Method Development and Applications of Pyrosequencing …9478/... · 2005-03-17 · Method development and applications of Pyrosequencing technology 1 1. Introduction Recent impressive

i

Method Development and Applications ofPyrosequencing Technology

Baback Gharizadeh

Royal Institute of TechnologyDepartment of Biotechnology

Stockholm 2003

HPV-16/18

HPV-16HPV-18

HPV-18

HPV-16

ii

©Baback Gharizadeh

Department of BiotechnologyRoyal Institute of TechnologyStockholm Center for Physics, Astronomy and BiotechnologySE-106 09 StockholmSweden

Printed at Universitetsservice US ABBox 700 14100 44Sweden

ISBN 91-7283-609-1

iii

Baback Gharizadeh (2003): Method development and applications of Pyrosequencingtechnology. Doctoral dissertation from the Department of Biotechnology, Royal Institute ofTechnology, Stockholm, Sweden.

ISBN 91-7283-609-1

AbstractThe ability to determine nucleic acid sequences is one of the most important platforms for

the detailed study of biological systems. Pyrosequencing technology is a relatively novelDNA sequencing technique with multifaceted unique characteristics, adjustable to differentstrategies, formats and instrumentations. The aims of this thesis were to improve thechemistry of the Pyrosequencing technique for increased read-length, enhance the generalsequence quality and improve the sequencing performance for challenging templates.Improved chemistry would enable Pyrosequencing technique to be used for numerousapplications with inherent advantages in accuracy, flexibility and parallel processing.

Pyrosequencing technology, at its advent, was restricted to sequencing short stretches ofDNA. The major limiting factor was presence of an isomer of dATPaS, a substitute for thenatural dATP, which inhibited enzyme activity in the Pyrosequencing chemistry. Byremoving this non-functional nucleotide, we were able to achieve DNA read-lengths of up toone hundred bases, which has been a substantial accomplishment for performance of differentapplications. Furthermore, the use of a new polymerase, called Sequenase, has enabledsequencing of homopolymeric T-regions, which are challenging for the traditional Klenowpolymerase. Sequenase has markedly made possible sequencing of such templates withsynchronized extension.

The improved read-length and chemistry has enabled additional applications, which werenot possible previously. DNA sequencing is the gold standard method for microbial and vialtyping. We have utilized Pyrosequencing technology for accurate typing of humanpapillomaviruses, and bacterial and fungal identification with promising results.

Furthermore, DNA sequencing technologies are not capable of typing of a sampleharboring a multitude of species/types or unspecific amplification products. We haveaddressed the problem of multiple infections/variants present in a clinical sample by a newversatile method. The multiple sequencing primer method is suited for detection and typing ofsamples harboring different clinically important types/species (multiple infections) andunspecific amplifications, which eliminates the need for nested PCR, stringent PCRconditions and cloning. Furthermore, the method has proved to be useful for samplescontaining subdominant types/species, and samples with low PCR yield, which avoids re-performing unsuccessful PCRs. We also introduce the sequence pattern recognition whenthere is a plurality of genotypes in the sample, which facilitates typing of more than one targetDNA in the sample. Moreover, target specific sequencing primers could be easily tailored andadapted according to the desired applications or clinical settings based on regional prevalenceof microorganisms and viruses.

Pyrosequencing technology has also been used for clone-checking by using pre-programmed nucleotide addition order, EST sequencing and SNP analysis, yielding accurateand reliable results.

Keywords: apyrase, bacterial identification, dATPaS, EST sequencing, fungal identification,human papillomavirus (HPV), microbial and viral typing, multiple sequencing primermethod, Pyrosequencing technology, Sequenase, single-stranded DNA-binding protein (SSB),SNP analysis

©Baback Gharizadeh

iv

v

To my parents

and to my son, Jonathan

vi

vii

“The stars are beautiful, because of a flower that cannot be seen”

“What is essential is invisible to the eye”

Le Petit Prince (The Little Prince)Antoine-Marie-Roger de Saint-Exupéry

viii

ix

This thesis is based on the following publications, which in the text will be referred toby their roman numerical:

List of publications

I. Gharizadeh, B., Nordstrom, T., Ahmadian, A., Ronaghi, M. and Nyren, P.:Long-read pyrosequencing using pure 2'-deoxyadenosine-5'-O'-(1-thiotriphosphate) Sp-isomer. Anal Biochem 301 (2002) 82-90.

II. Gharizadeh, B., Eriksson J., Nourizad, N., Nordstrom, T. and Nyren, P.:Improvements in Pyrosequencing technology by employing Sequenasepolymerase. Submitted

III. Nourizad, N., Gharizadeh, B. and Nyren, P.: Method for clone checking.Electrophoresis 24 (2003) 1712-5.

IV. Gharizadeh, B., Ghaderi, M., Donnelly, D., Amini, B., Wallin, K.L. andNyren, P.: Multiple-primer DNA sequencing method. Electrophoresis 24(2003) 1145-51.

V. Gharizadeh, B., Ohlin, A., Molling, P., Backman, A., Amini, B., Olcen, P.and Nyren, P.: Multiple group-specific sequencing primers for reliable andrapid DNA sequencing. Mol Cell Probes 17 (2003) 203-10.

VI. Gharizadeh, B., Kalantari, M., Garcia, C.A., Johansson, B. and Nyren, P.:Typing of human papillomavirus by pyrosequencing. Lab Invest 81 (2001)673-9.

VII. Gharizadeh, B., Norberg E., Löffler, J., Jalal, S., Tollemar, J., Einsele, H.,Klingspor, L., Nyrén, P.: Identification of medically important fungi by thePyrosequencing technology. Mycoses In Press

VIII. Nordstrom, T., Gharizadeh, B., Pourmand, N., Nyren, P. and Ronaghi, M.:Method enabling fast partial sequencing of cDNA clones. Anal Biochem 292(2001) 266-71.

IX. Ahmadian, A., Gharizadeh, B., Gustafsson, A.C., Sterky, F., Nyren, P.,Uhlen, M. and Lundeberg, J.: Single-nucleotide polymorphism analysis bypyrosequencing. Anal Biochem 280 (2000) 103-10.

x

Table of contents

1. Introduction -------------------------------------------------------------------------------- 1

2. Polymerase chain reaction--------------------------------------------------------------- 3

3. DNA sequencing techniques------------------------------------------------------------- 5

3.1. Dideoxy DNA sequencing by chain termination --------------------------------------------------------- 53.1.1. Slab gel electrophoresis ---------------------------------------------------------------------------------- 63.1.2. Capillary electrophoresis --------------------------------------------------------------------------------- 7

3.2. Non-electrophoretic DNA sequencing methods ---------------------------------------------------------- 73.2.1. Mass spectrometry ---------------------------------------------------------------------------------------- 73.2.2. Sequencing-by-hybridization ---------------------------------------------------------------------------- 83.2.3. Sequencing-by-synthesis --------------------------------------------------------------------------------- 8

4. Pyrosequencing technology------------------------------------------------------------- 12

4.1. Pyrosequencing by the solid-phase approach -----------------------------------------------------------12

4.2. Pyrosequencing by the liquid-phase approach----------------------------------------------------------15

4.3. Template preparation for the Pyrosequencing method------------------------------------------------194.3.1. Single-strand approach ----------------------------------------------------------------------------------194.3.2. Double-strand approach ---------------------------------------------------------------------------------20

5. Present investigation--------------------------------------------------------------------- 22

5.1. Methodological improvements of Pyrosequencing technology ---------------------------------------225.1.1. Read-length improvement (Paper I) -------------------------------------------------------------------225.1.2. Advancements in sequencing T-homopolymeric regions (Paper II) -------------------------------245.1.3. Improved DNA sequencing by SSB (Paper VIII) ----------------------------------------------------265.1.4. Pre-programmed DNA sequencing (Paper III) -------------------------------------------------------285.1.5. Multiple sequencing-primer method and applications (Papers IV and V) -------------------------29

5.1.5.1. Detection of multiple infections (Paper IV) -----------------------------------------------------305.1.5.2. Unspecific amplification products (Paper IV) --------------------------------------------------365.1.5.3. Subdominant types and amplicons with low yield----------------------------------------------385.1.5.4. Faster and more efficient DNA-sequencing (Paper V)-----------------------------------------39

5.2. Applications of Pyrosequencing technology (Papers V-IX) --------------------------------------------425.2.1. Microbial and viral typing (Papers V-VII) ------------------------------------------------------------42

5.2.1.1. Human papillomavirus genotyping (Paper VI) -------------------------------------------------425.2.1.2. Bacterial identification (Paper V) ----------------------------------------------------------------445.2.1.3. Fungal identification (Paper VII)-----------------------------------------------------------------47

5.2.2. EST sequencing (Paper VIII) ---------------------------------------------------------------------------495.2.3. SNP analysis (Paper IX) --------------------------------------------------------------------------------50

xi

6. Future trends of Pyrosequencing technology --------------------------------------- 52

7. Concluding remarks --------------------------------------------------------------------- 53

Abbreviations -------------------------------------------------------------------------------- 54

Acknowledgements-------------------------------------------------------------------------- 56

References ------------------------------------------------------------------------------------ 58

Original papers (I-IX)

xii

Method development and applications of Pyrosequencing technology

1

1. IntroductionRecent impressive advances in DNA sequencing technologies have accelerated

the detailed analysis of genomes from many organisms. We have been observing

reports of complete or draft versions of the genome sequence of several well-studied,multicellular organisms. Human biology and medicine are in the midst of a revolution

by Human Genome Project (Yager et al., 1991) as the main catalyst.

Chromosomal DNA contains the blueprint of cellular structure and function inspecific regions called genes. The double-stranded structure of DNA was revealed by

Watson and Crick in 1953 (Watson and Crick, 1953) and consequently, themechanism of translation from DNA to proteins was found a few years later. The

regulation and content of genetic information are encoded in the sequence order of

nucleotides in the DNA sequence and the human genome (Homo sapiens) comprisesof about 3 billion nucleotides present within the 23 human chromosomes (Lander et

al., 2001; Venter et al., 2001).

The nucleotide is the basic and underlying structural unit of DNA and thearrangement and order of the four nucleotides in DNA is also the functional basis of

storing and transmitting information. Knowledge and understanding of the sequenceof nucleotides in DNA is a fundamental paradigm for molecular medicine. The central

role of DNA for genetic information storage has increased immensely the importance

of DNA sequencing. Furthermore, DNA sequencing techniques are key tools in manyscientific fields and a considerable number of different sciences have been benefiting

from these techniques, ranging from molecular biology, genetics, biotechnology,forensics to archeology and anthropology. DNA sequencing is also promoting new

discoveries that are revolutionizing the conceptual foundations of many fields. It is

also considered to be the golden standard method for accurate identification ofmicroorganisms.

The chain termination sequencing method, also known as Sanger sequencing,developed by Frederick Sanger and colleagues (Sanger et al., 1977), has been the

most widely used DNA sequencing method since its advent in 1977 and still is in use

after more than 26 years since its development. The remarkable advances in chemistryand automation to the Sanger sequencing method has made it to a simple and elegant

Baback Gharizadeh

2

technique, central to almost all past and current genome-sequencing projects of anysignificant scale. Despite all these grand advantages, there are limitations in this

method, which could be complemented with other techniques.

Pyrosequencing technology is a rather novel DNA sequencing technology,developed at the Royal Institute of Technology (KTH), and is the first alternative to

the conventional Sanger method for de novo DNA sequencing. This method relies onthe luminometric detection of pyrophosphate that is released during primer-directed

DNA polymerase catalyzed nucleotide incorporation. At present, it is suited for DNA

sequencing of up to one hundred bases and it offers a number of unique advantages.In this thesis the main DNA sequencing technologies will be briefly reviewed

with the emphasis on the Pyrosequencing technology. The central focal point of this

thesis will be on methodological and chemical advancements of the Pyrosequencingtechnology and its applications and troubleshooting in microbial and viral typing.


3

2. Polymerase chain reactionPCR is an acronym, standing for polymerase chain reaction, which is a versatile

technology that is advancing disease detection, and is one of the revolutionizingscientific developments. Kary Mullis developed the PCR technique in 1983 and it has

been methodically improved since then (Mullis and Faloona, 1987). This innovationresulted in a Nobel Prize in chemistry in 1993 for Kari Mullis.

PCR is principally a primer extension reaction for amplifying specific nucleic

acids in vitro. The use of PCR in molecular diagnostics has increased to the pointwhere it is now adopted as a standard tool for detecting nucleic acids from a number

of origins and it has become a key tool in research and diagnostics.The use of a thermostable polymerase (most commonly derived from the

thermophilic bacterium Thermus aquaticus and called Taq) has allowed the separation

of newly produced complimentary DNA and successive annealing or hybridization ofprimers to the target DNA with minimal loss of enzymatic activity. Exponentially,

PCR permits a short part of DNA to be amplified to about a billion fold, which inturn, allows determination of size, nucleotide sequence, etc. Since the advent of PCR,

measurable improvements and modifications have been achieved in this technique,

such as multiplex PCR (Chamberlain et al., 1988), asymmetric PCR (Shyamala andAmes, 1989), hot-start PCR (Chou et al., 1992), nested PCR (Haqqi et al., 1988), RT-

PCR (Erlich et al., 1991), touchdown PCR (Don et al., 1991), real-time PCR (Hollandet al., 1991; Gibson et al., 1996; Heid et al., 1996), and miniaturization (Wittwer et

al., 1997; Kopp et al., 1998).

In principle, a pair of synthetic oligonucleotides or primers with each hybridizingto one strand of a double-stranded DNA target are used in the PCR reaction. The

hybridized primers perform as substrate for the DNA polymerase, which builds a

complementary strand via sequential incorporation of deoxynucleotides. The processcan be summarized in three steps: (i) dsDNA separation at temperatures >90oC, (ii)

primer annealing at 50-75oC, and (iii) optimal extension at 72-78oC (Mackay et al.,2002). The rate of temperature alterations, or in other words, ramp rate, the time-span

of the incubation at each temperature and the number of times each set of

temperatures (or cycle) repeated are controlled by a thermocycler. The advance of

Baback Gharizadeh

4

technologies in the current years has considerably decreased the ramp times utilizingelectronically controlled heating blocks or fan-forced heated air flows to regulate the

reaction temperature.


5

3. DNA sequencing techniquesRecent efforts to blueprint the entire genome of organisms ranging from yeast to

humans have yielded more high-throughput methods of DNA sequencing. Despite the

increased demand for these high-throughput advanced projects, the standard techniquefor DNA sequencing is still the one developed in 1970s by Sanger and colleagues.

This invention resulted in that Frederick Sanger received the Nobel Prize in

Chemistry for this elegant technique in 1980. The Sanger dideoxy technique is basedon the electrophoretic separation and detection of synthesized single-stranded DNA

molecules that have been terminated with dideoxynucleotides. Another concurrentsequencing strategy, known as Maxam-Gilbert sequencing, utilizing chemical

degradation was described also in 1977. This method was not widely adopted due to

the use of toxic chemicals (Maxam and Gilbert, 1977).In this chapter, the focus will be aimed at de novo sequencing methods and

technical parameters, such as sequencing speed, read length, and base-call precision.

3.1. Dideoxy DNA sequencing by chain terminationThe Sanger DNA sequencing technique (Sanger et al., 1977) has revolutionized

the biological sciences. As mentioned earlier, this simple and elegant method is still in

use after a quarter of century with continual advancements in chemistry andautomation. The principle behind the Sanger method is the termination of the

enzymatically synthesized DNA. The dideoxynuleotide (ddNTP) is incapable of

forming the next bond in the DNA chain and consequently, synthesis of the DNAsequence is interrupted when a ddNTP is incorporated in the growing chain. The four

reactions with the labeled ddNTPs are separated electrophoretically based on theirmolecular weight, and the different-sized DNA fragments are read from smallest to

largest.

The need for a DNA sequencing technique to have the possibility to provide longread-length (number of bases read per run), short analysis time, low cost, and high

accuracy has brought about establishment of several modifications of the original

Sanger dideoxy technique. Automation has been a major aspect of these

Baback Gharizadeh

6

improvements as it has reduced the time and resources required for sequencing oflong stretches of DNA.

Cycle sequencing is a modification of the traditional Sanger sequencing method.

In principle, cycle sequencing is exactly the same as Sanger sequencing, but thereaction proceeds in a series of cycles (Innis et al., 1988; Carothers et al., 1989;

Murray, 1989). The discovery of the PCR and the use of the heat stable Taq

polymerase facilitated the ability to perform sequencing with reduced amounts of

DNA template as the sequencing reaction can be repeated over and over again in the

same tube. Thus, less DNA template is needed than for conventional sequencingreactions. The DNA template is denatured by heating, followed by primer annealing

and extension (incorporation of ddNTPs) using a thermostable DNA polymerase. The

cycle is then repeated. In this way, several dideoxy-terminated chains are synthesizedfrom one template strand. The thermal denaturation step is carried out in the presence

of primers, preventing the re-annealing of double-stranded template. The largeamount of product produced from a single template strand means that this technique is

far more sensitive than standard Sanger sequencing.

Many enzymes are available for PCR and cycle sequencing. Some PCR enzymeshave an extra feature, a 3’-5’ exonuclease activity. This feature is called the proof-

reading ability of the enzyme, i.e. its ability to correct mistakes made duringincorporation of the nucleotides. For cycle-sequencing this activity must be

suppressed to avoid un-interpretable data.

3.1.1. Slab gel electrophoresisAcrylamide slab gel electrophoresis has been the most widely adopted format for

Sanger sequencing with ABI PRISM and ALFexpress as two of the broadly used

sequencers. The principle of the instruments is based on detection of fragment bands

as they drift in the gel by a scanning fluorescent detection system. Read length of 650-750 bases can be expected from these instruments, which is still a widely used

sequencing platform despite suffering from the common drawbacks of slab gelinstruments: gel casting and lane tracking.


7

3.1.2. Capillary electrophoresisRelying merely on slab gel technology was not sufficient to accomplish the

challenges set by the Human Genome Project. The continual and unrelenting

drawbacks of slab gel electrophoresis and the demand for more rapid sequencing andhigher throughput led to the development of capillary electrophoresis (CE) (Huang et

al., 1992). The completion of the human genome was only possible due to severaltechnological advances offered by CE.

Capillary electrophoresis is a fast technique for separation and analysis of

biopolymers. The high surface-to-volume ratio of a capillary allows more rapid heatdissipation than is possible in slab gels, therefore allowing higher operating voltages,

and consequently, faster sequencing reactions could be achieved. This higher electric

field and faster separation has made CE approximately 8-10 times faster thanconventional slab gel electrophoresis. Electrophoresis is performed basically in an

approach similar to slab gels with the advantage that each capillary contains a singleDNA sample and therefore tracking problems are eliminated.

3.2. Non-electrophoretic DNA sequencing methodsA few DNA sequencing methods which are not electrophoretic based have been

conceived in the past two decades. These techniques have advantages anddisadvantages compared to electrophoretic separation methods, depending on the type

of applications performed.

3.2.1. Mass spectrometrySignificant improvements in the ionization of biopolymers in the gas phase has

made mass spectrometry (MS) an alternative for fast and accurate DNA sequencing,

particularly with the approach Matrix-assisted laser desorption ionization time-of-

flight mass spectrometry (MALDI-TOF-MS), which was first introduced by Karasand Hillenkamp (Hillenkamp et al., 1991). This method allows the macromolecule to

be desorbed as an intact gas-phase ion by embedding it in the crystal of a low-molecular-weight molecule that strongly absorbs energy from a pulse of laser light. In

MALDI-TOF-MS the Sanger DNA molecule are desorbed and ionized and then

subjected to an intense electric field, accelerating the fragments in a flight tube in

Baback Gharizadeh

8

common kinetic energy, which is relative to their mass-charge-ratio. The detection isbased on time required for each particle to collide with an ion-to-electron conversion

detector.

In essence, MALDI-TOF-MS DNA sequencing adopted the enzymology andnucleic acid chemistry established for conventional sequencing. MALDI-TOF-MS

read length is stated to be limited by strand fragmentation (Smith, 1996) and salt-adduct formation (Lin et al., 1999), and it relies on strand stringent purification. In

contrast, there is currently no prospect of reaching long-reads per reaction, as is

common with high-throughput capillary devices. Therefore, MALDI-TOF-MS isunlikely to be widely used in de novo genomic sequencing in the foreseeable future.

3.2.2. Sequencing-by-hybridizationThe principle underlying the sequencing-by-hybridization (SBH) technique is in

actual fact the same as Southern blotting (Southern, 1975). Two research groupsindependently described the notion of SBH in 1988 (Lysov Iu et al., 1988; Drmanac et

al., 1989). De novo sequencing was one of the major foundations for developing

hybridization arrays (Drmanac et al., 1992; Drmanac et al., 1993). SBH is based onannealing a labeled unknown DNA fragment to a complete array of short

oligonucleotides (e.g. all 65,536 combinations of 8-mers) and analyzing the

unidentified sequence from the hybridization pattern by computer-assisted assemblingprograms, reconstructing the sequence order of the DNA fragment.

Nevertheless, SBH has faced problems of ambiguous sequence results connectedwith repetitive regions within the unknown DNA sequence, and in addition, formation

of secondary structures in the target DNA is an obstacle for this method. Moreover,

small variations in duplex stability between a complete match and a single mismatch(false positive), which can happen at the 3’-terminus, is another limitation. These

problems can be addressed in expression analysis or comparative sequencing onmicroarray format by SBH, but they have not been addressed in de novo sequencing

yet.

3.2.3. Sequencing-by-synthesisThe sequencing-by synthesis (SBS) approach was first introduced by Robert

Melamede in 1985 (Melamede, 1985). The principle of SBS is based on sequential


9

nucleotide addition and incorporation in a primer-directed polymerase extensionreaction in a way that a complementary strand will be formed by the iterative addition

of the four dNTPs. Figure 1 illustrates the principle of SBH.

The event of nucleotide incorporation in the primed DNA can be detected directlyor indirectly. In the direct method, dNTPs are fluorescently labeled and the detection

is performed by a fluorometric detection instrument (Canard and Sarfati, 1994;Metzker et al., 1994). This approach is limited to only a few bases as the nucleotide

incorporation efficiency is low, which consequently can lead to unsynchronization

(Metzker et al., 1994). In addition, removal of the fluorophore from the incorporatednucleotides in each cycle is another extra step for this approach.

In the indirect detection approach, natural nucleotides are utilized in the

incorporation process. The nucleotide incorporation results in release and detection ofpyrophosphate (PPi) (Nyren, 1987; Hyman, 1988). The major advantage of this

approach is utilization of non-modified nucleotides, and therefore, getting the best ofpolymerase incorporation efficiency in the assay. The enzymatic process shown

beneath is established on luminometric detection of ATP based on conversion of PPi

through a cascade of enzymatic reactions.

(DNA)n + nucleotide (DNA)n+1 + PPi

PPi ATP

ATP Light

polymerase

ATP sulfurylase

luciferase

Baback Gharizadeh

10

Figure 1. Schematic illustration of the sequencing-by-synthesis principle, in which a primed DNAtemplate is subjected to iterative nucleotide additions in the presence of DNA polymerase (the ovalshape). If the added nucleotide is complementary, it will be incorporated by the polymerase resulting inrelease of PPi and extension of the DNA template.

TGACG

dATP

TGACG

dCTP

A

TGACG

dGTP

AC

TGACG

dATP

ACT

TGACGACT

TGACG

dTTP

AC

PPi

PPi

PPi


11

When dNTP is added to the reaction mixture, DNA polymerase incorporates thecomplementary nucleotide onto the 3' terminus of the growing strand, resulting in the

release of PPi. The liberated PPi in the system is monitored using a coupled enzymatic

reaction in which ATP sulfurylase converts PPi to ATP. The produced ATP is sensedby the enzyme firefly luciferase, which in turn leads to generation of light (Nyren,

1987; Nyren et al., 1993). A photon multiplier or a charge coupled device (CCD)camera then records the visible light. Hyman studied the enzymatic SBS for DNA

sequencing by using a gel-filled column to attach nucleic acid template and the DNA

polymerase while solutions containing the four dNTPs were pumped through one at atime. The generated PPi was then measured off-line by a device consisting of a series

of columns containing covalently attached enzymes. This method is not very suitable

for robust DNA sequencing and no further progress of this study is reported in theliterature.

Progressively in time, the sequencing-by-synthesis approach was developed to auser-friendly and robust DNA sequencing method by more efficient removal of the

nucleotides and further modifications of the sequencing-by-synthesis principle,

resulting in innovation of Pyrosequencing technology, which was developed by Nyrénand coworkers (Ronaghi et al., 1996; Nyren et al., 1997; Ronaghi et al., 1998b; Nyrén,

2001).

Baback Gharizadeh

12

4. Pyrosequencing technologyRemoval or degradation of unincorporated or excess dNTPs was a crucial factor

for sequencing-by-synthesis in order to be applied for DNA sequencing. In

Pyrosequencing nucleotide removal is performed in two different ways: (i) the solid-phase Pyrosequencing, which utilizes a three-coupled enzymatic procedure with

washing steps and (ii) the liquid-phase Pyrosequencing technique, which employs a

cascade of four enzymes with no washing steps.

4.1. Pyrosequencing by the solid-phase approachThe solid-phase method is based on a combination of the sequencing-by-synthesis

technique and a solid-phase technique. The four nucleotides are dispensed

sequentially in the reaction system and a washing step removes the unincorporatednucleotides after each addition. There are different immobilization techniques that can

be used for the solid-phase approach. In one approach, the biotin-labeled DNAtemplate with annealed primer is immobilized to streptavidin coated magnetic beads

(Ronaghi et al., 1996). The immobilized primed single stranded DNA is incubated

with three enzymes: DNA polymerase, ATP sulfurylase and luciferase. After eachnucleotide addition to the reaction mixture, the DNA template is immobilized by a

magnet system and the unincorporated nucleotides are removed by a washing step.Loss of DNA templates in the washing procedure, repetitive addition of enzymes,

unstable baseline fluctuations and automation difficulties are drawbacks of this

approach. Another approach, which seems more promising, is the biotin-mediatedimmobilization of ATP sulfurylase and luciferase on streptavidin coated nylon tubes

for detection of PPi and ATP by using a flow system. This may result in a more stablebaseline and improved sequence signals. Furthermore, the later approach is more cost-

effective as replenishment of the enzyme mixture after each dNTP addition is

eliminated and has the advantage that inhibitory products are not accumulated duringthe process. In addition, it is compatible with microfluidic formats with the possibility

for miniaturization.

The solid-phase Pyrosequencing is being applied in microfluidic format by 454Life Sciences. By applying this format, DNA templates are immobilized on a solid


13

support and it is also possible to immobilize the detection enzymes (ATP sulfurylaseand luciferase) onto a solid support to reduce reagent cost. In an attempt the

adenovirus genome has been sequenced by utilizing the solid-phase Pyrosequencing

principle, which is the first demonstration of sequencing an entire genome. Thecompany claims to be making significant progress towards the goal of whole genome

sequencing in a massively parallel fashion. The 454’s developed microfluidicinstrument sequences DNA within thousands of 75 pico-liter wells contained within

the specifically designed PicoTiter Plate. The high density PicoTiter plate allows

amplification and sequencing of several thousand to several hundred thousand DNAsamples simultaneously. Figure 2 illustrates the microfluidic system in the PicoTiter

plate.

Figure 2. Schematic demonstration of the 454 fluidic system. The PicoTiter plate is placed face downon the backplate, creating a sealed, closed flow chamber. Sequencing reagents flow through the fluidicsystem in a programmed order, and the results are read by a detector. This figure is printed by thepermission of 454 Life Sciences.

DNA fragments are first amplified within the wells, eliminating the need for off-line amplification, which is less cost and time-effective. The reagents can diffuse

uniformly into and out of the wells. The light generated by the nucleotide

Baback Gharizadeh

14

incorporations in the system, is detected by a light detector. Figure 3 shows a close-upof the fluidic system in the wells and figure 4 illustrates the overall flow and detection

system.

Figure 3. Schematic illustration of flow in the solid-phase Pyrosequencing method. Each well contains75 picoliter volume where the amplification and sequencing is performed. The enzymes and DNAtemplate are immobilized on the beads. This figure is used by the permission of 454 Life Sciences.

Figure 4. Schematic illustration of the overall flow and detection system, demonstrating flow ofreagents and nucleotides in the microfluidic flow system and detection of light by a camera. Thispicture is adopted from 454 Life Sciences.


15

The microfluidic format for the solid-phase Pyrosequencing method exhibitspromising applications for large whole genome sequencing projects.

In short, performing Pyrosequencing reaction in a microfluidic system offers

several advantages: (i) theoretically, sequencing can be performed faster since thecycling time for each nucleotide addition can be reduced, (ii) as aforementioned,

accumulation of inhibitory substances will be minimized since washing is performedafter each nucleotide addition/cycle, (iii) low amounts of enzymes and reagents will

be consumed and (iv) the possibility for parallel processing of numerous samples

simultaneously.

4.2. Pyrosequencing by the liquid-phase approachThe breakthrough for Pyrosequencing by the liquid-phase approach came about

by the introduction of a nucleotide-degrading enzyme, called apyrase (Nyren, 1994;

Ronaghi et al., 1998b; Nyrén, 2001). The implementation of this enzyme in thePyrosequencing system excluded the use of solid-phase separation, and consequently,

eliminated extra steps such as washes and repetitive enzyme additions. The apyrase

shows high catalytic activity and low amounts of this enzyme in the Pyrosequencingreaction system efficiently degrade the unincorporated nucleoside triphosphates to

nucleoside diphosphates and subsequently to nucleoside monophosphate. In addition,apyrase stabilizes the baseline with no fluctuations in the sequencing procedure as the

same enzymes catalyze the reaction continuously.

The liquid-phase Pyrosequencing method employs a cascade of four enzymes andthe DNA sequencing is monitored in real-time. The sequencing reaction is initiated by

annealing a sequencing primer to a single-stranded DNA template. Figure 5 showsschematically in detail sequencing of a partially amplified DNA of human

papillomavirus (HPV) by Pyrosequencing technology. The cascade of the four-

enzyme catalyzed reactions is demonstrated where APS stands for adenosine 5’-phosphosulphate and hu represents light photons emitted by the bioluminoscent

reaction.

Baback Gharizadeh

16

Figure 5. The liquid-phase Pyrosequencing method is a non-electrophoretic real-time DNA sequencingmethod that uses the luciferase-luciferin light release as the detection signal for nucleotideincorporation into target DNA. The four different nucleotides are added iteratively to a four-enzymemixture. The pyrophosphate (PPi) released in the DNA polymerase-catalyzed reaction is quantitativelyconverted to ATP by ATP sulfurylase, which provides the energy to firefly luciferase to oxidizeluciferin and generate light (hu). The light is detected by a photon detection device and monitored inreal time by a computer program. Finally, apyrase catalyzes degradation of nucleotides that are notincorporated and the system will be ready for the next nucleotide addition. The sequence presented hereidentifies the genotype of a human papillomavirus (HPV-18).


17

In the liquid-phase Pyrosequencing method, the sequencing primer is hybridizedto a single-stranded DNA template and mixed with the enzymes, DNA polymerase,

ATP sulfurylase, luciferase and apyrase, and the substrates APS and luciferin. The

four dNTPs are added to the reaction mixture sequentially. When the DNApolymerase incorporates the complementary nucleotide onto the 3’-end of the primed

DNA template, PPi is released in a quantity equimolar to nucleotide incorporation.ATP sulfurylase quantitively converts PPi to ATP in the presence of APS. The

produced ATP drives the luciferase-mediated conversion of luciferin to oxyluciferin

that generates visible light in amounts that is proportional to the amount of ATP. Thelight produced in the luciferase-catalyzed reaction is detected by a photon multiplier

tube or CCD camera and are recorded as a peak in a pyrogram. Each light signal is

proportional to the number of nucleotides incorporated. Apyrase continuouslydegrades ATP and unincorporated excess dNTPs. When degradation is complete,

another dNTP is added. Addition of dNTPs is performed one at a time. As the processcontinues, a complementary DNA strand is formed and the nucleotide sequence is

determined from the signal peaks in the pyrogram.

Pyrogram in Pyrosequencing method corresponds to electropherogram in SangerDNA sequencing. A pyrogram can be observed in real-time while the sequencing

reaction is carried out and it is virtually the display of all the sequence signal peaks,showing the nucleotide additions, the order of nucleotide dispensation and dNTP

incorporations and non-incorporations, which consequently results in base calling.

Pyrosequencing technology takes advantage of the co-operativity of severalenzymes to monitor DNA synthesis. Parameters such as stability, fidelity, specificity,

sensitivity, KM, and kcat are imperative for the optimal performance of the enzymesused in the sequencing reaction. The kinetics of the enzymes can be studied in real-

time as shown in figure 6. The slope of the ascending curve in a pyrogram displays

the activities of DNA polymerase and ATP sulfurylase, the height of the signal showsthe activity of luciferase, and the slope of the descending curve demonstrates the

nucleotide degradation.

Baback Gharizadeh

18

Figure 6. Interpretation of a sequence signal in the pyrogram. The details of this figure is described inthe text.

As mentioned, apyrase catalyzes degradation of ATP, unincorporated and excess

nucleotides to yield nucleotide monophosphates and inorganic phosphate, resulting ina steady descending of the light output to baseline in the pyrogram. When the baseline

is achieved, there will be a time interval of less than 1 minute for the nucleotides to befully degraded and then the next dNTP can be added. The nucleotide addition cycle

can be repeated numerous times without involvement of washing steps.

The enzymes in the Pyrosequencing method originate from different organisms.The standard Pyrosequencing chemistry utilizes the modified 3’-5’exonuclease-

deficient Klenow fragment of E. coli DNA polymerase I, which is a relatively slowpolymerase (Benkovic and Cameron, 1995). The ATP sulfurylase used in the

Pyrosequencing method is a recombinant version from the yeast Saccharomyces

cerevisiae (Karamohamed et al., 1999) and the luciferase is from the American fireflyPhotinus pyralis. The apyrase is from Solanum tuberosum (Pimpernel varieity)

(Espinosa et al., 2003; Nourizad et al., 2003). The overall time frame frompolymerization to light detection takes place within 3-4 seconds at room temperature.

ATP sulfurylase converts PPi to ATP in approximately 1.5 seconds and the generation

of light by luciferase takes place in less than 0.2 seconds (Nyren and Lundin, 1985).The generated light with a wavelength maximum of 560 nanometers can be detected

by a photodiode, photon multiplier tube, or a CCD-camera.

LightLightintensityintensity

TimeTime


19

The Pyrosequencing technology has many unique advantages among DNAsequencing technologies. One advantage is that the order of nucleotide dispensation

can be easily programmed and alterations in the pyrogram pattern reveal mutations,

deletions and insertions (this will be discussed in the next chapter). Another majoradvantage of the Pyrosequencing method is that sequencing is performed directly

downstream of the primer, starting with the first base after the annealed primer,making primer design more flexible. And moreover, the Pyrosequencing technique is

carried out in real-time, as nucleotide incorporations and base callings can be

observed continuously for each sample. In addition, the Pyrosequencing method canbe automated for large-scale screenings.

4.3. Template preparation for the Pyrosequencing methodPCR products that are to be sequenced contain excess amounts of PCR primers,

nucleotides and PPi, which have to be removed or degraded prior to sequencing by thePyrosequencing method. These by-products can interfere in the course of DNA

sequencing since the amplification primers can re-anneal to the amplified DNA,

causing unspecific sequence signals, and the remaining nucleotides and PPi in thePCR products should also be removed or degraded before the sequencing procedure is

carried out in order to eliminate the risk for asynchronous extension and depletion ofAPS. The salt in the PCR reaction slightly inhibits the enzyme system and should be

removed or diluted.

The use of an internal primer for DNA sequencing is preferential for higherspecificity. Since there is the possibility for unspecific amplification products in PCR,

especially for genomic DNA, utilizing internal primers for sequencing can improvethe sequence signal quality.

There are two approaches currently used for template preparation: single-stranded

template preparation and double-stranded template preparation.

4.3.1. Single-strand approachAs the name suggests, this approach is based on sequencing of single-stranded

DNA template. In traditional Pyrosequencing method, solid-phase purification of the

template, based on streptavidin biotin binding has been utilized. One of the PCR

Baback Gharizadeh

20

primers is biotin-labeled at the 5’-terminus. The biotinylated PCR product binds to astreptavidin coated solid support, allowing the immobilization of the DNA fragment.

This permits the immobilized DNA to be single-stranded by alkali treatment (high

pH), and simultaneously, the interfering components to be removed. The eluted non-biotin-labeled strand can also be collected and used for sequencing. After the

separation step, a sequencing primer is annealed to the single-stranded DNA. Thereare two methods available for single-strand DNA separation (i) streptavidin coated

magnetic beads, using a magnet for purification, denaturation and elution, and (ii)

streptavidin coated Sepharose beads, based on filter separation by a vacuum system.Figure 7 shows the magnetic separation approach. An automated magnetic separation

system is available that is capable of performing this procedure on 96-well plate

format. The automated system can be programmed for different procedures, such asextra washing step to remove excess sequencing primers prior to DNA sequencing,

and regeneration of magnetic beads for multiple use.

4.3.2. Double-strand approachThere are two different methods available for preparation of double-stranded

template. In the first method (Nordstrom et al., 2000a), nucleotides, PPi and

amplification primers are removed enzymatically. Nucleotides and PPi are degradedby addition of apyrase and pyrophosphatase, and the amplification primers are

removed by exonuclease I, which specifically degrades single-stranded DNA. The

double-stranded DNA is then denatured by heat and the sequencing primer isannealed.

The second method is based on using blocking primers (Nordstrom et al., 2002).The principle behind this approach is to prevent the re-annealing of the present PCR

primers to the amplified DNA. This could be carried out either by utilizing

complementary blocking primers hybridizing to the PCR primers or using non-extendable primers, with the same sequence as the PCR primers, binding to the

amplification sites. This later method is faster and the sequence results obtained showbetter signal quality.


21

Figure 7. Single-stranded template preparation prior to the Pyrosequencing method utilizingsteptavidin conjugated magnetic beads. The biotinylated amplified DNA binds to the magnetic beadsand is separated under alkali treatment. The sequencing primers can be annealed to either strand forsequencing.

NaOH

primerannealing

5’3’

S- B

5’3’

5’ 3’

3’5’

3’S- B

5’

5’3’

S- B5’

5’

3’

3’

MB-280Streptav. S B

Amplificationproduct

Baback Gharizadeh

22

5. Present investigationThe present investigation deals with method improvements of the Pyrosequencing

technology, which have led to increased read-length, enhanced sequence performance

and sequencing of challenging homopolymeric regions. A novel approach for typingof clinical specimens harboring multiple infections (a multitude of different

types/species) as well as unspecific amplification products from genomic DNA will

be discussed. In addition, it will also be shown that these advances in Pyrosequencingtechnology have contributed to accomplishment of new significant applications.

5.1. Methodological improvements of Pyrosequencing technologyPyrosequencing at its advent faced limitations for de novo sequencing of about 20

nucleotides downstream of the annealed primer. This limitation was due toaccumulation of by-products in the system, giving rise to increased background and

lower sequence-specific signals. Improvements of the Pyrosequencing chemistry forlonger DNA-reads and enhancement of sequencing quality in general and for regions

containing homopolymeric regions have resulted in substantial improved sequence

data. Furthermore, these methodological advancements have contributed to utilizationof the Pyrosequencing technique for different microbial and viral applications.

5.1.1. Read-length improvement (Paper I)Despite the advantages of Pyrosequencing technology such as accuracy,

flexibility, parallel processing and use of non-labeled primers and nucleotides, it was

merely being used for short reads. In many cases, longer reads were not possible dueto the continuous decrease of nucleotide degrading efficiency of apyrase during the

sequencing procedure. The possibility to improve the method for longer reads should

open new avenues for new applications in many different areas.During the development of the Pyrosequencing method, the natural dATP was

replaced by dATPaS to increase the signal-to-noise ratio (Ronaghi et al., 1996). The

natural dATP is a substrate for luciferase giving simply rise to false-positive signals.However, the performance of the method for longer reads was still limited by this

substitute. We observed continuous decrease of the apyrase activity during the


23

sequencing process and inefficient incorporation of nucleotide A in homopolymeric

T-regions. The applied dATPaS was a mixture of two isomers (Sp and Rp) (Paper I).

The structures of the two isomers are shown in figure 8.

Figure 8. Structures of the Sp and Rp isomers of dATP-a-S

Different concentrations of Sp/Rp-mix and pure Sp-isomer were comparativelyanalyzed on ATP-luciferase assays, and furthermore, on different DNA templates.

The experimental results showed that higher nucleotide concentration of the Sp/Rp-

mix was needed for efficient incorporation of nucleotide A in homopolymeric regions.In addition, pure Sp-isomer could be applied for the same nucleotide A incorporation

experiments by only half the concentration. We also showed that the Rp-isomer wasnot a substrate for the Klenow polymerase and this was also in accordance with earlier

studies (Burgers and Eckstein, 1979). Significant sequence results were achieved for

longer DNA sequencing by the new pure Sp-nucleotide. The observed inhibition ofthe apyrase activity is probably due to accumulation of degradation products, mainly

nucleoside diphosphates, as no inhibition was observed in the presence of alkalinephosphatase. Our experiments also indicate that the diphosphates of the alpha-S

nucleotides are stronger inhibitors than the diphosphates of the natural nucleotides,

and that increased concentration of dATPaS nucleotides had negative effect on the

Baback Gharizadeh

24

apyrase activity. The apyrase activity continuously decreased during the successiveaddition of the nucleotides.

Furthermore, these investigations clearly showed impressive improvements in the

read length and the sequencing performance when using lower nucleotideconcentrations by using the pure Sp-isomer. The pure Sp-dATPaS was utilized for

sequencing of numerous DNA templates. Read lengths surpassing 100 bases were

achieved although it is worth noting that the read length in Pyrosequencing

technology is template dependent. This will be discussed further in this chapter.

5.1.2. Advancements in sequencing T-homopolymeric regions (Paper II)Despite the increase in the read length by the pure Sp-dATPaS, there are

templates that cannot by sequenced synchronously due to homopolymeric T-regions.

The Klenow polymerase normally used in the Pyrosequencing method shows low

catalytic efficiency for the modified alpha thio nucleotides. This has yielded inincomplete incorporation of dATPaS in templates containing homopolymeric regions

with more than 4-5 T-nucleotides, resulting in non-synchronized extensions.

To obtain high quality data with the Pyrosequencing technology, the DNA

polymerase should fulfill a number of characteristics that are essential for DNAsequencing. The DNA polymerase must be 3’-5’exonuclease-deficient in order to

avoid degradation of sequencing primer annealed to the template, and incorporatenucleotides with good fidelity and with reasonable processivity. Moreover, the DNA

polymerase must be able to utilize dATP analogs (such as dATPaS) and to

incorporate such nucleotides with high efficiency across homopolymeric regions.

Furthermore, it is advantageous if primer-dimers and loop-structures are not beutilized as substrates for the polymerase. Traditionally, the exonuclease-deficient

Klenow DNA polymerase has been used in the Pyrosequencing chemistry since itdisplays many of these important features. However, despite the fact that Klenow

polymerase fulfills many of these characteristics sequencing problems may still be

encountered due to inefficient incorporation of nucleotide dATPaS in homopolymeric

T-regions and extension of mispairs formed by unspecific hybridization events.


25

Figure 9. Sequencing performance by two different DNA polymerases. The Pyrosequencing reactionwas performed on a PCR fragment, containing a poly-T track of seven T, in the presence of (a)Klenow, and (b) Sequenase. Note the low T and high A signal peaks obtained (filled and dotted arrows,respectively) when Klenow was applied. When Sequenase was used the sequence could be easily readand the T and A signal peaks were close to the expected levels. The order of nucleotide addition isindicated on the bottom of the traces. The sequence obtained is indicated above trace b.

In order to improve nucleotide incorporation efficiency, a modified T7polymerase (exonuclease deficient T7 DNA polymerase), Sequenase™, was selected

based on known characteristics. We evaluated the effect of Sequenase on the

Pyrosequencing performance on poly(T)-rich templates in parallel with the KlenowDNA polymerase. In all combinations tested, Sequenase demonstrated far better

catalytic efficiency for the homopolymeric T-regions. On the other hand, Klenow

a

b

Klenow

Sequenase

A

7A

ACC AT

2T

GT2T

C

Baback Gharizadeh

26

polymerase resulted in unsynchronized sequence signals in the parallel sequencingreactions on templates containing regions with 4 to 5 T. Sequenase has the ability to

incorporate dATPaS more efficiently and we observed synchronized extension in

templates containing regions with 7 to 8 T as demonstrated in figure 9.

Our experimental results both Klenow and Sequenase incorporate all the othernucleotides with good efficiency.

An additional advantage with Sequenase was the ability to discriminate between

specific and unspecific binding of the sequencing primer to the template and to itself(primer-dimer). In contrast to Klenow polymerase, Sequenase was also reluctant to

extend free 3’-ends formed by loop-structures. It has been indicated that Sequenaserequires a longer stem (15 bases) than Klenow polymerase (12 bases) if a loop-

structure was used as primer (Ronaghi et al., 1998a). It has also been shown that

Sequenase is more discriminating for 3’-mismatches than Klenow polymerase (Nyrenet al., 1997).

Our experiments show that the use of Sequenase instead of Klenow polymerase inthe Pyrosequencing method has several advantages, such as (i) more efficient

polymerization in homopolymeric T-regions, (ii) longer reads on difficult poly-T rich

templates, (iii) better sequencing performance in the presence of primer-dimers andself-priming templates. Therefore, we predict that the use of Sequenase in the

Pyrosequencing method might lead to new applications for this technology in the fieldof long read DNA sequencing for challenging templates.

5.1.3. Improved DNA sequencing by SSB (Paper VIII)A protein, which has shown an essential role in sequence quality of

Pyrosequencing technology, is single-stranded DNA-binding protein (SSB).Introduction of SSB to the Pyrosequencing chemistry has facilitated the optimization

of different parameters (Ronaghi, 2000; Ehn et al., 2002). SSB has improved long

read DNA sequencing, sequencing of challenging templates, making primer designmore flexible and eliminating the need for intermediate washes to remove primers

from the reaction mixture due to problems such as primer-dimers and mis-

hybridization of primers.


27

Figure 10 demonstrates two HPV amplicons sequenced both in the presence andin the absence of SSB (with an extra wash performed prior to the Pyrosequencing

reaction to remove excess primers); the sequence results for HPV-72 sequenced by

the GP5+ primer and HPV-31 (simulated amplicon mixture of HPV-31/40/73)sequenced by a seven-primer-pool are remarkably improved by the presence of SSB

as shown. Consequently, SSB was used in all further Pyrosequencing reactions.

Figure 10. Effects of SSB on improvement of sequence signal quality. (a) shows pyrograms fromsequencing of HPV-72 by the GP5+ primer in the absence and in the presence of SSB.(b) showssequencing of HPV-31 in a simulated multiple infection of HPV-31/40/73 sequenced by a seven-primerpool both in the absence and in the presence of SSB.

a

b

T C G C A G T A C T A2 T G T A2 C T A T3 G T A C T

HPV-72 sequenced by GP5+ primer without SSB

HPV-72 sequenced by GP5+ primer with SSB

G A T A C T A C A T3 A4 G T A G T A2 T4 A3 G A G T A T2

HPV-31 (HPV-31/40/73) sequenced by a seven-primer pool without SSB

HPV-31 (HPV-31/40/73) sequenced by a seven-primer pool with SSB

Baback Gharizadeh

28

5.1.4. Pre-programmed DNA sequencing (Paper III)Pyrosequencing technology has the unique and significant advantage of a pre-

programmed nucleotide addition strategy for different purposes. This is considered as

an important benefit, since nucleotides are dispensed into the reaction mixture in aprogrammed order. In contrast, de novo sequencing uses cyclic nucleotide

dispensation, which can result in longer reaction time, together with productaccumulation due to more nucleotide dispensations in the system. The pre-

programmed feature can be used as a tool for mutation/artifact detection (Garcia et al.,

2000).In our work, we have used this approach for clone checking. Given that DNA

manipulation techniques can result in artifacts, methods that facilitate quality control

are important. In the case of cloning and/or mutagenesis of a gene or specific DNAfragment, the new construct must be carefully checked for proper function. Clone

checking is necessary to confirm that a DNA fragment has been inserted in the correctorientation and frame within a vector. Moreover, it is essential to check for undesired

mutations that could have occurred during initial PCR steps. In addition, the quality of

oligonucleotides utilized during different procedures must be considered.We have used the pre-programmed dispensation ability of Pyrosequencing

technique for such quality control with successful results. Mutations and deletionscould be easily observed in the pyrogram sequence pattern as missing signal peaks. It

is worth mentioning that single-base mutations, insertions or deletions that occur in a

context of similar bases, are observed as alterations in signal peak heights within ahomopolymeric region. We used this approach for mutation/deletion/insertion

detection for clone checking of the apyrase gene by sequencing a pre-programmedsequence pattern of up to 150 bases. Figure 11 shows three analyzed colonies: (i) with

no mutation in the N-terminus region (figure 11a), (ii) with one base deletion in

nucleotide A (figure 11b) and (iii) with a large deletion of 195 nucleotides (figure11c). It is worth noting that although a pre-programmed nucleotide dispensation

strategy was used, the sequence after the large deletion in figure 11c, could beidentified. Thus, after the large deletion the following sequence was obtained:

CCTATTGGCAACAATATTGAGTATTTTAT. This sequence is located 123 bases

into the apyrase gene.


29

The pre-programmed dispensation resulted in a more efficient clone checking aslonger and faster reads, and more time effective detection of artifacts was achieved.

For longer fragments, primers that bind to different regions of a DNA fragment,

separated by 100-150 bases, could be used to address the read length limitation.

Figure 11. Pyrogram, pre-programmed sequence information, from three of the apyrase clonesanalyzed. (a) one of the correct clones, (b) one of the clones with a one base deletion (the deletion isindicated with an arrow), and (c) a clone with a large deletion (the start position for the sequence afterthe deletion is indicated with an arrow). The correct sequence of a part of the region analyzed is shownabove trace (a). The nucleotides were added according to the correct sequence of the target DNA.

5.1.5. Multiple sequencing-primer method and applications (Papers IV and V)DNA sequencing is considered as the gold standard method for accurate typing

and identification of microorganisms and viruses. DNA sequencing is based onnucleic acid sequence knowledge; the informational core of every organism. Besides,

it is more reliable than the hybridization-based techniques, which are based on signal

detection and discrimination of closely related species. The hybridization techniquesare sensitive to possible cross-hybridization of the probes, and in addition, false

positive results are unlikely to be distinguished. In contrast, one can draw clearly thisdistinction in DNA sequencing as it provides nucleic acid knowledge.

Plasmid seq ApyraseTGAAGCTTAC AGAGGATCGCATCACCATCACCATCACGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCGCC CAAATTCCATTGAGAAG5´

3´

a

b

c

T G G C A C A G A A T C G C A T C A A T C A A T C A C G A A C G A T A T C G A G T G T A C A C G

A2 T2 G2

A G A G G A C A A G T C A T

C2 C2 T2A2 C2

C3A4

C2

T4

G3 C3 A3

T2 C2 T2 A2

T3T2 A2

T G G C A T A C C T A G A G T A A T

A2

C3

T2 G2 A2 A2 T2

T4

Baback Gharizadeh

30

In microbial and viral typing, universal/consensus and degenerate primers thatbind to conservative regions are often used for amplification of microorganisms and

viruses (Woese, 1987; Larsen et al., 1993; Maidak et al., 1994). By utilizing general

primers, a broader range of species/types can be covered in the amplification process.Accordingly, the variable regions on the microbial amplified DNA are used for

detection and identification. The variable region is a stretch of nucleotides, whichshows varying sequence between different nucleic acid molecules covering the same

gene. The microbial amplicons may contain more than one species or type (we will

apply the term multiple infections for different multitude of species or types). In suchcases, all the present types or species will be subjected to amplification when utilizing

consensus, general or degenerate primers. In addition, consensus and degenerate

primers may possibly amplify regions other than the target due to unspecific bindingof the primers to genomic DNA. Multiple infections and unspecific amplification

products have been a problem when genotyping by Sanger dideoxy sequencingmethod and Pyrosequencing technology (paper VI) since a plurality of species/types

or unspecific amplification products, present in one specimen, produce sequence

signals from all available types/products in the specimen when utilizing a generalsequencing primer or one of the amplification primers.

A new approach to address these issues in DNA sequencing technologies isutilizing of target-specific multiple sequencing primers. The new concept offers many

advantages, which are explained below.

5.1.5.1. Detection of multiple infections (Paper IV)

Presence of a multitude of species or genotypes in a clinical specimen gives riseto different sequence signals, making typing cumbersome or impossible due to

indistinct sequence data. By using target-specific multiple sequencing primers, we

have been able to detect and sequence clinically important HPV types. Figure 12 and13 illustrate the principle of this method. In cases when there are more than two types,

a pattern recognition system is used for typing (figure 13).By pattern recognition is meant comparison-by-alignment of at least two

sequence-pattern results and determining the characteristic sequence for each type

present in the sample in the sequence pattern combination. Therefore, based on the


31

Figure 12. When there is a multitude of types/species or/and unspecific amplification products in theamplicon, (a) all the present amplified products will give rise to sequence signals as depicted makingtyping difficult or impossible. (b) By utilizing target specific multiple sequencing primers, sequencingof unspecific amplifications and irrelevant types can be circumvented resulting in improved andspecific sequence signals.

HPV-16

Unspecific amp.

General primer siteHPV-16 site

General primer site

Sequencing and genotyping

HPV-16

Irrelevant type

General primer

Unspecific amp.General primer

General primera

b

General primer

HPV-16 primerHPV-18 primerHPV-31 primer


HPV-33 primer

Irrelevant type

Baback Gharizadeh

32

Figure 13. When there is a plurality of types/species or/and unspecific amplification products in theamplified DNA, (a) all the present amplified products will give rise to sequence signals as depictedmaking typing difficult or impossible. (b) By utilizing target specific multiple sequencing primers,sequencing of unspecific amplifications can be circumvented. In cases when there is a multitude ofgenotypes, they are sequenced and genotyped by pattern recognition based on sequence characteristicof each type.

HPV-16

HPV-18

Unspecific amp.



Sequencing and genotyping by pattern recognition

HPV-16

HPV-18

General primer

Unspecific amp.General primer

General primera

b

General primer



HPV-33 primer


33

number of the oligonucleotide primers applied in the sequencing reaction, the same

number of sequence patterns is expected; one characteristic pattern is reserved for

each primer used.Human papillomaviruses (HPV) are the main causative agent of cervical cancer

(Munoz and Bosch, 1996; Villa, 1997; Walboomers et al., 1999). It is not an unusualphenomenon for an HPV carrier to be exposed and infected by more than one HPV

genotype with the rate of multiple HPV infections varying depending on the

characteristics of the population tested. Moreover, the presence of multiple HPVgenotypes is a very common incidence in some patient groups. As mentioned earlier,

when there is presence of multiple infections in a clinical sample, the general primer

used as the sequencing primer will anneal to all genotypes.We designed seven genotype specific primers with each being specific for a

clinical important type. The primers were used in a pool for specific genotyping ofthe-seven-relevant HPV types. By applying the sequencing primer pool to different

samples, we were able to sequence and type these genotypes specifically. This

approach allowed us to perform genotyping on samples containing multiple HPVinfections by using sequence pattern recognition in pyrograms. The sequencing results

were more than satisfactory as we could observe the dominance of the genotypes inmultiple infections. In figure 14 we can clearly see the multiple infections of HPV-16

and HPV-18 in three independent clinical samples. HPV-18 is characterized by GGG

after the 7th nucleotide addition and HPV-16 is characterized by the sequence peaksfor A, C and A, after the 5th, 6th and 9th nucleotide addition, respectively. Figure 14

demonstrates clearly these characteristics in HPV-16 and HPV-18, andsimultaneously that the dominance of each genotype can be easily observed in the

PCR products. The common/shared and specific bases for each type (noted on top of

each peak in figure 14) facilitates genotyping of each DNA target. The dominant typecould be easily observed by comparison of single bases shown by arrows. Figure 14a

shows HPV-16 and HPV-18 almost in equal dominance, while HPV-18 is dominantin figure 14b and HPV-16 is dominant in figure 14c.

Baback Gharizadeh

34

Figure 14. Multiple infections of HPV-16 and HPV-18 in 3 clinical samples sequenced by the multiplesequencing primer method and genotyped utilizing pattern recognition based on characteristic sequenceof each genotype. The dark and dotted arrows are intended for demonstrating dominance of HPV-16and HPV-18, respectively. (a) shows both genotypes almost in equal quantity, (b) HPV-18 is dominantand (c) HPV-16 is dominant.

Pattern recognition can be simplified by a clever choice of primers and selection

of proper downstream upcoming sequence for each primer. A pattern differentiation

software could be designed to differentiate type-sequence-patterns for relevant humanpapillomaviruses. In addition, this can also serve as a general principle for microbial

and viral typing.The flexibility in primer design is very advantageous in Pyrosequencing

technology. Primers can be designed for specific regions, with the shortest possible

sequence-read. This is particularly advantageous by Pyrosequencing technology as theorder of nucleotide additions can be easily pre-programmed, and more importantly,

HPV-16/18

HPV-16

HPV-18

HPV-18

HPV-16

HPV-16/18

HPV-16

HPV-18

HPV-18HPV-16

HPV-16/18

HPV-16HPV-18

HPV-18

HPV-16

a

b

c

HPV-16HPV-18

HPV-16 HPV-18 dominant

HPV-16 dominantHPV-18


35

sequencing is performed directly on the first base on the DNA template downstreamof the sequencing primer, making primer design more flexible. As mentioned, this

eliminates long reads and increases the accuracy. Besides, specific and shorter reads

will enhance the sequence quality and detection ability, and it will be time and cost-effective. Many laboratories test only for HPV-16 and HPV-18 genotypes because of

their clinical relevance in cervical cancer. As for our assay, HPV-16 and HPV-18could be easily detected with the first two nucleotide additions of A and C. Figure 15

shows sequence pyrograms of HPV-16 and HPV-18 separately. If the sequence starts

with AAC, it distinguishingly characterizes HPV-16, and sequence ACC characterizesHPV-18, which are sufficient for genotyping and the sequencing time is minimized to

a few minutes. Above all, these results are obtained by DNA sequencing, which is by

far more reliable than hybridization-based techniques.More importantly, the target specific sequencing primer method could be easily

tailored and adapted according to the desired applications or clinical settings based onthe regional prevalence of microorganisms and viruses and other associated factors.

As the cost for DNA sequencing is decreasing, the same sample could be sequenced

in parallel with two or three different target specific primer pools covering a broaderspectrum of species/types, or the primer pool of choice could be utilized together with

the general primer.The multiple sequencing primer approach could be used for the Sanger dideoxy

sequencing method, although when there is a plurality of relevant types/species in the

specimen, pattern recognition is not applicable to electropherograms. However, insuch cases, the sequence pattern of the electropherogram reveals multiple infections,

which is clinically important. Separate sequencing reactions by each primer arerecommended for accurate genotyping. Pattern recognition is suitable for

Pyrosequencing technology as it is a non-electrophoretic, bioluminometric method

where the sequence signals are detected in real time and there is the possibility ofalignment of different sequence signals.

Baback Gharizadeh

36

Figure 15. Pyrograms of HPV-16 and HPV-18 sequenced by multiple sequencing primers. The firsttwo nucleotide additions (surrounded by squares) are sufficient for genotyping of these two importanthigh-risk HPV genotypes, minimizing the sequencing time and enhancing the specificity.

5.1.5.2. Unspecific amplification products (Paper IV)

Another limitation for DNA sequencing technologies is presence of unspecificamplifications in the PCR product, making microbial and viral detection a challenging

task. General primer sets and other primers aimed for genomic DNA may yield

unspecific amplification products (Fernandez-Contreras et al., 2000) making typingdifficult in DNA sequencing. This mainly happens when the general amplification

primer is used as sequencing primer, which hybridizes to unspecific products presentin the sample. The obtained sequence information is complicated or impossible to

interpret. Figure 16 shows unspecific amplifications in two ethidium bromide stained

agarose gels, in which the products are amplified with general and degenerate primersets GP5+/6+ and MY09/11, respectively, from genomic DNA. In such cases, nested

PCR has been performed, which requires an additional step with no assurance forhigh-quality results.

HPV-16

HPV-18

A2 C T A C A T A T A5 T

A C2 T G3 C A2 T A T


37

Figure 16. Consensus or degenerate primers may yield unspecific amplification products fromgenomic DNA. Figures (a) and (b) show unspecific amplification on ethidium bromide agarose stainedgels. The amplifications were performed by two different general primer sets.

This problem can be solved by using target-specific sequencing primers, whichare specifically detecting the species/types of interest as only the primers that have a

specific complementary nucleotide sequence in the sample will anneal, and thus, the

unspecific amplification products will not result in any sequence signals.Consequently, this approach is highly advantageous as it eliminates the need for

nested PCR, cloning or stringent PCR conditions. In our experiments, unspecificamplification products were not observed in amplicons derived from HPV plasmid

clones. However, clinical samples showed unspecific amplifications in one-step PCR.

Amplified DNA by MY09/11 primer set from genomic DNA yielding unspecific amplification products

HPV450 bp

HPV150 bp

Amplified DNA by GP5+/6+ primer set from genomic DNA resulting in unspecific amplification products

a

b

Baback Gharizadeh

38

The multiple-sequencing-primer approach improved significantly the sequence dataquality for those samples containing unspecific amplification products.

5.1.5.3. Subdominant types and amplicons with low yieldAnother limiting factor for DNA sequencing is when the specific sequence signals

represent a minority of the total signals from the amplification product and therebymay remain unnoticed. For example, if there are unspecific amplification products in

the amplified DNA, the specific sequence signals of the type/species in minority or

the specific DNA with low yield will be in the shadow due to dominant and strongsignals from the unspecific DNA.

We have been able to address these limitations by utilizing the multiple

sequencing primer approach, as the primer annealing is specific for the target DNAand the Pyrosequencing technology has proved to be capable to detect signals from

low DNA concentration. This approach eliminates the need for nested PCR or re-performing unsuccessful PCR, sparing time and labor.

The multiple sequencing primer method has shown remarkable results for

samples with low PCR yield or when the genotype is in minority compared tosequence signals from unspecific amplification products or multiple infections. Figure

17a shows a challenging clinical sample containing the clinically important high-riskHPV-33, which is in minority (low DNA concentration) and not detectable by the

general primer due to high sequence signals from either unspecific amplification

products or multiple infections, but is genotyped by multiple sequencing primers(figure 17b). Figure 17c shows the pyrogram of a pure HPV-33 amplicon as a

reference for comparison with figure 17b. The challenging template was genotypedcorrectly despite its low concentration and presence of multiple infections/unspecific

amplification products. Sequence pyrogram of each type will reveal easily the

genotype (as shown in figure 17b).


39

Figure 17. Detection of a subdominant type with low PCR yield in a challenging clinical sample;sequenced by (a) general primer resulting in unspecific sequence signals and (b) multiple sequencingprimer pool of seven primers resulting in specific sequence signals (genotyping HPV-33). (c) Pyrogramof HPV-33 from plasmid for comparison with trace b.

5.1.5.4. Faster and more efficient DNA-sequencing (Paper V)

The Pyrosequencing technology, as aforementioned, was earlier limited tosequence information of approximately 20 nucleotides. With the improved chemistry

we have been able to achieve DNA read-length of up to 100 bases. The increasedread-length has made numerous applications possible, such as microbial typing and

b

a

HPV-33

Sequenced by general primer

Sequenced and genotyped by multiple sequencing primers

c T A C A T A T A5 T

T A C A T A T A5 T

Sequence pyrogram of HPV-33

Baback Gharizadeh

40

clone checking. Despite the read-length improvements, there are DNA fragments thatare challenging to sequence in the expected sequence range due to different factors.

Figure 18. Principle of winning read-length by utilizing multiple group specific primers: (a)sequencing by general primer, (b) and (c) sequencing of bacterial group A and B by using groupspecific sequencing primers annealing downstream of the general primer site in order to win 19 and 31sequence bases, respectively. The grouping is based on sequence similarities.

We have used the group-specific multiple sequencing primers for winning read-

length, increase the sequence quality of challenging templates while decreasing the

sequencing time. This strategy is also suitable for samples harboring unspecificamplification products, which may interfere with specific sequencing results.

The principle for winning read-length by using the group-specific multiplesequencing primer approach is demonstrated in figure 18. The primers are specific for

a semi-conservative region downstream of the general (amplification) primer, which

enables annealing closer to the variable region, allowing further sequencinginformation from the variable region. The bacterial grouping in these experiments is

DNA sequencing by the general primer U3R

U3R primer

16S-bacterialamplicon

a

b

Primer pool

Seq-19b primerSeq-31b primer


Sample from group A

19 bases

Primer pool

Seq-19b primerSeq-31b primer


Sample from group B

31 bases

U3R primer

Seq-19b primer

Seq-31b primer

U3R site

U3R site

DNA sequencing by multiple sequencing primer pool for winning read length

c


41

based on similarity of sequence alignments of the clinically relevant bacteria studied.In this work, one group of the bacterial strains had sequence similarity in the first 19

bases after the consensus PCR primer and the second group had sequence similarity in

the first 31 bases. Based on this information, one group-specific primer was selectedfor each group, respectively. By using the group-specific primer pool, sequencing of

19 or 31 bases, respectively, could be avoided by annealing downstream of theamplification primer site, which reached closer to variable regions, improved the

sequence data quality and decreased sequencing procedure time.

Figure 19. Pyrograms from bacterial amplicons sequenced by Pyrosequencing technology utilizing (a)the general primer and (b) the group specific multiple-sequencing primer pool. Trace (b) shows an E.coli pyrogram, where 31 semi-conservative bases have been circumvented by using the group-specificmultiple-sequencing primers. The arrows indicate positions difficult to read in trace (a) due tounsynchronized extension. This problem has been addressed by using the multiple sequencing primersas shown in trace (b).

Long read sequencing of some templates could be challenging due to reasons

such as homopolymeric regions, accumulation of by-products in the system andproblematic DNA structures. The above-described approach has proved to be useful

for challenging templates that cannot be sequenced in the range expected or templateswith unsynchronized extensions. Figure 19a shows a pyrogram obtained from

sequencing of E. coli using the general sequencing primer. Unsynchronized extension

was observed (highlighted by arrows) at the end of the pyrogram. When the group-specific primer pool was utilized (figure 19b), sequencing of a semi-conservative

region consisting of 31 bases was avoided. By this approach, information from the

variable region was obtained more rapidly. In addition, sequence signals could be

E. coli sequenced by group specific sequencing primer

31 bases were circumvented

a

b

E. coli sequenced by general sequencing primer

G C T G2 C AC G2 A G T2A G C2G2T G C T2 C T2 C T G CG3

TA2CGT C A2 T G A G C A3

TA2CGT C A2 T G A G C A3 G2TA T2A2 C T3 AC TCG3

Baback Gharizadeh

42

correctly interpreted with no unsynchronized extension. Furthermore, multiplesequencing primers anneal specifically downstream of the general primer site on the

DNA template, eliminating the risk for sequencing of non-specific templates. The

method was also applicable to the Sanger dideoxy DNA sequencing technique.

5.2. Applications of Pyrosequencing technology (Papers V-IX)

The first applications of the Pyrosequencing method were limited to singlenucleotide polymorphisms (SNP) and sequencing short stretches of DNA. New

applications have been made feasible due to the advances in the Pyrosequencingchemistry. We have used the enhanced chemistry for microbial and viral typing,

mutation detection and EST sequencing.

5.2.1. Microbial and viral typing (Papers V-VII)

Near instantaneous detection of pathogens from clinical material are important fordiagnosis, treatment and prophylaxis measurements. The microbial and viral

infectious threats have been altered in the course of history as a substantial number of

pathogens have been eradiated or controlled. New pathogens are emerging and someare developing resistance. Accurate and specific typing of microbial and viral

pathogens is of utmost importance for clinical diagnosis and for characterizing

particular types/species/families. Many microorganisms usually lack adequatemorphological detail for easy identification. Furthermore, the development of specific

therapies/vaccines requires the implementation of sufficient parameters for microbialand viral detection, and a reliable and robust genotyping method is necessary for

accurate follow-up during clinical trials and monitoring of treatment (van Doorn et al.,

2001).Pyrosequencing technology, due to its many advantages, has been a useful

implement for microbial and viral typing. We have utilized this technique fordetection human of papillomaviruses, bacterial and fungal pathogens in clinical

specimens.

5.2.1.1. Human papillomavirus genotyping (Paper VI)

Human papillomaviruses (HPV) are part of the Papovaviridae family (Melnick,1962) with a genome of circular double stranded DNA of approximately 8 kbp. There


43

are over 100 different HPV types known to date, of which more than 30 infect thecervical mucosa. HPVs are classified on the basis of DNA sequence homology (Chan

et al., 1995; Vernon et al., 2000). Definition of a new type is based on sequence

homology. A sequence similarity lying under 90% is considered a new HPV type,homology between 90 to 98% constitute a subtype, and a homology above 98%

represents a type variant (Morrison and Burk, 1993; de Villiers, 1994).All the open reading frames (protein coding regions) of HPVs are located on one

strand and the genetic organization of the different genotypes is very similar. The

HPV genome encodes regulatory and structural proteins called early (E1-E7) and late(L1-L2) proteins. These proteins are involved in viral replication and oncogenicity

(Schneider, 1993).

Complete HPV genomic sequences are available for more than half the totalnumber of all identified HPV types. Since type assignment is based on sequence

comparisons in the L1 region, the genomic sequences for L1 are present for almost allHPV types on databases. HPVs contain both conservative and highly heterogeneous

regions on their genome.

Human papillomaviruses are considered as an important contributing factor in theetiology of certain benign and malignant lesions in humans, such as cervical cancer

(Godfroid et al., 1998), and are classified in low- and high-risk genotypes based ontheir oncogenic potential. High-risk HPVs have been shown to be present in 99.7% of

cervical cancer worldwide (Bosch et al., 1995; Walboomers et al., 1999). Therefore,

high-risk HPV testing has implications for the clinical management of women withcervical lesions and for primary screening for cervical cancer. In addition, it is

necessary to identify individual HPV genotypes to investigate the epidemiology andclinical behavior of particular types (van den Brule et al., 2002). Furthermore, it is not

an unusual phenomenon for an HPV carrier to be infected by more than one HPV

genotype with the varying rate of multiple HPV infections depending on thecharacteristics of the population tested. There is preliminary evidence that presence of

multiple HPV genotypes may reflect repeated exposure and may also be related to anincreased risk for development of disease.

Because all HPV types are closely related, assays can be designed to target

conserved regions of the genome or to target regions whose sequences can best be

Baback Gharizadeh

44

used to discriminate between different HPV types. Consensus assays use primersdirected at relatively conserved regions of the HPV genome. PCR is the most widely

used target amplification method and two approaches are most common in HPV

testing. One approach utilizes type-specific amplification and the second approachuses a consensus PCR approach. The former approach specifically amplifies a single

HPV genotype by the use of type-specific primers. However, the major disadvantageof this approach lies in the fact that many PCR reactions have to be performed. The

latter approach utilizes consensus or general PCR primers. There are several different

consensus PCR primer sets for amplification of HPV genotypes. The MY09/11(Hildesheim et al., 1994) and GP5+/6+ (Snijders et al., 1990; de Roda Husman et al.,

1995) are two consensus primer sets used widely for detection of a broad-spectrum of

HPV genotypes. These primers amplify fragments on the L1 region of HPV yieldingamplicons of 450 and 150 bp, respectively.

We have sequenced clinical HPV samples by Pyrosequencing technology todetermine the HPV type. We used the two commonly used primer systems, the

MY09/11 primers and the GP5+/6+ primers, which amplify a broad spectrum of HPV

genotypes (Resnick et al., 1990; de Roda Husman et al., 1995). GP5+ general primerwas applied as sequencing primer and the first 14 to 25 bases downstream of this

primer were adequate for accurate genotyping. The obtained sequence informationwas analyzed in the GenBank database for genotyping. For samples containing

unspecific amplification products nested PCR was performed. The problem with

multiple infections and unspecific amplification products were dealt with by using themultiple sequencing primer approach as described earlier. Pyrosequencing technology

proved to be a very reliable and rapid typing method with the highest discriminatoryability for HPV detection.

5.2.1.2. Bacterial identification (Paper V)Nucleic acid based analytical and diagnostic methods have revolutionized

molecular differentiation of microorganisms. Phenotypic typing approaches aregradually being supplemented or substituted by new genotyping methods allowing a

more distinguished and detailed discrimination of closely related microorganisms,

pathogens, bacterial strains and isolates on the DNA level.


45

The 16S rRNA is a structural part of the ribosomal subunit, which has beengenerally used for analysis of phylogenetic relationships between bacteria. The 16S

rDNA is approximately 1500 bp long, consisting of eight highly conserved regions

(U1-U8) and nine variable regions (V1-V9) in the bacterial domain (Gray et al.,1984). These features are not only valuable for bacterial phylogenetic studies but also

for bacterial detection and identification in the clinical laboratory (Van de Peer et al.,1996).

Several features of the 16S rRNA gene have made it a useful target for clinical

identification (Patel, 2001). Firstly, it is present in all bacteria making it a universaltarget for bacterial identification. Secondly, the function of 16S rRNA has remained

constant over a long period, so sequence changes are more likely to reflect random

changes than selected changes, which would alter the molecule’s function (Woese,1987). And moreover, the 16S rRNA gene is large enough to contain statistically

relevant sequence information.DNA sequencing of the entire 16S gene is not practical for clinical diagnostics as

the present sequencing technologies can offer read-lengths of 500 to 650 bases,

meaning that several sequencing reactions must be performed to sequence the entiregene, which is labor-intensive and expensive. Fortunately, for most bacteria, the entire

gene does not have to be sequenced to achieve the species-level. Even thoughphylogenetical informative positions are lying throughout the entire 16 rRNA gene,

the region with the greatest sequence heterogeneity lies approximately in the first 500

sequence bases of the 5’-end (Woese et al., 1983; Rogall et al., 1990; Tang et al.,1998; Harris and Hartley, 2003). Furthermore, extensive databases of rDNA

sequences are becoming available for all types of microorganisms (Benson et al.,2000), allowing the design of olignucleotides that can differentiate clinically

important species from all known microorganisms.

For bacterial detection and identification, universal/consensus primers that bind toconservative regions, are often used for amplification (Woese, 1987; Larsen et al.,

1993; Maidak et al., 1994). Since the 16S rRNA genes of almost all common bacterialpathogens found in body fluids have been sequenced, it is possible to design PCR

primers capable of amplifying all eubacteria based on the conservative nature of the

16S rRNA genes (Greisen et al., 1994; Radstrom et al., 1994; McCabe et al., 1995).

Baback Gharizadeh

46

Furthermore, the 16S ribosomal RNA-coding sequences contains regions that arefound in all bacteria but not in human DNA, and these regions flank species-specific

variable sequences (McCabe et al., 1995).

For bacterial detection, we performed partial 16S rDNA amplification by utilizinga universal primer pair, followed by DNA sequencing in a blind test by

Pyrosequencing technology for family/species typing of a selected bacterial test panelrelevant for neonatal severe infections. We chose the V6 region, as it is one of the

most highly variable regions on the 16S rDNA. The objective was to obtain sequence

data of up to 60 bases for bacterial identification as 36 to 55 bases were needed forfamily identification by using the general sequence primer. Moreover, three species

were typed to species level with sequence data of 50 bases (Haemophilus influenzae,

Neisseria meningitidis and Streptococcus agalactiae) and one with 68 bases(Staphylococcus haemolyticus).

This was the first study performed with the improved Pyrosequencing technologyfor sequencing of extended read-length of a clinical test panel. Sequence data in the

range 50 to 110 bases were obtained depending on the bacterial strain (a few

challenging templates could not be sequenced over 50 bases). As explained earlier,the multiple sequencing primer approach could circumvent 19 and 31 bases dependent

on the bacteria sequenced, allowing to genotype more easily challenging bacterialspecies. The obtained results were satisfactory. Figure 20 demonstrates pyrograms of

3 bacterial strains sequenced by general primer.

The bacterial identification by Pyrosequencing can be developed further andapplied to other regions for different bacterial targets and can be a useful utility in

diagnostics and clinical laboratories.


47

Figure 20. Pyrograms from long read sequencing of 3 bacterial amplicons (Listeria monocytgenes,Neisseria meningitides and Haemophilus influenzae) with U3R general primer. The order of nucleotideadditions is indicated at the bottom of the traces. The obtained sequence is indicated above the traces.

5.2.1.3. Fungal identification (Paper VII)

Human pathogenic fungi and yeasts are ubiquitous in the environment, of whichsome of them are normal inhabitants in the body. They are usually opportunistic

organisms, causing acute-to-chronic infections when conditions in the host arefavorable (Mannarelli and Kurtzman, 1998). The incidence of life-threatening

systemic fungal infections has been increasing in recent years, and the increasing

incidence has been correlated with increasing numbers of immunocompromisedpatients (Anaissie et al., 1989).

Drug resistance is a major problem in treating yeast infections (White et al.,1998). Therefore, quick and accurate identification of disease-causing yeasts is

important as it allows the delivery of the most effective drug and the use of the proper

dose of drug for the particular infection. In addition, a molecular detection approachthat can give definitive identification with same-day results and provide valuable

information to physicians for patient management is clinically favorable.Like bacteria, rRNA genes are good candidates for fungal detection. 18S rRNA

genes are attractive targets for fungal and yeast amplification-based detection assays,

Listeria moncyogenes

G C T G2 C ACGTA GT2A G C2GT G2 C T3 C T G2T2A G A TAC2GT C A2 G2 AC A2 G C A GT2AC T C T2A T

Neisseria meningitidis

G C T G2 C ACG TA GT2A G C2G2T G C T2A T2 C T2 C A G2TAC2GT C A T C A G C2 G C T G A TA T2

Haemophilus influenzae

G C T G2 C ACG2 A G T2A G C2G2T G C T2 C T2 C T G TA T3A2CGT C A2 T3 G A T G T G C TA T2A2C

Baback Gharizadeh

48

since these genes are present at a high copy number, thus increasing the sensitivity ofthe PCR (Hopfer et al., 1993). Furthermore, rRNA genes are composed of regions of

higher and lower evolutionary conservation, thereby enabling amplification at

different taxonomic levels. Consequently, nuclear ribosomal genes have been widelyused as a target for detection of fungal microorganisms by molecular methods (Hopfer

et al., 1993; Makimura et al., 1994; Haynes et al., 1995).The rates of isolation of the major yeast species causing fungemia have been

determined in several studies: Candida!albicans (50!to 59%), Candida! tropicalis

(11!to 25%), Candida! glabrata (8!to 18%), Candida! parapsilosis (7!to 15%),Candida! krusei (2!to 4%), Candida! neoformans (~2%), and other species (~2%)

(Beck-Sague and Jarvis, 1993; Rex et al., 1995a; Rex et al., 1995b; Nguyen et al.,

1996; Pfaller et al., 1999). Therefore, earlier information regarding the speciescausing fungemia is valuable to help physicians to select appropriate antifungal agents

and regimens to treat patients. The rate of isolation of C.!glabrata from blood cultureshas increased from 8% to about 20% during the period from 1952!to 1992!according

to recent surveys (Pfaller et al., 1998; Pfaller et al., 1999). This increase might be due

to the widespread use of antifungal drugs for prophylaxis and treatment of candidiasis,affirming the need for more rapid and accurate identification.

We utilized the Pyrosequencing technology for typing of fungal isolates andclinical samples from immunocompromised patients suffering from proven invasive

fungal infections. The DNA was amplified by general consensus primers (Einsele et

al., 1997), which were based on a highly conserved region within the 18S rRNA geneallowing the amplification of a broad range of fungal pathogens. The amplified DNA

fragments were sequenced up to 40 bases to identify the samples. All the sampleswere accurately identified by the Pyrosequencing technology. The reproducibility of

the technique was confirmed by sequencing the amplicons several times with identical

sequence data each time for every sample. The sequence data obtained by thePyrosequencing technology suggested that 18 to 32 bases were sufficient for

identification of C. albicans, C. glabrata, C. krusei, C. parapsilosis, C. tropicalis andAspergillus subsp. The species that we identified in our assay covers a wide range of

fungal infections as fungemia is usually caused by a limited number of fungal species.

In fact, the most commonly encountered yeast species (C.!albicans, C.!tropicalis,


49

C.!glabrata, C.!parapsilosis, C.!krusei, and C.!neoformans) may represent 95% of thetotal yeasts recovered from blood cultures (Rex et al., 1994; Nguyen et al., 1996;

Pfaller et al., 1999; Chang et al., 2001). According to our results, Pyrosequencing

technology appears to be a good diagnostic tool for detection and identification offungal pathogens. Fungal identification can be developed further for Pyrosequencing

technology.

5.2.2. EST sequencing (Paper VIII)

The sequence order of nucleotides determines the nature of the DNA. A relativelystraightforward approach to identify and characterize genes is to isolate mRNA from

different tissues at different ages, convert the mRNA to complementary DNA (cDNA)

and sequence single reads of cDNAs, also called Expressed Sequence Tags or ESTs.This approach leads to the discovery of genes and their relative expression levels

(Okubo et al., 1992; Adams et al., 1993; Adams et al., 1995; Braren et al., 1997).Theoretically, eight or nine nucleotides in a row should define a unique sequence

for every gene in the human genome. However, it has been found that in order to

uniquely identify a gene from a complex pool, a longer sequence of DNA is required.In order to perform large-scale EST analysis robust, accurate, and inexpensive

platforms allowing time-effective analysis of large numbers of samples will berequired.

To increase the capacity of conventional DNA sequencing in comparative EST

analysis, serial gene expression analysis (SAGE) (Velculescu et al., 1995; Brenner etal., 2000) was introduced. The key principle of SAGE lies in the fact that a very short

sequence tag of a transcript is required to uniquely identify the origin of the transcripton EST databases. These short cDNA tags are 9-13 nucleotides long. Compared to

single-pass partial sequencing methods, SAGE produces approximately 25-30 times

more gene-specific sequence data of several gene-tags in a single run. However, thistechnique faces limitations, since many mRNA molecules do not have proper

restriction sites for cleavage by the conventional endonucleases. Furthermore, theaccuracy of gene identification from the obtained sequence length (9-13 bases) is

limited to about 90-95 percent. In a study utilizing SAGE, the accuracy of gene

identification in yeast was about 90 percent (Velculescu et al., 1997).

Baback Gharizadeh

50

In our pilot study, it was found that 98% of all genes could be uniquely identifiedby sequencing a length of 30 nucleotides. Pyrosequencing technology was used to

sequence for EST sequencing and consequently, gene identification. The results were

in complete agreement with sequence information that was obtained by the dideoxymethod.

The present improved Pyrosequencing chemistry and automation allows increasedread-length sequencing and screening of cDNA libraries in a high-throughput fashion.

5.2.3. SNP analysis (Paper IX)Single nucleotide polymorphisms (SNPs) are a molecular form of genetic

variation (Collins et al., 1997). Because of their ubiquity, there are high frequency

SNPs in all human populations and they are plentiful in the genome. Present estimatesare that SNPs with minor allele frequencies of at least 1% are found at the rate of 1 in

every 200–300!bp in the genome (Kruglyak and Nickerson, 2001; Stephens et al.,2001). Extrapolating to the entire genome, this suggests that perhaps as many as 15

million SNPs are ultimately available to study (Salisbury et al., 2003). For correlation

of specific phenotypes to genomic variation, such as disease susceptibility or variabledrug response, it is important to have knowledge of how the variation is organized and

distributed among genes, gene regions, and populations. Because of their densedistribution across the genome, SNPs are viewed as ideal markers for large-scale

genome-wide association studies to discover genes in common complex diseases.

When SNPs are discovered, they are assembled into haplotypes (the set ofpolymorphism alleles that co-occur on a chromosome) to examine allelic variation.

As the number of identified SNPs escalates, there will be an increasing demandfor robust and accurate methods to type and assess the biological impacts of these

genetic variations. The golden standard method for SNP scoring is DNA sequencing.

In this work, we have applied the Pyrosequencing technology for SNP detection forthe very first time (also Nordstrom et al., 2000b for double-stranded SNP analysis).

The Pyrosequencing method was used for sequencing of four SNPs located onchromosomes 9q and 17p from 24 unrelated individuals, resulting in accurate results.

A unique property of Pyrosequencing technology in SNP typing is that each allele

combination (homozygous, heterozygous) will give a specific pattern compared to the


51

two other variants. This important feature makes typing extremely accurate and easy.SNP typing and analysis is one of the major applications of Pyrosequencing

technology suitable for automation and high-throughput analysis.

Baback Gharizadeh

52

6. Future trends of Pyrosequencing technologyDNA sequencing is one of the most central platforms for the study of biological

systems. Future applications require more robust and efficient DNA sequencing

techniques for sequence determination. As described in this thesis, Pyrosequencingtechnology is a relatively novel DNA sequencing method still at its infancy. Being a

young technique, it holds numerous unique advantages, which makes this method a

powerful tool in the field of DNA sequencing technologies.Conventional DNA sequencing, first described over 26 years ago (Sanger et al.,

1977), has gone through major improvements by a large number of academic andresearch groups as well as commercial companies during these years. The

Pyrosequencing method has not been exposed to such concentration of research yet.

There is extensive space for developments and improvements in chemistry andinstrumentation.

The Pyrosequencing method has already shown evidence of high accuracy inDNA sequencing and analysis of polymorphic DNA fragments in many clinical and

research settings. The technique in many ways is already competitive in comparison

to other existing sequencing methods. By increasing the read length to higher scoresand by shortening the sequence reaction time per base calling, Pyrosequencing can

take a more broad position in the DNA sequencing arena. Miniaturization of thistechnique, and its integration with nucleic acid amplification and fully automated

template preparation is envisioned for future application formats, as the trend is

directed to analysis of lesser amounts of specimens and large-scale settings, withhigher throughput and lower cost. Microfluidic formats appear to fulfill these

requirements, as most importantly, the problem with product accumulation will beminimized due to constant removal of unincorporated nucleotides, resulting in more

synchronized extension.


53

7. Concluding remarksThe Pyrosequencing method has emerged as a versatile DNA sequencing

technology suitable for numerous applications. It is the first alternative to the

conventional Sanger dideoxy method for de novo DNA sequencing. This techniquewas earlier restricted to sequencing and analysis of SNPs and short stretches of DNA.

However, the Pyrosequencing technology has gone through phenomenal

developments and improvements both in chemistry and instrumentation. Indeed, thereis room for further advancements as only a couple of academic research groups have

focused on this method.By removal of inhibitory factors and improved chemistry we have been able to

enhance the sequence quality and read-length, which has opened new avenues for

many new applications in de novo sequencing, as well as, in re-sequencing, mutationdetection, and microbial and viral typing. The novel multiple sequencing primer

method has also contributed to typing of samples containing a multitude oftypes/species and unspecific amplification products in clinical settings, eliminating

the need for stringent PCR reactions, nested PCRs and cloning. We believe that the

multiple sequencing primer strategy has many other potential applications especiallyas automation is being more and more integrated into clinical settings and the cost for

DNA sequencing is dropping.Further advancements in Pyrosequencing technology will be to achieve longer

read length for applications requiring DNA reads over the present boundary, to reduce

the sequencing time frame and to decrease the sample quantity and furtherimprovements in automation.

Completion of the human genome does not imply that no further sequencingefforts are necessary. Without doubt, the next technological development is directed

to generate fast-sequencing in microfabricated formats in order to bring the power and

accuracy of sequencing analysis in diagnostics to hospitals and clinical laboratories.

Baback Gharizadeh

54

Abbreviations

ADP adenosine diphosphateAMP adenosine monophosphateAPS adenosine phosphosulfateATP adenosine triphosphatebp base pairCCD charge-coupled devicecDNA complementary DNACE capillary electrophoresisdATP deoxyadenosine triphosphatedATPaS deoxyadenosine alfa-thio triphosphateddATP dideoxyadenosine triphosphateddCTP dideoxycytidine triphosphateddGTP dideoxyguanine triphosphateddNTP dideoxynucleotide triphosphateddTTP dideoxythymidine triphosphatedGTP deoxyguanine triphosphatedNDP deoxynucleotide diphosphatedNMP deoxynucleotide monophosphatedNTP deoxynucleotide triphosphateds double-strandeddTTP deoxythymidine triphosphateDNA deoxyribonucleic acidEDTA ethylenediamine tetraacetic acidEST expressed sequence tagHPV Human papillomaviruskb kilobaseKF Klenow fragmentKM Michaelis-Menten constantkcat catalytic constantmRNA messenger RNAMS mass spectrometryPCR polymerase chain reactionPPi inorganic pyrophosphateSBH Sequencing-by-hybridization


55

SBS Sequencing-by-synthesisSNP single nucleotide polymorphismss single-strandedSSB single-stranded DNA-binding proteinTA Tris-acetate

Baback Gharizadeh

56

Acknowledgements

This thesis is a synergistic result of many minds, collaborations and fruitful meetings anddialogues. I am deeply grateful for the inspiration and scientific sources of many scholars andthinkers and for the trans-generational knowledge and wisdom. I take this opportunity toexpress my profound gratitude to the entire staff at the biotechnology department forproductive collaborations. I would like to thank in particular:

Pål Nyrén, for his admirable supervision and indulging me the freedom and support towork on my areas of interest. I would like to thank him for his scientific guidance, for hissense for constructive details, having always time for me, efficiently dealing with matters,creating a pleasant working atmosphere, and simply, for being an altruistic fine scientist.

Håkan Mellstedt, my very first supervisor and a “sui generis”, whom I have alwayslooked up to as a remarkable scholar and scientist, an industrious group leader blessed withvirtues of determination, modesty, patience and warm heart. I am also very grateful for all thehelpful insights and for always gratifying me his precious time despite his tremendously busyschedule.

Mostafa Ronaghi, one of the senior members of our group, for great and supportivefriendship, for initiating my collaboration with Pål and Pyrosequencing method, for hisceaseless enthusiasm, hyperactive vision and most of all for his general generosity and well-acknowledged positive attitude.

Nader Nourizad, a great friend, colleague and our protein expert who has made our lab afun place with his great sense of humor and happy-go-lucky attitude. Thank you forassistance, collaboration and all the interesting conversations. Tommy Nordström, for goodcollaboration and most of all for your witty sense of humor and your modesty. JonasEriksson, for all the nice conversations and collaborations. Carlos Garcia and Samer Kara,the old members of the group, for your friendship and collaboration.

Pål Nyrén, Liam Good and Mostafa Ronaghi for their valuable comments on thisthesis.

Afshin Ahmadian, for friendship and for all the enlightening scientific conversations,always taking your time with patience to have fruitful dialogues, which have assisted me inmy work.

Bahram Amini and Mehran Gharderi, for your friendship, fruitful collaborations andfor always being ready to lend a hand.

Nader Pourmand, my best friend and my college classmate. Thank you for all yoursupport and help, your warm hospitality and generosity during all these years.

Alphonsa Lourdudoss, Anne Jifält, Lotta Rosenfeldt, Marita Johnsson, MonicaRuck and Pia Ahnlén for all excellent professional assistance during the years, and TommyÖstlund, our genius technical person, for his well-needed technical assistance.

Anders Holmberg and Morten Lukacs for their friendliness and excellent assistancewith the magnetic robotic technique.


57

All the new and old members of Håkan mellstedt’s group, particularly the very seniormembers and the heart of the group Birgitta Hagström, Gun Ersmark, Ingrid Eriksson andLena Virving who welcomed me and taught me the basic laboratory disciplines when Istarted in IGT lab in 1993. You have always been friendly, supportive and helpful. I wouldlike to thank Barbro Näsman-Glaser and Anna-Lena Borg who later joined the group.

Gunilla Burén, for great professional assistance, amazing excellent efficiency and awarm heart. Gerd Ståhlberg, for efficient professional and technical assistance and friendlyattitude. Anna Lena Hjelm-Skoog and Peter Ragnhammar, for good collaboration,sympathy and for your medical expertise. Anders Eklöf, Joe Lawrence, Sören Lindén, MaxPettersson at CCK and Ricardo Giscombe at CMM for admirable technical and “helping-out” assistance and for your friendliness.

The staff and researchers at Cancer Center Karolinska (CMM) and Center forMolecular Medicine (CMM).

Keng-Ling Wallin and Biying Zheng, Joakim Dillner, Lena Klingspor and her group,Nongnit Lewin and her group, Ann Kari Lefvert and Xiao Yan Zhao, Bo Johansson andMina Kalantari, Per Olcén and his group, Bengt Wretlind and Emma Lindbäck, MariaOggionni, and Edit Akom for fruitful collaborations.

The staff at Pyrosequencing AB for technical assistance and expertise, particularlyBjörn Ekström, Björn Ingemarsson, Anders Alderborn, Thomas Hultman, Nigel Tooke,Peter Hagerlid, Peter Lindqvist, Christina Johansson, Jenny Dunker, Kristin Hellman,Annika Tallsjö and Per-Johan Ulfendahl.

Cecilia Beer, my omniscient friend, for all the illuminating cultural, lingual, art andhistory conversations. Carin beer for your hospitality.

I would also like to express my deepest appreciation and gratitude to all my friends fortheir friendship: Fredrick Lekarp, Reza Khiabani, Maria Bertilsson, Hose Fakhrai-rad,Farnoush, Ali Ahari, Camilla Nevelius, Ali Samanci, Anne Silfverskiold, Sina, AliMoshfegh, Maryam Tousi, Tina Lekarp, Tommy Rykarv, Ann-Britt, Parisa, Mojgan,Soheila, Farokh, Shiva, Tamara, Mamaly Bakhtiar, Petra Mofazelli, Fayezeh, WanSong, Virginija, Audrey Long, Anita Gondor, Edit Akom and Lauraine Dube.

Bijan Tousi, my best friend in Toronto. You have been a true devoted and loyal comradethrough the years. I am not sure if I can ever thank you enough.

Kiriaki Ifantidou for being an incredible mother and always prioritizing Jonathan conamore. George, Eleni, Costas, Evi, Gregorios, Maria, Nicoleta and Margareta forfriendship, hospitality and for all the wining and dining during my stays in Greece.

My parents, my sister Mina and my brother Ciamack for their constant love andsupport.

Jonathan , my little prince, my teacher and my source of joy and happiness.

Baback Gharizadeh

58

References

Adams, M.D., Kerlavage, A.R., Fleischmann, R.D., Fuldner, R.A., Bult, C.J., Lee, N.H., Kirkness,E.F., Weinstock, K.G., Gocayne, J.D., White, O., et al.: Initial assessment of human gene diversity andexpression patterns based upon 83 million nucleotides of cDNA sequence. Nature 377 (1995) 3-174.

Adams, M.D., Soares, M.B., Kerlavage, A.R., Fields, C. and Venter, J.C.: Rapid cDNA sequencing(expressed sequence tags) from a directionally cloned human infant brain cDNA library. Nat Genet 4(1993) 373-80.

Anaissie, E.J., Bodey, G.P. and Rinaldi, M.G.: Emerging fungal pathogens. Eur J Clin Microbiol InfectDis 8 (1989) 323-30.

Beck-Sague, C. and Jarvis, W.R.: Secular trends in the epidemiology of nosocomial fungal infectionsin the United States, 1980-1990. National Nosocomial Infections Surveillance System. J Infect Dis 167(1993) 1247-51.

Benkovic, S.J. and Cameron, C.E.: Kinetic analysis of nucleotide incorporation and misincorporationby Klenow fragment of Escherichia coli DNA polymerase I. Methods Enzymol 262 (1995) 257-69.

Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Rapp, B.A. and Wheeler, D.L.: GenBank.Nucleic Acids Res 28 (2000) 15-8.

Bosch, F.X., Manos, M.M., Munoz, N., Sherman, M., Jansen, A.M., Peto, J., Schiffman, M.H.,Moreno, V., Kurman, R. and Shah, K.V.: Prevalence of human papillomavirus in cervical cancer: aworldwide perspective. International biological study on cervical cancer (IBSCC) Study Group. J NatlCancer Inst 87 (1995) 796-802.

Braren, R., Firner, K., Balasubramanian, S., Bazan, F., Thiele, H.G., Haag, F. and Koch-Nolte, F.: Useof the EST database resource to identify and clone novel mono(ADP-ribosyl)transferase gene familymembers. Adv Exp Med Biol 419 (1997) 163-8.

Brenner, S., Johnson, M., Bridgham, J., Golda, G., Lloyd, D.H., Johnson, D., Luo, S., McCurdy, S.,Foy, M., Ewan, M., et al.: Gene expression analysis by massively parallel signature sequencing(MPSS) on microbead arrays. Nat Biotechnol 18 (2000) 630-4.

Burgers, P.M. and Eckstein, F.: A study of the mechanism of DNA polymerase I from Escherichia coliwith diastereomeric phosphorothioate analogs of deoxyadenosine triphosphate. J Biol Chem 254 (1979)6889-93.

Canard, B. and Sarfati, R.S.: DNA polymerase fluorescent substrates with reversible 3'-tags. Gene 148(1994) 1-6.

Carothers, A.M., Urlaub, G., Mucha, J., Grunberger, D. and Chasin, L.A.: Point mutation analysis in amammalian gene: rapid preparation of total RNA, PCR amplification of cDNA, and Taq sequencing bya novel method. Biotechniques 7 (1989) 494-6, 498-9.

Chamberlain, J., Gibbs, R., Ranier, J., Nguyen, P. and Caskey, C.: Deletion screening of the Duchennemuscular dystrophy locus via multiplex DNA amplification. Nucleic Acid Res 16 (1988) 11141-11156.

Chan, S.Y., Delius, H., Halpern, A.L. and Bernard, H.U.: Analysis of genomic sequences of 95papillomavirus types: uniting typing, phylogeny, and taxonomy. J Virol 69 (1995) 3074-83.

Chang, H.C., Leaw, S.N., Huang, A.H., Wu, T.L. and Chang, T.C.: Rapid identification of yeasts inpositive blood cultures by a multiplex PCR method. J Clin Microbiol 39 (2001) 3466-71.


59

Chou, Q., Russell, M., Birch, D.E., Raymond, J. and Bloch, W.: Prevention of pre-PCR mis-primingand primer dimerization improves low-copy-number amplifications. Nucleic Acids Res 20 (1992) 1717-23.

Collins, F.S., Guyer, M.S. and Charkravarti, A.: Variations on a theme: cataloging human DNAsequence variation. Science 278 (1997) 1580-1.

de Roda Husman, A.M., Walboomers, J.M., van den Brule, A.J., Meijer, C.J. and Snijders, P.J.: Theuse of general primers GP5 and GP6 elongated at their 3' ends with adjacent highly conservedsequences improves human papillomavirus detection by PCR. J Gen Virol 76 (1995) 1057-62.

de Villiers, E.M.: Human pathogenic papillomavirus types: an update. Curr Top Microbiol Immunol186 (1994) 1-12.

Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. and Mattick, J.S.: 'Touchdown' PCR to circumventspurious priming during gene amplification. Nucleic Acids Res 19 (1991) 4008.

Drmanac, R., Drmanac, S., Labat, I., Crkvenjakov, R., Vicentic, A. and Gemmell, A.: Sequencing byhybridization: towards an automated sequencing of one million M13 clones arrayed on membranes.Electrophoresis 13 (1992) 566-73.

Drmanac, R., Drmanac, S., Strezoska, Z., Paunesku, T., Labat, I., Zeremski, M., Snoddy, J.,Funkhouser, W.K., Koop, B., Hood, L., et al.: DNA sequence determination by hybridization: astrategy for efficient large-scale sequencing. Science 260 (1993) 1649-52.

Drmanac, R., Labat, I., Brukner, I. and Crkvenjakov, R.: Sequencing of megabase plus DNA byhybridization: theory of the method. Genomics 4 (1989) 114-28.

Ehn, M., Ahmadian, A., Nilsson, P., Lundeberg, J. and Hober, S.: Escherichia coli single-strandedDNA-binding protein, a molecular tool for improved sequence quality in pyrosequencing.Electrophoresis 23 (2002) 3289-99.

Einsele, H., Hebart, H., Roller, G., Loffler, J., Rothenhofer, I., Muller, C.A., Bowden, R.A., van Burik,J., Engelhard, D., Kanz, L., et al.: Detection and identification of fungal pathogens in blood by usingmolecular probes. J Clin Microbiol 35 (1997) 1353-60.

Erlich, H.A., Gelfand, D. and Sninsky, J.J.: Recent advances in the polymerase chain reaction. Science252 (1991) 1643-51.

Espinosa, V., Kettlun, A.M., Zanocco, A., Cardemil, E. and Valenzuela, M.A.: Differences innucleotide-binding site of isoapyrases deduced from tryptophan fluorescence. Phytochemistry 63(2003) 7-14.

Fernandez-Contreras, M.E., Sarria, C., Nieto, S. and Lazo, P.A.: Amplification of human genomicsequences by human papillomaviruses universal consensus primers. J Virol Methods 87 (2000) 171-5.

Garcia, C.A., Ahmadian, A., Gharizadeh, B., Lundeberg, J., Ronaghi, M. and Nyren, P.: Mutationdetection by pyrosequencing: sequencing of exons 5-8 of the p53 tumor suppressor gene. Gene 253(2000) 249-57.

Gibson, U.E., Heid, C.A. and Williams, P.M.: A novel method for real time quantitative RT-PCR.Genome Res 6 (1996) 995-1001.

Godfroid, E., Heinderyckx, M., Mansy, F., Fayt, I., Noel, J.C., Thiry, L. and Bollen, A.: Detection andidentification of human papilloma viral DNA, types 16, 18, and 33, by a combination of polymerasechain reaction and a colorimetric solid phase capture hybridisation assay. J Virol Methods 75 (1998)69-81.

Baback Gharizadeh

60

Gray, M.W., Sankoff, D. and Cedergren, R.J.: On the evolutionary descent of organisms andorganelles: a global phylogeny based on a highly conserved structural core in small subunit ribosomalRNA. Nucleic Acids Res 12 (1984) 5837-52.

Greisen, K., Loeffelholz, M., Purohit, A. and Leong, D.: PCR primers and probes for the 16S rRNAgene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J ClinMicrobiol 32 (1994) 335-51.

Haqqi, T.M., Sarkar, G., David, C.S. and Sommer, S.S.: Specific amplification with PCR of arefractory segment of genomic DNA. Nucleic Acids Res 16 (1988) 11844.

Harris, K.A. and Hartley, J.C.: Development of broad-range 16S rDNA PCR for use in the routinediagnostic clinical microbiology service. J Med Microbiol 52 (2003) 685-91.

Haynes, K.A., Westerneng, T.J., Fell, J.W. and Moens, W.: Rapid detection and identification ofpathogenic fungi by polymerase chain reaction amplification of large subunit ribosomal DNA. J MedVet Mycol 33 (1995) 319-25.

Heid, C.A., Stevens, J., Livak, K.J. and Williams, P.M.: Real time quantitative PCR. Genome Res 6(1996) 986-94.

Hildesheim, A., Schiffman, M.H., Gravitt, P.E., Glass, A.G., Greer, C.E., Zhang, T., Scott, D.R., Rush,B.B., Lawler, P., Sherman, M.E., et al.: Persistence of type-specific human papillomavirus infectionamong cytologically normal women. J Infect Dis 169 (1994) 235-40.

Hillenkamp, F., Karas, M., Beavis, R.C. and Chait, B.T.: Matrix-assisted laser desorption/ionizationmass spectrometry of biopolymers. Anal Chem 63 (1991) 1193-1203.

Holland, P.M., Abramson, R.D., Watson, R. and Gelfand, D.H.: Detection of specific polymerase chainreaction product by utilizing the 5'--3' exonuclease activity of Thermus aquaticus DNA polymerase.Proc Natl Acad Sci U S A 88 (1991) 7276-80.

Hopfer, R.L., Walden, P., Setterquist, S. and Highsmith, W.E.: Detection and differentiation of fungi inclinical specimens using polymerase chain reaction (PCR) amplification and restriction enzymeanalysis. J Med Vet Mycol 31 (1993) 65-75.

Huang, X.C., Quesada, M.A. and Mathies, R.A.: DNA sequencing using capillary arrayelectrophoresis. Anal Chem 64 (1992) 2149-54.

Hyman, E.D.: A new method of sequencing DNA. Anal Biochem 174 (1988) 423-36.

Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A.: DNA sequencing with Thermus aquaticusDNA polymerase and direct sequencing of polymerase chain reaction-amplified DNA. Proc Natl AcadSci U S A 85 (1988) 9436-40.

Karamohamed, S., Nilsson, J., Nourizad, K., Ronaghi, M., Pettersson, B. and Nyren, P.: Production,purification, and luminometric analysis of recombinant Saccharomyces cerevisiae MET3 adenosinetriphosphate sulfurylase expressed in Escherichia coli. Protein Expr Purif 15 (1999) 381-8.

Kopp, M.U., Mello, A.J. and Manz, A.: Chemical amplification: continuous-flow PCR on a chip.Science 280 (1998) 1046-8.

Kruglyak, L. and Nickerson, D.A.: Variation is the spice of life. Nat Genet 27 (2001) 234-6.

Lander, E.S., Linton, L.M., Birren, B., Nusbaum, C., Zody, M.C., Baldwin, J., Devon, K., Dewar, K.,Doyle, M., FitzHugh, W., et al.: Initial sequencing and analysis of the human genome. Nature 409(2001) 860-921.


61

Larsen, N., Olsen, G.J., Maidak, B.L., McCaughey, M.J., Overbeek, R., Macke, T.J., Marsh, T.L. andWoese, C.R.: The ribosomal database project. Nucleic Acids Res 21 (1993) 3021-3.

Lin, H., Hunter, J.M. and Becker, C.H.: Laser desorption of DNA oligomers larger than one kilobasefrom cooled 4-nitrophenol. Rapid Commun Mass Spectrom 13 (1999) 2335-40.

Lysov Iu, P., Florent'ev, V.L., Khorlin, A.A., Khrapko, K.R. and Shik, V.V.: [Determination of thenucleotide sequence of DNA using hybridization with oligonucleotides. A new method]. Dokl AkadNauk SSSR 303 (1988) 1508-11.

Mackay, I.M., Arden, K.E. and Nitsche, A.: Real-time PCR in virology. Nucleic Acids Res 30 (2002)1292-305.

Maidak, B.L., Larsen, N., McCaughey, M.J., Overbeek, R., Olsen, G.J., Fogel, K., Blandy, J. andWoese, C.R.: The Ribosomal Database Project. Nucleic Acids Res 22 (1994) 3485-7.

Makimura, K., Murayama, S.Y. and Yamaguchi, H.: Detection of a wide range of medically importantfungi by the polymerase chain reaction. J Med Microbiol 40 (1994) 358-64.

Mannarelli, B.M. and Kurtzman, C.P.: Rapid identification of Candida albicans and other humanpathogenic yeasts by using short oligonucleotides in a PCR. J Clin Microbiol 36 (1998) 1634-41.

Maxam, A.M. and Gilbert, W.: A new method for sequencing DNA. Proc Natl Acad Sci U S A 74(1977) 560-4.

McCabe, K.M., Khan, G., Zhang, Y.H., Mason, E.O. and McCabe, E.R.: Amplification of bacterialDNA using highly conserved sequences: automated analysis and potential for molecular triage ofsepsis. Pediatrics 95 (1995) 165-9.

Melamede, R.J.: Automatable process for sequencing nucleotide. In U.S. Patent 4863849 (1985).

Melnick, J.: Papovavirus group. Science 135 (1962) 1128-30.

Metzker, M.L., Raghavachari, R., Richards, S., Jacutin, S.E., Civitello, A., Burgess, K. and Gibbs,R.A.: Termination of DNA synthesis by novel 3'-modified-deoxyribonucleoside 5'-triphosphates.Nucleic Acids Res 22 (1994) 4259-67.

Morrison, E.A. and Burk, R.D.: Classification of human papillomavirus infection. Jama 270 (1993)453.

Mullis, K.B. and Faloona, F.A.: Specific synthesis of DNA in vitro via a polymerase-catalyzed chainreaction. Methods Enzymol 155 (1987) 335-50.

Munoz, N. and Bosch, F.X.: The causal link between HPV and cervical cancer and its implications forprevention of cervical cancer. Bull Pan Am Health Organ 30 (1996) 362-77.

Murray, V.: Improved double-stranded DNA sequencing using the linear polymerase chain reaction.Nucleic Acids Res 17 (1989) 8889.

Nguyen, M.H., Peacock, J.E., Jr., Morris, A.J., Tanner, D.C., Nguyen, M.L., Snydman, D.R., Wagener,M.M., Rinaldi, M.G. and Yu, V.L.: The changing face of candidemia: emergence of non-Candidaalbicans species and antifungal resistance. Am J Med 100 (1996) 617-23.

Nordstrom, T., Alderborn, A. and Nyren, P.: Method for one-step preparation of double-stranded DNAtemplate applicable for use with Pyrosequencing technology. J Biochem Biophys Methods 52 (2002)71-82.

Baback Gharizadeh

62

Nordstrom, T., Nourizad, K., Ronaghi, M. and Nyren, P.: Method enabling pyrosequencing on double-stranded DNA. Anal Biochem 282 (2000a) 186-93.

Nordstrom, T., Ronaghi, M., Forsberg, L., de Faire, U., Morgenstern, R. and Nyren, P.: Direct analysisof single-nucleotide polymorphism on double-stranded DNA by pyrosequencing. Biotechnol ApplBiochem 31 ( Pt 2) (2000b) 107-12.

Nourizad, N., Ehn, M., Gharizadeh, B., Hober, S. and Nyren, P.: Methylotrophic yeast Pichia pastorisas a host for production of ATP-diphosphohydrolase (apyrase) from potato tubers (Solanumtuberosum). Protein Expr Purif 27 (2003) 229-37.

Nyren, P.: Enzymatic method for continuous monitoring of DNA polymerase activity. Anal Biochem167 (1987) 235-8.

Nyren, P.: Apyrase immobilized on paramagnetic beads used to improve detection limits inbioluminometric ATP monitoring. J Biolumin Chemilumin 9 (1994) 29-34.

Nyrén, P.: Method of sequencing DNA based on detection of the release of pyrophosphate andenzymatic nucleotide degradation. In U.S. Patent 6,258,568B1 (2001).

Nyren, P., Karamohamed, S. and Ronaghi, M.: Detection of single-base changes using abioluminometric primer extension assay. Anal Biochem 244 (1997) 367-73.

Nyren, P. and Lundin, A.: Enzymatic method for continuous monitoring of inorganic pyrophosphatesynthesis. Anal Biochem 151 (1985) 504-9.

Nyren, P., Pettersson, B. and Uhlen, M.: Solid phase DNA minisequencing by an enzymaticluminometric inorganic pyrophosphate detection assay. Anal Biochem 208 (1993) 171-5.

Okubo, K., Hori, N., Matoba, R., Niiyama, T., Fukushima, A., Kojima, Y. and Matsubara, K.: Largescale cDNA sequencing for analysis of quantitative and qualitative aspects of gene expression. NatGenet 2 (1992) 173-9.

Patel, J.B.: 16S rRNA gene sequencing for bacterial pathogen identification in the clinical laboratory.Mol Diagn 6 (2001) 313-21.

Pfaller, M.A., Jones, R.N., Messer, S.A., Edmond, M.B. and Wenzel, R.P.: National surveillance ofnosocomial blood stream infection due to species of Candida other than Candida albicans: frequency ofoccurrence and antifungal susceptibility in the SCOPE Program. SCOPE Participant Group.Surveillance and Control of Pathogens of Epidemiologic. Diagn Microbiol Infect Dis 30 (1998) 121-9.

Pfaller, M.A., Messer, S.A., Hollis, R.J., Jones, R.N., Doern, G.V., Brandt, M.E. and Hajjeh, R.A.:Trends in species distribution and susceptibility to fluconazole among blood stream isolates of Candidaspecies in the United States. Diagn Microbiol Infect Dis 33 (1999) 217-22.

Radstrom, P., Backman, A., Qian, N., Kragsbjerg, P., Pahlson, C. and Olcen, P.: Detection of bacterialDNA in cerebrospinal fluid by an assay for simultaneous detection of Neisseria meningitidis,Haemophilus influenzae, and streptococci using a seminested PCR strategy. J Clin Microbiol 32 (1994)2738-44.

Resnick, R.M., Cornelissen, M.T., Wright, D.K., Eichinger, G.H., Fox, H.S., ter Schegget, J. andManos, M.M.: Detection and typing of human papillomavirus in archival cervical cancer specimens byDNA amplification with consensus primers. J Natl Cancer Inst 82 (1990) 1477-84.

Rex, J.H., Bennett, J.E., Sugar, A.M., Pappas, P.G., van der Horst, C.M., Edwards, J.E., Washburn,R.G., Scheld, W.M., Karchmer, A.W., Dine, A.P., et al.: A randomized trial comparing fluconazolewith amphotericin B for the treatment of candidemia in patients without neutropenia. CandidemiaStudy Group and the National Institute. N Engl J Med 331 (1994) 1325-30.


63

Rex, J.H., Pfaller, M.A., Barry, A.L., Nelson, P.W. and Webb, C.D.: Antifungal susceptibility testingof isolates from a randomized, multicenter trial of fluconazole versus amphotericin B as treatment ofnonneutropenic patients with candidemia. NIAID Mycoses Study Group and the Candidemia StudyGroup. Antimicrob Agents Chemother 39 (1995a) 40-4.

Rex, J.H., Rinaldi, M.G. and Pfaller, M.A.: Resistance of Candida species to fluconazole. AntimicrobAgents Chemother 39 (1995b) 1-8.

Rogall, T., Flohr, T. and Bottger, E.C.: Differentiation of Mycobacterium species by direct sequencingof amplified DNA. J Gen Microbiol 136 ( Pt 9) (1990) 1915-20.

Ronaghi, M.: Improved performance of pyrosequencing using single-stranded DNA-binding protein.Anal Biochem 286 (2000) 282-8.

Ronaghi, M., Karamohamed, S., Pettersson, B., Uhlen, M. and Nyren, P.: Real-time DNA sequencingusing detection of pyrophosphate release. Anal Biochem 242 (1996) 84-9.

Ronaghi, M., Pettersson, B., Uhlen, M. and Nyren, P.: PCR-introduced loop structure as primer inDNA sequencing. Biotechniques 25 (1998a) 876-8, 880-2, 884.

Ronaghi, M., Uhlen, M. and Nyren, P.: A sequencing method based on real-time pyrophosphate.Science 281 (1998b) 363, 365.

Salisbury, B.A., Pungliya, M., Choi, J.Y., Jiang, R., Sun, X.J. and Stephens, J.C.: SNP and haplotypevariation in the human genome. Mutat Res 526 (2003) 53-61.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. ProcNatl Acad Sci U S A 74 (1977) 5463-7.

Schneider, A.: Pathogenesis of genital HPV infection. Genitourin Med 69 (1993) 165-73.

Shyamala, V. and Ames, G.F.: Amplification of bacterial genomic DNA by the polymerase chainreaction and direct sequencing after asymmetric amplification: application to the study of periplasmicpermeases. J Bacteriol 171 (1989) 1602-8.

Smith, L.M.: Sequence from spectrometry: a realistic prospect? Nat Biotechnol 14 (1996) 1084, 1087.

Snijders, P.J., van den Brule, A.J., Schrijnemakers, H.F., Snow, G., Meijer, C.J. and Walboomers, J.M.:The use of general primers in the polymerase chain reaction permits the detection of a broad spectrumof human papillomavirus genotypes. J Gen Virol 71 (1990) 173-81.

Southern, E.M.: Detection of specific sequences among DNA fragments separated by gelelectrophoresis. J Mol Biol 98 (1975) 503-17.

Stephens, J.C., Schneider, J.A., Tanguay, D.A., Choi, J., Acharya, T., Stanley, S.E., Jiang, R., Messer,C.J., Chew, A., Han, J.H., et al.: Haplotype variation and linkage disequilibrium in 313 human genes.Science 293 (2001) 489-93.

Tang, Y.W., Ellis, N.M., Hopkins, M.K., Smith, D.H., Dodge, D.E. and Persing, D.H.: Comparison ofphenotypic and genotypic techniques for identification of unusual aerobic pathogenic gram-negativebacilli. J Clin Microbiol 36 (1998) 3674-9.

Van de Peer, Y., Chapelle, S. and De Wachter, R.: A quantitative map of nucleotide substitution ratesin bacterial rRNA. Nucleic Acids Res 24 (1996) 3381-91.

Baback Gharizadeh

64

van den Brule, A.J., Pol, R., Fransen-Daalmeijer, N., Schouls, L.M., Meijer, C.J. and Snijders, P.J.:GP5+/6+ PCR followed by reverse line blot analysis enables rapid and high-throughput identificationof human papillomavirus genotypes. J Clin Microbiol 40 (2002) 779-87.

van Doorn, L.J., Kleter, B. and Quint, W.G.: Molecular detection and genotyping of humanpapillomavirus. Expert Rev Mol Diagn 1 (2001) 394-402.

Velculescu, V.E., Zhang, L., Vogelstein, B. and Kinzler, K.W.: Serial analysis of gene expression.Science 270 (1995) 484-7.

Velculescu, V.E., Zhang, L., Zhou, W., Vogelstein, J., Basrai, M.A., Bassett, D.E., Jr., Hieter, P.,Vogelstein, B. and Kinzler, K.W.: Characterization of the yeast transcriptome. Cell 88 (1997) 243-51.

Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mural, R.J., Sutton, G.G., Smith, H.O., Yandell,M., Evans, C.A. and Holt, R.A.: The sequence of the human genome. Science 291 (2001) 1304-51.

Vernon, S.D., Unger, E.R. and Williams, D.: Comparison of human papillomavirus detection andtyping by cycle sequencing, line blotting, and hybrid capture. J Clin Microbiol 38 (2000) 651-5.

Villa, L.L.: Human papillomaviruses and cervical cancer. Adv Cancer Res 71 (1997) 321-41.

Walboomers, J.M., Jacobs, M.V., Manos, M.M., Bosch, F.X., Kummer, J.A., Shah, K.V., Snijders, P.J.,Peto, J., Meijer, C.J. and Munoz, N.: Human papillomavirus is a necessary cause of invasive cervicalcancer worldwide. J Pathol 189 (1999) 12-9.

Watson, J.D. and Crick, F.H.: Molecular structure of nucleic acids. A structure for deoxyribose nucleicacid. Nature 171 (1953) 737-738.

White, T.C., Marr, K.A. and Bowden, R.A.: Clinical, cellular, and molecular factors that contribute toantifungal drug resistance. Clin Microbiol Rev 11 (1998) 382-402.

Wittwer, C.T., Herrmann, M.G., Moss, A.A. and Rasmussen, R.P.: Continuous fluorescencemonitoring of rapid cycle DNA amplification. Biotechniques 22 (1997) 130-1, 134-8.

Woese, C.R.: Bacterial evolution. Microbiol Rev 51 (1987) 221-71.

Woese, C.R., Gutell, R., Gupta, R. and Noller, H.F.: Detailed analysis of the higher-order structure of16S-like ribosomal ribonucleic acids. Microbiol Rev 47 (1983) 621-69.

Yager, T.D., Nickerson, D.A. and Hood, L.E.: The Human Genome Project: creating an infrastructurefor biology and medicine. Trends Biochem Sci 16 (1991) 454, 456, 458.

Documents

Method Development and Applications of Pyrosequencing …9478/... · 2005-03-17 · Method development and applications of Pyrosequencing technology 1 1. Introduction Recent impressive