Molecular Cloning and Characterization of A

ORIGINAL PAPER

Molecular Cloning and Characterization of a Trichome-SpecificPromoter of Artemisinic Aldehyde 11(13) Reductase (DBR2)in Artemisia annua

Weimin Jiang & Xu Lu & Bo Qiu & Fangyuan Zhang & Qian Shen &Zongyou Lv & Xueqing Fu & Tingxiang Yan & Erdi Gao & Mengmeng Zhu &Lingxian Chen & Ling Zhang & Guofeng Wang & Xiaofen Sun & Kexuan Tang

Published online: 26 May 2013# Springer Science+Business Media New York 2013

Abstract Artemisinin is widely used as an antimalarial drugaround the world. Artemisinic aldehyde 11(13) reductase(DBR2) is a key enzyme which reduces artemisinic aldehydeto dihydroartemisinic aldehyde in the biosynthesis of artemisinin.In this study, two fragments encompassing a putative promoter ofDBR2, designated as DBR2pro1 and DBR2pro2, were isolatedusing genomic DNAwalking. The transcription start site and theputative cis-elements of each version of promoter were predictedusing bioinformatic analysis. In order to study the function of thecloned promoter, Artemisia annua was transformed with -glucuronidase (GUS) reporter gene driven by DBR2pro1 andDBR2pro2, respectively. GUS staining results demonstrated thatboth DBR2pro1 and DBR2pro2 were strongly expressed inglandular secretory trichomes (GSTs) of leaf primordia andflower buds, but were not obviously expressed in roots, stems,old leaves, and fully developed flowers, thus indicating that thetwo versions of promoter were functional and specificallyexpressed in GSTs.

Keywords DBR2 . Artemisia annua . Promoter . GUS .

Artemisinin . Transformation

Introduction

Artemisia annua has been used as a medicinal plant in Chinafor a long time (Hsu 2006; Miller and Su 2011).Artemisinin, which is extracted from A. annua, is widelyused as drugs for treating malaria (Miller and Su 2011).Artemisinin-based combination therapy is the most effectivemethod against malaria (Bhattarai et al. 2007). Artemisininmight also play a role in the treatment of other diseases,such as cancer and hepatitis B virus (Romero et al. 2005;Singh and Lai 2004). However, the yield of artemisinin istoo limited to meet the demand of market (Covello 2008;Graham et al. 2010), while metabolic engineering is verypromising to produce artemisinin. Artemisinin could bepartly synthesized in Escherichia coli and the engineeredyeast Saccharomyces cerevisiae (Chang et al. 2007; Martinet al. 2003; Ro et al. 2006). The content of artemisinin couldbe increased by suppressing the expression of squalenesynthase, a key enzyme of sterol pathway which competeswith the pathway of artemisinin biosynthesis (Zhang et al.2009), or by overexpression of the key enzymes ofartemisinin biosynthesis pathway (Chen et al. 2012).

The artemisinin biosynthesis pathway has been studiedfor many years, and most of the enzymes have already beencloned (Arsenault et al. 2010; Covello et al. 2007). Theprecursor of artemisinin biosynthesis is isopentenyl diphos-phate (IPP) which originates from both mevalonate pathwayand nonmevalonate pathway (Towler and Weathers 2007).IPP and dimethylallyl diphosphate form farnesyl diphos-phate (FPP) by farnesyl diphosphate synthase. Amorpha-4,11-diene synthase (ADS) is the first key enzyme in the

Weimin Jiang and Xu Lu contributed equally to this work

Electronic supplementary material The online version of this article(doi:10.1007/s11105-013-0603-2) contains supplementary material,which is available to authorized users.

W. Jiang :X. Lu :B. Qiu : F. Zhang :Q. Shen : Z. Lv :X. Fu :T. Yan : E. Gao :M. Zhu : L. Chen : L. Zhang :G. Wang :X. Sun :K. TangFudan-SJTU-Nottingham Plant Biotechnology R&D Center,School of Agriculture and Biology, Shanghai Jiao Tong University,Shanghai 200240, Peoples Republic of China

W. Jiang :X. Lu :B. Qiu : F. Zhang :Q. Shen : Z. Lv :X. Fu :T. Yan : E. Gao :M. Zhu : L. Chen : L. Zhang :G. Wang :X. Sun :K. Tang (*)Plant Biotechnology Research Center, School of Agriculture andBiology, Shanghai Jiao Tong University, Shanghai 200240,Peoples Republic of Chinae-mail: [email protected]

Plant Mol Biol Rep (2014) 32:8291DOI 10.1007/s11105-013-0603-2

artemisinin biosynthesis pathway, which converts FPP toamorpha-4,11-diene (Bouwmeester et al. 1999; Picaud et al.2005; Pu et al. 2013; Wallaart et al. 2001). Amorpha-4,11-diene is gradually oxidized to artemisinic alcohol, artemisinicaldehyde, and artemisinic acid through cytochrome P450enzyme CYP71AV1 (CYP) (Teoh et al. 2006). Artemisinicaldehyde could be reduced to dihydroartemisinic aldehyde byartemisinic aldehyde 11(13) reductase (DBR2) (Zhang et al.2008). Dihydroartemisinic aldehyde is further oxidized todihydroartemisinic acid (DHAA) through an aldehyde dehy-drogenase (ALDH1) (Teoh et al. 2009). DHAA could beconverted into artemisinin with unknown mechanism (Syand Brown 2002). At the same time, some transcription fac-tors regulating the artemisinin biosynthesis pathway havebeen cloned. AaWRKY1 could positively regulate the expres-sion of ADS in the artemisinin biosynthesis pathway (Ma et al.2009); AaERF1 and AaERF2 were supposed to bind to bothADS and CYP promoters (Yu et al. 2012).

Trichomes are small protrusions of epidermal origin on thesurfaces of leaves, flowers, and other organs of plants(Schilmiller et al. 2008). Many genes related with trichomedevelopment have been reported (Schellmann and Hlskamp2005). Trichomes are generally divided into two categories:glandular trichomes and nonglandular trichomes. Artemisininis produced in glandular secretory trichomes (GSTs) (Olsson etal. 2009; Tellez et al. 1999). The content of artemisinin changeswith the amount and growth stages of trichomes (Lommen et al.2006). Most of the enzymes in artemisinin biosynthesis pathwayare preferentially expressed in GSTs (Olofsson et al. 2011).Therefore, the study of promoters of genes in artemisinin bio-synthesis pathway would be significantly important. It wasreported that the promoter of ADS is specifically expressed inglandular trichomes (Kim et al. 2008; Wang et al. 2011a). Thepromoter of CYP was isolated in our lab previously, which wastrichome-specific promoter (Wang et al. 2011b). Recently, an-other copy of CYP was cloned (Wang et al. 2012). However,there was no study about the promoters of DBR2 and ALDH1.

In this study, two versions of DBR2 promoter were clonedthrough genomic DNAwalking method. Moreover, using -glucuronidase (GUS) assay, the activities of the promoter werestudied by stable transformation in A. annua. These resultscould make us better understand the artemisinin biosynthesispathway. It may bring us great progresses to produceartemisinin in metabolic engineering.

Materials and Methods

Plant Materials and Growth Conditions

Seeds of A. annua were obtained from Southwest University(Chongqing, China), surface-sterilized with 70 % ethanol for2 min and then with 0.5 % sodium hypochlorite solution for

7 min, and then rinsed with sterilized distilled water for fourtimes. Seeds were germinated on one-half strength Murashigeand Skoog (1962) (1/2 MS) medium under a 16-h photoperi-od, providing 4060 mol m2 s1 light intensity, at 231 C(Lu et al. 2012a). The seedlings were transferred into soil after10 days, and some of themwere transferred to the green houseafter 6 weeks (Zhang et al. 2012).

DNA Extraction and Isolation of DNA Fragmentsof the DBR2 Promoter of A. annua

Genomic DNA was extracted from young leaves and flowerbuds of A. annua through the cetyltrimethylammonium bromide(CTAB)method (Lu et al. 2011, 2012b; Porebski et al. 1997). Toisolate the promoter ofDBR2, GenomeWalkerTM Universal Kits(Clontech, 638904) were used. Three blunt end restriction en-zymes,DraI,EcoRV, andPvuII, were used to digest theA. annuagenomic DNA. All the digested products were purified andlinked with the Genome Walker adapters. The primary PCRwas operated using nested gene-specific primers DBR2-SP1and the adapter primer AP1 (Table 1). The secondary PCR wasoperated using 1L of 50 dilution of the primary PCR productsas the PCR templates and using nested gene-specific primerDBR2-SP2 and the adapter primer AP2 (Table 1) (Wang et al.2011b).

DNA Sequence Analysis

Two sequences from the genomic DNAwalking method abovewere cloned to pMD18-T simple vector according to the in-structions (TaKaRa D103A). Nucleotide acid sequences wereanalyzed using Vector NTI software (Invitrogen, USA).Bioinformatic analyses of the two sequences were carried outonline BLASTN at the NCBI database and EBI database (Lu etal. 2012a). The transcription start site (TSS) and the elements ofthe cloned promoter were analyzed by the TSSP software (http://linux1.softberry.com/berry.phtml), the PlantCARE software(http://bioinformatics.psb.ugent.be/webtools/plantcare/html/),

Table 1 Primers used in this study

Primers Primer sequences

AP1 GTAATACGACTCACTATAGGGC

AP2 ACTATAGGGCACGCGTGGT

DBR2-SP1 ATAAGAAAGCCACCAGCAGTTGA

DBR2-SP2 ATTGAACTTGCCCATCTTGTAGG

DBR2pro1-up GACTGCAGTGAAGGATGACCAAAAGCATAA

DBR2pro1-down

GCGGATCCTATTGAATTTGATGTTGATCAGG

DBR2pro2-up GACTGCAGTGAAGGATGACCAAAAGCATAA

DBR2pro2-down

GCGGATCCTATTGAGTTTGATGTTGATCAGG

GUS-down GCCTGCCCAACCTTTCGGTATA

Plant Mol Biol Rep (2014) 32:8291 83

and the PLACE software (http://www.dna.affrc.go.jp/PLACE/signalscan.html).

Construction of Overexpression Vectors and A. annuaTransformation

pCAMBIA1391Z-DBR2pro1 and pCAMBIA1391Z-DBR2pro2 were constructed by amplifying the promoter with

the specific primers DBR2pro1/DBR2pro2-up andDBR2pro1/DBR2pro2-down (Table 1) and then excising thefull sequences of DBR2pro1/DBR2pro2 with PstI and BamHI.The two constructs were introduced into Agrobacteriumtumefaciens strain EHA105.

When the plants grew to 5 cm in length, young leaves fromthe seedlings were cut into about 0.5 cm diameter discs, whichwere used as the explants in A. tumefaciens-mediated trans-formation (Vergauwe et al. 1996; Zhang et al. 2009). The l/2MS suspension, with the activated EHA105 harboringDBR2pro1 or DBR2pro2, completely covered the explants.The mixture was then cultured at 28 C in the dark for 48 h.After cocultivation, the explants were washed with steriledistilled water containing cefotaxime (200 mg/L) for fourtimes. After hygromycin B selection in the selective shoot-

Table 2 The length and the accession number of DBR2pro1/2 atGenBank

Name Length Accession no. at NCBI

DBR2pro1 1,813 bp KC347592

DBR2pro2 1,780 bp KC347593

Fig. 1 Sequence of DBR2pro1 with putative TSS and cis-elements

84 Plant Mol Biol Rep (2014) 32:8291

induction medium MS1 (MS0+2 mg/L N6-benzoyladenine+0.2 mg/L naphthalene-1-acetic acid+25mg/L hygromycin B),the hygromycin B-resistant plantlets were regenerated andtransferred into rooting medium MS2 (MS0+0.3 mg/Lnaphthalene-1-acetic acid) for root induction. When the rootswere formed, the rooted plantlets were transferred into soil forfurther growth in the green house.

After genomic DNAs were extracted by CTAB method,using primers DBR2pro1-up/DBR2pro2-up and GUS-down(Table 1), DBR2pro1 and DBR2pro2 transgenic plants wereidentified from regenerated A. annua plants by PCR analysis.

GUS Assay

Roots, stems, leaf primordia, young leaves, and old leaveswere analyzed from 8-week-old transgenic A. annua and the

wild A. annua by GUS staining assay to perform GUSanalysis. When the plants flowered, flower buds and flowerswere analyzed by the same methods. GUS staining of thevarious plant tissues was performed as previously described(Kang et al. 2009). Stained tissues were cleared in 70 %ethanol and detected under a microscope (Olympus BX51)with a digital camera (Olympus DP70).

RT-PCR

Total RNAwas extracted from the different tissues of A. annuaplants using RNAprep pure Plant Kit (Tiangen Biotech, Beijing)according to the instructions. Concentration of theA. annua totalRNA was measured by a NanoDrop spectrophotometer(NanoDrop, Wilmington, USA) and analyzed by agarose gelelectrophoresis. First-strand synthesis of cDNAwas carried out

Fig. 2 Sequence of DBR2pro2 with putative TSS and cis-elements


by PrimeScript RT Master Mix (TaKaRa, Japan) according tothe manufacturers instructions.

Expression of the genes in A. annua were analyzed byquantitative reverse transcription (RT)-PCR (qPCR) usingthe fluorescent intercalating dye SYBR Green (TaKaRa,Japan) in a detection system (Opticon3; MJ Research).qPCR was performed as previously described (Lu et al.2012a). The data were analyzed by 2-CT method(Livak and Schmittgen 2001). AaActin1 was used as astandard control in the qPCR analysis.

Results

Cloning of DBR2 Promoter

To isolate DBR2 promoter, genomic DNA walking methodwas used from three different genomic DNA libraries, andtwo DNA fragments were identified. Sequence analysisshowed that both of the two sequences overlapped 50 bpat the 5 end of the ORF of DBR2. Upstream of the ORF ofDBR2, we acquired two upstream sequences of DBR2,1,813 bp and 1,780 bp, named DBR2pro1 and DBR2pro2,respectively (Table 2). The similarity of the two sequenceswas 75 %.

Structure Analysis of DBR2pro1 and DBR2pro2

The TSSs of the cloned promoter were predicted by theTSSP software (http://linux1.softberry.com/berry.phtml).For DBR2pro1, a putative TSS of the promoter (labeled +1in Fig. 1) was predicted 86 bp upstream of the translationinitiation ATG codon (labeled ORF in Fig. 1). A putativeTATA box was found at the position from 34 to 28 bp (labeled TATA box in Fig. 1) in the upstream ofthe putative TSS.

For DBR2pro2, a putative TSS of the promoter (labeled +1in Fig. 2) was predicted 1,142 bp upstream of the translationinitiation site ATG (labeled ORF in Fig. 2). A putative TATAbox was found at the position from 11 to 8 bp (labeledTATA box in Fig. 2) in the upstream of the putative TSS.

Putative cis-elements of the promoter were predicted by thePlantCARE software (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) and the PLACE software (http://www.dna.affrc.go.jp/PLACE/signalscan.html). ForDBR2pro1, many elements were found in the sequence(Fig. 1): ABRE motifs were found at the positions from 1,264to 1,259 bp and from 1,222 to 1,217 bp; G boxes at thepositions from 1,264 to 1,259 bp, from 1,223 to 1,218 bp, from 165 to 160 bp, and from 62 to 57 bp; CAT box at the position from 1,237 to 1,232 bp;W boxes at the positions from 955 to 950 bp, from 750to 745 bp, and from 247 to 242 bp; 5-UTR Py-rich stretchat the position from 662 to 657 bp; CRTDREHVCBF2(CBF2) motifs at the positions from 1,049 to 1,044 bp,from 469 to 464 bp, and from 367 to 362 bp; andRAV1AAT (RAA) motifs at the positions from 1,202 to 1,198 bp, from 782 to 778 bp, from 714 to 710 bp,from 23 to 19 bp, from 22 to 26 bp, from 69 to 73 bp,and from 98 to 94 bp.

Fig. 3 Construction of pCAMBIA1391Z-DBR2pro1/ DBR2pro2vectors

Fig. 4 GUS staining of high-density GSTs tissues of transgenic A. annua containing pCAMBIA1391Z-DBR2pro1. a, b Leaf primordia; c flowerbuds; d CK; eh fluorescence images of (a)(d). Scale bars in (a, d, e, h) = 200 m; scale bars in (b, c, f, g) = 100 m


For DBR2pro2, many elements were also found inthe sequence (Fig. 2): TGA element was found at theposition from 529 to 524 bp; box 4 at the positionfrom 419 to 414 bp; GT1 motif at the position from 323to 318 bp; AE box at the position from 216 to 209 bp; Gboxes at the positions from 179 to 174 bp and from 138to 133 bp; GAG motif at the position from 126 to 132 bp; 5-UTR Py-rich stretch at the position from 582 to 591 bp; MYBbinding site at the position from 628 to 633 bp; W boxat the position from 803 to 808 bp; CBF2 motifs at thepositions from 656 to 661 bp and from 391 to 396 bp; and

RAA motifs at the positions from 117 to 113 bp, from 194to 198 bp, from 462 to 466 bp, from 1,034 to 1,038 bp, from1,078 to 1,082 bp, from 1,125 to 1,129 bp, and from 962 to966 bp.

Expression Pattern of DBR2pro1 and DBR2pro2

To investigate the expression patterns of DBR2pro1 andDBR2pro2, we placed the GUS reporter gene under thecontrol of DBR2pro1 and DBR2pro2, respectively (Fig. 3).Then, the two constructs were introduced into A. annua by A.

Fig. 5 GUS staining of high density GSTs tissues of transgenic A. annua containing pCAMBIA1391Z-DBR2pro2. a, b Leaf primordia; c Flowerbuds; d CK; e-h Fluorescence images of (a)-(d). Scale bar in (a, d, e, h)= 200 m; scale bars in (b, c, f, g) = 100 m

Fig. 6 GUS staining of youngleaves of transgenic A. annua. aYoung leaves of transgenic A.annua containingpCAMBIA1391Z-DBR2pro1;b Young leaves of transgenic A.annua containingpCAMBIA1391Z-DBR2pro2;c-d Fluorescence images of(a)-(b). Scale bars = 200 m


tumefaciens-mediated leaf-disc transformation method.Twenty four independent lines of DBR2pro1-GUS and 23independent lines of DBR2pro2-GUS were obtained and con-firmed by PCR analysis.

The GUS staining results showed that DBR2pro1 andDBR2pro2 exhibited similar expression pattern which var-ied in different growth stages and tissues. The strong GUSstaining was observed in the GSTs of leaf primordia andflower buds, and only the GSTs of them were stained(Figs. 4 and 5). The GUS staining decreased in young leaves(Fig. 6) and disappeared in old leaves and fully developedflowers, and no GUS staining was detected in roots andstems either (Fig. 7).

Expression patterns of the DBRpro1 and DBRpro2 werealso analyzed by qPCR (Fig. 8). The results of qPCR anal-ysis are similar with the GUS staining results. DBR2pro1and DBR2pro2 were strongly expressed in leaf primordiaand flower buds. The expression of both DBRpro1 andDBRpro2 became weaker as the leaves and flowers weredeveloping. There were quite weak expression in roots andstems. Furthermore, the activity of DBRpro1 and DBRpro2were compared by qPCR (Fig. 8). The activity of DBRpro1was higher than that of DBRpro2.

Discussion

DBR2 is a key enzyme in artemisinin biosynthesis pathway(Zhang et al. 2008). Therefore, cloning the promoter ofDBR2 is extremely important to basic research. Two ver-sions of DBR2 promoter were cloned. These two sequencesoverlapped 50 bp at the 5 end of the ORF of DBR2. In A.

annua, 12-oxophytodienoate reductase 3 (OPR3), whichencodes a key enzyme in jasmonate biosynthesis pathway(Sanders et al. 2000; Schaller and Stintzi 2009; Stintzi andBrowse 2000), has high similarity with DBR2 in nucleotideacid sequences. But, they have totally different expressionpatterns: DBR2 is preferentially expressed in young leavesand flower buds and had almost no expression in roots,stems, and old leaves, while AaOPR3 is mainly expressedin stems and had no obvious expression in young leaves andflower buds (Olofsson et al. 2011; Zhang et al. 2008). Theresults of expression of DBR2 in various tissues also wereconfirmed by qPCR. According to GUS staining and qPCRresults, we suppose that both sequences are promoters ofDBR2, and they are promoters of different copies of thegene. Alternatively, there might be only one copy ofDBR2, and the two versions are the promoter of the sameORF because A. annua cannot self-fertilize.

The TSSs of the promoter were predicted. Through pre-diction, a typical TATA box was found at the position from34 to 28 bp in the upstream of the putative TSS inDBR2pro1. For DBR2pro2, two probable TSSs were foundat the DBR2pro2: one was the +1 site and the other was +424 site. There was no TATA box in 150 bp upstream of thelatter putative TSS. Therefore, we prefer the former TSS,but the RACE PCR would be required to verify the trueTSS. Three W boxes (TTGACC[T]) were found inDBR2pro1 and one W box in DBR2pro2. Most WRKYsregulate the targets by binding to W box (Rushton et al.2010), and AaWRKY1 regulated the expression of ADS bybinding to the W box of ADSpro (Ma et al. 2009). Itsuggests that AaWRKY1 or other WRKYs may bind tothe promoter of DBR2. Three CBF2 ([G/A][T/C]CGAC)

Fig. 7 GUS staining of mature tissues of transgenic A. annua. a Roots oftransgenic A. annua containing pCAMBIA1391Z-DBR2pro1; b Stems oftransgenicA. annua containing pCAMBIA1391Z-DBR2pro1; cOld leavesof transgenic A. annua containing pCAMBIA1391Z-DBR2pro1; d fullydeveloped flowers of transgenic A. annua containing pCAMBIA1391Z-

DBR2pro1; e Roots of t ransgenic A. annua conta iningpCAMBIA1391ZDBR2pro2; f Stems of transgenic A. annua containingpCAMBIA1391Z-DBR2pro2; gOld leaves of transgenicA. annua containingpCAMBIA1391Z-DBR2pro2; h fully developed flowers of transgenic A.annua containing pCAMBIA1391Z-DBR2pro2. Scale bars = 200 m


motifs and seven RAA (CAACA) motifs were found inDBR2pro1; two CBF motifs and seven RAA motifs werefound in DBR2pro2. AaERF1 and AaERF2 are able to bindto the CBF2 and RAA motifs present in both ADS and CYPpromoters (Yu et al. 2012). This indicates that AaERF1 andAaERF2 may also be able to bind to the promoter of DBR2.There may be other ERFs regulating the expression of ADS,CYP, and DBR2 by CBF2 motif and RAA motif. DBR2pro2carried an MBS motif which is the binding site for MYBtranscription factors. It indicates that AaMYBs may beinvolved in the artemisinin biosynthesis. However, the func-tions of transcription factors above containing certain regu-latory motifs are only prediction. It could be verifiedexperimentally by DNAprotein binding assay. These

regulatory elements existed in the different areas ofDBR2pro1 and DBR2pro2. The homologous areas ofDBR2pro1 and DBR2pro2 are 5 end and 3 end, while themiddle part is diverse. From the position of the regulatoryelements and distribution of the homologous areas, we thinkthat the uneven homology might result from evolution.

Both DBR2pro1 and DBR2pro2 are strongly expressed inGSTs of leaf primordia and flower buds but have no obviousexpression in other tissues. Temporally, the expression ofDBR2pro1 and DBR2pro2 gradually decreased with the de-velopment of leaves and flowers. The expression patternswere almost the same with ADS and CYP (Kim et al. 2008;Ma et al. 2009; Olofsson et al. 2011;Wang et al. 2012; Zeng etal. 2009). The expression pattern of DBR2 indicates the

Fig. 8 Expression of gene invarious tissues of transgenic A.annua. a Expression levels ofDBRpro1:GUS in roots (R),stems (S), leaf primordia (LP),young leaves (YL), old leaves(OL), flower buds (FB), andfully developed flowers (FDF);b expression levels ofDBRpro2:GUS in roots (R),stems (S), leaf primordia (LP),young leaves (YL), old leaves(OL), flower buds (FB), andfully developed flowers (FDF);c comparison of activity ofDBRpro1 and DBRpro2


reduction of artemisinic aldehyde to dihydroartemisinic alde-hyde by DBR2 should mainly take place in GSTs of leafprimordial, young leaf tissues, and flower buds. Since ADS,CYP,DBR2, and ALDH1were expressed in GSTs (Olofsson etal. 2011), we propose that all the biosynthesis of artemisininprecursors amorpha-4,11-diene, artemisinic alcohol,artemisinic aldehyde, dihydroartemisinic aldehyde, andDHAA mainly occurs in GSTs of leaf primordial, young leaftissues, and flower buds.

In this study, two trichome-specific versions of DBR2promoter were cloned, which would bring great help to met-abolic engineering to produce artemisinin. Plant metabolicengineering is used to increase the content of artemisininusing constitutive promoters. Overexpression of one or moregenes in artemisinin biosynthesis pathway increased the yieldof artemisinin in transgenic A. annua (Alam and Abdin 2011;Aquil et al. 2009; Banyai et al. 2010; Chen et al. 2012; Nafis etal. 2011). Downregulation of enzymes competing with theartemisinin biosynthesis also led to an improved yield ofartemisinin (Chen et al. 2011; Feng et al. 2009; Zhang et al.2009). Since many trichome-specific promoters were cloned(Kim et al. 2008; Ma et al. 2009; Wang et al. 2012, 2011a, b),it should be worth determining whether these promoters couldbe used to more effectively improve the yield of artemisinincompared to constitutive promoters by metabolic engineering.

Acknowledgments This work was funded by China 863 Program(grant no. 2011AA100605), China Transgenic Research Program(grant no. 2011ZX08002001), and Shanghai Leading Academic Dis-cipline Project (Horticulture).

References

Alam P, Abdin MZ (2011) Over-expression of HMG-CoA reductase andamorpha-4,11-diene synthase genes in Artemisia annua L. and itsinfluence on artemisinin content. Plant Cell Rep 30:19191928

Aquil S, Husaini AM, AbdinMZ, Rather GM (2009) Overexpression of theHMG-CoA reductase gene leads to enhanced artemisinin biosynthesisin transgenic Artemisia annua plants. Planta Med 75:14531458

Arsenault PR, Vail D, Wobbe KK, Erickson K, Weathers PJ (2010)Reproductive development modulates gene expression and me-tabolite levels with possible feedback inhibition of artemisinin inArtemisia annua. Plant Physiol 154:958968

Banyai W, Kirdmanee C, Mii M, Supaibulwatana K (2010)Overexpression of farnesyl pyrophosphate synthase (FPS) geneaffected Artemisinin content and growth of Artemisia annua L.Plant Cell Tissue Organ Cult 103:255265

Bhattarai A, Ali AS, Kachur SP, Mrtensson A, Abbas AK, Khatib R, Al-mafazy AW, Ramsan M, Rotllant G, Gerstenmaier JF, Molteni F,Abdulla S, Montgomery SM, Kaneko A, Bjrkman A (2007)Impact of artemisinin-based combination therapy and insecticide-treated nets on malaria burden in Zanzibar. PLoSMed 4:17841790

Bouwmeester HJ, Wallaart TE, Janssen MHA, Van Loo B, Jansen BJM,Posthumus MA, Schmidt CO, De Kraker JW, Knig WA, FranssenMCR (1999) Amorpha-4,11-diene synthase catalyses the first prob-able step in artemisinin biosynthesis. Phytochemistry 52:843854

Chang MCY, Eachus RA, Trieu W, Ro DK, Keasling JD (2007)Engineering Escherichia coli for production of functionalizedterpenoids using plant P450s. Nat Chem Biol 3:274277

Chen JL, Fang HM, Ji YP, Pu GB, Guo YW, Huang LL, Du ZG, Liu BY,Ye HC, Li GF, Wang H (2011) Artemisinin biosynthesis enhance-ment in transgenic Artemisia annua plants by downregulation ofthe-Caryophyllene synthase gene. Planta Med 77:17591765

Chen Y, Shen Q, Wang Y,Wang T, Wu S, Zhang L, Lu X, Zhang F, JiangW, Qiu B, Gao E, Sun X, Tang K (2012) The stacked over-expression of FPS, CYP71AV1 and CPR genes leads to the increaseof artemisinin level in Artemisia annua L. Plant Biotechnol Rep.doi:10.1007/s11816-012-0262-z

Covello PS (2008) Making artemisinin. Phytochemistry 69:28812885Covello PS, TeohKH, PolichukDR,ReedDW,NowakG (2007) Functional

genomics and the biosynthesis of artemisinin. Phytochemistry68:18641871

Feng LL, Yang RY, Yang XQ, Zeng XM, Lu WJ, Zeng QP (2009)Synergistic re-channeling of mevalonate pathway for enhancedartemisinin production in transgenic Artemisia annua. Plant Sci177:5767

Graham LA, Besser K, Blumer S, Branigan CA, Czechowski T, Elias L,Guterman I, Harvey D, Isaac PG, Khan AM, Larson TR, Li Y, PawsonT, Penfield T, Rae AM, Rathbone DA, Reid S, Ross J, SmallwoodMF,Segura V, Townsend T, Vyas D, Winzer T, Bowles D (2010) Thegenetic map of Artemisia annua L identifies loci affecting yield ofthe antimalarial drug artemisinin. Science 327:328331

Hsu E (2006) The history of qing hao in the Chinese materia medica.Trans R Soc Trop Med Hyg 100:505508

Kang CY, LianHL,Wang FF, Huang JR, YangHQ (2009) Cryptochromes,phytochromes, and COP1 regulate light-controlled stomatal develop-ment in Arabidopsis. Plant Cell 21:26242641

Kim SH, Chang YJ, Kim SU (2008) Tissue specificity and develop-mental pattern of amorpha-4,11-diene synthase (ADS) proved byADS promoter-driven GUS expression in the heterologous plant,Arabidopsis thaliana. Planta Med 74:188193

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2-CT method.Methods 25:402408

Lommen WJM, Schenk E, Bouwmeester HJ, Verstappen FWA (2006)Trichome dynamics and artemisinin accumulation during devel-opment and senescence of Artemisia annua leaves. Planta Med72:336345

Lu X, Jiang W, Zhang L, Zhang F, Shen Q, Wang T, Chen Y, Wu S, LvZ, Gao E, Qiu B, Tang K (2012a) Characterization of a novel ERFtranscription factor in Artemisia annua and its induction kineticsafter hormones and stress treatments. Mol Biol Rep 39:95219527

Lu X, Lin X, Shen Q, Zhang F, Wang Y, Chen Y, Wang T, Wu S, TangK (2011) Characterization of the jasmonate biosynthetic geneallene oxide cyclase in Artemisia annua L., source of theantimalarial drug artemisinin. Plant Mol Biol Rep 29:489497

Lu X, Zhang F, Jiang W, Lin X, Chen Y, Shen Q, Wang T, Wu S, SunX, Tang K (2012b) Characterization of the first specific jasmonatebiosynthetic pathway gene allene oxide synthase from Artemisiaannua. Mol Biol Rep 39:22672274

Ma D, Pu G, Lei C, Ma L, Wang H, Guo Y, Chen J, Du Z, Li G, Ye H,Liu B (2009) Isolation and characterization of AaWRKY1, anArtemisia annua transcription factor that regulates the amorpha-4,11-diene synthase gene, a key gene of artemisinin biosynthesis.Plant Cell Physiol 50:21462161

Martin VJJ, Piteral DJ, Withers ST, Newman JD, Keasling JD (2003)Engineering a mevalonate pathway in Escherichia coli for pro-duction of terpenoids. Nat Biotechnol 21:796802

Miller LH, Su X (2011) Artemisinin: discovery from the Chineseherbal garden. Cell 146:855858


Murashige T, Skoog F (1962) A revised medium for rapid growth andbio-assays with tobacco tissue cultures. Physiol Plant 15:473497

Nafis T, Akmal M, Ram M, Alam P, Ahlawat S, Mohd A, Abdin MZ(2011) Enhancement of artemisinin content by constitutive ex-pression of the HMG-CoA reductase gene in high-yielding strainof Artemisia annua L. Plant Biotechnol Rep 5:5360

Olofsson L, Engstrm A, Lundgren A, Brodelius PE (2011) Relativeexpression of genes of terpene metabolism in different tissues ofArtemisia annua L. BMC Plant Biol 11:45

Olsson ME, Olofsson LM, Lindahl AL, Lundgren A, Brodelius M,Brodelius PE (2009) Localization of enzymes of artemisininbiosynthesis to the apical cells of glandular secretory trichomesof Artemisia annua L. Phytochemistry 70:11231128

Picaud S, Olofsson L, Brodelius M, Brodelius PE (2005) Expression,purification, and characterization of recombinant amorpha-4,11-diene synthase from Artemisia annua L. Arch Biochem Biophys436:215226

Porebski S, Bailey LG, Baum BR (1997) Modification of a CTABDNA extraction protocol for plants containing high polysaccha-ride and polyphenol components. Plant Mol Biol Rep 15:815

Pu GB, Ma DM, Wang H, Ye HC, Liu BY (2013) Expression andlocalization of amorpha-4,11-diene synthase in Artemisia annuaL. Plant Mol Biol Rep 31:3237

Ro DK, Paradise EM, Quellet M, Fisher KJ, Newman KL, NdunguJM, Ho KA, Eachus RA, Ham TS, Kirby J, Chang MCY, WithersST, Shiba Y, Sarpong R, Keasling JD (2006) Production of theantimalarial drug precursor artemisinic acid in engineered yeast.Nature 440:940943

Romero MR, Efferth T, Serrano MA, Castao B, MacIas RIR, Briz O,Marin JJG (2005) Effect of artemisinin/artesunate as inhibitors ofhepatitis B virus production in an in vitro replicative system.Antiviral Res 68:7583

Rushton PJ, Somssich IE, Ringler P, Shen QJ (2010) WRKY transcrip-tion factors. Trends Plant Sci 15:247258

Sanders PM, Lee PY, Biesgen C, Boone JD, Beals TP, Weiler EW,Goldberg RB (2000) The Arabidopsis DELAYED DEHISCENCE1gene encodes an enzyme in the jasmonic acid synthesis pathway.Plant Cell 12:10411061

Schaller A, Stintzi A (2009) Enzymes in jasmonate biosynthesisstructure,function, regulation. Phytochemistry 70:15321538

Schellmann S, Hlskamp M (2005) Epidermal differentiation: tri-chomes in Arabidopsis as a model system. Int J Dev Biol49:579584

Schilmiller AL, Last RL, Pichersky E (2008) Harnessing plant tri-chome biochemistry for the production of useful compounds.Plant J 54:702711

Singh NP, Lai HC (2004) Artemisinin induces apoptosis in humancancer cells. Anticancer Res 24:22772280

Stintzi A, Browse J (2000) The Arabidopsis male-sterile mutant, opr3,lacks the 12-oxophytodienoic acid reductase required forjasmonate synthesis. Proc Natl Acad Sci U S A 97:1062510630

Sy LK, Brown GD (2002) The mechanism of the spontaneous autox-idation of dihydroartemisinic acid. Tetrahedron 58:897908

Tellez MR, Canel C, Rimando AM, Duke SO (1999) Differentialaccumulation of isoprenoids in glanded and glandless Artemisiaannua L. Phytochemistry 52:10351040

Teoh KH, Polichuk DR, Reed DW, Covello PS (2009) Molecularcloning of an aldehyde dehydrogenase implicated in artemisininbiosynthesis in Artemisia annua. Bot 87:635642

Teoh KH, Polichuk DR, Reed DW, Nowak G, Covello PS (2006)Artemisia annua L. (Asteraceae) trichome-specific cDNAs revealCYP71AV1, a cytochrome P450 with a key role in the biosynthe-sis of the antimalarial sesquiterpene lactone artemisinin. FEBSLett 580:14111416

Towler MJ, Weathers PJ (2007) Evidence of artemisinin productionfrom IPP stemming from both the mevalonate and thenonmevalonate pathways. Plant Cell Rep 26:21292136

Vergauwe A, Cammaert R, Vandenberghe D, Genetello C, Inze D, VanMontagu M, Van den Eeckhout E (1996) Agrobacteriumtumefaciens-mediated transformation of Artemisia annua L. andregeneration of transgenic plants. Plant Cell Rep 15:929933

Wallaart TE, Bouwmeester HJ, Hille J, Poppinga L, Maijers NCA(2001) Amorpha-4,11-diene synthase: cloning and functional ex-pression of a key enzyme in the biosynthetic pathway of the novelantimalarial drug artemisinin. Planta 212:460465

Wang H, Han J, Kanagarajan S, Lundgren A, Brodelius PE (2012)Trichome-specific expression of the amorpha-4,11-diene 12-hydroxylase (cyp71av1) gene, encoding a key enzyme of artemisininbiosynthesis in Artemisia annua, as reported by a promoter-GUSfusion. Plant Mol Biol. doi:10.1007/s11103-012-9986-y

Wang H, Olofsson L, Lundgren A, Brodelius PE (2011a) Trichome-specific expression of amorpha-4,11-diene synthase, a key en-zyme of artemisinin biosynthesis in Artemisia annua L., asreported by a promoter-GUS fusion. Am J Plant Sci 2:619628

Wang Y, Yang K, Jing F, Li M, Deng T, Huang R,Wang B,Wang G, SunX, Tang KX (2011b) Cloning and characterization of trichome-specific promoter of cpr71av1 gene involved in artemisinin biosyn-thesis in Artemisia annua L. Mol Biol 45:751758

Yu ZX, Li JX, Yang CQ, Hu WL, Wang LJ, Chen XY (2012) Thejasmonate-responsive AP2/ERF transcription factors AaERF1and AaERF2 positively regulate artemisinin biosynthesis inArtemisia annua L. Mol Plant 5:353365

Zeng QP, Zeng XM, Yin LL, Yang RY, Feng LL, Yang XQ (2009)Quantification of three key enzymes involved in artemisinin bio-genesis in Artemisia annua by polyclonal antisera-based ELISA.Plant Mol Biol Rep 27:5057

Zhang L, Jing F, Li F, Li M, Wang Y, Wang G, Sun X, Tang K (2009)Development of transgenic Artemisia annua (Chinese worm-wood) plants with an enhanced content of artemisinin, an effec-tive anti-malarial drug, by hairpin-RNA-mediated gene silencing.Biotechnol Appl Biochem 52:199207

Zhang L, Lu X, Shen Q, Chen Y, Wang T, Zhang F, Wu S, Jiang W, LiuP, Wang Y, Tang K (2012) Identification of putative Artemisiaannua ABCG transporter unigenes related to artemisinin yieldfollowing expression analysis in different plant tissues and inresponse to methyl jasmonate and abscisic acid treatments. PlantMol Biol Rep 30:838847

Zhang Y, Teoh KH, Reed DW, Maes L, Goossens A, Olson DJH, RossARS, Covello PS (2008) The molecular cloning of artemisinicaldehyde 11(13) reductase and its role in glandular trichome-dependent biosynthesis of artemisinin in Artemisia annua. J BiolChem 283:2150121508


Molecular...AbstractIntroductionMaterials and MethodsPlant Materials and Growth ConditionsDNA Extraction and Isolation of DNA Fragments of the DBR2 Promoter of A. annuaDNA Sequence AnalysisConstruction of Overexpression Vectors and A. annua TransformationGUS AssayRT-PCR

ResultsCloning of DBR2 PromoterStructure Analysis of DBR2pro1 and DBR2pro2Expression Pattern of DBR2pro1 and DBR2pro2

DiscussionReferences

Documents

Molecular Cloning and Characterization of A