Research article

Molecular basis of antithrombin deficiency in four Japanese patients withantithrombin gene abnormalities including two novel mutations

Mayu Kyotani,1 Kaoru Okumura,1 Akira Takagi,1,2 Takashi Murate,1,2 Koji Yamamoto,3

Tadashi Matsushita,4 Motoi Sugimura,5 Naohiro Kanayama,5 Takao Kobayashi,6

Hidehiko Saito,7 and Tetsuhito Kojima1,2*1 Department of Pathophysiological Laboratory Sciences, Nagoya University Graduate School of Medicine, Nagoya, Japan

2 Department of Medical Technology, Nagoya University School of Health Sciences, Nagoya, Japan3 Division of Transfusion Medicine, Nagoya University Hospital, Nagoya, Japan

4 Department of Hematology-Oncology, Nagoya University Graduate School of Medicine, Nagoya, Japan5 Maternal-Fetal Neonatal Care Center, Hamamatsu University School of Medicine, Hamamatsu, Japan

6 Department of Family and Child Nursing, and Midwifery, Shinshu University School of Health Sciences, Matsumoto, Japan7 JR Tokai Genaral Hospital, Nagoya, Japan

We analyzed the antithrombin (AT) gene in four unrelated Japanese patients with an AT deficiency, and indi-vidually identified four distinct mutations in the heterozygous state. There were two novel mutations,2417delT leading to a frameshift with a premature termination at amino acid –3 (FS-3Stop) and C2640Tresulting in a missense mutation (Ala59Val). Previously reported mutations, T5342C (Ser116Pro) and T72C(Met-32Thr), were also found in the other two patients. To understand the molecular basis responsible forthe AT deficiency in these patients, in vitro expression experiments were performed using HEK293 cellstransfected with either wild type or respective mutant AT expression vector. We found that –3Stop-AT and–32Thr-AT were not secreted into the culture media, whereas 116Pro-AT and 59Val-AT were secreted nor-mally. We further studied the heparin cofactor activity and the binding to heparin of each recombinant ATmolecule. Ser116Pro mutation significantly impaired the binding affinity to heparin resulting in a reducedheparin cofactor activity. In contrast, we found that Ala59Val mutant AT unexpectedly showed a normal af-finity to heparin, but severely impaired the heparin cofactor activity. Our findings suggested that FS-3Stopand Met-32Thr mutations are responsible for type I AT deficiency, whereas Ser116Pro and Ala59Val muta-tions contribute to type II AT deficiency, confirming that there were diverse molecular mechanisms of ATdeficiency depend upon discrete AT gene abnormalities as reported previously. Am. J. Hematol. 82:702–705, 2007. VVC 2007 Wiley-Liss, Inc.

IntroductionAntithrombin (AT) is a plasma serine protease inhibitor

that inhibits thrombin as well as other activated serine pro-teases of the coagulation system [1]. Human AT genemeasures 13.5 kb in length and comprises 7 exons and 6introns, and is located on human chromosome 1 at q23.1-23.9 [2]. Plasma AT is synthesized by hepatocytes as a464 amino acid precursor with a 32 amino acid signal pep-tide, which is cleaved off before secretion of a 432 aminoacid mature inhibitor into plasma. It is a single chain glyco-protein with a molecular weight of approximately 58 kDa,which has two important functional domains; one is the re-active site domain located in the C-terminal to inhibit clot-ting proteases and the other is the heparin binding site do-main composed of basic amino acid residues such as11Lys, 13Arg, 46Arg, 47Arg, 114Lys, 125Lys, and 129Argin the N-terminal [3].The inhibition of thrombin by AT, forming a covalent com-

plex in a 1:1 molar ratio, is relatively slow, but is dra-matically enhanced in the presence of glycosaminoglycan,heparin [4]. The plasma AT plays a key role in the naturalhemostatic balance to maintain blood fluidity, and patientswith AT deficiency are susceptible to thromboembolic dis-eases, particularly deep vein thrombosis of lower limb andpulmonary embolism [5]. Congenital AT deficiency is usu-

ally heterozygous and classified into two types: quantitativedeficiency (type I) and qualitative deficiency (type II). Thelatter includes reactive site defect, heparin binding sitedefect, and pleiotrophic effect AT deficiencies [6].To date, 172 distinct AT gene abnormalities were re-

ported at the Human Gene Mutation Database Web site(http://www.hgmd.cf.ac.uk/ac/gene.php?gene–SERPINC1).In this study, we investigated the nature of AT deficiency infour Japanese female patients with thrombotic complica-tions during pregnancy, and identified four distinct muta-tions including two novels in the AT gene, which might beresponsible for discrete phenotypes of AT deficiency.

Contract grant sponsors: Ministry of Health, Labor and Welfare (Japan),Grant-in-Aid for Research on Measures for Intractable Diseases.

*Correspondence to: Tetsuhito Kojima, Department of Medical Technology,Nagaya University School of Health Sciences, 1-1-20 Daiko-Minami, Higa-shi-ku, Nagoya 461-8673, Japan. E-mail: kojima@met.nagoya-u.ac.jp

M.K. and K.O. contributed equally to this work.

Received for publication 11 July 2006; Revised 19 January 2007; Accepted23January 2007

Am. J. Hematol. 82:702–705, 2007.

Published online 9 May 2007 in Wiley InterScience (www.interscience.wiley.com).DOI: 10.1002/ajh.20924

VVC 2007 Wiley-Liss, Inc.

American Journal of Hematology 702 http://www3.interscience.wiley.com/cgi-bin/jhome/35105

Materials and Methods

Patients and sample preparationsAll patients suffered from either deep vein thrombosis or pulmonary

embolism during pregnancy and were thus investigated for AT deficiencyon the basis of thrombosis. There was no relative with thrombotic dis-ease in all cases. The AT activity and antigen levels of those patients areshown in Table I. Ethical approval for the study was obtained from theEthics Review Committee of Nagoya University School of Medicine. Afterobtaining informed consent from all patients, blood samples from thepatients, family members, and healthy volunteers were collected in a 1/10 volume of 3.13% sodium citrate. Plasma was separated by centrifuga-tion at � 2000g for 20 min, and genomic DNA was isolated from periph-eral blood leukocytes as previously described [7].

Identification of gene abnormalities of thepatients’ AT gene

All 7 exons including splice junctions of the AT gene were amplifiedby (PCR) using the primer sets listed in Table II. The PCR amplifica-tions and Cycle sequencing of all PCR products were performed asdescribed previously [8].

Construction of recombinant AT expression vectorsA full length cDNA of human AT was amplified from the human liver

cDNA library (Clontech, CA) by PCR, using a primer set (50-GAAGATTAGCGGCCATGT-30 and 50-GGAAGAGGTGAAAGAATAAG-30), andused to prepare the wild type human AT expression vector using thefull length AT cDNA in pcDNA3.1(+) plasmid (Invitrogen, Carlsbad, CA)(pcDNA/WT-AT). Subsequently, we prepared the mutant AT expressionvectors (pcDNA/116Pro-AT, pcDNA/-32Thr-AT, pcDNA/FS-3Stop-AT,and pcDNA/59Val-AT) by the recombinant PCR method describedelsewhere [9].

Transient expression of the recombinant ATsHuman embryo kidney 293 (HEK293) cells were grown in Dulbeco’s

modified Eagle medium (DMEM) supplemented with 10% fetal calf se-rum (FCS) at 378C in 5% CO2. The cells were cultured in 60-mm dishesuntil they became 50% confluent, and then were transiently transfectedwith 10 mg of the expression plasmid vectors using the calcium phos-phate method as described previously [10]. After incubation in FCS-freeDMEM for 24 hr, the cell culture media and cell lysates that had dissolvedin reporter lysis buffer (Promega, Madison, USA) were collected, centri-fuged at � 1500g for 10 min, and prepared as Western blot samples.The Western blot analysis was performed as described previously [11],using a polyclonal anti-AT antibody (rabbit IgG) and a peroxidase-labeledanti-rabbit IgG antibody (Behringwerke AG, Marburg, W. Germany).

Specific activity measurements of recombinant ATsWe transfected HEK293 cells with 20 mg of the recombinant ATexpres-

sion vectors (pcDNA/WT-AT, pcDNA/116Pro-AT, and pcDNA/59Val-AT)using the calcium phosphate method as described earlier. The trans-formed cells were selected in culture medium containing 700 mg/ml G418(Gibco BRL, Rockville, USA), and the stable transformants highlyexpressing respective recombinant AT molecules were obtained. Theantigen levels of recombinant AT molecules were measured by anenzyme-linked immunosorbent assay (ELISA) using a polyclonal sheepanti-AT IgG antibody (Biogenesis England, UK) for capturing, and amplifi-cation and detection of the signals were achieved with biotinylatedpolyclonal sheep anti-AT IgG antibody and avidin peroxidase using ECLProtein Biotinylation Module kit (Amersham Biosciences) according tothe manufacturer’s protocol. The culture media of the stably transformedcells were concentrated to 2 mg/ml of AT using Centrisart I (Sartorius,Goettingen, Germany), and the AT activities were measured using the N-test AT III-S kit (Nittobo, Tokyo, Japan). The progress ATactivity was meas-ured in the absence of heparin. The specific activity of each recombinantATwas calculated as a percentage of the wild type ATactivity.

Affinity chromatography of recombinant ATson heparin-sepharose

Affinity chromatography of each recombinant AT molecule was per-formed on a heparin–sepharose column. Concentrated media (2 mg/mlof AT) containing wild type-, 116Pro-, or 59Val-AT were subjected tocolumn chromatography on the heparin–sepharose CL6B column (0.8cm � 0.5 cm) that was equilibrated with 50 mmol/l Tris-HCl buffer(pH7.4) containing 0.01 mol/l citric acid. The column was washed withthree-column volumes of the equilibration buffer, and the bound AT wasthen eluted by a stepwise increase in the concentration of NaCl (0.25,0.5, 0.75, 1.0, and 1.5 mol/l). The concentration of AT in each fractionwas determined by ELISA as described earlier.

Results and DiscussionWe analyzed the AT gene in four unrelated Japanese

patients with an AT deficiency by polymerase chain reaction(PCR) mediated direct sequencing, and identified four dis-tinct mutations individually (Table I). They included twonovel mutations (2417delT and C2640T) and two previouslyreported ones (T5342C and T72C) [12,13], and were all inthe heterozygous state. We also detected each mutation inthe baby of both cases with the mutation that had beenreported before (data not shown). We were not able toobtain any sample from relatives of the cases who had anovel mutation.We identified two mutations resulting in an abnormality in

the signal peptide, the novel 2417delT (FS-3Stop) mutationand the previously reported T72C (Met-32Thr) mutation.

TABLE I. Gene Abnormalities and Clinical Features of the Patients with AT Deficiency

Case Age (years) Sex Mutation Predicted AA change Location AT:Ac (%) AT:Ag (%)

1 33 F T5342Ca Ser116Proa Exon 3a 31.0 72.4

2 28 F T72C Met-32Thr Exon 1 65.0 61.4

3 24 F 2417delT FS-3Stop Exon 2 44.3 ND

4 40 F C2640T Ala59Val Exon 2 62.5 93.2

acDNA and amino acid numbers are according to Old et al. (2).

M, male; F, female; ND, not done; underline, novel mutation.

TABLE II. Oligonucleotide Primers for PCR Amplification of the AT Gene

Exon Sense (50?30) Antisense (50?30) Product (bp) Annealing (8C)

1 GGAGTGTGGGCAAGAGAG GAGGTCACAAAACCCAGTAG 366 60

2 TGGGCAGTGGGGCTAGG ACAAGGTGGCTGGGCAGA 459 65

3a TAACTAGGCAGCCCACCAAA TCGGAGGTCAGGGGTAACA 297 60

3b CTGCCTGGGAAAATGGAGAA GGGTAAGCTGAAGAGCAAGA 264 55

4 GAATGTTTGTGTTCTTACTTT AGACTACCTTGCGGGTG 475 55

5 ATGTTTCAAAAAGCCCCAAAG CACCATGAAGGTTTTGGAGAG 322 57

6 CGGCAGAGTGGCTAATTTAGT TGTCTTCATTTCAAATGCAGA 335 57

American Journal of Hematology DOI 10.1002/ajh 703

The 2417delT results in a frameshift mutation (FS-3Stop),which encodes 13 abnormal amino acids from the �16Tyrresidue in the signal peptide of plasma AT precursor. TheFS-3Stop mutant AT could not be secreted into the media,since it was likely to be truncated in the signal peptide.Indeed, we observed that a Western blot analysis for theculture media and cell lysate samples from FS-3Stop-ATexpressed cells showed no signal of normal translated pro-tein bands (58 and 52 kDa) (Fig. 1A), but we did detect aconsiderable signal of a 47 kDa band, which was expectedto be an alternative translation initiated from 17Met [14] (Fig.1B). We also observed a similar result in the samples from�32Thr-AT expressed cells, which is consistent with the pre-vious report [13]. These data suggested that both mutationswould likely cause a type I AT deficiency in such patients.AT has two important functional domains, one is to inhibit

clotting protease while the other is to bind heparin, bywhich the inhibition of protease can be accelerated by*1000 fold [4]. In the case of thrombin, heparin acceler-ates the protease inhibitor activity of AT via both approxi-mation effects and conformational changes, while in thecase of factor Xa and other clotting proteases, it enoughactivates via only conformational changes [15]. The reac-tive site and the heparin binding site are located in theC-terminal and in the N-terminal of the AT molecule,respectively. We identified two missense mutations in theAT gene, which were previously reported as Ser116Promutation and a novel Ala59Val mutation. Both mutationsare located in the N-terminal, or so-called heparin bindingdomain. Okajima et al. reported that the patient plasma ATbearing the Ser116Pro mutation to have no affinity for hep-arin and this mutation was thus thought to be causative fortype II AT deficiency [12]. We observed consistent results,which included a normal progressive AT activity (98.3% ±22.6% of the wild type-AT), an impairment of the heparinbinding affinity and a significantly reduced specific heparincofactor activity in the recombinant 116Pro-AT molecule(23.9% ± 2.5%) (Fig. 2A). We speculate that the recombi-nant 116P-AT may have some differences in conformationfrom natural mutant AT III Nagasaki, so that it might showless impaired activity (23.9% normal versus essentiallyinactive). Indeed, heparin affinity of the recombinant 116P-AT seemed to be also less impaired than that of AT III Na-

gasaki reported by others [12] (Fig. 2B). In contrast, therecombinant 59Val-AT also abolished the specific heparincofactor activity (5.2% ± 0.2%), but surprisingly showed anormal affinity to heparin–sepharose as well as a substan-tially normal progressive AT activity (60.8% ± 16.3%) (seeFig. 2). Similar results were obtained from the Case 4patient’s plasma sample, which showed normal affinity ofthe patient’s AT to the heparin–sepharose, but its AT activitywas reduced to about half of the normal plasma regardlessof addition of heparin (data not shown). The 59Ala locatesat center of a-helix consisting of residues 47Arg to 69Ser,via which heparin pentasaccharide primarily interacts withAT [16]. Therefore, it might be possible that the Ala59Val

Figure 1. Western blot analysis of the recombinant ATmolecules. Wild type and mutant ATs were transientlyexpressed in HEK293 cells, and the culture media and celllysates were analyzed by Western blotting. We loaded10 lg of each sample normalized for total protein. (A) Cul-ture media, (B) cell lysates. Lane1, vector; lane 2, wildtype-AT; lane 3, 116Pro-AT; lane 4, –32Thr-AT; lane 5, FS-3Stop-AT; lane 6, 59Val-AT.

Figure 2. Characteristics of the recombinant AT mole-cules. (A) Progressive AT activities (Prog Ac: solid col-umn) and heparin cofactor AT activities (Hc Ac: opencolumn) of the recombinant proteins stably expressed inthe culture media were examined as described in theMaterials and Methods. Every specific AT activities werecalculated as a percentage of wild type-AT activity (mean ±SD %, n = 3). (B) Affinity chromatographies of the recombi-nant AT molecules were performed on a heparin–sepharosecolumn as described in the Materials and Methods. Thebound AT was eluted by a stepwise increase in the concen-tration of NaCl (0.25, 0.5, 0.75, 1.0, and 1.5 mol/l), and theconcentration of AT in each fraction was determined byELISA. We applied 100 ng (WT and A59V) or 150 ng(S116P) of the respective recombinant ATs to the heparin col-umn, and eluted 21.4 ng (WT), 24.3 ng (A59V), and 30.3 ng(S116P), respectively. Some of ATs (17.5 ng of WT, 19.5 ng ofA59V, and 37.9 ng of S116P) run through the column.

704 American Journal of Hematology DOI 10.1002/ajh

mutation makes a great influence to the AT conformationalstatus, resulting in an impaired expulsion of the reactivecenter loop to free the P1 393Arg for the interaction of thetarget proteases, even if its heparin-binding is normal. As aresult, the Ala59Val mutation would be the cause of type IIAT deficiency in the patient.In conclusion, we investigated the molecular basis of AT

deficiency in four Japanese female patients with thromboticcomplications during pregnancy, and identified four distinctcausative mutations including two novel mutations in theirAT gene. Our findings confirmed that there were diversemolecular mechanisms of AT deficiency depend upon dis-crete AT gene abnormalities as reported previously.

AcknowledgmentsThe authors thank C. Wakamatsu for her expert technical

assistance and are also indebted to M. Yamashita, N.Yamakage, M. Ikejiri, T. Yamada and H. Okada for theirhelpful discussions.

References1. Rosenberg RD. Biochemistry of heparin antithrombin interactions, and the

physiologic role of this natural anticoagulant mechanism. Am J Med1989;87:2S–9S.

2. Olds RJ, Lane DA, Chowdhury V, De Stefano V, Leone G, Thein SL. Com-plete nucleotide sequence of the antithrombin gene: Evidence for homologousrecombination causing thrombophilia. Biochemistry 1993;32:4216–4224.

3. Jin L, Abrahams JP, Skinner R, Petitou M, Pike RN, Carrell RW. The anticoa-gulant activation of antithrombin by heparin. Proc Natl Acad Sci USA1997;94:14683–14688.

4. Olds RJ, Lane DA, Mille B, Chowdhury V, Thein SL. Antithrombin: The princi-pal inhibitor of thrombin. Semin Thromb Hemost 1994;20:353–372.

5. Bauer KA, Rosenberg RD. Congenital antithrombin III deficiency: Insights intothe pathogenesis of the hypercoagulable state and its management usingmarkers of hemostatic system activation. Am J Med 1989;87:39S–43S.

6. Lane DA, Olds RJ, Conard J, et al. Pleiotropic effects of antithrombin strand1C substitution mutations. J Clin Invest 1992;90:2422–2433.

7. Toyozumi H, Kojima T, Matsushita T, Hamaguchi M, Tanimoto M, Saito H. Di-agnosis of hemophilia B carriers using two novel dinucleotide polymorphismsand Hha I RFLP of the factor IX gene in Japanese subjects. Thromb Haemost1995;74:1009–1014.

8. Tsukahara A, Yamada T, Takagi A, et al. Compound heterozygosity for twonovel mutations in a severe factor XI deficiency. Am J Hematol 2003;73:279–284.

9. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagene-sis by overlap extension using the polymerase chain reaction. Gene 1989;77:51–59.

10. Sobue S, Hagiwara K, Banno Y, et al. Transcription factor specificity protein 1(Sp1) is the main regulator of nerve growth factor-induced sphingosine kinase1 gene expression of the rat pheochromocytoma cell line, PC12. J Neuro-chem 2005;95:940–949.

11. Yamada T, Takagi A, Takeshita K, et al. Enzyme immunoassay for measure-ment of murine plasminogen activator inhibitor-1, employing a specific anti-body produced by the DNA vaccine method. Thromb Res 2003;111:285–291.

12. Okajima K, Abe H, Maeda S, et al. Antithrombin III Nagasaki (Ser116-Pro):A heterozygous variant with defective heparin binding associated with throm-bosis. Blood 1993;81:1300–1305.

13. Nagaizumi K, Inaba H, Amano K, et al. Five novel and four recurrent pointmutations in the antithrombin gene causing venous thrombosis. Int J Hematol2003;78:79–83.

14. Fitches AC, Appleby R, Lane DA, De Stefano V, Leone G, Olds RJ. Impairedcotranslational processing as a mechanism for type I antithrombin deficiency.Blood 1998;92:4671–4676.

15. Quinsey NS, Greedy AL, Bottomley SP, Whisstock JC, Pike RN. Antithrombin:In control of coagulation. Int J Biochem Cell Biol 2004;36:386–389.

16. Li W, Johnson DJ, Esmon CT, Huntington JA. Structure of the antithrombin-thrombin-heparin ternary complex reveals the antithrombotic mechanism ofheparin. Nat Struct Mol Biol 2004;11:857–862.

American Journal of Hematology DOI 10.1002/ajh 705