Chapter 2The Chemistry of BiologyCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.*

ShellsHydrogenCarbon6 protons6 neutrons6 electronsNucleus(b)protonneutronelectronNucleusNucleusCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.1 proton1 electron*Atoms, Bonds, and MoleculesMatter - all materials that occupy space and have mass. Matter is composed of atoms

Atom - simplest form of matter not divisible into simpler substances

Protons: (+) subatomic particlesNeutrons: neutral subatomic particlesElectrons: (-) subatomic particles

*Different Types of AtomsAll atoms share the same fundamental structure

Element - pure substances with a characteristic number of protons, neutrons, and electrons and predictable chemical behaviorsShellsHydrogenCarbon6 protons6 neutrons6 electronsNucleus(b)protonneutronelectronNucleusNucleusCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.1 proton1 electron

The Major Elements of Life*

*Characteristics of ElementsAtomic number number of protonsMass number number of protons and neutronsIsotopes variant forms of the same element that differ in the number of neutronsAtomic weight average mass numbers of all isotopic formsElectron orbitals volumes of space surrounding the atomic nucleus where electrons are likely to be found

(a)OrbitalsShell 1Shell 2ShellHydrogenCarbonShellsHydrogenCarbon6 protons6 neutrons6 electronsNucleus(b)protonneutronelectronNucleusNucleus1 proton1 electron

Biologically Important Atoms*MgS16SULFURAT. MASS 32.06Cl17CHLORINEAT. MASS 35.45P15PHOSPHORUSAT. MASS 30.97Ca20CALCIUMAT. MASS 40.08K19POTASSIUMAT. MASS 39.10Na11SODIUMAT. MASS 22.99O8OXYGEN2 6AT. MASS 16.00N7NITROGEN2 5AT. MASS 14.00C6CARBON2 4AT. MASS 12.01Mg12MAGNESIUM2 8 2AT. MASS 24.30Chemical symbolAtomic numberChemical nameNumberOf e inEachEnergylevelPQSNCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.AT. MASS 1.001HHYDROGEN1p12pHc6p7pN8pO2 8 111pNa2 8 8 12 8 8 219p20pKCa2 8 52 8 6PS2 8 7Cl15p16p17pHLiBeNaMgKCaRbSrCsBaFrRaMnTcReFeRuOsCoRhIrNiPdPtScTiVCrCuZnGaGsAsSeBrKrAlSiPSClArBCNOFNeHe1

Concept Check:If two atoms have the same number of protons and electrons but different numbers of neutrons, they would be

A. Different elements Isotopes of the same element Ions of the same element Orbitals of the same element

*

*Bonds and MoleculesMolecule - a chemical substance that results from the combination of two or more atomsCompounds - molecules that are combinations of two or more different elementsFormula/Mass weight - sum of all of the atomic masses of the atoms a molecule containsChemical bonds - when 2 or more atoms share, donate, or accept electrons to form molecules and compounds3 types: covalent, ionic, and hydrogen

83 Types of Chemical BondsCovalent bonds electrons are shared among atomsPolar covalent bonds unequal sharingNonpolar covalent bonds equal sharing

Covalent BondsSingleDoubleCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Covalent Bonds*Hydrogen moleculeSingle bondH2eeeeH++Hydrogen atomHHydrogen atom1p+1p+1p+1pH HCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.8n8n8p+8p+Molecular oxygen (O2)Double bondO O6p+6n1p+1p+1p+1p+Methane (CH4)HHHHCHHHHC

Polarity*()H HHH(+)(+)(a)(b)8p+1p+1p+O(+)(+)OCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.()

*3 Types of Chemical Bonds

Ionic bonds electrons are transferred to one atom forming positively charged cations and negatively charged anions

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.Ionic Bond(+)()

Ionic Bonding*11p+12nNa[Na]+ [Cl]ClSodiumChloride(c)17p+18nChlorine atom (Cl)12Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.(a) Sodium atom (Na)(b) Na Cl(d) Kathy Park TalaroCl2Cl2Na1Cl2Cl2Cl2Cl2Cl2Na1Na1Na1Na1Na1NaCl crystalsCl2Cl2Na11221HHO11122Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.11p117p2Sodium ion (Na1)(cation)Chlorine atom (Cl2)(anion)Na1

*3 Types of Chemical BondsHydrogen bonds weak bonds between hydrogen and other atoms

Hydrogen BondHOorNMolecule BMolecule ACopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.(+)()1Hydrogen bondsWater moleculeHOHOHHHOHHOHOHH121222111111Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.*

Concept Check:Molecules where atoms share electrons contain

A. Covalent Bonds Ionic Bonds Hydrogen Bonds

*

*Oxidation-Reduction Reactions Energy exchange in cells is a result of the movement of electrons from one molecule to another. Oxidation the loss of electrons Reduction the gaining of electrons Redox reactionsNaReducing agent gives up electrons.Oxidizing agent accepts electrons.Oxidized cationReduced anion281Na28Cl287Cl28812Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Chemical ShorthandReactants - molecules starting a reactionProducts - substances left by a reactionSynthesis reaction - the reactants bond together in a manner that produces an entirely new molecule

Decomposition reaction - the bonds on a single reactant molecule are broken to release two or more products

Exchange reaction - the reactants trade portions between each other and release products that are combinations of the two*+NaOH

*SolutionsSolutes Na+ & Cl-

Solvent H2OSolution a mixture of one or more substances called solutes, dispersed in a dissolving medium called a solventCl2Cl2Na1Cl2Cl2Cl2Cl2Cl2Na1Na1Na1Na1Na1NaCl crystalsCl2Cl2Na11221HHO11122Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.11p117p2Sodium ion (Na1)(cation)Chlorine atom (Cl2)(anion)Na1

Aqueous Solutions*Hydrophilic molecules - dissolve in waterHydrophobic molecules - repel waterAmphipathic molecules - have both hydrophilic and hydrophobic propertiesCl-+++++++++++++++++++++++++++++++++++++++HydrogenOxygenWater moleculesNa+-++--------++-------++-------------+++++++++++++++-Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

*Acidity, Alkalinity, and the pH Scale Ionization of H2O releases hydrogen ions [H+] and hydroxyl ions [OH-] pH scale ranges from 0 to 14, expresses the concentration of H+ ions pH is the negative logarithm of the concentration of H+

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.[H+]1234Increasing acidityIncreasing basicity2.0 acid spring water2.3 lemon juice2.4 vinegar3.0 red wine3.5 sauerkraut4.2 beer4.6 acid rain5.0 cheese5678910111213146.0 yogurt6.6 cow's milk7.0 distilled water7.4 human blood8.0 seawater8.4 sodium bicarbonate9.2 borax, alkaline soils10.5 milk of magnesia11.5 household ammonia12.4 limewater0pH13.2 oven cleaner1 M potassium hydroxide0.1 M hydrochloric acidAcidicNeutralBasic (alkaline) [OH]

pH and Ion Concentration*

Concept Check:If solution A has a pH of 2 and solution B has a pH of 4, which of the following is true?

A. Solution A has 2 times more H+ ions than solution BSolution B has 2 times more H+ ions than solution ASolution A has 10 times more H+ ions than solution BSolution B has 10 times more H+ ions than solution ASolution A has 100 times more H+ ions than solution B

*

*The Chemistry of Carbon and Organic CompoundsOrganic chemicals compounds containing carbon bonded to hydrogens

Carbon is the fundamental element of lifeContains 4 atoms in its outer orbitalCan form single, double, or triple covalent bondsCan form linear, branched, or ringed molecules

The Versatility of Bonding in Carbon*(a)C OCNC CCCCNCH(b)BranchedCCCCCCCCCRingedCCCCCCCCCCCOCOCCNNCCCCCCCCCHCHLinearCCCCCCCCC11CNN1111Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.CCCCCCCCC

NH2TABLE 2.3Representative Functional Groups and Organic Compounds That Contain ThemFormula of Functional GroupNameCan Be Found inHydroxylAlcohols, carbohydratesCarboxylFatty acids, proteins, organic acidsAminoProteins, nucleic acidsEsterLipidsSulfhydrylCysteine (amino acid), proteinsCarbonyl, terminal endAldehydes, polysaccharidesCarbonyl, internalKetones, polysaccharidesPhosphateDNA, RNA, ATPR*RO HCOOHR CHHR COO RR CHHSHR COHR COCCR OOPOHOHCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.Functional Groups of Organic CompoundsAccessory molecules that bind to organic compounds

Confer unique reactive properties on the whole molecule*

*MacromoleculesBiochemicals are organic compounds produced by living things

Macromolecules: large compounds assembled from smaller subunitsMonomer: a repeating subunitPolymer: a chain of monomers

4 Biological Macromolecules: Carbohydrates, Lipids, Proteins, Nucleic Acids

Biological Macromolecules*

*CarbohydratesSugars and polysaccharidesGeneral formula (CH2O)nAldehydes and ketones

C1HOCH2CH2OHFructoseOHOHHOHHOHHOHHKetone groupHOHHOH1236GalactoseHOHOHHOHHOHHOHHOCH2OHHOHHOHHOHOHHH123456HOHOHHOHOH45GlucoseHOHOHHOHHOHHOHHOHHAldehyde groupOCH2OHHHOHOHHOHOHHH123456HC2C3C4C5C6C1C2C3C4C5C6C1C2 C3C4C5C6Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

*Carbohydrates

Saccharide: simple carbohydrateMonosaccharide: 3-7 carbonsDisaccharide: two monosaccharidesPolysaccharide: five or more monosaccharides*PolysaccharideOOOOOOOOOOOOOOCH2O DisaccharideMonosaccharideCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.OOOCH2

(c)(d)(b)(a)H2OCOHCOHCC1COHCCCOHCOCCOHHCCC1HHHOHHOOHHHOCCCCCOHHOHOHHCCCCOCH2OHCH2OHCH2OHCH2OHCH2OHCH2OHCH2OHCH2OHCH2OHCH2OHHHHOHHOOHHCCCCCOHHHHOHHOOHHHOCCCCCMaltoseHHHOHHOOHHCCCCOHGlucose11HHHOHHOOHHOCCCCCOH HOGlucose1OHHOHOHOHHCCCC11CCCCCCCHHHOHHOOHHHOCCCCCOHGlucoseH2O1H2OH2O66CH2OHHHHOHHOOHHHOCCCCOHGlucoseGalactose11C6CH2OHHHOHHOOHCCCCCH666616616OOSucroseLactoseFructoseHOHCHCH2OHHHHOHHOOHOHCCCCHOC6CH2OHHHOHHOOHCCCCH6HOHC3123512344512345123451234512345124524531234524531(b)23451(b)23451(b)1(b)Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.*CarbohydratesSubunits linked by glycosidic bonds

Dehydration synthesis: loss of water in a polymerization reaction

*CarbohydratesFunctions cell structure, adhesion, and metabolismCH2OHHHOHHOOHHOCH2OHHHHOHHOOHHOHOCH2OHHHHOHHOOHHaaOBranchOCH2OHHHHOHOOHHOCHHHOHHOOHHBranchpointOHOHCH2OHOCH2OHHOHOHHHHHOHHOOHHOHHOHCH2OHHOHOHHHHOHOOCH2OHHHHOHHOOHHOHbonds(a) Cellulose(b) Starch14141456141465323256325632563214141414Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.bbbaab

*LipidsLong or complex, hydrophobic, C - H chainsTriglycerides, phospholipids in membranes, steroids like cholesterolFunctionsTriglycerides energy storagePhospholipid major cell membrane componentSteroids cell membrane component

Triglycerides: 3 fatty acids bound to glycerol* Triglycerides are used for energy storage Could be saturated or unsaturatedCCCCCCCCCCCCCCCHHHHHHHHHHHHHHHHHHHHHHHHHHHHHCHHOHOLinolenic acid, an unsaturated fatty acidPalmitic acid, a saturated fatty acidHCCCCCCCCCCCCCCCHHHHHHHHHHHHHHHHHHHHHOCHHOCHHCHHHH1Fatty acidsTriglycerides2Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Phospholipids: glycerol with 2 fatty acids and a phosphate group* Bilayers of phospholipids form membranesGlycerolCharged headPhosphateTailDoublebond Creates a kink.Fatty acids(a)(b)Variable alcohol groupWaterPolar lipid moleculePolar headNonpolartails1 Phospholipids in single layer2 Phospholipid bilayerWaterWaterOOCCHCHHCHHCHHCHHCHHCHHCHHCHHCHCHHCHHCHOHCHHCHHCHHCHHCHHCHHCHHCHHCHHCHHCHHCHOCHHCHHCHOPO2OHHCHHCHHCHHCHHCHHCHHCHHCHHOHCHCHRCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Membrane Lipids* Cholesterol is inserted into the phospholipid bilayerCH2CCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.GlycolipidGlobular proteinProteinCholesterolPhospholipidsCellmembraneSite forester bondwith a fattyacidCholesterolH2HCH2CCHCCCCH2H2CH2CHOCCH2CH2CH3CH3CH3CH3CH2CH2HCHHCCHCH3CHCH2CH

Concept Check:Triglycerides that have double bonds in their fatty acids are best described as

A. Saturated Unsaturated Phospholipids Cholesterol

*

*ProteinsPredominant molecules in cellsMonomer amino acids 20Polymer peptide, polypeptide, proteinSubunits linked by peptide bondsFold into very specific 3-D shapesFunctions support, enzymes, transport, defense, movement

*Amino AcidsAmino acids are the monomers that make up a protein polymer

Formation of a Peptide Bond*Amino acids are attached through peptide bonds to form proteinsNCR1HCONHCCR3HCONHCCHR2CONHCCHR4CH + 3H2ONCR1HHCOOHNHHCCR3HCOHONHHCCHR2COHONHHCCHR4COOHBond formingHHHOCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

*Protein StructurePrimary Structure

Secondary Structure

Tertiary Structure

Quaternary StructureThe primary structure is a series of amino acids bound in a chain. Amino acids display small charged functional groups (red symbols).The tertiary structure forms when portions of the secondary structure further interact by forming covalent disulfide bonds and additional interactions. From this emerges a stable three-dimensional molecule. Depending on the protein, this may be the final functional state.The quaternary structure exists only inproteins that consist of more than onepolypeptide chain. Shown here is amodel of the cholera toxin, composedof five separate polypeptides, eachone shown in a different color.The secondary structure develops when CO and NH groups on adjacent amino acids form hydrogen bonds. This action folds the chain into local configurations called the a helix and b -pleated sheet. Most proteins have both types of secondary structures.Secondary structureProjected 3-dimensional shape (note grooves and projections)Quaternary structureDisulfide bondSTertiary structurea helixb-pleated sheet1234Detail of hydrogen bondNCCNNONCCCOHOOHCAmino acidsPrimary structureCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.Image courtesy RCSB Protein Data Bank, www.pdp.orgS

*Nucleic AcidsDNA and RNANucleotide monomerDNA deoxyribonucleic acidA,T,C,G nitrogen basesDouble helix Function hereditary materialRNA ribonucleic acidA,U,C,G nitrogen basesFunction organize protein synthesis

H bondsBackboneBackboneDNA(b) In DNA, the polymer is composed of alternating deoxyribose (D) and phosphate (P) with nitrogen bases (A,T,C,G) attached to the deoxyribose. DNA almost always exists in pairs of strands, oriented so that the bases are paired across the central axis of the molecule.(a) A nucleotide, composed of a phosphate, a pentose sugar, and a nitrogen base (either A,T,C,G, or U) is the monomer of both DNA and RNA.PhosphateN basePentose sugarPPPPPPPPPPPPPPPPPPP(c) In RNA, the polymer is composed of alternating ribose (R) and phosphate (P) attached to nitrogen bases (A,U,C,G), but it is usually a single strand.RNAATCGGCTAATCGUACGCADDDDDDDDDDDDRRRRRRCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Nucleotide Components*DNA Nucleotides:DeoxyriboseC, G, A or T

RNA Nucleotides:RiboseC, G, A or UOHOCH2OHHHHOHHOHRibose(a) Pentose sugars(c) Pyrimidine basesUracil (U)HOCH2OHHHHOHHHDeoxyriboseThymine (T)Cytosine (C)OHHHOHONNHH3CHOHNHHHHOHNNNN(b) Purine basesAdenine (A)Guanine (G)OHHNHHHNHHHHHNNNNNNNNOCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Double Helix of DNADNA is formed by two very long polynucleotide strands linked along their length by hydrogen bonds*OOOOPPHydrogen bondsBase pairsBackbonestrandsDTADPPDCGDDDATPOOOOOOOOCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

DNA Passing on the Genetic MessageEach strand is copiedReplication is guided by base pairingEnd result is two separate double strands*GCTGTACAACAGCTGTGCACTGTCellsTwo double strandsTwo single strandsNew basesH-bonding severedEvents in Cell DivisionEvents in DNA ReplicationATCGATGCGATGCCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

*ATP: The Energy Molecule of CellsAdenosine triphosphateNucleotide - adenine, ribose, three phosphatesFunction - transfer and storage of energy

N2N4563OHOHOCH2OPOPOPOOOOOOOCopyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display.Adenosine diphosphate (ADP)Adenosine triphosphate (ATP)Adenosine87N9NNH21

Concept Check:Which of the following is TRUE about RNA?

A. It is a double stranded molecule It contains the sugar deoxyribose It contains the nitrogenous base Uracil It holds the genetic information All of the above are true

*

************************************************************