Lo splicing dell’RNA definizione importanza predizione

  • View
    44

  • Download
    1

Embed Size (px)

DESCRIPTION

Lo splicing dell’RNA definizione importanza predizione. Ing Francesco Piva Gruppo di biologia computazionale e molecolare Dipartimento di Biochimica, Biologia e Genetica Università Politecnica delle Marche Edificio Scienze 3, Brecce Bianche, Ancona f.piva@univpm.it. - PowerPoint PPT Presentation

Text of Lo splicing dell’RNA definizione importanza predizione

  • Lo splicing dellRNA definizione importanza predizioneIng Francesco PivaGruppo di biologia computazionale e molecolareDipartimento di Biochimica, Biologia e GeneticaUniversit Politecnica delle MarcheEdificio Scienze 3, Brecce Bianche, Anconaf.piva@univpm.it

  • These are synonymous words, are we sure ?. . . Ala Val Arg . . .GCA C G TGTA C G TCGA C G TAGA GGCAGTACGAGCAGTACGCGCAGTACGGGCAGTACGTGCAGTAAGAGCAGTAAGGGCAGTCCGAGCAGTCCGCGCAGTCCGGGCAGTCCGTGCAGTCAGAGCAGTCAGGGCAGTGCGAGCAGTGCGCGCAGTGCGGGCAGTGCGTGCAGTGAGAGCAGTGAGGGCAGTTCGAGCAGTTCGCGCAGTTCGGGCAGTTCGTGCAGTTAGAGCAGTTAGGGCCGTACGAGCCGTACGCGCCGTACGGGCCGTACGTGCCGTAAGAGCCGTAAGGGCCGTCCGAGCCGTCCGCGCCGTCCGGGCCGTCCGTGCCGTCAGAGCCGTCAGGGCCGTGCGAGCCGTGCGCGCCGTGCGGGCCGTGCGTGCCGTGAGAGCCGTGAGGGCCGTTCGAGCCGTTCGCGCCGTTCGGGCCGTTCGTGCCGTTAGAGCCGTTAGGGCGGTACGAGCGGTACGCGCGGTACGGGCGGTACGTGCGGTAAGAGCGGTAAGGGCGGTCCGAGCGGTCCGCGCGGTCCGGGCGGTCCGTGCGGTCAGAGCGGTCAGGGCGGTGCGAGCGGTGCGCGCGGTGCGGGCGGTGCGTGCGGTGAGAGCGGTGAGGGCGGTTCGAGCGGTTCGCGCGGTTCGGGCGGTTCGTGCGGTTAGAGCGGTTAGGGCTGTACGAGCTGTACGCGCTGTACGGGCTGTACGTGCTGTAAGAGCTGTAAGGGCTGTCCGAGCTGTCCGCGCTGTCCGGGCTGTCCGTGCTGTCAGAGCTGTCAGGGCTGTGCGAGCTGTGCGCGCTGTGCGGGCTGTGCGTGCTGTGAGAGCTGTGAGGGCTGTTCGAGCTGTTCGCGCTGTTCGGGCTGTTCGTGCTGTTAGAGCTGTTAGG4 * 4 * 6 = 96Three AAs specified by 96 synonymous words

  • ATGTAAACGTATATCGTGACAGTGGTCTGTTAGTATTCCTTTAGTCATGGTTTATGTAAACTGGTCTGTTATCATGGTTTGenomic DNAmRNA

  • attggaaaccgaaacccgttggtcacctctgcaatagccctccctccctcacttctacaattttgtgacagtggtcttgttttctgcattctctgcttcacgtgcttgttttgttggagcgcgtttgcatgctgctttaaattctgaaatattaaaaaaatttcgaagtttttcagcacatgggatgggagttttgaatttcaattttttaaaaacatttttctgtgattagtgccgtcgtggcacggctgttagccgcctatccggtttattcgatactttGTGAGTTTTTTGTAACTTTATGGTCGTCGAAATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAACAATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAATAAAAAAATCGATCAGATATTCTGGAAAAAAAATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAGAAAAATAGAAAAATGAATGTTTTTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAGCAATGTTTTTCATTTTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAATTTTTTGGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAACGCGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAATTGTTATTGTATGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTTTTTTTGGCATTTTCTGCTATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGTTGGACAATTTTCAGtgagcatcttatccatcctagttctcagttcaggacttgtgcacattcgtttagagccagatattcgcaaagccttttcaccggatgattcagatgctggataGTAAGTGACTACTGACCTTGAAGCCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAATGTTTTTCTTTTTCTAATTCGATTTCCCTTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGAAAATTGAATTTTTTTGGAATTCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAAAAGAAAACTTTAAAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATATGCTTTTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGtgaaacccgtgtctggctggaatactacggactcgacatctatccggaacgagcattctgtatttttaccgccaagcgcgaaaattccagtattctccaggaaggcgcactggcagacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCAGatttatactgtggacaatcgactatcggcggcagttggctaccaagatggggatggacgaaaaaattgcgatccactctgcgacttgaacagcccctttcacttgttagcgGTAGGTGGTGGTCTAGGGTGTCATTTTTCGATTTTTTCAATTATTCGATGTTTTTAGTGAAAATCGAAAAATCTAAAAATTGAAAATCGAAAAATGAAAGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAACAACAGGGAAAACTGAACAGAAACCTGGACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAAGTTAAAATAAAAACATTATCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGAAAAACCGAAACCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgacgcggagaaacaatggtaccacaagtgtattcacctatccggatatgccatatagcggactggatattttcctgggacttcacttgagtaatgcggattttggtaagattttttttgaaatgttaaatgaaaagttgaaaaatagtttttatgatttagccactttccagttaaaatttcatttttttaactataaaaagttctggaaaaatg

  • Struttura tipica dei geni umaniesoniintroni

  • esone1introne1esone2introne2esone3esone1esone1introne1esone2esone2introne2esone3esone3SPLICINGeliminazione introniunione esoniGTGTAGAG

  • Lo splicing avviene in tutto il trascritto, anche nelle zone non codificanti

  • R = G, AY = T, C

  • RCORIOHORII+=RCORIIOHORI+Meccanismo di splicingesterealcooldue legami fosfoesterici

  • U2AFU2AFU2AFU2AFarlyU2AF si lega al tratto pirimidinico a valle del sito di ramificazionesnRNP U2 si lega al sito di ramificazione (richiesta idrolisi ATP)Arg-Serle prot SR connettono U2Af con snRNP U1si legano insiemesnRNP U5 si lega al 5ss, snRNP U6 si lega a snRNP U2snRNP U1 rilasciato, snRNP U5 si sposta dallesone allintrone, snRNP U6 si lega al 5sssnRNP U4 rilasciato (richiesta idrolisi ATP), snRNP U6 e U2 catalizzano la transesterificazione, snRNP U5 si lega al 3ss, il 5 ss tagliato e si forma il cappioil 3ss tagliato e gli esoni vengono saldati insieme, il cappio verr deramificato

  • introne (5ss)

  • Sm proteinsnRNP U1

  • C5G16RBD: RNA binding domain

  • si appaia al sito di ramificazioneSm proteinsnRNP U2si appaiano con snRNA U6

  • U5U17

  • 42Lo splicing tessuto specifico

  • Esempio di alternative splicing di un gene umano

  • Alternative splicing tessuto specifico

  • Tutti i modi di fare splicing alternativo

  • Alcuni genomi virali subiscono splicing allinterno della cellula ospite

  • equine infectious anemia virus (EIAV)

  • AIM:SPLICING PREDICTION TOOLpre mRNAsequencemRNAstructure

  • attggaaaccgaaacccgttggtcacctctgcaatagccctccctccctcacttctacaattttgtgacagtggtcttgttttctgcattctctgcttcacgtgcttgttttgttggagcgcgtttgcatgctgctttaaattctgaaatattaaaaaaatttcgaagtttttcagcacatgggatgggagttttgaatttcaattttttaaaaacatttttctgtgattagtgccgtcgtggcacggctgttagccgcctatccggtttattcgatactttGTGAGTTTTTTGTAACTTTATGGTCGTCGAAATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAACAATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAATAAAAAAATCGATCAGATATTCTGGAAAAAAAATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAGAAAAATAGAAAAATGAATGTTTTTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAGCAATGTTTTTCATTTTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAATTTTTTGGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAACGCGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAATTGTTATTGTATGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTTTTTTTGGCATTTTCTGCTATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGTTGGACAATTTTCAGtgagcatcttatccatcctagttctcagttcaggacttgtgcacattcgtttagagccagatattcgcaaagccttttcaccggatgattcagatgctggataGTAAGTGACTACTGACCTTGAAGCCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAATGTTTTTCTTTTTCTAATTCGATTTCCCTTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGAAAATTGAATTTTTTTGGAATTCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAAAAGAAAACTTTAAAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATATGCTTTTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGtgaaacccgtgtctggctggaatactacggactcgacatctatccggaacgagcattctgtatttttaccgccaagcgcgaaaattccagtattctccaggaaggcgcactggcagacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCAGatttatactgtggacaatcgactatcggcggcagttggctaccaagatggggatggacgaaaaaattgcgatccactctgcgacttgaacagcccctttcacttgttagcgGTAGGTGGTGGTCTAGGGTGTCATTTTTCGATTTTTTCAATTATTCGATGTTTTTAGTGAAAATCGAAAAATCTAAAAATTGAAAATCGAAAAATGAAAGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAACAACAGGGAAAACTGAACAGAAACCTGGACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAAGTTAAAATAAAAACATTATCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGAAAAACCGAAACCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgacgcggagaaacaatggtaccacaagtgtattcacctatccggatatgccatatagcggactggatattttcctgggacttcacttgagtaatgcggattttggtaagattttttttgaaatgttaaatgaaaagttgaaaaatagtttttatgatttagccactttccagttaaaatttcatttttttaactataaaaagttctggaaaaatg

  • aatttctAGgccgccgatcctaaaAGTgcaccatttcgcAGaAGTacGTacAGTttcccatctatccctAGTgGTcttGTtttctgcattctctgcttcacGTgcttGTtttGTtggAGcgcGTttgcatgctgctttaaattctgaaatattaaaaaaatttcgaAGTttttcAGcacatgggatgggAGTtttgaatttcaattttttaaaaacatttttctGTgattAGTgccGTcGTggcacggctGTtAGccgcctatccgGTttattcgatactttGTGAGTTTTTTGTAACTTTATGGTCGTCGAAATGGGAAAACTTGGCCACCAATATAAGTTTGGAAAACAATTTCCTAAAAATAAAATAATTGAACTTTTCCGATGAATAAAAAAATCGATCAGATATTCTGGAAAAAAAATCGATAAATTAATCGATTTTCTTGGAAAATACATCGAAAAATTGAGAAAAATAGAAAAATGAATGTTTTTCGATTACCGATTTATTGATTTTTCGTGAAAACTGAGTTCAGATAATTTTAAAAGCAATGTTTTTCATTTTTCAAATCAGAATCACTATAGTTTTGAAAAATCAATAATTAATTTATTGATTTTTCAATATAATTTTTTGGAAAAAATAGAAAAATCCCTTTCTAAAAGTTTTAAATTTCCAAGAAAAATTCATTTTCAAAATCACCAACGCGCTCTATAGAGTAGTCGATGAAAATCTCCGTTAAGGGTGCATGGGCAAAACGCGCTCGAACGACAATTGTTATTGTATGTTTGGTCTTGCAACGAAAAGTTTGAAAAATTGAAAAAAAGTTGTGTCTGATACATTTTTTTTTGGCATTTTCTGCTATTTTACACCAGAAAAAATTTAATAAACATAAAAAATCGAAATTTTTCAAGTTGGACAATTTTCAGtgAGcatcttatccatcctAGTtctcAGTtcAGgacttGTgcacattcGTttAGAGccAGatattcgcaaAGccttttcaccggatgattcAGatgctggatAGTAAGTGACTACTGACCTTGAAGCCTCCTTCCTCCACCAGTCAGAAATAACACGTTTTTTCGCAATGTTTTTCTTTTTCTAATTCGATTTCCCTTTCTCCCTTTCTTATTGTGATTTGGTCAATGTTTGGTTGACTGGGAAGAAAATTGAATTTTTTTGGAATTCCACTTGAAGTTAAAAAACCCAAAATAAATATTTGATCAAAAATAAATAAGAAAAAAAAGAAAACTTTAAAGCAAATGAAAATTTCGTTCGTAACTATTTTGTTAATTTTTTTAAAACTCCTATTTTAAATATATGCTTTTTGCGGAAATTTCTATAAATTTTTTTACATTTTTCAGTgaaacccGTGTctggctggaatactacggactcgacatctatccggaacgAGcattctGTatttttaccgccaAGcgcgaaaattccAGTattctccAGgaAGgcgcactggcAGacGTAAGTTGATTCTCCGTCACGCCCACTTTTCTGGCGGGAATTTAAAAAATTTCAGatttatactGTggacaatcgactatcggcggcAGTtggctaccaAGatggggatggacgaaaaaattgcgatccactctgcgacttgaacAGcccctttcacttGTtAGcgGTAGGTGGTGGTCTAGGGTGTCATTTTTCGATTTTTTCAATTATTCGATGTTTTTAGTGAAAATCGAAAAATCTAAAAATTGAAAATCGAAAAATGAAAGAAACATTGTTTTTTGGGGACCAAACATCTTAATGAATTTAACAACAGGGAAAACTGAACAGAAACCTGGACGGTCTTATCCCATTTATCTATATTCTTAAAATGAATGATGGAGAAAAAAGTTAAAATAAAAACATTATCAGCTTTTTGTAAGTTTTTCTCAAAAATTGTTCGATTTTTCGATTTTCTAAAAAGTCGAAAAACCGAAACCCTTGGTGGTGGTGGTGGTGGACTAGAAAACTCTTCAACGACCACATGGCAATTTTCAGaatttgacgcggAGaaacaatgGTaccacaAGTGTattcacctatccggatatgccatatAGcggactggatattttcctgggacttcacttgAGTaatgcggattttgGTaAGattttttttgaaatGTtaaatgaaaAGTtgaaaaatAGTttttatgatttAGccactttccAGTtaaaatttcatttttttaactataaaaAGTtctggaaaaatG

  • Segnali per il riconoscimento degli introniMotivi conservati

  • I segnali dei