Upload
truongtu
View
214
Download
0
Embed Size (px)
Citation preview
Life Goes On
Dr. Kwok Cheong CHUNG Department of Biology
The Chinese University of Hong Kong
6 th International Junior Science Olympiad (IJSO)
Genetic Engineering
1
Genetic Engineering Outline
• Recombinant DNA • Restriction Endonucleases • Host / Vector Systems • DNA Libraries • Applications of transgenic technology
2
Notes to Teachers • Learning Objectives
– Structure of DNA and recombinant DNA – Functions and specificity of restriction endonucleases – Various Host / Vector Systems – Formation and functions of DNA Libraries – Applications of transgenic technology
• Time allocation: 4 hrs – DNA structure: 1 hr – Structure of recombinant DNA: 0.5 hr – Restriction endonucleases: 0.5 hr – Various Host / Vector Systems: 0.5 hr – DNA libraries: 0.5 hr – Applications of transgenic technology: 1 hr
3
Learning Outcomes
• Know the structure of DNA and RNA • Understand the basic principles of genetic engineering
• Know the components of recombinant DNA • Know the function and specificity of restriction endonucleases
• Know various host / vector systems • Appreciate the various applications of transgenic technology
After studying this topic students will be able to:
4
Recombinant DNA • A molecule that combines DNA from two sources resulting a new combination of genetic material
• Genetically modified organisms are possible because of the universal nature of the genetic code
• Examples of recombinant organisms –Transfers gene(s) of interest to develop and improve plants, animals and other organisms
–Human insulin gene placed in bacteria for producing insulin in large quantities for diabetics
5
Genetic Engineering – Basic Principle • Select the desired gene(s) to be inserted
• DNA molecules cut into fragments with restriction enzymes
• Splice the fragments together in the desired combination
• Recombinant DNA introduced into a living cell by a vector
• Transformation: uptake of foreign DNA into cells replication and change their genetic make up 6
Restriction Endonucleases • Enzymes which cleave DNA at specific nucleotide sequences and create DNA fragments
• Each restriction endonuclease has a specific recognition sequence and can cut DNA from any source into fragments
• Due to complementarity singlestranded ends can pair with each other sticky ends
• Fragments joined together with DNA ligase
Type I simple cuts
Type II – cut at dyad symmetry
CUT
7 8
Vectors • DNA molecules that can be moved into and replicated in an organism
• If a fragment of DNA is ligated into an appropriate vector, it can be inserted into cells which will then be replicated
• Typical vectors plasmids or viruses that engineered to both accept DNA insertions and reproduce inside cells
• Cloning is the process of inserting DNA encoding a gene of interest into a vector, then establishing it as a stable part of a cell line
Vector Size of Insert (kb)
Plasmid Up to 15
Bacteriophage Up to 90
Bacterial artificial chromosome (BAC) 100 500
Yeast artificial chromosome (YAC) 250 2000 9
Plasmids • E. coli – the most flexible and common host
• Plasmids and phages are the two most commonly used vectors
10
Typical Plasmid pUC 18
lacZ Gene
Multiple Cloning Site
aagcttgcatgcctgcaggtcgactctagaggat ccccgggtaccgagctcgaattc HindIII SphI PstI SalI XbaI BamHI XmaI KpnI SstI EcoRI AccI SmaI BanII HincII BspMI
Origin of Replication
Amp R Gene
2,686 bp
11
Selecting for Cells with Vectors • Vectors are commonly engineered to carry antibiotic resistance genes
• Host bacteria die in the presence of the antibiotic
• Bacteria harboring the vector will survive
• Growing cells on media with antibiotics ensures that all growing cells must carry the vector
12
To Know the Results of Cloning
Ampicillin Kills all bacteria that lack the plasmid
Blue colonies Express β galatosidase which metabolizes colorless Xgal to blue and turn blue thus lacZ is not disrupted and there is no foreign DNA cloned
XGal A lactose analog which turns blue when split by β galactosidase
Cloned fragments disrupt lacZ thus make no β galactosidase and colonies remain white
IPTG Induces expression of lacZ
13 14
DNA Libraries • A collection of DNA from a specific source in a form that can be propagated in a host
• All the DNA from an organism is digested with a restriction enzyme and cloned into plasmids, forming many different recombinant plasmids each with a different fragment of cloned DNA
• Genomic library (Shotgun library) – Collection of DNA fragments that represent all the DNA in the genome
• Chromosome library – All the DNA fragments in that specific chromosome
• cDNA library – Produced using reverse transcriptase – Makes DNA copies of mature mRNA
15
DNA Libraries
16
Library Screening • Libraries tend to have a lot of clones only one of which has the sequence of interest
• Screening a library is the process of eliminating those clones that do not contain the sequence of interest and locating the clone that does
• Preliminary screening – Eliminate any clones without a vector and clones with vectors that do not contain DNA of interest
– Employ vector with gene for antibiotic resistance and lacZ gene
– Expose to growth medium
17
Secondary Screening • Hybridization screening
–DNA from a library is bound to a membrane –The membrane is exposed to a radioactive probe (singlestranded DNA) that is complementary to and would base pair (hybridize) to the sequence of interest –Autoradiography
• Expression vectors –If the gene for a protein is cloned, the protein is made and detected
18
cDNA Libraries • Because of the large size of libraries and the difficulties of screening, anything that can be done to limit library size is favorable
• Protein coding regions of most eukaryotic genomes make up only a small percentage of the total DNA (3% in humans)
• Most cells only express a small subset of an organism’s genes
• By using reverse transcriptase, a cDNA (complementary DNA) copy of the mRNA being produced in a group of cells can be made
• Cloning cDNA to make a library produces a much smaller library enriched with the part of an organism’s genome that is of most interest
19
Rev. Trans.
TTTTTTTTTTTT5’ 3’
cDNA Library Construction
TTTTTTTTTTTT5’
TTTTTTTTTTTT5’ 3’
cDNA after RNase treatment
AAAAAAAAAAA3’ 5’ mRNA
AAAAAAAAAAA3’ 5’
mRNA cDNA hybrid
Insert into vector
AAAAAAAAAAA3’ 5’
Reverse transcription
TTTTTTTTTTTT5’ 3’
Double stranded cDNA after DNA polymerase
RN ase
AAAAAAAAAAA3’ 5’ DNA Pol
20
Applications of Biotechnology • Medical applications
– Pharmaceuticals • Drug production • Introduction of proteinencoding genes
– Gene therapy • Add working copies of single defective gene
– Tissue engineering – Vaccines
• Agricultural – Enhance growth of crops or animals – Enhance quality of crop or animals
• Resistance to diseases, insects, and herbicides • Nitrogen fixation
• Industrial • Environmental
– Transgenic organisms in bioremediation 21 22
Subunit Herpes Vaccine
23
Agricultural Applications • Ti plasmid from Agrobacterium tumefaciens used as vector – Nitrogen fixation
• Introduce genes that allow crops to fix nitrogen – reduce need for fertilizer
– Herbicide resistance • Insert genes encoding for proteins making crops resistant to herbicide – widespread herbicide use possible
– Insect resistance • Insert genes encoding proteins harmful to insects
Golden Rice with high levels of βcarotene
24
• Limited to exchanges between the same or very closely related species
• Little or no guarantee of obtaining any particular gene combination from the millions of crosses generated
• Undesirable genes can be transferred along with desirable genes
• Take a long time to achieve desired results
Conventional Breeding Genetic Engineering
• Allows the direct transfer of one or just a few genes, between either closely or distantly related organisms
• Crop improvement can be achieved in a shorter time compared to conventional breeding
25
Ti Plasmid
26
27 28
Transgenic Rice
29
Bt Corn – Insect Resistance
• Natural insecticide from Bacillus thuringiensis
• Nontoxic to humans • Target insect: corn borer • Potential to:
– reduce insecticide use – reduce mycotoxins
• 40% U.S. Corn crop Bt (2006) • Concerns
– Bt pollen harms nontarget species? – Bt crops select for resistant insects – Bt pollen can drift to organic fields
30
Herbicide Resistance • Roundup Ready Soy, Corn, Canola • Allows postemergence herbicide spraying • Increases yield • Facilitates notill farming • 89% U.S. Soy crop (2006) • Concerns
– Encourages herbicide use – Groundwater contamination – Kills beneficial soil microbes – Crosspollinates weeds – Fosters dependence on Agrochemcial companies
31
Transgenic Animals • More difficult than plants • Several techniques to insert DNA
– Chemicals to open holes in plasma membrane and liposomes carry DNA in cells
– Electroporation–a brief jolt of electricity to open membrane
– Microinjection–uses microscopic needles – Particle bombardment – a gun like device shoots metal particles coated with foreign DNA
32
33
Bovine Somatotropin Bovine somatotropin • Homology with prolactin • Increase milk production
34
Industrial Applications The Dye Indigo
• The blue dye in blue jeans • Originally came from mollusks
or fermented leaves of woad or indigo plants
• Synthetic process uses coal tar releases toxic byproducts
• With recombinant DNA E. coli can produce indigo
Indigo Plant 35
Bioremediation • Transgenic organisms can provide process as well as products
• Ability to detoxify pollutants • Examples
– Hgcontaminated soils – GFP gene reveal locations of land mines – Pseudomonas putida with TNT inducible promoter fused to GFP
– Organisms to treat oil pollution
36
Risk and Regulation • Questions
– How do we measure the potential risks of genetically modified animals and crops ?
– Is eating genetically modified food dangerous ? – Are genetically modified crops harmful to the environment ?
– Should we label genetically modified foods ? – What limits should society place on genetically engineered organisms?
– If you could alter the genetic makeup of your child, where would you draw the line?
37
• Safety guidelines – Safety concerns
• Introduction of transgenic organisms into the environment
• Health effects on humans from consuming GM crops
– Safety measures • Special facilities designed to hold pathogenic organisms
• Science of risk assessment
Safety Issues
38
References for Further Study
• Genetic Engineering by Wikipedia – http://en.wikipedia.org/wiki/Genetic_engineering
• Genetic Engineering and Its Dangers – http://online.sfsu.edu/~rone/GEessays/gedanger.htm
• What is Genetic Engineering? – http://online.sfsu.edu/~rone/GEessays/WhatisGE.html
• Genetic Engineering – http://www.cfaitc.org/LessonPlans/pdf/412.pdf
39
End
40