Leishmania Subtilisin Is a Maturase for the TrypanothioneReductase System and Contributes to Disease Pathology*□S

Received for publication, February 16, 2010, and in revised form, July 13, 2010 Published, JBC Papers in Press, July 30, 2010, DOI 10.1074/jbc.M110.114462

Ryan K. Swenerton‡, Giselle M. Knudsen‡§, Mohammed Sajid‡¶, Ben L. Kelly‡�, and James H. McKerrow‡1

From the ‡Department of Pathology, Sandler Center for Drug Discovery, and the §Department of PharmaceuticalChemistry, University of California, San Francisco, California 94158, the ¶Leiden University Medical Centre,2333 ZA Leiden, The Netherlands, and the �Department of Microbiology, Louisiana State University Health SciencesCenter, New Orleans, Louisiana 70112

Proteases are a ubiquitous group of enzymes that play keyroles in the life cycle of parasites, in the host-parasite relation-ship, and in the pathogenesis of parasitic diseases. Furthermore,proteases are druggable targets for the development of newanti-parasitic therapy. The subtilisin protease (SUB; Clan SB, familyS8) of Leishmania donovani was cloned and found to possess aunique catalytic triad. This gene was then deleted by geneknock-out, which resulted in reduced ability by the parasite toundergo promastigote to amastigote differentiation in vitro.Electron microscopy of SUB knock-out amastigotes revealedabnormalmembrane structures, retained flagella, and increasedbinucleation. SUB-deficient Leishmania displayed reduced vir-ulence in both hamster andmurine infection models. Histologyof spleens from SUB knock-out-infected hamsters revealed theabsence of psammoma body calcifications indicative of thegranulomatous lesions that occur during Leishmania infection.Todelineate the specific role of SUB in parasite physiology, two-dimensional gel electrophoresis was carried out on SUB�/� ver-suswild-type parasites. SUBknock-out parasites showed alteredregulation of the terminal peroxidases of the trypanothionereductase system. Leishmania and other trypanosomatids lackglutathione reductase, and therefore rely on the novel trypano-thione reductase system to detoxify reactive oxygen intermedi-ates and to maintain redox homeostasis. The predominant try-paredoxin peroxidases were decreased in SUB�/� parasites, andhigher molecular weight isoforms were present, indicatingaltered processing. In addition, knock-out parasites showedincreased sensitivity to hydroperoxide. These data suggest thatsubtilisin is the maturase for tryparedoxin peroxidases and isnecessary for full virulence.

Protozoan parasites of the genus Leishmania cause a varietyof vector-borne diseases in vertebrates, including cutaneous,mucocutaneous, and visceral leishmaniases in humans. Due tothe lack of safe and effective treatments for this disease, leish-maniasis is classified by the World Health Organization as aTropical Disease Research Category I disease, an emerging or

uncontrolled disease (1). This kinetoplastid parasite has a rela-tively simple dimorphic life cycle consisting of promastigoteand amastigote stages. Leishmania promastigotes multiplyextracellularly as spindle-shaped flagellates in themidgut of thephlebotomine sandfly vector. The parasites are then transmit-ted to a mammalian host when an infected sandfly bites to takein a bloodmeal. In the naïve host the parasites infectmacrophagesand differentiate into amastigotes. This form of the parasite is anovoid intracellular aflagellate. Throughout its life cycle, Leishma-nia is exposed to a variety of reactive oxygen species that it mustdetoxify to survive. Antioxidant defense is particularly importantfor amastigotes, because theymust also survive the oxidative burstgenerated by the host macrophages (2).Recent advances in parasite molecular biology and bioinfor-

matics have enabled us to strategically identify and study Leish-mania proteins as therapeutic targets. Parasite proteases areviable drug targets, because many of them are required for thepathogenic life cycle of the parasite (3, 4).We have identified anunusual Clan SB, family S8 subtilisin-like serine protease inLeishmania as one of these therapeutic targets. This family ofendopeptidases is conserved across all biological kingdoms (5).Subtilisins are protein-processing enzymes and known viru-lence factors for both Plasmodium and Toxoplasma parasites(6). In Plasmodium falciparum a subtilisin-like serine proteaseis required for erythrocyte egress by infectiousmerozoites (7, 8)and is believed to be the convertase for the maturation of mer-ozoite surface protein 1 and SERA proteins (9, 10). In Toxo-plasma gondii a subtilisin is involved in rhoptry organelle pro-tein processing (11, 12).In this study we describe the identification and phenotypic

characterization of Leishmania subtilisin. This protease wasfound to process the terminal peroxidases of the trypanothionereductase system. This system plays an important role in Leish-mania survival within host macrophages and is being intenselystudied as a target for antiparasitic drug development (13). Thisstudy has found that subtilisin is an important regulator of thissystem and is key for parasite infectivity and virulence.

EXPERIMENTAL PROCEDURES

Animals and Parasite Strains—Commercially bred, 6- to8-week-old, female BALB/cmice (Musmusculus) were used forthe murine footpad infection model (Charles River Laborato-ries International, Inc., Davis, CA). Commercially bred, 4- to5-week-old, male Golden Syrian hamsters (Mesocricetus aura-tus) were used for the visceral infection model (Simonsen Lab-

* This work was supported by a National Science Foundation GraduateResearch Fellowship and the Sandler Foundation.

□S The on-line version of this article (available at http://www.jbc.org) containssupplemental Fig. S1.

1 To whom correspondence should be addressed: 1700 4th St., Box 2550,UCSF QB3, San Francisco, CA 94158-2550. Tel.: 415-476-2940; Fax: 415-502-8193; E-mail: James.McKerrow@ucsf.edu.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 285, NO. 41, pp. 31120 –31129, October 8, 2010© 2010 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

31120 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 41 • OCTOBER 8, 2010

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

oratories, Inc., Gilroy, CA). Leishmania donovani donovaniMHOM/ET/67/HU3 cloned stock andLeishmaniamajorLV39MRHO/SU/59/P were used for knock-out studies and for ani-mal infections. Leishmania promastigotes were cultured at27 °C in M199 (Sigma) liquid medium as previously described(14). Axenic amastigotes of L. donovani were cultured at 37 °Cin 100% fetal bovine serum (Omega Scientific Inc., Tarzana,CA) as previously described (15).Subtilisin Cloning and Sequencing—Genomic DNA from L.

donovani was isolated as previously described (16). The sub-tilisin gene was then amplified from this genomic DNA byPCR using the Expand High Fidelity PCR System (RocheDiagnostics, Indianapolis, IN) in two overlapping pieces,termed the 5� and 3� halves. For each half, an external primerfrom the non-coding flanks of the gene and an internalprimer were designed based on regions of identity betweenthe known L. infantum and L. major sequences (Sanger Insti-tute GeneDB: LinJ13_V3.0940 and LmjF13.1040). Bothhalves were cloned into the pGEM-7Zf(�) vector (Promega,Madison, WI) and then spliced together using an internalHindIII site. The open reading frame was sequenced usingthe following primers: 5�-CAT GCA TCA GCC GGT AC-3�,5�-GCG GCA TGG TCA TCT AC-3�, 5�-TAC TCA CAATCT CTA CG-3�, 5�-CAC CAG TAA GAG TGC GG-3�,5�-GAA GAG CCG CCA CCG TG-3�, 5�-CGT GCT GGCAGG ACA GC-3�, 5�-TCC TCT TTG AGG GTG CG-3�,5�-TAG CCA TAG CCC ACC GC-3�, 5�-CTC CTC TTTGAG GGT GC-3�, 5�-CGC TCT GTC TCG AGG CG-3�,5�-GTG TGG GGC AGC GGC AG-3�, 5�-ACC GTT GGCTGT CAG AG-3�, 5�-CGT TAG GAG ACG CCG CA-3�,5�-CGT CGT CAG CAC AAG AG-3�, 5�-ACC CAC CTTCCG CTT CG-3�, 5�-GTG CCA GCA GAC CAC GG-3�,5�-TAG GCA GCG GTG CCG AC-3�, 5�-AAC GGC AGCAGG CTC TC-3�, 5�-GTC GGC ACC GCT GCC TA-3�,5�-ATC GGC TAT AGG ATT CC-3�, 5�-CAG TAG CCCGCA GGT GC-3�, 5�-CGT TGT CTG TGC CGA CC-3�, and5�-ACT GAT CAG CCA AGG CG-3�. The amino acid sequenceof L. donovani subtilisin catalytic core was identified using Pfam(accession number PF00082, Subtilase family) and was alignedwith homologous sequences from L. infantum, L. major, L. bra-ziliensis, T. cruzi (1 and 2), T. brucei (1 and 2), P. falciparum (1, 2,and 3), T. gondii (1a, 1b, and 2), B. licheniformis, B. amyloliquefa-ciens, B. subtilis,H. sapiens (furin and Site-1),M.musculus, S. cer-evisiae, S. pombe,C. intestinalis,A.mellifera,X. laevis, andD. rerio(respectively: LinJ13_V3.0940, LmjF13.1040, LbrM13_V2.0860,Tc00.1047053511045.40, Tc00.1047053511859.60, Tb11.02.1280,Tb927.3.4230, CAD51440, XP_001348051, CAD51437, XP_002370002, XP_002368971, XP_002364650, P00780, P00782,P04189, P09958, EAW95506, P23188, P13134, Q09175, XP_002122807, XP_395754, NP_001087381, and CAK04389) usingthe ClustalW algorithm from MegAlign (DNASTAR, Madison,WI).Expression and Purification of Recombinant SUB from Pichia

pastoris—Transformation constructs were generated by PCRamplification of L. donovani and L. major SUB2 cores, adding a

5� SalI site (bold) followed by a Kex2 cleavage site (underlined)and a 3� SpeI site (underlined bold) using forward (L.d.: 5�-CTCGTC GAC AAA AGA GCA CAC CGT TCC ACA GAT GCG-3�;L.m.: CTCGTCGACAAAAGAGCACGCCGTTCCACCGAT GCG) and reverse (L.d.: 5�-CTC ACT AGT TCA ACACGGGCAAGTCGATTCTGAC-3�;L.m.: 5�-CTCACTAGTTCA ACA CGA GAG AGT CGA TTC TGA CG-3�) primers,and then cloned into pPICZa A (Invitrogen). The pPICZ�-SUBconstructs were electroporated into X-33 P. pastoris, andexpression clones were isolated and induced for 96 h as per themanufacturer’s protocol. For each L. donovani and L. majorSUB, three clones were independently evaluated for proteaseactivity. Supernatant from induced cultures was harvested bycentrifugation at 3,000 � g for 10 min, followed by 0.2-�mfiltration (Nalge Nunc). Expressed SUB protein was then buffer-exchanged with 50 mM Tris-HCl, pH 7.5, and concentratedon an Amicon Ultra-4 10,000 NMWL filter device (Millipore,Billerica, MA). This concentrate was then fractionated byhydrophobic interaction. The sample was diluted 1:1 to a finalbuffer concentration 30 mM Tris-HCl, pH 8.0, with 1 M ammo-nium sulfate and loaded onto a HiTrap Octyl-Sepharose 4FFhydrophobic interaction column (Amersham Biosciences). A10mMTris-HCl, pH 8.0, buffer with 1M ammonium sulfate wasused for column equilibration, sample loading, andwashing at a1 ml/min flow rate. The ammonium sulfate concentration wasdecreased from1–0Mover 40 columnvolumes to elute the SUBprotein. The eluate was desalted by buffer exchanging with 50mM Tris-HCl, pH 7.5, and concentrated by Amicon. SUB pro-tein concentration was measured by inhibitor titration withPPACK (H-D-Phe-Pro-Arg-CMK) and NanoDrop 1000.

Protease activity was measured using peptide substrates con-taining C-terminal 7-amino-4-carbamoylmethylcoumarin (AMC)as the fluorogenic leaving group. The synthetic substrates Z-VFRSLK-AMC, Z-RVRR-AMC, and Z-RR-AMC were used. Ini-tial test reactions contained 20 �M substrate. For Km determina-tion VFRSLK was serially diluted from 100–0.05 �M, and RVRRwas serially diluted from 20 to 0.025 �M. Enzyme samples weremixedwith substrate in50mMTris-HCl, pH7.5,with0.2%DMSOin 150 �l of total volume. Hydrolysis of the substrates was mea-sured at 25 °C using a FlexStation microplate spectrofluorometer(Molecular Devices, Sunnyvale, CA). Excitation/emission forAMC and 7-amino-4-carbamoyl-methylcoumarin were 355/460nm and 380/460 nm, respectively. Vmax values were calculatedusing the accompanying SoftMax Pro v4.8 software.Southern and Northern Blot Analyses—For Southern blot

analysis, genomic DNA was digested with indicated restrictionendonucleases (New England Biolabs, Ipswich, MA and RocheDiagnostics, Indianapolis, IN), and fragments were separatedby electrophoresis on a 0.6% agarose gel (17). These were thentransferred to Hybond-N� (Amersham Biosciences) nylon fil-ters by the manufacturer’s instructions for alkali transfer.Southern blot probes were 32P-labeled using a Rediprime IIRandom Prime Labeling System (Amersham Biosciences) asper the manufacturer’s instructions. Hybridization and wash-

2 The abbreviations used are: SUB, subtilisin; AMC, 7-amino-4-methylcouma-rin; Site-1, membrane-bound transcription factor peptidase; TR, trypano-

thione reductase; TS2 and T(SH)2, oxidized and reduced trypanothione;TXN, tryparedoxin; TXNPx, tryparedoxin peroxidase; Prx, peroxidoxin; Z,benzyloxycarbonyl.

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

OCTOBER 8, 2010 • VOLUME 285 • NUMBER 41 JOURNAL OF BIOLOGICAL CHEMISTRY 31121

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

ing conditions were performed as previously described (18).RNA was isolated from L. donovani promastigotes and axenicamastigotes (19). RNA (5 �g/lane) was size-fractionated, andNorthern blot hybridization was performed as previouslydescribed.Constructs for Targeted Gene Deletion of SUB—Two knock-

out cassettes (one for each allele) were created to delete the L.donovani and L. major SUB genes. These cassettes each con-tained an antibiotic resistance gene, hygr (conferring hygromy-cin B resistance) (20), pacr (conferring puromycin resistance,used for L. donovani only) (21), or satr (conferring nourseothri-cin resistance, L. major only) (22), followed by 1.5 kb of the3�-untranslated region of the L. major dhfr-ts gene (23). Thisuntranslated region ensures high level expression during thelife cycle of Leishmania. To target these knock-out cassettes tothe SUB locus, 5� and 3� targeting flanks were created andligated into their respective sides of the cassettes. These target-ing flanks were generated by PCR amplification of the untrans-lated regions directly 5� of the SUB ORF and 3� of the SUBcatalytic core (L. donovani) or 3� of the ORF (L. major). PCRprimers were designed based on the published L. infantum andL. major sequences (GeneDB): L. donovani 5� flank forward(5�-CTCACTAGT CGC CTC CTCGTCGTCGCACTC-3�)and reverse (5�-CTC TCT AGA CAC CAC TAC CTC AATCGG AGC G-3�) (1.3-kb fragment), 3� flank forward (5�-CTCACT AGT TGG TCA TCT ACG TCC GCT GTA GC-3�) andreverse (5�-CTC TCT AGA CGT GCC CTG ATC TGC GGCAGC-3�) (0.7-kb fragment); L. major 5� flank forward (5�-CTCACT AGT TGC GCA ACC ACA GCG GTC ATC-3�) andreverse (5�-CTC TCT AGA TAC CTC AAT GGG AGC GTGCTT G-3�) (1.5-kb fragment), 3� flank forward (5�-CTC ACTAGT TCG TTG GAG AGG CCA ACG CGC-3�) and reverse(5�-CTC TCT AGA CGA GTA GGA AGA GGT GAC CGTC-3�) (0.8-kb fragment) primers (SpeI sites, in bold, and XbaIsites, underlined, were included for cloning). These constructswere maintained and amplified in the pGEM-9Zf(�) vector(Promega). For targeted gene deletion, 50 �g of the targetingconstructs was excised from their vectors using the flankingrestriction endonucleases SpeI and XbaI (New England Bio-labs) and purified by electrophoresis on 0.8% agarose gels thenpurified using the QIAEX II Gel Extraction Kit (Qiagen Inc.,Valencia, CA).Leishmania Transfections and Clone Isolation—Purified

transfection constructs described above were used to transfectlog phase Leishmania promastigotes by electroporation (2.25kV/cm, 500 microfarads) as previously described (23). Afterelectroporation, the cells were grown and selected using hygro-mycin B, puromycin, or nourseothricin on both plates and inliquid media and clones were isolated as previously described(24).Replication Rates and in Vitro Differentiation—Day 4 SUB

knock-out and wild-type parasites were split in triplicate intonew M199 (for promastigote replication rates) and into 37 °Cfetal bovine serum (for axenic amastigote replication). Parasiteculture densitieswere determined ondays 1–4post-split by cellcounting on aMultisizer 3 Coulter Counter (Beckman Coulter,Inc., Fullerton, CA). Axenic amastigote differentiation wasobserved by microscopy.

Transmission Electron Microscopy—Approximately 108 day4 L. donovani axenic amastigotes from wild-type or SUB�/�

cultures were pelleted and washed 3� in PBS. The parasiteswere processed for conventional EM by freeze-substitution in1%OsO4/0.1%uranyl acetate in acetone and embedded in Eponresin. Sections were cut with a Leica Ultracut UCT Ultramic-rotome (Leica Microsystems, Bannockburn, IL) and viewed onaTecnai T20 electronmicroscope (FEICo., Hillsboro,OR)witha 4000� 4000UltraScan charge-coupled device camera (GatanInc., Pleasanton, CA).Hamster and Mouse Infections—Hamsters were infected

intraperitoneally with 109 day 4 SUB knock-out or wild-type L.donovani promastigotes (groups of three) (25). Animals wereweighed weekly over the length of the experiment. Hamsterswere culled 200 days post-infection by CO2 inhalation followedby thoracotomy. Pieces of each spleen and liver were fixed in10% formalin in PBS and then embedded in paraffin for histol-ogy. Sections were cut at 5 �m and stained with eitherWright-Giemsa or hematoxylin and eosin by the University of Califor-nia at San Francisco (UCSF) Morphology Core using standardprotocols. Psamomma bodies were identified by microscopyand counted. Mice were infected with metacyclic L. major pro-mastigotes purified from day 4 SUB�/� and wild-type culturesusing negative selection by binding to peanut agglutinin as hasbeen previously described (26). BALB/cmice (groups of 5) wereanesthetized by isoflurane inhalation and infected subcutane-ously in the left hind footpad with 5 � 106 metacyclic promas-tigotes in 50 �l of Hanks’ balanced salt solution. Footpad swell-ing was measured weekly after inoculation using a Mitutoyocaliper. Parasites were recovered from infected mice by resec-tion of the left popliteal lymph node.Two-dimensional Gel Electrophoresis—Three experimental

replicates were prepared from separately cultured samples ofbothwild-type and SUB knock-out L. donovani. Approximately109 cells were pelleted, washed 3� with PBS, and stored at�80 °C. Lysates were prepared by resuspending the cell pelletsin 2 ml of native lysis buffer containing 20 mM HEPES, pH 7.5,250 mM sucrose, 3 mM MgCl2, 0.5% Nonidet P-40, 1 mM DTT,and 1� Halt EDTA-free protease inhibitor mixture (Pierce).Cells were then broken bymechanical lysis using 70 strokes of aDounce homogenizer. The lysates were centrifuged at 12,000�g for 20min at 4 °C, and the clarified supernatantswere dialyzedovernight against 50 mM Tris-HCl, pH 7.5, 100 mM NaCl using8-kDa molecular weight cut-off dialysis membranes. The fol-lowing day the protein samples were concentrated and washedby precipitation using the ReadyPrep 2-DCleanupKit (Bio-RadLaboratories, Inc., Hercules, CA). Approximately 300 �g ofprotein per gel was brought up to 300 �l in Bio-Rad Rehydra-tion/Sample buffer and was passively loaded onto 17-cm, 3–10pH immobilized pH gradient isoelectric focusing strips. Iso-electric focusing was performed using slow increases in voltageover multiple steps up to 10 kV for a total of 60–65 kVh focus-ing time. Next, the strips were reduced and alkylated usingsequential 10-min incubations in 2% DTT then 2.5% iodoacet-amide and dissolved in sample equilibration buffer. The iso-electric focusing strips were run in the second dimension on17 � 17 cm, 12.5% acrylamide Tris-glycine, SDS-PAGE gels.Gels were stained with SYPRO Ruby and imaged using a

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

31122 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 41 • OCTOBER 8, 2010

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

TyphoonTrioVariableMode Imager (AmershamBiosciences).These imageswere utilized for spot intensity analysis using Bio-Rad PDQuest software (v. 7.4). For proteomic analysis, gelswere silver-stained (27), and selected protein spots wereexcised and in-gel-digested with trypsin (28, 29). The resultingpeptideswere extracted and analyzed by on-line liquid chroma-tography/mass spectrometry using an Eksigent nanoflow pump(Dublin, CA) coupled to a QStar Pulsar quadrupole orthogonalacceleration, time-of-flight hybrid instrument (Applied Biosys-tems, Foster City, CA). The reversed-phase chromatographiccolumn was controlled with a Famos autoinjector (Sunnyvale,CA) and Eksigent software to run at a 5–50% acetonitrile gradientin0.1%formicacidwitha350nl/min flowrate.Datawereanalyzedin Analyst 2.0 software (Applied Biosystems) with the Mascotscript 1.6b20 (Matrix Science, London, UK). Analyst-processingoptions for peak finding in spectrumwere 0.5% default threshold,400Gaussian filter, and aGaussian filter limit of 10; for TOF auto-centroiding: 20 ppm merge distance, 10 ppm minimum width,50% percentage height, and 100 ppm maximum width. Defaultparameters were used except that “no de-isotoping” was selectedandprecursormass tolerance for groupingwas set to0.2.Databasesearches were performed using ProteinProspector v. 5.3.0 (avail-able on-line) using the Batch-Tag and Search Compare modules(30). Searches were performed on the SwissProt databank(December16, 2008) to evaluate samplepurity followedby search-ing TriTrypDB v. 1.0 beta (available on-line, January, 2009).Hydroperoxide Sensitivity Assay—These assays were per-

formed as was previously described (31). Stationary phaseLeishmania promastigotes were split into 2-mlM199 at 2� 106per ml in the presence of different concentrations tert-butylhy-droperoxide (Sigma). Culture densities were determined after5–6 days by using the Coulter Counter. Relative density wascalculated by normalizing to untreated controls.

RESULTS

L. donovani SUBUses aNon-canonical Catalytic Triad—Thegene encoding L. donovani SUBwas cloned as described above.Sequencing yielded a 5,235-bp gene. This sequencewas submit-ted to GenBankTM with accession number ADA81891. Theresultant 1,744-amino acid protein has an estimated molecularmass of 184.7 kDa. This protein has a predicted signal peptide(SignalP V2.0 HMM probability of 0.995) with a cleavage sitebetween amino acids 38–39 (0.421 probability), and a probableC-terminal transmembrane helix between amino acids 1709–

1731 (TMHMM v. 2.0). The published L. major SUB (GeneDB:LmjF13.1040) shares this general layout; however, SUB fromthe more closely related L. infantum (a subspecies from withinthe L. donovani complex) has a C-terminal truncation afteramino acid 1192 (LinJ13_V3.0940). The Pfam predicted Subti-lase family core for L. donovani SUB is between amino acids86–414. Comparisons of L. donovani SUB to other trypanoso-matid SUBs are summarized in Table 1. Interestingly, L. dono-vani SUB has a non-canonical catalytic triad with the catalyticGlu in place of the standardAsp due to a single C toG base parechange. L. infantum SUB also has Glu in place of the Asp, indi-cating that this adaptation may be specific to parasites in the L.donovani complex. The SUB catalytic core amino acidsequences are relatively conserved within the Leishmania spe-cies; however, these sequences have diverged considerablyfrom those of the trypanosomes, with only a 40% identitybetween the genera.To determine the subfamily of Leishmania subtilisin, the cat-

alytic core sequence was comparedwith the cores of other ClanSB, family S8 family members. Core sequences were alignedusingClustalW2 (EMBL-EBI), and a phylogenetic tree was gen-erated (Fig. 1). The Leishmania SUBs group with the subfamilyS8A proteases, which include the eukaryotic Site-1 peptidasesand the bacterial subtilisins. This distinguishes LeishmaniaSUB from theToxoplasma andPlasmodium SUBs and from thesubfamily S8B kexins and furins. Site-1 peptidases are restrictedto metazoan organisms and are known to process sterol regu-latory element binding proteins, which are not found intrypanosomatids (32).L. donovani and L. major SUBs Were Recombinantly

Expressed in P. pastoris—The catalytic cores of the subtilisinproteins from L. donovani and L. major were successfullyrecombinantly expressed. Site-1 proteases, to which Leishma-nia SUB is most similar, have a requirement for a lysine orarginine in the P4 position. For this reason SUB activity wasevaluated using synthetic substrates with and without P4 Arg.Cleavage of the synthetic substrates RVRR and VFRSLK wasdetected in all of the SUB-expressing Pichia supernatants com-pared with the X-33 background strain. Slight activity againstthe RR substrate was only detected in one L.major clone. In thisclone the RVRR Vmax was over six times that of RR. Poor cleav-age of RR and the lack of detected protease activity in the X-33control strain indicate that the cleavage is not due to endoge-

TABLE 1Comparison of predicted SUB proteins from trypanosomatidsL. donovani SUB was compared to the other known trypanosomatid SUB protein sequences using ClustalW2. The catalytic cores of each protein were determined byaligning themwith the Pfam Subtilase family core (PF00082). Subtilisins have the catalytic triad Asp-His-Ser. L. donovani SUB has a non-canonical catalytic triad with a Gluin place of the standard Asp due to a single C to G base pair change. L. infantum SUB also has Glu in place of the Asp, indicating that this adaptation may be specific toparasites in the L. donovani complex. The SUB catalytic core amino acid (aa) sequences are relatively conserved within the Leishmania species; however, these sequenceshave diverged considerably from those of the trypanosomes, with only a 40% identity between the genera. L. infantum has a truncated C terminus. All the trypanosomatidSUB proteins fall between 126 and 191 kDa.

Species Gene aa identity Core identity Length Molecular mass Catalytic triad

% % aa kDaL. donovani SUB 100.0 100.0 1744 184.7 Glu-97, His-130, Ser-395L. infantum SUB 99.6 99.7 1192 126.2 Glu-97, His-130, Ser-395L. major SUB 89.0 94.5 1722 182.7 D99, His-132, Ser-397L. braziliensis SUB 70.0 83.0 1785 190.7 D97, His-130, Ser-405T. cruzi SUB1 23.1 40.3 1430 160.5 D219, His-269, Ser-502T. cruzi SUB2 23.4 40.1 1408 158.0 D196, His-246, Ser-480T. brucei SUB1 24.4 39.5 1487 161.5 D191, His-238, Ser-476

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

OCTOBER 8, 2010 • VOLUME 285 • NUMBER 41 JOURNAL OF BIOLOGICAL CHEMISTRY 31123

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

nous KEX2. These results show that, like the Site-1 proteases,Leishmania SUB prefers a basic P4 residue. L. donovani and L.major SUB was isolated from the Pichia supernatants, and kcatand Km values were determined for both RVRR and VFRSLKsubstrates (Table 2). Both enzymes catalyzed the RVRR sub-strate at about a 10-fold faster rate than VFRSLK. The L. dono-vani SUB had a similar affinity for both substrates, whereas L.major SUBhad a 10-fold higher affinity for RVRR. Interestingly,L. donovani SUB had a much lower rate of catalysis for eachsubstrate (126- and 62-fold lower for RVRR and VFRSLK,respectively) when compared with L. major SUB. This differ-ence could potentially be due to the non-canonical catalytictriad of L. donovani.Subtilisin (SUB) �/� Parasites Have Defects in Promastigote

to Amastigote Differentiation—The published L. major and L.infantum genomes (GeneDB) indicate thatLeishmania sp. con-tain a single copy of SUB per haploid genome. This was con-firmed to be true in L. donovani and L. major by Southern blotanalysis of genomic DNA (data not shown). Deletion of bothalleles of the single copy gene was carried out by two rounds oftargeted gene replacement in L. donovani and confirmed bySouthern blot (Fig. 2). Only one allele could be deleted from L.major despite multiple attempts at targeting the second allele.Wild-type, SUB�/�, and �/� L. donovani promastigotes

were cultured at 27 °C in M199. These parasites replicated at arate comparable to wild-type parasites. To test for the ability to

differentiate into axenic amastigotes, stationary phase (day 5post-split) promastigotes were split 1:10 in FBS at 37 °C. Wild-type and SUB�/� parasites differentiated readily, howeverSUB�/� did not (Fig. 3). The SUB�/� parasites remained aselongated, flagellated spindles. These cells did not form aggre-gates of cells typically seen in axenic amastigote cultures. Totest for differentiation under lower dilution conditions, station-ary phase SUB�/� promastigotes were diluted 1:2 in FBS at37 °C. After 4 days, some of the cells appeared to differentiate;however, cell aggregation did not occur.ElectronMicroscopy of SUB�/�Amastigotes RevealedAbnor-

mal Ultrastructures—Wild-type and SUB�/� axenic amastig-otes from the low dilution differentiation were processed fortransmission electron microscopy. Wild-type axenic amastig-otes had typical amastigote morphology: a rounded cell bodymeasuring �3 �m in diameter, no external flagellum, and acondensed electron-dense kinetoplast (Fig. 4A). SUB�/� axenicamastigotes exhibited many abnormalities (Fig. 4, B–D).Although most of these cells had rounded cell bodies, manywere still elongated and spindle-shaped. Those that wererounded often had invaginations in the plasma membrane.Additionally, many of these cells were binucleated. Unlikethe wild-type amastigotes, the SUB�/� cells also had multi-ple flagellar cross sections, including flagella appearing inthe cytoplasm, outside of their expected location within theflagellar pocket. These images indicate that the SUB�/� cells

were not successfully differentiat-ing into amastigotes.SUBRegulatesLevels of Peroxidases

from the Trypanothione ReductaseSystem—Site-1 peptidases and thesubtilisins from apicomplexan para-sites such as Toxoplasma and Plas-modium are maturases that processproteins within vesicles (9, 11, 33).The presence of a signal peptide andC-terminal transmembrane domainon Leishmania SUB indicates thatitmayperforma similar function.Weemployed two-dimensional gel elec-trophoresis to study the main differ-ences in protein expression and pro-cessing between wild-type andSUB�/� parasites. Gels were run intriplicate (Fig. 5). On average, gelshad �325 well defined spots, a valuetypical for two-dimensional gels ofthis size. These protein species repre-

FIGURE 1. The catalytic cores of the Leishmania subtilisins were compared with the cores of other Clan SB,family S8 family members, as determined by Pfam. Core sequences were aligned using ClustalW2 (EMBL-EBI). The Leishmania SUBs group with the subfamily S8A proteases, which include the eukaryotic Site- 1 pep-tidases and the bacterial subtilisins. This distinguishes Leishmania SUB from the Toxoplasma and PlasmodiumSUBs and from the subfamily S8B kexins and furins.

TABLE 2Kinetic analysis of L. donovani and L. major SUBThe catalytic cores of L. donovani and L. major SUBs were recombinantly expressed in P. pastorisX-33. Isolated and concentrated proteases were tested for activity againstthe synthetic fluorogenic substrates RVRR and VFRSLK. Km and kcat parameters were calculated for each substrate using both enzymes. Both enzymes had a higher rate ofcatalysis for the RVRR substrate over VSRSLK. In addition, L. major SUB had a much higher rate of catalysis compared to L. donovani SUB for both substrates.

AMC substrateL. donovani SUB L. major SUB

kcat Km kcat/Km kcat Km kcat/Km

S�1 �M S�1 �M�1 S�1 �M S�1 mM�1

RRVR 2.19 � 10�3 1.20 1.83 � 10�3 2.78 � 10�1 5.64 4.93 � 10�2

VFRSLK 1.88 � 10�4 0.91 2.07 � 10�4 1.17 � 10�2 50.21 2.33 � 10�3

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

31124 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 41 • OCTOBER 8, 2010

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

sentup to4%of thepredicted8,195protein-codinggenes fromtheL. donovani complex (34). Spots that differed in intensity betweenthe wild-type and SUB�/� parasites were selected for peptidesequencing bymass spectrometry. The identities of these proteinsare presented in Table 3. Interestingly, nine distinct spots werefound to be tryparedoxin peroxidases, the terminal peroxidases ofthe trypanothione reductase system. In the L. donovani complex,this family of peroxidases is comprised of three cytoplasmic try-paredoxin peroxidases encoded in a multigene array, TXNPx1–3(TRYP1–3), and a mitochondrial peroxidoxin, Prx (35). Interest-ingly, L. major encodes seven cytoplasmic tryparedoxin peroxi-

FIGURE 2. Successful deletion of both genomic copies of the SUB genewas determined by Southern blot analysis. Digested genomic DNA fromwild-type, single-copy, and double-copy knockouts were analyzed at the SUBlocus for the presence of either the wild-type locus or the knock-out cassette.The blot was stripped and re-probed for the core of the SUB gene itself toensure that the gene was not relocated to another site in the genome.

FIGURE 3. Wild-type, SUB�/�, and �/� L. donovani promastigotes werecultured successfully at 27 °C in M199. To test for the ability to differentiateinto axenic amastigotes, stationary phase (day 5 post-split) promastigotes ofeach culture were split 1:10 in FBS at 37 °C. Wild-type and SUB�/� parasitesdifferentiated readily, however SUB�/� did not. The SUB�/� parasitesremained as elongated, flagellated spindles. These cells did not form aggre-gates of cells typically seen in axenic amastigote cultures.

FIGURE 4. Wild-type axenic amastigotes (A) had normal rounded cell bod-ies measuring �3 �m in diameter (scale bar � 1 �m) with no externalflagellum and a condensed electron-dense kinetoplast. SUB�/� axenicamastigotes (B–D) exhibited many abnormalities. Although most of thesecells had rounded cell bodies, many were still elongated and spindle-shaped(D). Those that were rounded often had invaginations in the plasma mem-brane (B). Additionally, many of these cells were binucleated (C). Unlike thewild-type amastigotes, the SUB�/� cells also had multiple flagellar cross-sec-tions, including flagella appearing in the cytoplasm (B), outside of theirexpected location within the flagellar pocket (N � nucleus, K � kinetoplast,FP � flagellar pocket, and F � flagellum).

FIGURE 5. Wild-type L. donovani had high levels of TXNPx1 and -3 forminga single doublet of spots (WT spots 4 and 5, left). The level of TXNPx2 waslow (spot 3) and Prx was not detectable (spot 1). In the SUB�/� parasites (right),the wild-type TXNPx1/3 doublet decreased (SUB�/� spots 4 and 5) and twonew TXNPx1/3 doublets were present at a higher molecular weight (spots 6and 7) and at a higher molecular weight with a lower pI (spots 8 and 9). Prxlevels (spots 1 and 2) were elevated in these parasites.

TABLE 3Two-dimensional gel analysis of WT and SUB�/� LeishmaniaSpots that differed in intensity between the wild-type and SUB �/� parasites wereselected for peptide sequencing by mass spectrometry. Nine distinct spots werefound to be tryparedoxin peroxidases, the terminal peroxidases of the trypano-thione reductase system. In the L. donovani complex, this family of peroxidases iscomposed of three cytoplasmic tryparedoxin peroxidases, TXNPx1–3 (TRYP1–3),and a mitochondrial peroxidoxin.

WT SUB �/�Spot Protein Spot Protein Relative to WT

1 No Prx detected 1 Prx Elevated2 Prx Elevated

3 TXNPx2 3 TXNPx2 Same4 TXNPx1/3 4 TXNPx1/3 Decreased5 TXNPx1/3 5 TXNPx1/3 Decreased

6 TXNPx1/3 Elevated7 No TXNPx detected 7 TXNPx1/3 Elevated

8 TXNPx1/3 Elevated9 TXNPx1/3 Elevated

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

OCTOBER 8, 2010 • VOLUME 285 • NUMBER 41 JOURNAL OF BIOLOGICAL CHEMISTRY 31125

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

dases, TXNPx1–7, in addition to the single Prx. Theseenzymes are all 2-Cys peroxiredoxins and have complemen-tary roles in parasite protection against oxidative stress (31).L. donovani TXNPx1 and -3 share 99% amino acid identityand have 94% identity to TXNPx2 (GeneDB).Spot densitometry was performed on the peroxidase spots in

triplicate. Wild-type L. donovani had high levels of TXNPx1and -3 forming a single “wild-type doublet” of spots. The level ofTXNPx2 was low and Prx was not detectable. In the SUB�/�

parasites, theTXNPx1/3wild-type doublet decreased (to�35%of the wild-type spot density), and two newTXNPx1/3 “mutantdoublets” were present at a higher molecular weight and at ahigher molecular weight with a lower pI. In addition, Prx levelswere elevated in these parasites, which could be a compensa-tion for the decreased level of wild-type TXNPx1/3. TXNPx2spot density was not significantly different between the wild-type and SUB�/�. The range of mass spectrometry amino acidcoverage was nearly complete for all TXNPx spots (sup-plemental Fig. S1), with the notable exception of the wild-typedoublet spots 4 and 5 for bothWT and SUB�/�. For these spotsthe C-terminal 20 amino acids were never detected, despitehigh protein abundance and the fact that these amino acidswere detected in the higher molecular weight doublets. Thesedata suggest that the lower molecular weight wild-type doubletis C-terminally cleaved. The molecular weight shift of themutant doublets is �2 kDa, which is consistent with the reten-tion of the 20-amino acid C terminus.SUB Knock-out Parasites Have Increased Sensitivity to Oxi-

dativeDamage—Proteomic analysis of SUB-deficientLeishma-nia indicated that SUB is required for normal regulation of thetrypanothione reductase system. Alteration of this systemwould hinder the parasite’s ability to detoxify hydroperoxidesand thus render it more sensitive to oxidative damage (13). Toevaluate sensitivity of wild-type and SUB-deficient Leishmaniato oxidative damage, a hydroperoxide sensitivity assay was per-formed (Fig. 6). As expected, SUB knock-out Leishmania wassignificantly more sensitive to hydroperoxide compared withwild type. In 100 �M tert-butylhydroperoxide, wild-type para-sites were over 60% viable while SUB knock-out parasites cul-tures had less than 10% viability.Loss of SUB Results in Delayed Lesion Formation inMice and

the Absence of Psammoma Body Lesions in Hamsters—Withinthe host,Leishmania is exposed to a variety of oxidative stressesparticularly within host macrophages. It was predicted thatSUB-deficient parasites would have reduced virulence in ani-mal infection models due to the altered regulation of thetrypanothione reductase system. Indeed, SUB-deficient Leish-mania were found to be less virulent in both the mouse andhamster systems.BALB/c mice were infected subcutaneously into their left

hind footpads with either wild-type or SUB-deficient parasites.Footpad swelling was measured weekly (Fig. 7A). Swelling wasevident in the wild-type-infected mice after 7 weeks; however,significant swelling (compared with the contralateral footpad)was not observed in mice infected with SUB-deficient parasitesuntil after 14weeks. The SUB-deficient infectionswere not self-limiting and continued to increase footpad swilling, however

the lesion size was consistently 7–8 weeks delayed comparedwith the wild-type infections.For the visceral leishmaniasis infection model, male Golden

Syrian hamsters were infected intraperitoneally with wild-typeor SUB-deficient parasites. At 200 days post-infection, thehamsters were sacrificed, and their spleens were sectioned andhistologically examined. Spleens were enlarged in both wild-type- and knock-out-infected animals. All wild-type-infectedhamsters’ spleens contained psammoma body calcifications(Fig. 7, B andC), indicative of granulomatous lesions that occurin visceral leishmaniasis (36, 37). Strikingly, no psammomabodies were observed in the spleens of hamsters infected withSUB-deficient Leishmania (Fig. 7, D and E).

DISCUSSION

Leishmania is a dimorphic parasite that must survive andreplicate in two vastly different environments: the gut of a phle-botomine sandfly and within the parasitophorous vacuole inphagocytic cells of vertebrates. Throughout this life cycle, theparasite is exposed to a variety of oxidative insults, including thereactive oxygen species produced by host macrophages. Anti-oxidant defense is therefore extremely important for parasitesurvival. Leishmania, along with the other kinetoplastids, usesan unusual hydroperoxide metabolic pathway, the trypano-thione reductase system, which employs trypanothione as themain transporter of electrons (38). This system has been iden-tified as an important target for antiparasitic drug develop-ment. Our research has shown that Leishmania parasites con-tain an unusual subtilisin-like enzyme that governs the levels ofkey peroxidases in the trypanothione reductase system. Thisserine protease, therefore, represents a potential target forrational drug design (39, 40).Wehave identified and cloned anovel subtilisin-like protease

from the parasite L. donovani. Phylogenetic sorting of knownsubtilisin catalytic cores showed that the Leishmania SUBs fallwithin the subfamily S8A and are most closely related to site-1proteases. Interestingly, L. donovani (and the related L. infan-tum) SUB has a non-canonical catalytic triad. Clan SB serine

FIGURE 6. Leishmania major promastigote replication was measured inthe presence of varying concentrations of tert-butylhydroperoxide.Wild-type (black squares) and SUB-deficient (dark gray squares) were grown tostationary phase and counted on a Multisizer 3 Coulter Counter. Values areexpressed as the percent culture density relative to the untreated controls.

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

31126 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 41 • OCTOBER 8, 2010

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

proteases use an Asp-His-Ser triad, whereas L. donovani com-plex SUBs use a Glu in place of the Asp. Glu and Asp are iden-tical save for one additional carbon in the side chain of Glu.Subtilisins are known to be pliable enzymes; however, a searchof theMEROPS database has shown that there are currently noother known cases of Glu in the catalytic triad of a Clan SBprotease (33). To verify that L. donovani subtilisin is an activeenzyme, the catalytic cores of both L. donovani and L. majorwere recombinantly expressed in Pichia pastoris. Activitywas recovered for both SUB cores indicating that the Glu-His-Ser catalytic triad is functional; however, kcat values for this

non-canonical triad were around100-fold lower than for the canoni-cal triad. Proteolytic cleavage pref-erentially occurred when substrateshad a basic residue in the P4 posi-tion, much like the site-1 proteases(41, 42). This strengthens the place-ment of Leishmania subtilisin insubfamily S8A.To phenotypically characterize

the function of subtilisin in Leish-mania, the genes were disrupted inL. donovani and L. major by homol-ogous recombination. Both allelesof the L. donovani gene wereknocked out; however, only oneallele could be deleted in L. majordespite multiple attempts at genetargeting. This could be due toeither a greater requirement forsubtilisin in L. major or a compen-satory change in L. donovani thatallowed for the full knock-out to begenerated. Knock-out parasites ofboth species grew well in vitro aspromastigotes; however, attemptsto grow the L. donovani SUB�/�

parasites as amastigotes revealed adefect in their ability to differenti-ate. This indicates that subtilisinmay be beneficial for survival in theamastigote stage. Electron micros-copy of amastigote-like cells fromthe SUB�/� differentiation experi-ments revealed that these cells wereeither extremely abnormal or hadnot fully differentiated. Commonlyseen ultrastructural abnormalitiesincluded elongated cell bodies,severe membrane invaginations,binucleation, and multiple flagellarcross sections. These abnormalitiesare likely due to parasite distress inresponse to the lack of subtilisinenzyme. This research suggestedthat the biological role of subtilisinwithin Leishmania may be as a

maturase for a protein or pathway that promotes amastigotesurvival.To test this hypothesis and to uncover the pathway catalyzed

by subtilisin, proteomic analysis was performed on Leishmaniawild-type and SUB knockouts. We uncovered five sets of pro-tein spots that differed considerably between wild-type andSUB�/� parasites. All five of these sets were identified as mem-bers of the tryparedoxin peroxidase family, the terminal peroxi-dases of the trypanothione reductase system. Both the cytoplas-mic tryparedoxin peroxidases (TXNPx1, -2, and -3) and themitochondrial peroxidoxin (Prx) were identified. Wild-type

FIGURE 7. BALB/c mice (n � 5) were infected subcutaneously in the left hind footpads with wild-type(solid circle) or SUB�/� (empty circle) parasites. Footpad swelling was measured weekly and the footpadthickness was plotted over time. Footpad size was significantly larger (p � 0.001) in WT infections after 40 daysPI. Error bars indicate the � S.D. between the 5 mice in each group. The mice were sacrificed at 180 days postinfection. No swelling was observed in the right hind (uninfected) footpads. Male Golden Syrian hamsters (n �3) were infected intraperitoneally with wild-type or SUB�/� L. donovani. At 200 days post-infection, the ham-sters were sacrificed, and their spleens were sectioned, H&E-stained, and histologically examined. All wild-type-infected hamsters’ spleens (B and C) contained psammoma body calcifications (arrows). No psammomabodies were observed in the spleens of hamsters infected with SUB-deficient Leishmania (D and E).

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

OCTOBER 8, 2010 • VOLUME 285 • NUMBER 41 JOURNAL OF BIOLOGICAL CHEMISTRY 31127

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Leishmania had high amounts of TXNPx1 and -3 forming asingle doublet of spots. Knocking out SUB resulted in a reduc-tion of this wild-type doublet and the appearance of highermolecular weight mutant doublets. TXNPx2 was unchangedfollowing SUB knock-out. Peptide analysis of these spotsrevealed that all the wild-type TXNPx1 and -3 spots did notcontain the C termini of the proteins, whereas themutant spotsretained these termini (supplemental Fig. S1). Subtilisin istherefore putatively responsible for C-terminal processing ofthe wild-type tryparedoxin peroxidases 1 and 3. This conclu-sion is further supported by the fact that the mutant doublethad a mass shift of 2 kDa, which is the calculated mass of theremoved C termini. Interestingly, TXNPx2, which was notfound to be processed, already has an abbreviated C terminus.Although the tryparedoxin peroxidases are primarily cyto-

plasmic they, along with other members of the trypanothionereductase system, can be targeted to the trypanosomatid per-oxisomes, known as glycosomes (43). The targeting of theseenzymes to the glycosomes requires a canonical type-1 peroxi-some/glycosome-targeting signal, PTS1 (44). The PST1 is com-prised of a short C-terminal extension with a terminal tripep-tide SKL, or a conserved variant of SKL (45, 46). Both TXNPx1and -3 C termini encode a PTS1 (SKL and SKQ, supple-mental Fig. S1); however, TXNPx2 lacks this tripeptide target-ing sequence. In addition, TXNPx1 and -3, but not TXNPx2,contain a potential subtilisin cleavage motif at the site whereprocessing is believed to occur. This Lys-Lys-Gly-Ala motif isnearly identical to a potential autocatalytic cleavage site ofLeishmania subtilisin, Lys-Tyr-Gly-Ala. C-terminal proteolyticprocessing of TXNPx1 and -3 by subtilisin can therefore have arole in balancing levels of the peroxidases in the glycosomes andin the cytoplasm. Trypanothione reductase, which itself can betargeted to the glycosome using a PTS1, also contains a poten-tial subtilisin cleavage motif (Lys-Met-Gly-Ala) (GeneDB),indicating that subtilisin may control targeting of multipleenzymes in the tryparedoxin peroxidase pathway.Proteomic analysis of SUB�/� parasites also showed in-

creased levels of Prx compared with wild-type. The function ofmitochondrial Prx is believed to be complementary to that ofcytosolic TXNPx (31), thus the increase in Prx may be a com-pensatory change due to the reduction of functional TXNPx.This hypothesis is supported by the fact that both alleles of theSUB gene could not be deleted in L. major. Although L. dono-vani complex parasites encode three cytosolic tryparedoxinperoxidase genes in the TXNPx gene array, L. major encodesseven cytosolic tryparedoxin peroxidases (GeneDB). L. majortherefore relies more heavily on these cytosolic enzymes,therebymaking a sufficient compensatory increase in Prxmoredifficult.SUB-deficient Leishmania was found to have increased sen-

sitivity to hydroperoxides comparedwith wild-type parasites invitro. Reduced viability of SUB-deficient L. major and L. dono-vani amastigotes was also exhibited in vivo using the murineand hamster infection models, respectively. In both systems,the SUBknock-out parasites had clearly reduced virulence.Ourresearch has shown that subtilisin promotes survival of Leish-mania amastigotes by serving as a maturase for the trypano-thione reductase system, thus aiding in redox homeostasis and

protecting the parasite from oxidative stresses in the hostmacrophage. Because parasite proteases are known to be viablechemotherapeutic targets (3, 4), Leishmania subtilisin repre-sents a new potential target for rational drug design.

Acknowledgments—We graciously thank Margaret Mays at theUCSF Morphology Core for tissue histology, K. C. Lim in the UCSFDept. of Pathology for his help with the hamster infections, and RickFetter for the electron microscopy. Mass spectrometry analysis wasprovided by the Bio-Organic BiomedicalMass Spectrometry Resourceat UCSF (A. L. Burlingame, Director) supported by the BiomedicalResearch Technology Program of the National Institutes of HealthNational Center for Research Resources, NIH NCRR P41RR001614,and National Institutes of Health NCRR RR012961.

REFERENCES1. Scientific Working Group on Leishmaniasis and UNDP/World Bank/

WHOSpecial Programme for Research and Training in Tropical Diseases(2004) Report of the Scientific Working Group Meeting on Leishmaniasis,Geneva, 2–4 February, 2004, World Health Organization, Geneva

2. Levick, M. P., Tetaud, E., Fairlamb, A. H., and Blackwell, J. M. (1998)Mol.Biochem. Parasitol. 96, 125–137

3. Sajid, M., and McKerrow, J. H. (2002)Mol. Biochem. Parasitol. 120, 1–214. McKerrow, J. H., Caffrey, C., Kelly, B., Loke, P., and Sajid,M. (2006)Annu.

Rev. Pathol. 1, 497–5365. Siezen, R. J., de Vos, W. M., Leunissen, J. A., and Dijkstra, B. W. (1991)

Protein Eng. 4, 719–7376. Miller, S. A., Binder, E. M., Blackman, M. J., Carruthers, V. B., and Kim, K.

(2001) J. Biol. Chem. 276, 45341–453487. Blackman, M. J. (2008) Cell. Microbiol. 10, 1925–19348. Arastu-Kapur, S., Ponder, E. L., Fonovic, U. P., Yeoh, S., Yuan, F., Fonovic,

M., Grainger, M., Phillips, C. I., Powers, J. C., and Bogyo, M. (2008) Nat.Chem. Biol. 4, 203–213

9. Barale, J. C., Blisnick, T., Fujioka, H., Alzari, P. M., Aikawa, M., Braun-Breton, C., and Langsley, G. (1999) Proc. Natl. Acad. Sci. U.S.A. 96,6445–6450

10. Yeoh, S., O’Donnell, R. A., Koussis, K., Dluzewski, A. R., Ansell, K. H.,Osborne, S. A., Hackett, F.,Withers-Martinez, C.,Mitchell, G. H., Bannis-ter, L. H., Bryans, J. S., Kettleborough, C. A., and Blackman, M. J. (2007)Cell 131, 1072–1083

11. Miller, S. A., Thathy, V., Ajioka, J. W., Blackman,M. J., and Kim, K. (2003)Mol. Microbiol. 49, 883–894

12. Kim, K. (2004) Acta Trop. 91, 69–8113. Krauth-Siegel, R. L., and Comini, M. A. (2008) Biochim. Biophys. Acta

1780, 1236–124814. Wallis, A. E., and McMaster, W. R. (1987) J. Exp. Med. 166, 1814–182415. Doyle, P. S., Engel, J. C., Pimenta, P. F., da Silva, P. P., and Dwyer, D. M.

(1991) Exp. Parasitol. 73, 326–33416. Medina-Acosta, E., and Cross, G. A. (1993) Mol. Biochem. Parasitol. 59,

327–32917. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982)Molecular Cloning: A

LaboratoryManual, Cold SpringHarbor Laboratory, Cold SpringHarbor,NY

18. Button, L. L., Russell, D. G., Klein, H. L., Medina-Acosta, E., Karess, R. E.,and McMaster, W. R. (1989)Mol. Biochem. Parasitol. 32, 271–283

19. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156–15920. Gritz, L., and Davies, J. (1983) Gene 25, 179–18821. Lacalle, R. A., Pulido, D., Vara, J., Zalacaín, M., and Jimenez, A. (1989)

Gene 79, 375–38022. Joshi, P. B., Webb, J. R., Davies, J. E., and McMaster, W. R. (1995) Gene

156, 145–14923. Joshi, P. B., Sacks, D. L., Modi, G., and McMaster, W. R. (1998) Mol.

Microbiol. 27, 519–53024. Joshi, P. B., Kelly, B. L., Kamhawi, S., Sacks, D. L., and McMaster, W. R.

(2002)Mol. Biochem. Parasitol. 120, 33–40

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

31128 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 285 • NUMBER 41 • OCTOBER 8, 2010

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

25. Wyllie, S., and Fairlamb, A. H. (2006) Acta Trop. 97, 364–36926. Sacks, D. L., Hieny, S., and Sher, A. (1985) J. Immunol. 135, 564–56927. Shevchenko, A., Wilm, M., Vorm, O., and Mann, M. (1996) Anal. Chem.

68, 850–85828. Hellman, U., Wernstedt, C., Gonez, J., and Heldin, C. H. (1995) Anal.

Biochem. 224, 451–45529. Rosenfeld, J., Capdevielle, J., Guillemot, J. C., and Ferrara, P. (1992) Anal.

Biochem. 203, 173–17930. Chalkley, R. J., Baker, P. R., Medzihradszky, K. F., Lynn, A. J., and Burl-

ingame, A. L. (2008)Mol. Cell. Proteomics 7, 2386–239831. Castro, H., Sousa, C., Santos, M., Cordeiro-da-Silva, A., Flohe, L., and

Tomas, A. M. (2002) Free Radic. Biol. Med. 33, 1552–156232. Barrett, A. J., Rawlings, N. D., and Woessner, J. F. (2004) Handbook of

Proteolytic Enzymes, 2nd Ed., Elsevier Academic Press, Amsterdam33. Rawlings, N. D.,Morton, F. R., Kok, C. Y., Kong, J., and Barrett, A. J. (2008)

Nucleic Acids. Res. 36, D320–D32534. Peacock, C. S., Seeger, K., Harris, D., Murphy, L., Ruiz, J. C., Quail, M. A.,

Peters,N., Adlem, E., Tivey, A., Aslett,M., Kerhornou,A., Ivens, A., Fraser,A., Rajandream, M. A., Carver, T., Norbertczak, H., Chillingworth, T.,Hance, Z., Jagels, K.,Moule, S., Ormond, D., Rutter, S., Squares, R.,White-head, S., Rabbinowitsch, E., Arrowsmith, C.,White, B., Thurston, S., Brin-gaud, F., Baldauf, S. L., Faulconbridge, A., Jeffares, D., Depledge, D. P.,Oyola, S. O., Hilley, J. D., Brito, L. O., Tosi, L. R., Barrell, B., Cruz, A. K.,Mottram, J. C., Smith, D. F., and Berriman, M. (2007) Nat. Genet. 39,839–847

35. Flohe, L., and Harris, J. R. (2007) in Subcellular Biochemistry, Vol. 44, pp.231–251, Springer, New York

36. Kahl, L. P., Byram, J. E., David, J. R., Comerford, S. A., and Von Lichten-berg, F. (1991) Am. J. Trop. Med. Hyg. 44, 218–232

37. Wilson, M. E., Innes, D. J., Sousa, A. D., and Pearson, R. D. (1987) J.Parasitol. 73, 55–63

38. Flohe, L., Steinert, P., Hecht, H., and Hofmann, B. (2002) Methods Enzy-mol. 347, 244–258

39. Bal, G., Van der Veken, P., Antonov, D., Lambeir, A.M., Grellier, P., Croft,S. L., Augustyns, K., and Haemers, A. (2003) Bioorg. Med. Chem. Lett. 13,2875–2878

40. Caler, E. V., Vaena de Avalos, S., Haynes, P. A., Andrews, N. W., andBurleigh, B. A. (1998) EMBO J. 17, 4975–4986

41. Lenz, O., terMeulen, J., Klenk, H. D., Seidah, N. G., and Garten,W. (2001)Proc. Natl. Acad. Sci. U.S.A. 98, 12701–12705

42. Vincent, M. J., Sanchez, A. J., Erickson, B. R., Basak, A., Chretien, M.,Seidah, N. G., and Nichol, S. T. (2003) J. Virol. 77, 8640–8649

43. Smith, K., Opperdoes, F. R., and Fairlamb, A. H. (1991) Mol. Biochem.Parasitol. 48, 109–112

44. Parsons, M. (2004)Mol. Microbiol. 53, 717–72445. Emanuelsson, O., Elofsson, A., von Heijne, G., and Cristobal, S. (2003) J.

Mol. Biol. 330, 443–45646. Naderer, T., Ellis, M. A., Sernee, M. F., De Souza, D. P., Curtis, J., Hand-

man, E., and McConville, M. J. (2006) Proc. Natl. Acad. Sci. U.S.A. 103,5502–5507

Leishmania Subtilisin Regulates Tryparedoxin Peroxidase

OCTOBER 8, 2010 • VOLUME 285 • NUMBER 41 JOURNAL OF BIOLOGICAL CHEMISTRY 31129

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from

McKerrowRyan K. Swenerton, Giselle M. Knudsen, Mohammed Sajid, Ben L. Kelly and James H.

Contributes to Disease Pathology Subtilisin Is a Maturase for the Trypanothione Reductase System andLeishmania

doi: 10.1074/jbc.M110.114462 originally published online July 30, 20102010, 285:31120-31129.J. Biol. Chem. 

  10.1074/jbc.M110.114462Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2010/07/30/M110.114462.DC1

  http://www.jbc.org/content/285/41/31120.full.html#ref-list-1

This article cites 43 references, 10 of which can be accessed free at

by guest on August 28, 2020

http://ww

w.jbc.org/

Dow

nloaded from