lable at ScienceDirect

Fish & Shellfish Immunology 36 (2014) 120e129

Contents lists avai

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate/ fs i

Full length article

Modulatory effects of deltamethrin-exposure on the immune status,metabolism and oxidative stress in gilthead seabream(Sparus aurata L.)

F.A. Guardiola, P. Gónzalez-Párraga, J. Meseguer, A. Cuesta, M.A. Esteban*

Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, Campus Regional de Excelencia Internacional “CampusMare Nostrum”, University of Murcia, 30100 Murcia, Spain

a r t i c l e i n f o

Article history:Received 3 September 2013Received in revised form16 October 2013Accepted 21 October 2013Available online 29 October 2013

Keywords:DeltamethrinImmune systemAntioxidant genesGilthead seabream (Sparus aurata L.)Teleosts

* Corresponding author. Department of Cell BioloBiology, Campus Regional de Excelencia InternacionUniversity of Murcia, 30100 Murcia, Spain. Tel.:868883963.

E-mail address: aesteban@um.es (M.A. Esteban).

1050-4648/$ e see front matter � 2013 Elsevier Ltd.http://dx.doi.org/10.1016/j.fsi.2013.10.020

a b s t r a c t

Deltamethrin, a sintetic pyrethroid, is the insecticide that has been replacing recently to others likeorganochlorines, organophosphates and carbamates which are less toxic for birds and mammals,although, unfortunately, all of them are highly toxic to various non-targeted aquatic organisms includingfish. In the present study, the consequences of the exposition of gilthead seabream (Sparus aurata L.)specimens to sublethal bath dose of deltamethrin (0.1 ppb) on organo-somatic indexes, immunity, sericmetabolic parameters, oxidative stress and liver histology were determined after 1, 3, 7 and 14 days ofexposure. Deltamethrin alters gilthead seabream immune status, the hepato-somatic index and variousseric metabolic parameters since the first exposure day while important progressive deleteriousmorphological changes in liver were also observed. However, no statistically significant deviation wasdetected in the expression of oxidative stress-related genes whilst the expression of cytochrome P450gene was up-regulated in head-kidney and liver of exposed fish. Overall, the present results indicatesevere immunotoxicological and metabolic effects of deltamethrin in gilthead seabream, the species withthe highest rate of production in Mediterranean aquaculture. In general, the values obtained for thetested parameters during the trial seem to indicate that specimens try to adapt to this adverse situationalthough the continuous presence of the toxic impede the hypothetic recovery of homoeostasis. The useof deltamethrin in the proximities of seabream farms should be carefully considered.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Traditional pesticides such as organochlorines, organophos-phates and carbamates are recognized for their ecological hazards[1] and they may cause various diverse side effects in animals andhumans, for example: changes in DNA structure [2], sperm mal-formations [3], generation of reactive oxygen species [4], in-crements in the level of free radicals [5], inhibition of specificenzymes [6], changes on antioxidant defense system [7], decreaseof expression levels of growth-related genes [8], act as inducers ofheat-shock protein in tissues and cells in different organisms [9] orprovoked the formation of micronucleus in human lymphocytes[10]. Thus, elimination of their use or reduction in the adverse ef-fects of pesticides is desirable for the environment.

gy and Histology, Faculty ofal “Campus Mare Nostrum”,þ34 868887665; fax: þ34

All rights reserved.

In this sense, the pyrethroids, a new generation of compounds,have proved to be good substitutes of traditional pesticides and theyare extensively used in agriculture and forestry, for controlling pests,insects and vectors of endemic diseases, protecting seeds duringstorage and fighting household insects [11]. Pyrethroids have a lowpersistence in the ambient, high bio-efficacy, biodegradability andlower toxicity to mammals and birds comparing to traditional in-secticides [12] because they have a short life in most animals as theyare readily metabolized [13]. Specifically, deltamethrin [(S)-a-ciano-3-fenoxibencil, (1R, 3R)-3-(2,2-dibromovinil)-2,2-dimetilciclopropancarboxilato] (C22H19Br2NO3) is one of the most important py-rethroids widely used as pesticide and insecticide because it has awide range of application in both industrial and agricultural pur-poses. Deltamethrin is a synthetic analogue of the pyrethrins,derived from natural extracts from the Chrysanthemum cinerar-iaefolium, with a similar structure to these but modified in order toimprove its stability in the environment [14]. Although primarily itwas thought to be less toxic, numerous reports have demonstrateddeltamethrin toxicity in laboratory and wildlife animal species [15e17]. Strikingly, fish are an exception for its clearance since they are

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129 121

reported to be deficient in enzymes involved in pyrethroid hydro-lization [18], due to this peculiarity fish are extremely sensitive tothe neurotoxic effects of these pesticides, in general, and of delta-methrin, in particular [19e24]; in other words, pyrethroids are up to1000 times more toxic to fish than to mammals or birds [25]. Ac-cording to the World Health Organization [26] the acute toxicitydata (LC50) for deltamethrin in fish after 96 h of exposure, withranges between 0.4 and 2.0 mg L�1, is classified as highly toxic.Furthermore, deltamethrin is also toxic formarine invertebrates [17]and zooplankton communities [27] so its effects onmarine fauna arevery negative and remain largely unknown.

Exposure of fish to deltamethrin produces different adverse ef-fects: histopathological alterations in different organs [23,25,28,29],affects both energetic metabolism and ionic regulation [30], blocksthe sodium channels of nerve filaments [31], affects the gamma-aminobutyric acid (GABA) receptors in the nerve filaments [32],causes different effects on the reproductive state [22], causes severalsymptoms of stress [33], inhibits acetylcholine esterase [34], affectsinnate immunity [35,36], causes increased lipid peroxidation [1] anddecreases antioxidant superoxide dismutase (SOD) and catalase(CAT) activities [1,21]. Deltamethrin also provokes alterations onvital tissues of fish as gills (the primary route for the entry of pes-ticides) and liver (major site of storage, biotransformation andexcretion of pesticides). For this reason, both organs were chosen ascriteria for the sublethal action of deltamethrin in fish and resultedto be an extraordinarily sensitive tool to reveal harmful effects infish health [37]. In aquaculture, deltamethrin is commonly used inrainbow trout and Atlantic salmon to treat sea lice (Lepeophtheirussalmonis, Caligus elongatus) [38,39] in many aquatic larvicidal pro-grams [25]. Therefore, further characterization of the potentialnegative effects that this toxicant may exert on aquatic environ-ments is mandatory.

Regarding immune status, in general, pesticides are pollutantsthat cause immunosuppressive effects in fish. In spite of theimportance of this problem the available studies of how pyre-throids disrupt the functioning of the immune system of teleostsare very scarce and none focus on gilthead seabream (Sparus aurataL.), the main cultured fish species in the Mediterranean area [40].Then, the aim of the present study was to investigate the conse-quences of the exposure of gilthead seabream specimens to asublethal waterborne dose of deltamethrin (0.1 ppb) on maininnate immune parameters, as well as on the spleen and liverorgano-somatic indexes, seric metabolic parameters and liver his-tology after 1, 3, 7 and 14 days of exposure. Furthermore, the effectson the expression levels of several genes related to the oxidativestress or detoxification were analyzed by real-time PCR in head-kidney and liver, with the purpose of discriminating which ofthese parameters could be useful for evaluating the effects of pes-ticides in fish immune system.

2. Materials and methods

2.1. Animals

Forty-eight (104 � 26 g weight and 18 � 1.5 cm length) of thehermaphroditic protandrous seawater teleost gilthead seabream (S.aurata L.), obtained fromDoramenor Acuicultura S.L. (Murcia, Spain),were kept in recirculating seawater aquaria (250 L) in theMarine FishFacility at the University of Murcia in recirculation systems. Thewater wasmaintained at 20� 2 �Cwith a flow rate of 1500 l h�1 and28& salinity. The photoperiod was of 12 h light:12 h dark and fishwere fedwith a commercial pellet diet (Skretting) at a rate of 2%bodyweight day�1. Fishwere allowed to acclimatise for 15 days before thestart of the experimental trial. All experimental protocols wereapproved by the Bioethical Committee of the University of Murcia.

2.2. Experimental design

Fish were randomly assigned and divided into two identicaltanks as unexposed (control group) or exposed to a sublethaldosage (0.1 ppb) of deltamethrin. To do this, deltamethrin (Sigma)was dissolved in acetone at 1 mg ml�1 and the precise amount addedto the tank. The control group received the same volume of acetonealone. Six fish per group were sampled after 1, 3, 7 and 14 days ofexposure.

2.3. Sample collection

Fish were dissected under sterile conditions and the whole fish,liver and spleen weighed. Liver fragments were sampled for his-tology. Head-kidney (HK) and liver fragments were stored in TRIzolReagent (Invitrogen) at �80 �C for later isolation of RNA. Bloodsamples were obtained from the caudal vein of each specimenwitha 27-gauge needle and 1 ml syringe. After clotting at 4 �C, eachsample was centrifuged and the serum removed and frozenat �80 �C until use. Other HK fragments were cut into small frag-ments and transferred to 8 ml of sRPMI [RPMI-1640 culture me-dium (Gibco) supplemented with 0.35% sodium chloride (to adjustthe medium’s osmolarity to gilthead seabream plasma osmolarityof 353.33 mOs), 2% foetal calf serum (FCS, Gibco), 100 i.u. ml�1

penicillin (Flow) and 100 mg ml�1 streptomycin (Flow)] for leuco-cyte isolation [41]. Cell suspensions were obtained by forcingfragments of the organ through a nylon mesh (mesh size 100 mm),washed twice (400 � g, 10 min), counted and adjusted to107 cells ml�1 in sRPMI. Cell viability was determined by the trypanblue exclusion test.

2.4. Determination of organo-somatic indexes and condition factor

Whole body, spleen and liver were weighted. The organo-somatic index (OSI) for spleen and liver was calculated with thefollowing formula: OSI¼ (g tissue g body�1)� 100. Condition factor(K) was calculated according to the following formula:K ¼ (g body cm length�3) � 100.

2.5. Determination of metabolic parameters in serum

The presence of aspartate aminotransferase (AST), creatine ki-nase (CK), uric acid (UA), glucose (GLU), calcium (CAþ2), phos-phorus (PHOS), total protein (TP), albumin (ALB), globulin (GLOB),potassium (Kþ) and sodium (Naþ) were determined in the serum ofseabream gilthead specimens using samples of 100 ml of serum inan automated analyzer (VetScan, Abaxis Veterinary Diagnostics)and rotor (VetScan AvianeReptilian Profile Plus) according to themanufacturer’s instructions.

2.6. Light microscopy

Liver samples were fixed with 10% neutral buffered formalin(Panreac) at room temperature for 24 h. After serial dehydrationsteps in alcohol, samples were embedded in hydrophilic resin JB-4according to routine procedures. Sections were cut at 5 mm(Microm), mounted and stained with haematoxylin and eosin (HE).Slides were analyzed by a light microscope (Leica 6000B) and im-ages were acquired with a Leica DFC280 digital camera.

2.7. Immune parameters

2.7.1. Natural haemolytic complement activityThe activity of the alternative complement pathway was

assayed using sheep red blood cells (SRBC, Biomedics) as targets

Table 1Primers used for real-time PCR.

Gene name Geneabbreviation

GenBanknumber

Primer sequences (50 / 30)

Elongationfactor 1a

EF1a AF184170 CTGTCAAGGAAATCCGTCGTTGACCTGAGCGTTGAAGTTG

Cu/Zn superoxidedismutase

SOD AJ937872 CCATGGTAAGAATCATGGCGGCGTGGATCACCATGGTTCTG

Catalase CAT FG264808 TTCCCGTCCTTCATTCACTCCTCCAGAAGTCCCACACCAT

Glutathionereductase

GR AJ937873 CAAAGCGCAGTGTGATTGTGGCCACTCCGGAGTTTTGCATTTC

CytochromeP450

CYP1A1 AF011223 GCATCAACGACCGCTTCAACGCCCTACAACCTTCTCATCCGACATCTGG

Heat-ShockProtein 70

HSP70 EU805481 AATGTTCTGCGCATCATCAAGCCTCCACCAAGATCAAAGA

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129122

[42]. Equal volumes of SRBC suspension (6%) in phenol red-freeHank’s buffer (HBSS) containing Mgþ2 and EGTA (ethylene glycoltetraacetic acid) were mixed with serially diluted serum to givefinal serum concentrations ranging from 10% to 0.078%. After in-cubation for 90 min at 22 �C, the samples were centrifuged at 400 gfor 5 min at 4 �C to avoid unlysed erythrocytes. The relative hae-moglobin content of the supernatants was assessed by measuringtheir optical density at 550 nm in a plate reader (BMG labtech-Fluostar galaxy). The values of maximum (100%) and minimum(spontaneous) haemolysis were obtained by adding 100 ml ofdistilled water or HBSS to 100 ml samples of SRBC, respectively. Thedegree of haemolysis (Y) was estimated and the lysis curve for eachspecimenwas obtained by plotting Y (1�Y)�1 against the volume ofserum added (ml) on a logelog scaled graph. The volume of serumproducing 50% haemolysis (ACH50) was determined and the num-ber of ACH50 units ml�1 obtained for each experimental fish.

2.7.2. Serum and leucocyte peroxidase activityThe peroxidase activity in serum or leucocytes was measured

according to Quade and Roth [43]. Briefly, 15 ml of serum werediluted with 135 ml of HBSS without Caþ2 or Mgþ2 in flat-bottomed96-well plates. 50 ml of 20 mM 3,30,5,50-tetramethylbenzidine hy-drochloride (TMB, Sigma) and 5 mM H2O2 were added. To deter-mine the leucocyte peroxidase content, 106 HK leucocytes in sRPMIwere lysed with 0.002% cetyltrimethylammonium bromide (Sigma)and, after centrifugation (400 g, 10 min), 150 ml of the supernatantswere transferred to a fresh 96-well plate containing 25 ml of 10 mMTMB and 5 mMH2O2. In both cases, the colour-change reactionwasstopped after 2 min by adding 50 ml of 2 M sulphuric acid and theoptical density was read at 450 nm in a plate reader. Standardsamples without serum or leucocytes, respectively, were used asblanks.

2.7.3. Serum IgM levelTotal serum IgM levels were analyzed using the enzyme-linked

immunosorbent assay (ELISA) [44]. Thus, 20 ml per well of 1/100diluted serum were placed in flat-bottomed 96-well plates intriplicate and the proteins were coated by overnight incubation at4 �C with 200 ml of carbonateebicarbonate buffer (35 mM NaHCO3and 15 mM Na2CO3, pH 9.6). After three rinses with PBT (20 mMTriseHCl, 150 mM NaCl and 0.05% Tween 20, pH 7.3) the plateswere blocked for 2 h at room temperature with blocking buffercontaining 3% bovine serum albumin (BSA, Sigma) in PBT, followedby three rinses with PBT. The plates were then incubated for 1 hwith 100 ml per well of mouse anti-gilthead seabream IgM mono-clonal antibody (Aquatic Diagnostics Ltd.) (1/100 in blockingbuffer), washed and incubated with the secondary antibody anti-mouse IgG-HRP (1/1000 in blocking buffer, Sigma). After exhaus-tive rinsing with PBT the plates were developed using 100 ml of a0.42 mM TMB solution, prepared daily in a 100 mM citric acid/so-dium acetate buffer, pH 5.4, containing 0.01% H2O2. The reactionwas allowed to proceed for 10 min and stopped by the addition of50 ml of 2 M H2SO4 and the plates were read at 450 nm. Negativecontrols consisted of samples without serum or without primaryantibody, whose OD values were subtracted for each sample value.

2.7.4. Respiratory burst activityThe respiratory burst activity of gilthead seabream HK leuco-

cytes was studied by a chemiluminescence method [45]. Briefly,samples of 106 leucocytes in sRPMI were placed in the wells of aflat-bottomed 96-well microtiter plate, to which 100 ml of HBSScontaining 1 mg ml�1 phorbol myristate acetate (PMA, Sigma) and10�4 M luminol (Sigma) were added. The plate was shaken andluminescence immediately read in a plate reader (BMG labtech-Fluostar galaxy) for 1 h at 2 min intervals. The kinetics of the

reactions were analyzed and the maximum slope of each curve wascalculated. Luminescence backgrounds were calculated using re-agent solutions containing luminol but not PMA.

2.7.5. Phagocytic activityThe phagocytosis of Saccharomyces cerevisiae (strain S288C) by

gilthead seabream HK leucocytes was studied by flow cytometry[46]. Heat-killed and lyophilized yeast cells were labelled withfluorescein isothiocyanate (FITC, Sigma), washed and adjusted to5 � 107 cells ml�1 of sRPMI. Phagocytosis samples consisted of125 ml of labelled-yeast cells and 100 ml of HK leucocytes in sRPMI(6 yeast cells:1 leucocyte). Samples were mixed, centrifuged (400 g,5 min, 22 �C), resuspended and incubated at 22 �C for 30min. At theend of the incubation time, samples were placed on ice to stopphagocytosis and 400 ml ice-cold PBS was added to each sample.The fluorescence of the extracellular yeasts was quenched byadding 40 ml ice-cold trypan blue (0.4% in PBS). Standard samples ofFITC-labelled S. cerevisiae or HK leucocytes were included in eachphagocytosis assay.

All samples were analyzed in a flow cytometer (Becton Dick-inson) with an argon-ion laser adjusted to 488 nm. Analyses wereperformed on 3000 cells, which were acquired at a rate of300 cells s�1. Datawere collected in the form of two-parameter sidescatter (granularity) (SSC) and forward scatter (size) (FSC), andgreen fluorescence (FL1) and red fluorescence (FL2) dot plots orhistogramsweremade on a computerized system. The fluorescencehistograms represented the relative fluorescence on a logarithmicscale. The cytometer was set to analyze the phagocytic cells,showing highest SSC and FSC values. Phagocytic ability was definedas the percentage of cells with one or more ingested bacteria(green-FITC fluorescent cells) within the phagocytic cell populationwhilst the phagocytic capacity was the mean fluorescence in-tensity. The quantitative study of the flow cytometric results wasmade using the statistical option of the Lysis Software Package(Becton Dickinson).

2.8. Real-time PCR

After 1, 3 and 14 days of deltamethrin-exposure, total RNA wasextracted from 0.5 g of seabream HK and liver tissues using TRIzolReagent [47]. It was then quantified and the purity assessed byspectrophotometry; the 260:280 ratios were 1.8e2.0. The RNA wasthen treated with DNase I (Promega) to remove genomic DNAcontamination. Complementary DNA (cDNA) was synthesized from1 mg of total RNA using the SuperScript III reverse transcriptase(Invitrogen) with an oligo-dT18 primer. The expression of theselected genes was analyzed by real-time PCR, which was

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129 123

performed with an ABI PRISM 7500 instrument (Applied Bio-systems) using SYBR Green PCR Core Reagents (Applied Bio-systems). Reaction mixtures (containing 10 ml of 2� SYBR Greensupermix, 5 ml of primers (0.6 mM each) and 5 ml of cDNA template)were incubated for 10 min at 95 �C, followed by 40 cycles of 15 s at95 �C,1 min at 60 �C, and finally 15 s at 95 �C,1min at 60 �C and 15 sat 95 �C. For each mRNA, gene expression was corrected by theelongation factor 1a (EF1a) RNA content in each sample. Theprimers used in the present study are shown in Table 1. In all cases,each PCR was performed with triplicate samples.

2.9. Statistical analysis

The results are expressed as mean � standard error, SE. Datawere statistically analyzed by one-way analysis of variance(ANOVA) to determine differences between groups. Normality ofthe data was previously assessed using a ShapiroeWilk test andhomogeneity of variance was also verified using the Levene test.Non-normally distributed data were log-transformed prior toanalysis and a non-parametric KruskaleWallis test, followed by amultiple comparison test, was used when data did not meetparametric assumptions. Statistical analyses were conducted usingSPSS 19.0 and differences were considered statistically significantwhen p � 0.05.

3. Results

3.1. Deltamethrin-exposure increases the hepato-somatic index

The condition factor value (K) (data not shown) and the spleen-somatic index (Fig. 1) of the gilthead seabream specimens exposedto deltamethrin not showed any significant variations with respectto those found in control group (unexposed fish). However, thehepato-somatic index of seabream specimens showed an increasein all deltamethrin-exposed fish, compared with the values ob-tained in control group, being the observed increments statisticallysignificant after 1 day of exposure (Fig. 1).

3.2. Serum metabolic parameters are drastically altered bydeltamethrin

All the metabolic parameters analyzed in serum were alteredas a consequence of the exposure of gilthead seabream to

Fig. 1. Spleen and liver organo-somatic index (OSI, %) of gilthead seabream specimens unerepresent the mean � S.E. (n ¼ 6). Asterisk denotes significant differences between unexpo

deltamethrin although in a different way (Table 2). Aspartateaminotransferase (AST) showed a statistically significant decrease(p� 0.05) in serum from fish exposed for short times (1 and 3 days)while the values increased for longer exposure times, althoughsuch differences were no statistically significant. Creatine kinase(CK) was not significantly increased in all exposed fish, except inthose exposed for 3 days, where a decrease was observed. The UAexhibited increases in fish exposed for 7 and 14 days, being sta-tistically significant after 7 days (p � 0.05). In the same way, sericlevels of PHOS, GLOB and Kþ decreased in the first three samplingtimes, being significant after 1 day for GLOB (p � 0.05) and after 3days for Kþ (p� 0.05); however, no statistically significant increasesof these three parameters were observed after 14 days of exposureto deltamethrin. The ALB and GLU levels increased in all exposedfish and assayed times, except after 3 days of exposition, being theincrements statistically significant after 1 day for ALB (p� 0.05) andafter 1 and 7 days for GLU (p � 0.05), compared with the valuesobtained in control (unexposed) fish. Serum Caþ2 values increasedafter 1 and 14 days, being statistically significant after 14 days(p � 0.05) of exposure and decreased after 3 and 7 days. Sodium(Naþ) values decreased after 3, 7 and 14 exposure days, while totalprotein (TP) decrease after 1, 3 and 7 days and increase after 14days. On the contrary, ratio of ALB/GLOB increased for all fishexposed to deltamethrin, being statistically significant after 1 and14 days compared to unexposed fish (p � 0.05) (Table 2).

3.3. Deltamethrin-exposure produces histopathological alterationsin the liver

Gilthead seabream hepatocytes are located between the sinu-soids (which usually have circulating cells in the lumen, mainlyerythrocytes) forming cord-like structures known as hepatic cellcords. Hepatocytes have a roundish polygonal cell body containinga clear spherical nucleus with usually one nucleolus (Fig. 2).

After exposition of seabream to deltamethrin, some progressivedeleterious alterations were observed in the liver by light micro-scopy and consisted of progressive altered hepatocyte distributionand circulatory disturbances (e.g. rounding or narrowing of sinu-soids) (Fig. 3). Liver from specimens exposed for 1 and 3 daysshowed hypertrophied hepatocytes and it was also noticeable focalnecrosis and nuclear pycnosis (Fig. 3A and B), while in liver fromspecimens exposed to deltamethrin for 7 and 14 days, fattydegeneration and hepatocyte vacuolization were the more evident

xposed (control; white bars) or exposed to deltamethrin (0.1 mg L�1; black bars). Barssed and deltamethrin-exposed groups (p � 0.05).

Table 2Metabolic parameters in serum of gilthead seabream specimens unexposed (control) or exposed to deltamethrin (0.1 mg L�1). Data represent the mean� S.E. (n ¼ 6). Asterisksdenote significant differences between unexposed and deltamethrin-exposed groups (p� 0.05*). Aspartate aminotransferase (AST), creatine kinase (CK), uric acid (UA), glucose(GLU), calcium (Caþ2), phosphorus (PHOS), total protein (TP), albumin (ALB), globulin (GLOB), potassium (Kþ) and sodium (Naþ).

Metabolic parameters Days of exposition

1 3 7 14

Control Exposed Control Exposed Control Exposed Control Exposed

AST (U ml�1) 84.0 � 6.01 62 � 1.0* 92.0 � 3.2 37 � 2.3* 83.0 � 4.1 133 � 3.5 109 � 5.4 110 � 3.1CK (U ml�1) 577 � 45.2 835.7 � 74 922 � 83.2 419 � 25 1006 � 42 1519 � 75 1185 � 54 1191 � 48UA (mg dL�1) 0.3 � 0.02 0.3 � 0.01 0.3 � 0.02 0.3 � 0.01 0.4 � 0.02 2.2 � 0.5 0.3 � 0.01 0.7 � 0.1*GLU (mg dL�1) 72 � 2.4 85 � 0.28* 71 � 4.5 67. 8 � 3.4 80 � 3.1 210 � 8.6* 69 � 4.4 152 � 9.6Caþþ (mg dL�1) 11.5 � 0.69 12.4 � 0.2 13.3 � 0.4 12 � 0.55 14.3 � 0.6 12.2 � 0.33 11.5 � 0.43 15 � 0.64*PHOS (mg dL�1) 11.3 � 1.33 10 � 0.12 13.8 � 1.5 8.6 � 0.45 13.0 � 0.9 10.8 � 2.03 7.8 � 1.4 12.7 � 0.87TP (g dL�1) 3.9 � 0.19 3.8 � 0.06 4.5 � 0.22 3.7 � 0.08 4.2 � 0.15 4.1 � 0.3 3.6 � 0.24 4.1 � 0.3ALB (g dL�1) 1.8 � 0.06 2.2 � 0.05* 2.1 � 0.04 1.9 � 0.02 1.9 � 0.03 2.2 � 0.15 1.9 � 0.09 2.2 � 0.14GLOB (g dL�1) 2.1 � 0.14 1.7 � 0.3* 2.4 � 0.16 1.8 � 0.11 2.2 � 0.11 1.9 � 0.18 1.7 � 0.1 1.9 � 0.16Kþ (mM) 8.5 � 0.19 7.9 � 0.01 8.3 � 0.21 7.1 � 0.4* 8.3 � 0.3 8.2 � 0.28 7.6 � 0.24 7.9 � 0.28Naþ (mM) 170 � 2.59 170 � 0.01 169 � 1.4 160 � 5.8 180 � 1.2 166 � 2 170 � 0.9 167 � 1.6ALB/GLOB 0.9 � 0.06 1.3 � 0.02* 0.9 � 0.03 1.1 � 0.08 0.9 � 0.01 1.1 � 0.08 1.1 � 0.03 1.2 � 0.04*

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129124

morphological alterations, although hypertrophy, nuclear pycnosisand focal necrosis of hepatocytes were also noticeable (Fig. 3Cand D).

3.4. Deltamethrin-exposure has little effect on humoral immuneparameters

Gilthead seabream humoral immune parameters were differ-ently affected by deltamethrin-exposure (Table 3). The haemolyticcomplement activity of specimens maintained in presence of del-tamethrin showed an abrupt increase after 1 and 3 days, beingstatistically significant for this last sampling time; by contrast, itwas observed a reduction of this activity after 7 and 14 days ofexposure, respect to the values obtained in the serum from unex-posed specimens (control group). Seric peroxidase activity was al-ways increased in specimens exposed to deltamethrin except after1 day, being the increment statistically significant for fish exposedfor 7 days. Finally, the seric total IgM level was increased in seab-ream specimens after 1, 3 and 7 days of exposition to deltamethrin,while it was reduced in fish exposed for 14 days, respect to thelevels obtained in the serum from unexposed fish (control group),although the observed variations were no statistically significant.

3.5. Deltamethrin-exposure increased the cellular innate immuneparameters

In general, innate cellular immune parameters of giltheadseabream specimens were increased after short exposure times

Fig. 2. Micrograph of liver from unexposed or control gilthead seabream stained withhaematoxylineeosin. Bar ¼ 100 mm.

(Figs. 4e6). Leucocyte peroxidase activity showed a statisticallysignificant increase after 1 and 3 days of exposure, respect to thevalues obtained from leucocytes from unexposed fish (controlgroup) (Fig. 4). Otherwise, the respiratory burst of head-kidneyleucocytes not showed variations after 1, 3 and 7 exposure dayswhile after 14 days this activity increased in a statistically signifi-cant way in exposed fish compared to the values obtained in con-trol fish (Fig. 5). Similarly, the phagocytic activity (Fig. 6A) andcapacity (Fig. 6B) of leucocytes isolated from gilthead seabreamexposed to deltamethrin for 1 and 3 days was significantlyincreased, respect to the values obtained for control group, whileafter 7 and 14 days both activities were unaffected and slightlyincreased, respectively, comparing with the values obtained fromunexposed fish.

3.6. Deltamethrin up-regulates the expression of cytochrome P450gene

The expression of genes related to the oxidative stress, intra-cellular SOD (Cu/Zn superoxide dismutase), CAT (catalase), GR(glutathione reductase) and, cellular stress, HSP70 (heat-shockprotein 70) in the HK and liver of seabream specimens exposed todeltamethrin did not suffer any statistically significant variationscompared to the control group (unexposed) (Fig. 7A). However,there was an up-regulation of CYP1A1 (cytochrome P450) gene atall exposure times, being statistically significant after 1 and 3 daysin head-kidney (Fig. 7A) and after 3 days in liver (Fig. 7B).

4. Discussion

The aquatic environment is constantly undergoing hundreds ofadverse chemicals from industrial, agricultural or household pur-poses. The effluents from these processes contain highly toxicchemicals such as pesticides that lead to water contamination [30]and eventually, the seas. In this sense, the presence and accumu-lation of pesticides in the aquatic environment can result in seriousdamage to non-target organisms such as fish and shellfish, causingserious negative effects on all ecosystems and the health of or-ganisms that inhabit them, as well as human consumers as the laststep in the food chains [48]. Besides to the indiscriminate dumpingof pesticides from agricultural, livestock waste and industrial ef-fluents on aquatic ecosystems, these are also directly applied inaquaculture to eliminate parasites [49]. Generally, the levels ofpesticides in surface waters are located far from the lethal con-centrations for aquatic organisms, but can easily be produced

Fig. 3. Micrographs of liver from gilthead seabream exposed to deltamethrin (0.1 mg L�1) for 1 (A), 3 (B), 7 (C) and 14 (D) days and stained with haematoxylineeosin. H, hepatocyte;S sinusoid; *, focal necrosis; arrow, hypertrophic hepatocytes; Fd, fatty degeneration; V, vacuolization. Bar ¼ 100 mm.

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129 125

sublethal effects after exposure of living organisms to these pesti-cides at environmentally relevant concentrations [50].

Pesticides are among the environmental pollutants that causeimmunotoxic effects in fish when they occur in aquatic environ-ments. Thus, synthetic pyrethroids have emerged as viable sub-stitutes to be less toxic, especially for mammals and birds [21] anddeltamethrin is one of them. The toxicity of deltamethrin on thefish takes place mainly when applied directly to aquaculture [49],since in other conditions this pesticide would not be so toxic due toits lower bioavailability, affinity by sediment, low concentrationsusually applied and its short half-life. In several studies carried outin fish, acute toxicity effects of deltamethrin were present at verylow concentrations. For example, LC50 for a 96 h waterbornetreatment is 0.39 mg L�1 in Salmo gairdneri (actually named Onco-rhynchus mykiss) [51], 14.5 mg L�1 in Oreochromis niloticus [52],1.84 mg L�1 in Cyprinus carpio and 3.50 mg L�1 in Sarotherodonmossambica [53]. Thus, we decided to try a sublethal dose of0.1 mg L�1 in the gilthead seabream. In aquaculture, the recom-mended bath dosages of deltamethrin are 2 mg L�1 for 30 min in aclosed container or 3 mg L�1 for 40 min in partially closed sea cage[54]. Therefore, a large amount of this pyrethroid could be released

Table 3Humoral immune activities in the serum of gilthead seabream specimens unexposed (conAsterisks denote significant differences between unexposed and deltamethrin-exposed g

Activities Experimental group

Natural haemolytic complement activity (ACH50 units ml�1) ControlExposed

Peroxidase activity (units ml�1) ControlExposed

Immunoglobulin M (OD 450 nm) ControlExposed

into the sea and exert potential adverse effects in the surroundingfauna.

In the present study, gilthead seabream specimens wereexposed to chronic sublethal concentrations of waterborne delta-methrin (0.1 mg L�1) in order to better simulate the normal flux ofpesticides into the fish. The condition factor (as an indicator of thewelfare status of specimens) not showed any significant variationsin the exposed group compared to the control group (unexposed),indicating that fish belonging to these two groups were in similarthermal and nutritional conditions, so that the observed differencesin the tested parameters were due solely to the effect of delta-methrin. In the present study, the hepato-somatic index, showed astatistically significant increase only in the group exposed to del-tamethrin for 1 day. On the contrary, spleen-somatic index notrevealed any variations between treated and control groups. Theincrease in the hepato-somatic index could be associated with thedegradation of the toxic compound present in water but also withthe initial phases of important degenerative changes in the liver, asdemonstrated by our results, or with an inflammatory response inthis tissue. On the contrary, when catfish (Clarias gariepinus) wereexposed to a very high concentration of deltamethrin (5 mg L�1) a

trol) or exposed to deltamethrin (0.1 mg L�1). Data represent the mean � S.E. (n ¼ 6).roups (p � 0.05).

s Days of exposition

1 3 7 14

11.85 � 2.99 12.87 � 3.96 11.94 � 2.97 13.99 � 1.5015.61 � 3.32 23.73 � 2.20* 9.81 � 1.19 8.58 � 1.60*51.60 � 4.34 48.88 � 6.55 53.13 � 4.95 47.50 � 2.7245.78 � 7.57 54.72 � 2.94 70.39* � 5.85 56.91 � 4.760.30 � 0.01 0.33 � 0.01 0.32 � 0.01 0.33 � 0.010.32 � 0.01 0.34 � 0.02 0.33 � 0.01 0.32 � 0.01

Fig. 4. Leucocyte peroxidase activity (units 10�7 leucocytes) of head-kidney leucocytesof gilthead seabream specimens unexposed (control; white bars) or exposed to del-tamethrin (0.1 mg L�1; black bars). Bars represent the mean � S.E. (n ¼ 6). Asterisksdenote significant differences between unexposed and deltamethrin-exposed groups(p � 0.05).

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129126

reduction of their hepato-somatic index and deposit of liverglycogen was observed [55]. The histopathological changesdescribed in the present work in the liver of seabream exposed todeltamethrin are consistent with those previously reported in otherfish species treated with fenvalerate [56] cypermethrin [29] andalso, with deltamethrin [57]. Recently, it has been described thatvitamin E repaired the genotoxicity and improved the histopatho-logical changes induced by deltamethrin in some degree, perhapsdue to its antioxidant properties [13]. The morphological resultsindicated that histological assays are very sensitive and useful toolsfor evaluating the effects of deltamethrin due to its adverse effectson liver histology, since the deleterious effect were visible since thefirst exposition day. More studies are needed to understand thisdeleterious effect in fish liver, the primary organ involved in themetabolism and detoxification of xenobiotics and excretion ofharmful substances.

Seric metabolic parameters of seabream exposed to delta-methrin were evaluated in order to know the metabolic routes oractivities which could be involved in the deleterious effect causedby this insecticide. The AST, ALT, ALP, CK and UA activities wereselected because they are enzymes used as a relevant stress, liverdisease, muscle damage and renal health indicators [29]. Firstly, ingeneral, AST, CK and UA showed a decrease after 1 and 3 days ofexposition whilst they were increased after 7 and 14 days, which

Fig. 5. Respiratory burst activity (slope min�1) of head-kidney leucocytes of giltheadseabream specimens unexposed (control; white bars) or exposed to deltamethrin(0.1 mg L�1; black bars). Bars represent the mean � S.E. (n ¼ 6). Asterisk denotes sig-nificant differences between unexposed and deltamethrin-exposed groups (p � 0.05).

could suggest deleterious alterations in hepatic metabolism, mus-cle and kidney along the exposure time. These data also correlatedwith the elevated hepato-somatic index and liver alterations pre-viously discussed and agree with others results previously obtainedin common carp [29], rainbow trout [14], tilapia [31] and Africansharptooth catfish [30]. On the contrary, CK and UA levels were notaffected in common carp [29], while increased in rainbow trout [14]and catfish [30] also exposed to deltamethrin. The results seem tosupport the idea that deltamethrin could be able to induce enzymeleakage and consequently hepatic damage as was suggested by El-Sayed et al. [31].

Available results about the effect of deltamethrin exposition onblood glucose are contradictories in fish. Deltamethrin did not alter[29], or decrease [14,31], as it was observed in seabream after 3exposure days, or increase [58] glucose levels. The detected varia-tion in glucose levels may indicate severe liver fish damages, sincethis organ is responsible for regulating glucogenogenesis processesand glycogenolysis, likewise in the pancreas, the organ responsiblefor regulation of blood glucose levels by producing insulin orglucagon. Likely seabream could also be stressed by deltamethrin-exposure, as the organisms respond to stress by releasing storedglucose in the liver [59]. Results on the reduction of TP and GLOB onexposed fish, agree with previous studies in other fish species[30,31,54,60] although in these studies, a parallel reduction in thevalues of ALB and ALB/GLOB ratio were observed. On the contrary,in the present study was observed an increase of ALB, except after 3days, and ALB/GLOB ratio values in almost all cases as it wasdescribed in rainbow trout [14]. However, Vani et al. [60] demon-strated that exposure of Catla catla to sublethal deltamethrin con-centrations (1.61 mg L�1) for 45 days caused a decrease of all themetabolic studied parameters (TP, ALB, GLOB, ALB/GLOB and AST)except ALT activity. Finally, the present results demonstrated thatdeltamethrin disturb the levels of PHOS, Kþ and Caþ2 in seabreamspecimens which may be due to nutritional factors in the case ofphosphorus or, more probably, to kidney damage because thekidney is one of the organs that controls the excretion of theseminerals in the urine and defines the balance in the organism. Theresults correlate with previous ones [22,61] although furtherstudies focussing on physiology and pharmacology of deltamethrinwill help to understand its effects on fish metabolism.

There are very few studies about the effect of deltamethrin onfish immune system and subsequently, we evaluated its effects onthe main humoral and cellular immune parameters of giltheadseabream. A brief exposure of 30min of rainbow trout specimens todeltamethrin (with different concentrations ranging from 1 to4 mg L�1) it was enough to cause a decrease in the levels of lysozymeand IgM in serum but the variations between the control and thelowest dose (1 mg L�1) were not significant [54]. These results werecorroborated by us since exposure of seabream to a sublethal doseof deltamethrin not caused any significant variations in serum IgMlevels. Although there are no more toxicity data of this syntheticpyrethroid on fish immune system, it is known that fish humoralimmune parameters are often slightly altered by the action ofvarious environmental toxic such as organochlorines [62,63], or-ganophosphates [64] or heavy metals as arsenic and cadmium[65,66]. Regarding the cellular immune parameters analyzed somealterations were detected, the significant differences observed be-tween exposed to deltamethrin and unexposed fish depending onthe parameter assayed as well as the exposure time. Injection ofdeltamethrin in Ancistrus multispinis increased the number ofperitoneal leucocytes and the production of reactive nitrogen in-termediates bymacrophages [36], and exposure of rainbow trout todeltamethrin reduced the phagocytic activity of macrophages andproliferation of splenic lymphocytes [54]. New studies evaluatingthe potential effect on the immune status of fish caused by different

Fig. 6. Phagocytic ability (%) (A) and capacity (a.u.) (B) of head-kidney leucocytes of gilthead seabream specimens unexposed (control; white bars) or exposed to deltamethrin(0.1 mg L�1; black bars). Bars represent the mean � S.E. (n ¼ 6). Asterisks denote significant differences between unexposed and deltamethrin-exposed groups (p � 0.05).

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129 127

environmental toxicants and its possible impact on aquaculturewill be very welcomed.

The expression of some genes after deltamethrin-exposure inthe seabream was evaluated in order to throw some light at mo-lecular level. Aquatic organisms have developed several cellulardefense paths, which regulate the level of reactive oxygen speciesand protect against the deleterious effects of free radicals [1]. SOD,CAT, GR, GPX (glutathione peroxidase) and GST (glutathione S-transferase) are major antioxidant enzymes, which are activated tocounteract the negative effect of the oxygen-free radicals [21]. Inthe present work, the expression of these genes has been studied inHK (as the main haemopoietic organ) and liver (major site ofstorage, biotransformation and excretion of pesticides) after del-tamethrin-exposure and only a general slight down-regulationtendency was observed in antioxidant (SOD, CAT and GR) geneexpression. Ceyhun et al. [7] demonstrated that deltamethrin in-hibits the activities of various proteins including antioxidant en-zymes, so the present results about gene expression could agreewith previous ones focussing on the study of these enzyme activ-ities [1,21,67,68]. Some preceding results indicated that the super-oxide radicals can also inhibit CAT activity and the increasedhydrogen peroxide levels subsequent from CAT inhibition couldfinally inhibit SOD [69] or that the oxidative stress is excessive andcannot be compensated anymore [70]. The present results could beexplained by the former hypothesis, because severe morphological

and physiological changes are demonstrated in seabream exposedto deltamethrin which could be considered as stressor.

Finally, an up-regulation for CYP1A1 gene was observed beingstatistically significant after 1 and 3 days (HK) and after 3 days(liver) of deltamethrin-exposure. In vertebrates, including fish,cytochrome P450 and the conjugates glutathione S-transferase(GST) plays an important role in themetabolism of many pollutants[35]. Consequently, CYP1A gene up-regulation has been used as abiomarker of exposure to various contaminants in a diverse rangeof species, such as mammals [71], birds [72], reptiles [73] and fish[74]. In rainbow trout, deltamethrin-exposure significantlyincreased the expression levels of CYP1A gene in a time-dependentmanner [75]. The exposition of deltamethrin at sublethal concen-tration of 0.2 mg L�1 in common carp resulted in faster metabolismand was evaluated as induction of hepatic microsomal cytochromeP450-dependent monooxygenases [76]. Contrary to our results,deltamethrin at the concentration of 0.75 mg L�1 for 48 h inducedHSP70 gene in liver, kidney and gills of spotted snakehead [68]. Inaddition, Atamanalp and Erdo�gan [77] and Ceyhun et al. [7]demonstrated that exposition of deltamethrin in rainbow troutinduces the expression of HSP70 gene, besides to reducing theexpression levels of insulin-like growth factors and growth hor-mone [6,8]. These researchers have also found that deltamethrinadversely affects gene expression in rainbow trout, and it may alsochange the organism’s gene sequence.

Fig. 7. Relative gene expression, determined by real-time PCR, in head-kidney (A) andliver (B) of gilthead seabream specimens after 1 (white bars), 3 (grey bars) and 14 days(black bars) of exposure to deltamethrin (0.1 mg L�1). Bars represent the mean � S.E.(n ¼ 6) fold increase relative to control. Asterisks denote significant differences be-tween unexposed and deltamethrin-exposed groups (p � 0.05).

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129128

To conclude, the present results indicate severe immunotox-icological and metabolic effects of deltamethrin in gilthead seab-ream specimens exposed to sublethal waterborne dose (0.1 ppb); ingeneral, the values obtained for the tested parameters during thetrial seem to indicate that specimens try to adapt to this adversesituation although the continuous presence of the toxic impede thehypothetic recovery of homoeostasis. Liver histological study andCYP1A gene expression are useful tools for evaluating the effects ofdeltamethrin, since the deleterious effects were visible from thefirst exposure day. The use of deltamethrin in the proximities ofseabream farms (the species with the highest rate of production inMediterranean aquaculture) should be carefully considered.Furthermore, studies like this one should serve to make us thinkthat all discharges to be made anywhere in the world eventuallyreach the sea, so that marine animals should be borne in mind aspotential target species, in order to avoid unforeseen damage toecosystems or marine species.

Acknowledgements

The financial support of the Spanish Ministry of Economy andCompetitiveness under Grant no. AGL-2011-30381-C03-01 and ofthe Fundación Séneca de la Región de Murcia (Spain) (Grant no.04538/GERM/06, Grupo de Excelencia de la Región de Murcia) isgratefully acknowledged.

References

[1] Dinu D, Marinescu D, Munteanu MC, Staicu AC, Costache M, Dinischiotu A.Modulatory effects of deltamethrin on antioxidant defense mechanisms and

lipid peroxidation in Carassius auratus gibelio liver and intestine. Arch EnvironContam Toxicol 2010;58:757e64.

[2] Patel S, Pandey AK, Bajpayee M, Parmar D, Dhawan A. Cypermethrin-inducedDNA damage in organs and tissues of the mouse: evidence from the cometassay. Mutat Res 2006;607:176e83.

[3] Mathew G, Vijayalaxmi KK, Abdul Rahiman M. Methyl parathion-inducedsperm shape abnormalities in mouse. Mutat Res 1992;280:169e73.

[4] Bagchi D, Bagchi M, Hassoun EA, Stohs SJ. In vitro and in vivo generation ofreactive oxygen species, DNA damage and lactate dehydrogenase leakage byselected pesticides. Toxicology 1995;104:129e40.

[5] Freeman BA, Crapo JD. Biology of disease: free radicals and tissue injury. LabInvest 1982;47:412e26.

[6] Ekinci D, Beydemir S. Risk assessment of pesticides and fungicides for acid-base regulation and salt transport in rainbow trout tissues. Pestic BiochemPhys 2010;97:66e70.

[7] Ceyhun SB, SentürkM, Ekinci D, Erdo�gan O, Ciltas A, Kocaman EM. Deltamethrinattenuates antioxidant defense system and induces the expression of heat shockprotein 70 in rainbow trout. Comp Biochem Phys C 2010;152:215e23.

[8] Aksakal E, Ceyhun SB, Erdo�gan O, Ekinci D. Acute and long-term genotoxicityof deltamethrin to insulin-like growth factors and growth hormone inrainbow trout. Comp Biochem Phys C 2010;152:451e5.

[9] Bagchi D, Bhattacharya G, Stohs SJ. In vitro and in vivo induction of heat shock(stress) protein (Hsp) gene expression by selected pesticides. Toxicology1996;112:57e68.

[10] Scassellati SG, Moretti M, Villarini M, Angeli G, Pasquini R, Monarca, et al. Anevaluation of toxic and genotoxic risk from work-related exposure to chem-ical compounds. Prev Oggi 1994;6:125e38.

[11] Braguini WL, Cadena SM, Carnieri EG, Rocha ME, de Oliveira MB. Effects ofdeltamethrin on functions of rat liver mitochondria and on native and syn-thetic model membranes. Toxicol Lett 2004;152:191e202.

[12] Parvez S, Raisuddin S. Copper modulates non-enzymatic antioxidants in thefreshwater fish Channa punctata (Bloch) exposed to deltamethrin. Chemo-sphere 2006;62:1324e32.

[13] Kan Y, Cengiz EI, Ugurlu P, Yanar M. The protective role of vitamin E on gilland liver tissue histopathology and micronucleus frequencies in peripheralerythrocytes of Oreochromis niloticus exposed to deltamethrin. Environ Tox-icol Pharmacol 2012;34:170e9.

[14] Velí�sek J, Jur�cíková J, Dob�síková R, Svobodová Z, Pia�cková V, Máchová J, et al.Effects of deltamethrin on rainbow trout (Oncorhynchus mykiss). EnvironToxicol Pharmacol 2007;23:297e301.

[15] Bhunya SP, Pati PC. Effect of deltamethrin, a synthetic pyrethroid, on the in-duction of chromosome aberrations, micronuclei and sperm abnormalities inmice. Mutagenesis 1990;5:229e32.

[16] Husain R, Malaviya M, Seth PK. Effect of deltamethrin on regional brainpolyamines and behaviour in young rats. Pharmacol Toxicol 1994;74:211e5.

[17] Kontreczky C, Farkas A, Nemcsók J, Salánki J. Short- and long-term effects ofdeltamethrin on filtering activity of freshwater mussel (Anodonta cygnea L.).Ecotoxicol Environ Safe 1997;38:195e9.

[18] Haya K. Toxicity of pyrethroid insecticides to fish. Environ Toxicol Chem1989;8:381e91.

[19] Bálint T, Szegletes T, Szegletesb Z, Halasy K, Nemcsók J. Biochemical andsubcellular changes in carp exposed to the organophosphorus methidathionand the pyrethroid deltamethrin. Aquat Toxicol 1995;33:279e95.

[20] Kamalaveni K, Gopal V, Sampson U, Aruna D. Effect of pyrethroids on carbo-hydrate metabolic pathways in common carp, Cyprinus carpio. Pest Manag Sci2001;57:1151e4.

[21] Sayeed I, Parvez S, Pandey S, Bin-Hafeez B, Haque R, Raisuddin S. Oxidativestress biomarkers of exposure to deltamethrin in freshwater fish, Channapunctatus Bloch. Ecotoxicol Environ Safe 2003;56:295e301.

[22] Srivastav AK, Srivastava SK, Srivastav SK. Impact of deltamethrin on serumcalcium and inorganic phosphate of freshwater catfish, Heteropneustes fossilis.Bull Environ Contam Toxicol 1997;59:841e6.

[23] Viran R, Ünlü Erkoç F, Polat H, Koçak O. Investigation of acute toxicity of delta-methrin on guppies (Poecilia reticulata). Ecotoxicol Environ Safe 2003;55:82e5.

[24] Yilmaz M, Gül A, Erbasli K. Acute toxicity of alpha-cypermethrin to guppy(Poecilia reticulata, Pallas, 1859). Chemosphere 2004;56:381e5.

[25] Köprücü K, Aydın R. The toxic effects of pyrethroid deltamethrin on thecommon carp (Cyprinus carpio L.) embryos and larvae. Pestic Biochem Phys2004;80:47e53.

[26] Organization WH. Environmental Health Criteria 97. Deltamethrin. Interna-tional Programme on Chemical Safety. Geneva, Switzerland: World HealthOrganization; 1990. p. 1e133.

[27] Tidou AS, Moreteau JC, Ramade F. Effects of lindane and deltamethrin onzooplankton communities of experimental ponds. Hydrobiology 1992;232:157e68.

[28] Erkoc F, Benli K, Selvi M, Ayhan O, Yildirim MZ. Acute toxicity, behavioralchanges, and histopathological effects of deltamethrin on tissues (gills, liver,brain, spleen, kidney, muscle, skin) of Nile tilapia (Oreochromis niloticus L).Environ Toxicol 2006:614e20.

[29] Velísek J, Dobsíková R, Svobodová Z, Modrá H, Lusková V. Effect of delta-methrin on the biochemical profile of common carp (Cyprinus carpio L.). BullEnviron Contam Toxicol 2006;76:992e8.

[30] Amin KA, Hashem KS. Deltamethrin-induced oxidative stress and biochemicalchanges in tissues and blood of catfish (Clarias gariepinus): antioxidant de-fense and role of alpha-tocopherol. BMC Vet Res 2012;8:45.

F.A. Guardiola et al. / Fish & Shellfish Immunology 36 (2014) 120e129 129

[31] El-Sayed YS, Saad TT, El-Bahr SM. Acute intoxication of deltamethrin inmonosex Nile tilapia, Oreochromis niloticus with special reference to theclinical, biochemical and haematological effects. Environ Toxicol Pharmacol2007;24:212e7.

[32] Eshleman AJ, Murray TF. Pyrethroid insecticides indirectly inhibit GABA-dependent 36Cl- influx in synaptoneurosomes from the trout brain. Neuro-pharmacology 1991;30:1333e41.

[33] Cengiz EI, Unlu E. Sublethal effects of commercial deltamethrin on thestructure of the gill, liver and gut tissues of mosquitofish, Gambusia affinis: amicroscopic study. Environ Toxicol Pharmacol 2006;21:246e53.

[34] Hernández-Moreno D, Soler F, Míguez MP, Pérez-López M. Brain acetylcho-linesterase, malondialdehyde and reduced glutathione as biomarkers ofcontinuous exposure of tench, Tinca tinca, to carbofuran or deltamethrin. SciTotal Environ 2010;408:4976e83.

[35] Pimpão CT, Zampronio AR, Silva de Assis HC. Effects of deltamethrin on he-matological parameters and enzymatic activity in Ancistrus multispinis (Pisces,Teleostei). Pestic Biochem Phys 2007;88:122e7.

[36] Pimpão CT, Zampronio AR, Silva de Assis HC. Exposure of Ancistrus multispinis(Regan, 1912, Pisces, Teleostei) to deltamethrin: effects on cellular immunity.Fish Shellfish Immunol 2008;25:528e32.

[37] Alazemi BM, Lewis JW, Andrews EB. Gill damage in the freshwater fish Gna-thonemus petersii (Family: Mormyridae) exposed to selected pollutants: anultrastructural study. Environ Technol 1996;17:225e38.

[38] Roth M. The availability and use of chemotherapeutic sea lice control prod-ucts. Contrib Zool 2000;69:109e18.

[39] Sevatdal S, Copley L, Wallace C, Jackson D, Horsberg TE. Monitoring of thesensitivity of sea lice (Lepeophtheirus salmonis) to pyrethroids in Norway,Ireland and Scotland using bioassays and probit modelling. Aquaculture2005;244:19e27.

[40] FAO. Fisheries and Aquaculture topics. The State of World Fisheries andAquaculture (SOFIA). Topics Fact Sheets. Rome: FAO Fisheries and AquacultureDepartment; 2012. http://www.fao.org/fishery/sofia/en.

[41] Esteban MA, Mulero V, Muñoz J, Meseguer J. Methodological aspects ofassessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seab-ream (Sparus aurata L.) by flow cytometry and electron microscopy. CellTissue Res 1998;293:133e41.

[42] Ortuño J, Esteban MA, Mulero V, Meseguer J. Methods for studying the hae-molytic, chemoattractant and opsonic activities of seabream (Sparus aurataL.). In: Barnes AC, Davidson GA, Hiney M, McInthos D, editors. Methodology infish diseases research. Albion Press; 1998. p. 97e100.

[43] Quade MJ, Roth JA. A rapid, direct assay to measure degranulation of bovineneutrophil primary granules. Vet Immunol Immunop 1997;58:239e48.

[44] Cuesta A, Meseguer J, Esteban MA. Total serum immunoglobulin M levels areaffected by immunomodulators in seabream (Sparus aurata L.). Vet ImmunolImmunop 2004;101:203e10.

[45] Bayne CJ, Levy S. Modulation of the oxidative burst in trout myeloid cells byadrenocorticotropic hormone and catecholamines: mechanisms of action.J Leukoc Biol 1991;50:554e60.

[46] Rodríguez A, Esteban MA, Meseguer J. Phagocytosis and peroxidase release byseabream (Sparus aurata L.) leucocytes in response to yeast cells. Anat Rec ADiscov Mol Cell Evol Biol 2003;272:415e23.

[47] Chomczynski P. A reagent for the single-step simultaneous isolation of RNA,DNA and proteins from cell and tissue samples. Biotechniques 1993;15:532e7.

[48] Goksøyr A, Förlin L. The cytochrome P-450 system in fish, aquatic toxicologyand environmental monitoring. Aquat Toxicol 1992;22:287e311.

[49] Smith TM, Stratton GW. Effects of synthetic pyrethroid insecticides on non-target organisms. Residue Rev 1986;97:92e110.

[50] Bretaud S, Toutant JP, Saglio P. Effects of carbofuran, diuron, and nicosulfuronon acetylcholinesterase activity in goldfish (Carassius auratus). EcotoxicolEnviron Safe 2000;47:117e24.

[51] Pawlisz AV, Busnarda J, McLauchlin A, Caux PY, Kent RA. Canadian waterquality guidelines for deltamethrin. Environ Toxic Water 1998;13:175e210.

[52] Golow A, Godz T. Acute toxicity of deltamethrin and dieldrin to Oreochromisniloticus. Bull Environ Contam Toxicol 1994;52:351e4.

[53] Mestres R, Mestres G. Deltamethrin: uses and environmental safety. Rev En-viron Contam Toxicol 1992;124:1e18.

[54] Siwicki AK, Terech-Majewska E, Grudniewska J, Malaczewska J, Kazun K,Lepa A. Influence of deltamethrin on nonspecific cellular and humoral defensemechanisms in rainbow trout (Oncorhynchus mykiss). Environ Toxicol Chem2010;29:489e91.

[55] Datta M, Kaviraj A. Ascorbic acid supplementation of diet for reduction ofdeltamethrin induced stress in freshwater catfish Clarias gariepinus. Chemo-sphere 2003;53:883e8.

[56] Tilak KS, Veeraiah K, Susan TA, Yacobu K. Toxicity and residue studiesof fenvalerate to some selected freshwater fishes. J Environ Biol 2001;22:177e80.

[57] El-Sayed YS, Saad TT. Subacute intoxication of a deltamethrin-based prepa-ration (Butox) 5% EC) in monosex Nile tilapia, Oreochromis niloticus L. BasicClin Pharmacol Toxicol 2008;102:293e9.

[58] Datta M, Kaviraj A. Acute toxicity of the synthetic pyrethroid deltamethrin tofreshwater catfish Clarias gariepinus. Bull Environ Contam Toxicol 2003;70:296e9.

[59] Biron M, Benfey TJ. Cortisol, glucose and hematocrit changes during acutestress, cohort sampling, and the diel cycle in diploid and triploid brook trout(Salvelinus fontinalis). Fish Physiol Biochem 1994;13:153e60.

[60] Vani T, Saharan N, Mukherjee SC, Ranjan R, Kumar R, Brahmchari RK. Delta-methrin induced alterations of hematological and biochemical parameters infingerlings of Catla catla (Ham.) and their amelioration by dietary supplementof vitamin C. Pestic Biochem Phys 2011;101:16e20.

[61] Kumar S, Lata S, Gopal K. Deltamethrin induced physiological changes infreshwater cat fish Heteropneustes fossilis. Bull Environ Contam Toxicol1999;62:254e8.

[62] Tellez-Bañuelos MC, Santerre A, Casas-Solis J, Bravo-Cuellar A, Zaitseva G.Oxidative stress in macrophages from spleen of Nile tilapia (Oreochromisniloticus) exposed to sublethal concentration of endosulfan. Fish ShellfishImmunol 2009;27:105e11.

[63] Tellez-Bañuelos MC, Santerre A, Casas-Solis J, Zaitseva G. Endosulfan increasesseric interleukin-2 like (IL-2L) factor and immunoglobulin M (IgM) of Niletilapia (Oreochromis niloticus) challenged with Aeromona hydrophila. FishShellfish Immunol 2010;28:401e5.

[64] Dunier M, Siwicki AK, Demaël A. Effects of organophosphorus insecticides:effects of trichlorfon and dichlorvos on the immune response of carp (Cyp-rinus carpio). III. In vitro effects on lymphocyte proliferation and phagocy-tosis and in vivo effects on humoral response. Ecotoxicol Environ Safe1991;22:79e87.

[65] Guardiola FA, Gónzalez-Párraga MP, Cuesta A, Meseguer J, Martínez S, Mar-tínez-Sánchez MJ, et al. Immunotoxicological effects of inorganic arsenic ongilthead seabream (Sparus aurata L.). Aquat Toxicol 2013;134-135:112e9.

[66] Guardiola FA, Cuesta A, Meseguer J, Martínez S, Martínez-Sánchez MJ, Pérez-Sirvent C, et al. Accumulation, histopathology and immunotoxicological ef-fects of waterborne cadmium on gilthead seabream (Sparus aurata). FishShellfish Immunol 2013:1e9.

[67] Ansari RA, Kaur M, Ahmad F, Rahman S, Rashid H. Genotoxic and oxidativestress-inducing effects of deltamethrin in the erythrocytes of a freshwaterbiomarker fish species, Channa punctata Bloch. Environ Toxicol 2008:429e36.

[68] Kaur M, Atif F, Ansari RA, Ahmad F, Raisuddin S. The interactive effect ofelevated temperature on deltamethrin-induced biochemical stress responsesin Channa punctata Bloch. Chem Biol Interact 2011;193:216e24.

[69] Kono Y, Fridovich I. Superoxide radical inhibits catalase. J Biol Chem1982;257:5751e4.

[70] Atif F, Parvez S, Pandey S, Ali M, Kaur M, Rehman H, et al. Modulatory effect ofcadmium exposure on deltamethrin-induced oxidative stress in Channapunctata Bloch. Arch Environ Contam Toxicol 2005;49:371e7.

[71] White RD, Hahn ME, Lockhart WL, Stegeman JJ. Catalytic and immunochem-ical characterization of hepatic microsomal cytochromes P450 in belugawhale (Delphinapterus leucas). Toxicol Appl Pharmacol 1994;126:45e57.

[72] Sanderson JT, Norstrom RJ, Elliott JE, Hart LE, Cheng KM, Bellward GD. Bio-logical effects of polychlorinated dibenzo-p-dioxins, dibenzofurans, and bi-phenyls in double-crested cormorant chicks (Phalacrocorax auritus). Jpn JToxicol Environ Health 1994;41:247e65.

[73] Rie MT, Lendas KA, Woodin BR, Stegeman JJ, Callard IP. Hepatic biotransfor-mation of enzymes in a sentinel species, the painted turtle (Chrysemys picta)from Cape Cod, Massachusetts: seasonal-, sex- and location related differ-ences. Biomarkers 2000;5:382e94.

[74] Smolowitz RM, Hahn ME, Stegeman JJ. Immunohistochemical localization ofcytochrome-P-450Ia1 induced by 3,30 ,4,40-tetrachlorobiphenyl and by 2,3,7,8-tetrachlorodibenzoafuran in liver and extrahepatic tissues of the teleostStenotomus chrysops (Scup). Drug Metab Dispos 1991;19:113e23.

[75] Erdo�gan O, Ceyhun SB, Ekinci D, Aksakal E. Impact of deltamethrin exposureon mRNA expression levels of metallothionein A, B and cytochrome P450 1Ain rainbow trout muscles. Gene 2011;484:13e7.

[76] Deer KA, Bankal L, Nemcso KJ, Abraham M. Effects of deltamethrin on hepaticmicrosomal cytochrome P450-dependent monooxygenases in carp. J EnvironSci Heal B 1996;31:637e44.

[77] Atamanalp M, Erdo�gan O. Alterations of HSP70 gene expression in rainbowtrout (Oncorhyncus mykiss) exposed to deltamethrin. Turk J Vet Anim Sci2010;34:359e63.