted in a bandshift, which could be com-peted off by nonlabeled SP70, but not by a nonspe-cific competitor. Similarly, a supershift band could beobserved when the anti-KLF15 antibody was added inthe binding reaction (Fig. 5E). Consistent with theseresults, ChIP assays showed that KLF15 was able tobind to the S promoter DNA. Further analysis indi-cated that mutations in the Sp1 sites (i.e., Z1/Z2mutant; Fig. 5F, middle panel), which prevented thebinding of Sp1, reduced the binding of KLF15 to the Spromoter by 42% (Supporting Fig. 2). In contrast,mutations in the NF-Y site (i.e., M2 mutant; Fig. 5F,

Fig. 3. KLF15 increases the expression ofHBsAg and HBcAg and the replication of HBVDNA. HepG2 (A, C, and D) or Huh7 (B) cellswere cotransfected with pHBV1.3D and pKLF15or its control vector (Ctrl). An aliquot of the cul-ture medium was removed 24 hours after trans-fection and used for EIA to measure the HBsAglevel (A, B). Cells were lysed 48 hours after trans-fection for Western blot analysis of HBcAg andactin (C). For qPCR analysis of HBV DNA (D), cellsand culture media were harvested 96 hours aftertransfection.


bottom panel) had essentially no effect on the binding ofKLF15 to the S promoter, despite suppressing NF-Ybinding. Together, the results in Fig. 5 indicated thatKLF15 could bind to the HBV core and surface pro-moters and further suggested the partial overlap of theKLF15 sites with the Sp1 sites or the presence of a cryp-tic KLF15-binding site elsewhere in the S promoter.Suppression of KLF15 expression in the liver

decreases viral gene expression and DNA replication ina HBV mouse model. To determine whether KLF15would also regulate HBV gene expression in vivo, weperformed a hydrodynamic injection to introduce theHBV genome into the mouse liver and used RNAi tosuppress KLF15 expression. First, we validated thesilencing effect of KLF15-specific short-hairpin RNA(shRNA), which was expressed using the InvitrogenBLOCK-it miR RNAi vector that also contains an em-bedded EmGFP cassette, in Huh7 cells. As shown inFig. 6A, four independent KLF15 miR RNAi con-structs (Cons1-4) could each reduce the KLF15mRNA level by approximately 60% at 48 hours aftertransfection. Next, we introduced the KLF15 RNAiconstruct 4 with pAAV-HBV1.2 into the mouse liverusing the hydrodynamic injection. Because the trans-fection efficiency of this injection procedure rangesfrom 10% to 40%, transfected (i.e., GFP-positive) andnontransfected (i.e., GFP-negative) hepatocytes wereseparated by cell sorting after liver perfusion. Similarto Huh7 cells, the KLF15 mRNA level in KLF15

RNAi construct-transfected hepatocytes was reducedby approximately 60% when it was compared with thenontransfected hepatocytes. Such a reduction was notobserved if the KLF15 RNAi construct was replacedwith the control RNAi construct (Fig. 6B). Theseresults indicated that the KLF15 RNAi construct couldalso reduce the expression of KLF15 in mouse hepato-cytes. To determine the effect of KLF15 knockdownon HBV gene expression, we performed immunofluo-rescence staining on mouse liver tissue sections. Inmice coinjected with the control RNAi construct andpAAV-HBV1.2 (Fig. 6C), almost all the cells positivefor GFP were also positive for HBcAg, indicating thesuccessful cotransfection of the same hepatocytes bythe RNAi construct and the HBV genome. However,when the control RNAi construct was replaced by theKLF15 RNAi construct, the HBcAg signal in GFP-positive cells was greatly diminished. This immunoflu-orescence staining result was further confirmed byWestern blot analysis of the core protein. As shown inFig. 6D, the liver of mice injected with the KLF15RNAi construct had a lower level of the core proteinthan the liver of mice injected with the control RNAiconstruct. These results indicated that the knockdownof KLF15 expression could result in the suppression ofcore protein expression.After the codelivery of pAAV-HBV1.2 and RNAi

constructs (KLF15 construct 4 or the control vector)into the mouse liver through hydrodynamic injection,

Fig. 4. Endogenous KLF15 regulates HBVgene expression. (A) Reduction of KLF15mRNA level by its siRNA. Huh7 cells trans-fected with pHBV1.3D, pXGH, and the nega-tive control siRNA (Ctrl) or the KLF15 siRNA(KLF15) were lysed 24 hours after transfec-tion, and the KLF15 mRNA was quantified byqRT-PCR and normalized against the GAPDHRNA internal control. (B) Reduction of HBsAgexpression from the HBV genome by KLF15siRNA. Culture media in A were used forHBsAg and hGH ELISAs. The amount ofHBsAg was normalized against hGH, whichserved as the transfection control. (C, D) Lu-ciferase reporter assays for the HBV core pro-moter (C) and the surface promoter (D). Thereporters were cotransfected with pRL-TK andeither the control siRNA or the KLF15 siRNAinto Huh7 cells. Cells were then lysed 24 or48 hours after transfection for the luciferaseassay. Relative Luc Levels refers to firefly lu-ciferase activity normalized with controlRenilla luciferase activity.


Fig. 5. Detection of KLF15 interaction with HBV core and surface promoters in electrophoretic mobility shift assays (EMSA) and ChIP assays.(A) Western blot analysis of recombinant KLF15 (KLF15) protein expressed in 293T cells and purified using an anti-FLAG affinity column. Westernblot analyses were conducted using antibodies directed against KLF15, the FLAG tag, Sp1, and NF-Y. Lane 1, crude cell lysates; lane 2, unboundfraction of the affinity column; lane 3, eluate of the bound fraction. (B) EMSA showed the specific binding of core promoter (CP35) by KLF15.Lanes 1-7, CP35 probe incubated with KLF15; lanes 2-4, competition with 100-fold excess of unlabeled competitor (CPT) CP35 (CP), CLCK1(CK), and nonspecific (NS) MLTF oligonucleotides, respectively; lane 5, supershift with 1 lg of anti-KLF15 antibody; lane 6, supershift with 2 lg ofanti-KLF15 antibody; lane 7, supershift with 2 lg of control antibody; lane 8, CP35 probe and 2 lg of anti-KLF15 antibody only. The specificKLF15-DNA complex (arrow) and supershift (arrowhead) are indicated. (C) Binding of CP35 and KLF15 (lane 1) in the presence of an increasingamount (5-, 10-, and 20-fold) of unlabeled CP35 (lanes 2-4) and CP35-2m (lanes 5-7). CP35-2m contained mutations in KLF15-binding sites. (D)EMSA using surface promoter (SP70) and KLF15. Lane 1, SP70 probe only; lane 2, SP70 probe plus KLF15; lanes 3-4, same as in lane 2, withthe addition of a 100-fold excess of unlabeled SP70 (lane 3) or a 100-fold excess of nonspecific MLTF oligonucleotide (lane 4). (E) Lane 1, SP70probe only; lane 2, SP70 probe plus KLF15; lanes 3 and 4, supershift with 1 and 2 lg of anti-KLF15 antibody. (F) Top: ChIP assays showed thatKLF15 bound to the wild-type core promoter (CP-wt), but not to the mutant core promoter where the two potential KLF15 binding sites were mutated(Top). The mouse IgG was used as the control in the ChIP assay. Middle: ChIP assays showed that KLF15 binding to the surface promoter (SP-wt)was reduced by approximately 40% if Sp1 binding sites were mutated (Z1/Z2-mut). In contrast, Sp1 binding to the surface promoter was abolishedby the Z1/Z2 mutations. Bottom: Although the M2 mutation suppressed NF-Y binding to the surface promoter, it had little effect on KLF15 binding.


we monitored the level of HBsAg in the serum ofinjected mice. pAAV-HBV1.2 contains the 1.2-merHBV genome in an AAV vector. This construct waspreviously shown to lead to a high replication level of

HBV in the mouse liver.33 Our results indicated thatmice with a KLF15 knockdown had consistently lowerlevels of HBsAg than control mice (Fig. 7A and B).This reduction of the HBsAg level was more dramatic

Fig. 6. KLF15-specific RNAi constructs reduce KLF15 mRNA levels in vitro and in vivo and HBcAg expression in vivo. (A) Cotransfection ofpKLF15 and various KLF15 RNAi constructs (Cons1-4) or the control (Ctrl) RNAi construct into Huh7 cells. The relative KLF15 mRNA levels weremeasured by qRT-PCR and normalized against the GAPDH RNA. (B) Reduction of KLF15 mRNA levels in the mouse liver by the KLF15 RNAi con-struct. Two groups of mice (four in each group) were coinjected with pAAV-HBV1.2 and the control RNAi construct (Ctrl) or the KLF15 RNAi con-struct 4 (KLF15). The plasmid, pLive-SEAP, was also used for coinjection to monitor transfection efficiency. GFP-positive (GFPþ) and GFP-negative(GFP�) hepatocytes were isolated from these mice 3 days after injection for RNA extraction. The KLF15 RNA was quantified by qRT-PCR and nor-malized against mouse 36B4 RNA. The KLF15 mRNA level in GFP-negative cells isolated from mice injected with the KLF15 RNAi construct wasarbitrarily defined as 100%. (C) Confocal microscopy of liver tissue sections from mice injected with pAAV-HBV1.2 and the control RNAi construct(top) or KLF15 RNAi construct 4 (bottom). (A, E) GFP signals expressed from the miR RNAi vector; (B, F) HBcAg staining; (C, G) DAPI staining;and (D, H) merged images. (D) Western blot analysis of the HBV core protein in the mouse liver. The liver homogenates of mice hydrodynamicallyinjected with pAAV-HBV1.2 and the control RNAi construct (lane 1), pAAV-HBV1.2 and KLF15 RNAi construct (lane 2), or PBS (lane 3) wereused for Western blot analysis for the core protein and actin.


with 50 than with 30 lg of KLF15 RNAi construct(data not shown), indicating a dose-dependent effectof the KLF15 RNAi construct on HBsAg expressionin mice. We also examined the effect of KLF15 knock-down on the replicated HBV DNA level in the mouseserum. KLF15 knockdown also reduced the HBVDNA level in the serum (Fig. 7C). Similar to HBsAgprofiles, this reduction effect was more prominentwith 50 than with 30 lg of KLF15 RNAi construct.Mutations in the KLF15 Binding Site in HBV

Core Promoter Reduced Viral DNA Production inMice. To further confirm the effect of KLF15 onHBV replication, we generated an HBV genome withthe CPm2 mutations that abolished the stimulatoryeffect of KLF15 on the core promoter (Fig. 2D). Thereplication efficiency of this HBV mutant plasmid inmice was then compared with that of the wild-typeplasmid by hydrodynamic injection. As shown inFig. 8, mice injected with the mutant genome had sig-nificantly lower levels of viral DNA in the sera thanthose injected with the wild-type genome (Mann-Whit-ney U ¼ 27.0, P ¼ 0.030, two-tailed). These resultsdemonstrated the importance of the KLF15 response ele-ment in the core promoter in HBV replication.

Discussion

In this study, we demonstrated that the transcriptionfactor, KLF15, could activate HBV major surface andcore promoters (Figs. 1 and 2). The overexpression ofKLF15 in hepatoma cell lines increased, whereas thesuppression of KLF15 expression with RNAi reduced,the activities of HBV surface and core promoters (Fig.4). Consistent with these results, EMSAs and ChIP

assays showed that KLF15 could bind to core and sur-face promoters (Fig. 5). The role of KLF15 in HBVgene expression was also confirmed in vivo using amouse model, as we demonstrated that RNAi knock-down of KLF15 expression in the mouse liver couldlead to a significant reduction in the expression ofHBV core protein and HBsAg (Figs. 6 and 7), as wellas HBV DNA copy number in mouse sera (Fig. 8).Therefore, KLF15 is important for modulating HBVgene expression and viral load.By performing mutagenesis studies, we demon-

strated that mutations in the two Sp1-binding sites inthe surface promoter (i.e., the Z1/Z2 mutant) could

Fig. 7. Suppression of KLF15 expression decreases HBsAg and HBV DNA levels in mouse serum. (A,B) HBsAg studies. Mice were hydrody-namically injected as described in the Fig. 6 legend. Mouse sera were isolated at the time points indicated. In (A), 30 lg of the control RNAi con-struct (Ctrl) or the KLF15 RNAi construct (KLF15) were injected, and in (B), 50 lg were used. Time points with statistically significant differences arelabeled with asterisks. (C) HBV DNA studies. Mouse sera from day 5 after injection as shown in (A) and (B) were first treated with TURBO DNase(Ambion) for the removal of free DNA prior to the extraction of encapsidated HBV DNA, which was quantified by qPCR.

Fig. 8. CPm2 mutations in the HBV core promoter reduced HBVDNA level in mice. Mice were injected with pAAV-HBV1.2-CPm2 (n ¼5), which contains the CPm2 mutations, or with the parental wild-type(WT) plasmid pAAV-HBV1.2 (n ¼ 6). The plasmid, pLive-SEAP, wasused for the coinjection to monitor transfection efficiency. HBV DNAcopy numbers in mouse sera were measured by qPCR 3 days afterinjection and normalized against SEAP activity. The short bars repre-sent the median values of each group.


reduce the transactivation effect of KLF15 on this pro-moter (Fig. 1C). This observation is consistent withour ChIP assay results, which showed that these muta-tions reduced the binding of KLF15 to the surfacepromoter (Fig. 5F). Because the mutations in the Sp1sites reduced, but did not abolish, the binding ofKLF15 to the surface promoter, it is likely that theKLF15 binding sites partially overlap with the Sp1sites. The possibility that there are cryptic KLF15 siteselsewhere in the surface promoter cannot be ruled out,at present. Interestingly, however, results from theChIP assays showed that mutating the CCAAT site didnot affect KLF15 binding to the surface promoter(Fig. 5), but yet it abolished the effect of KLF15 onthis promoter (Fig. 1C). It is conceivable that KLF15needs to cooperatively interact with NF-Y, which bindsto CCAAT,12 to exert its effect on the S promoter.Using similar approaches, we also found that mutationsin the consensus KLF15 sequence in the core promotercould abolish the effects of KLF15 on the core pro-moter (Fig. 2C and D). This KLF15 binding site in thecore promoters was initially thought to be the Sp1-binding site.34 However, as we demonstrated by EMSAand ChIP assays (Fig. 5), it is also recognized byKLF15. It is possible that KLF15 and Sp1 work synerg-istically to modulate gene transcription as has beendocumented.24 Finally, mutations in the putativeKLF15-binding site in the core promoter reduced HBVDNA copy numbers in mouse sera, indicating the im-portance of this KLF15 site in HBV gene expressionand replication (Fig. 8).KLF factors regulate various important cellular func-

tions, including differentiation, apoptosis, cell prolifer-ation, and metabolism.19 KLF15 activates the expres-sion of genes involved in glucose metabolism andadipogenesis, including the insulin-sensitive glucosetransporter, GLUT4, and peroxisome proliferator-acti-vated receptor gamma.22,35 It is expressed in multipletissues, including the liver.25 Hepatic expression ofKLF15 is increased upon fasting and decreased uponfeeding.36 Interestingly, Shaul et al. have shown, in amouse model, that food deprivation induces theexpression of HBV genes, which is reversible uponrefeeding.37 Perhaps, part of the HBV activationobserved by Shaul et al. is attributable to the fasting-induced activation of KLF15. KLF15�/� mice areviable and show hypoglycemia only upon fasting.23

Therefore, inhibition of KLF15 should be amenable asa potential HBV therapeutic modality.

Acknowledgment: We thank Drs. P.J. Chen, Y.Shaul, and S. Gray for plasmids. This article is dedi-

cated to Dr. T.S. Benedict Yen, who was an inspiringmentor.

References1. Seeger C, Mason WS. Hepatitis B virus biology. Microbiol Mol Biol

Rev 2000;64:51-68.

2. Yen TS. Posttranscriptional regulation of gene expression in hepadnavi-ruses. Semin Virol 1998;8:319-326.

3. Gunther S, Piwon N, Will H. Wild-type levels of pregenomic RNAand replication but reduced pre-C RNA and e-antigen synthesis of hep-atitis B virus with C(1653) --> T, A(1762) --> T and G(1764) --> Amutations in the core promoter. J Gen Virol 1998;79:375-380.

4. Hasegawa K, Huang J, Rogers SA, Blum HE, Liang TJ. Enhanced rep-lication of a hepatitis B virus mutant associated with an epidemic offulminant hepatitis. J Virol 1994;68:1651-1659.

5. Chen M, Hieng S, Qian X, Costa R, Ou JH. Regulation of hepatitis Bvirus ENI enhancer activity by hepatocyte-enriched transcription factorHNF3. Virology 1994;205:127-132.

6. Li M, Xie Y, Wu X, Kong Y, Wang Y. HNF3 binds and activatesthe second enhancer, ENII, of hepatitis B virus. Virology 1995;214:371-378.

7. Lopez-Cabrera M, Letovsky J, Hu KQ, Siddiqui A. Transcriptional fac-tor C/EBP binds to and transactivates the enhancer element II of thehepatitis B virus. Virology 1991;183:825-829.

8. Ori A, Shaul Y. Hepatitis B virus enhancer binds and is activated bythe hepatocyte nuclear factor 3. Virology 1995;207:98-106.

9. Pei DQ, Shih CH. Transcriptional activation and repression by cellularDNA-binding protein C/EBP. J Virol 1990;64:1517-1522.

10. Raney AK, Le HB, McLachlan A. Regulation of transcription from thehepatitis B virus major surface antigen promoter by the Sp1 transcrip-tion factor. J Virol 1992;66:6912-6921.

11. Yuh CH, Ting LP. C/EBP-like proteins binding to the functional box-alpha and box-beta of the second enhancer of hepatitis B virus. MolCell Biol 1991;11:5044-5052.

12. Lu CC, Yen TS. Activation of the hepatitis B virus S promoter by tran-scription factor NF-Y via a CCAAT element. Virology 1996;225:387-394.

13. Zhou DX, Yen TS. The ubiquitous transcription factor Oct-1 and theliver-specific factor HNF-1 are both required to activate transcriptionof a hepatitis B virus promoter. Mol Cell Biol 1991;11:1353-1359.

14. Zhou DX, Yen TS. The hepatitis B virus S promoter comprises ACCAAT motif and two initiation regions. J Biol Chem 1991;266:23416-23421.

15. Chen M, Ou JH. Cell type-dependent regulation of the activity ofthe negative regulatory element of the hepatitis B virus core promoter.Virology 1995;214:198-206.

16. Zhang P, McLachlan A. Differentiation-specific transcriptional regula-tion of the hepatitis B virus nucleocapsid gene in human hepatoma celllines. Virology 1994;202:430-440.

17. Guo W, Chen M, Yen TS, Ou JH. Hepatocyte-specific expression ofthe hepatitis B virus core promoter depends on both positive and nega-tive regulation. Mol Cell Biol 1993;13:443-448.

18. Raney AK, McLachlan A. Characterization of the hepatitis B virusmajor surface antigen promoter hepatocyte nuclear factor 3 bindingsite. J Gen Virol 1997;78:3029-3038.

19. Kaczynski J, Cook T, Urrutia R. Sp1- and Kruppel-like transcriptionfactors. Genome Biol 2003;4:206.

20. Bieker JJ. Kruppel-like factors: three fingers in many pies. J Biol Chem2001;276:34355-34358.

21. Fisch S, Gray S, Heymans S, Haldar SM, Wang B, Pfister O, et al.Kruppel-like factor 15 is a regulator of cardiomyocyte hypertrophy.Proc Natl Acad Sci U S A 2007;104:7074-7079.

22. Gray S, Feinberg MW, Hull S, Kuo CT, Watanabe M, Sen-Banerjee S,et al. The Kruppel-like factor KLF15 regulates the insulin-sensitive glu-cose transporter GLUT4. J Biol Chem 2002;277:34322-34328.


23. Gray S, Wang B, Orihuela Y, Hong EG, Fisch S, Haldar S, et al. Regu-lation of gluconeogenesis by Kruppel-like factor 15. Cell Metab 2007;5:305-312.

24. Yamamoto J, Ikeda Y, Iguchi H, Fujino T, Tanaka T, Asaba H, et al. AKruppel-like factor KLF15 contributes fasting-induced transcriptionalactivation of mitochondrial acetyl-CoA synthetase gene AceCS2. J BiolChem 2004;279:16954-16962.

25. Uchida S, Tanaka Y, Ito H, Saitoh-Ohara F, Inazawa J, Yokoyama KK,et al. Transcriptional regulation of the CLC-K1 promoter by myc-associated zinc finger protein and kidney-enriched Kruppel-like factor,a novel zinc finger repressor. Mol Cell Biol 2000;20:7319-7331.

26. Huang ZM, Tan T, Yoshida H, Mori K, Ma Y, Yen TS. Activation ofhepatitis B virus S promoter by a cell type-restricted IRE1-dependentpathway induced by endoplasmic reticulum stress. Mol Cell Biol 2005;25:7522-7533.

27. Wei G, Ku S, Ma GK, Saito S, Tang AA, Zhang J, et al. HIPK2 repressesbeta-catenin-mediated transcription, epidermal stem cell expansion, andskin tumorigenesis. Proc Natl Acad Sci U S A 2007;104:13040-13045.

28. Xu Z, Yen TS, Wu L, Madden CR, Tan W, Slagle BL, et al. Enhance-ment of hepatitis B virus replication by its X protein in transgenicmice. J Virol 2002;76:2579-2584.

29. Zheng Y, Li J, Ou JH. Regulation of hepatitis B virus core promoterby transcription factors HNF1 and HNF4 and the viral X protein.J Virol 2004;78:6908-6914.

30. Lu CC, Chen M, Ou JH, Yen TS. Key role of a CCAAT element inregulating hepatitis B virus surface protein expression. Virology 1995;206:1155-1158.

31. Keasler VV, Hodgson AJ, Madden CR, Slagle BL. Enhancement ofhepatitis B virus replication by the regulatory X protein in vitro andin vivo. J Virol 2007;81:2656-2662.

32. Keasler VV, Hodgson AJ, Madden CR, Slagle BL. Hepatitis B virusHBx protein localized to the nucleus restores HBx-deficient virus repli-cation in HepG2 cells and in vivo in hydrodynamically-injected mice.Virology 2009;390:122-129.

33. Huang LR, Wu HL, Chen PJ, Chen DS. An immunocompetent mousemodel for the tolerance of human chronic hepatitis B virus infection.Proc Natl Acad Sci U S A 2006;103:17862-17867.

34. Zhang P, Raney AK, McLachlan A. Characterization of functional Sp1transcription factor binding sites in the hepatitis B virus nucleocapsidpromoter. J Virol 1993;67:1472-1481.

35. Mori T, Sakaue H, Iguchi H, Gomi H, Okada Y, Takashima Y, et al.Role of Kruppel-like factor 15 (KLF15) in transcriptional regulation ofadipogenesis. J Biol Chem 2005;280:12867-12875.

36. Teshigawara K, Ogawa W, Mori T, Matsuki Y, Watanabe E, HiramatsuR, et al. Role of Kruppel-like factor 15 in PEPCK gene expression inthe liver. Biochem Biophys Res Commun 2005;327:920-926.

37. Shlomai A, Paran N, Shaul Y. PGC-1alpha controls hepatitis B virusthrough nutritional signals. Proc Natl Acad Sci U S A 2006;103:16003-16008.


Documents

Krüppel-like factor 15 activates hepatitis B virus gene expression and replication