Embed Size (px)
Citation preview
Molecular Genetics of Tooth Agenesis
Pekka Nieminen
Department of Orthodontics Institute of Dentisty
andInstitute of Biotechnology
andDepartment of Biological and Environmental Sciences
Faculty of Biosciences University of Helsinki
Finland
Academic Dissertation To be discussed publicly with the permission
of the Faculty of Biosciences of the University of Helsinki,in the Main Auditorium of the Institute of Dentistry
on November 23rd 2007 at 12 noon.
Helsinki 2007
SupervisorsSinikka Pirinen, DDS, PhD Professor emeritaDepartment of Pedodontics and Orthodontics Institute of Dentistry, University of Helsinki, Finland
Irma Thesleff, DDS, PhDProfessorDevelopmental Biology ProgrammeInstitute of Biotechnology, University of Helsinki, Finland
Reviewed by Jan Huggare, DDS, PhD ProfessorDepartment of Orthodontics Karolinska institutetHuddinge, Sweden
Anu Wartiovaara, MD, PhDProfessorFinMIT, Research Program of Molecular Neurology Biomedicum Helsinki Finland
Opponent:Heiko Peters PhD, Reader University of Newcastle
ISBN 978-952-10-4350-5 (nid.) ISBN 978-952-10-4351-2 (PDF) ISSN 1795-7079
Yliopistopaino Oy Helsinki 2007
Contents
LIST OF ORIGINAL PUBLICATIONS 7ABBREVIATIONS 8SUMMARY 9
INTRODUCTION 10
REVIEW OF THE LITERATURE 11
OVERVIEW OF TOOTH DEVELOPMENT 11Principles of development 11Teeth and dentitions 13Development of teeth 14Commitment, morphogenesis and inductive interactions 19Molecular regulation of tooth development 26
Reciprocal signaling and signaling centers 26Transcription factors 27MSX1 and PAX9 28Initiation 29Morphogenesis 32Tooth replacement 34
TOOTH AGENESIS 36Developmental anomalies 36Developmental anomalies of teeth 37Genetic traits of tooth number and shape 37Supernumerary teeth 38Tooth agenesis 39
Terminology 39Diagnostic challenges 40Prevalences 40Patterns of agenesis 41Tooth agenesis in syndromes 43
Dental anomalies associated with agenesis 43Reduction of tooth size and morphology 44Delayed development and eruption 45Root abnormalities 46Abnormal positions of teeth 47Enamel defects 48
Etiology and pathogenesis of tooth agenesis 48Environmental factors 48Tooth size variation and heritability 50Twin studies on agenesis 50Segregation analyses in families 51Molecular genetics 52
4
Pathogenesis of tooth agenesis 53Tooth agenesis and cancer 56
HUMAN GENETICS AND GENE DEFECTS 57The human genome 57Variation 58From genotypes to phenotypes 59Gene identification 60
AIMS 64
MATERIALS AND METHODS 65Subjects 65DNA isolation 66Genotyping 67Linkage analysis (I, IV) 68Sequencing (II) 68FISH Analysis (III) 68Gene expression data collection (V) 69WWW implementation (V) 69
RESULTS AND DISCUSSION 70MSX1 and PAX9 in dominantly inherited severe tooth agenesis (pub-lications II and III) 70Attempts to unravel the genetic basis of common tooth agenesis (incisorand premolar hypodontia) (publications I, IV) 74Construction of the gene expression database (publication V) 78
GENERAL DISCUSSION 80Uncovering the genetic background of tooth agenesis 80Implications for the pathogenetic mechanisms of tooth agenesis 82
CONCLUDING REMARKS 85
ACKNOWLEDGEMENTS 86
REFERENCES 88
5
6
List of original publications
This thesis is based on the following original articles, which are referred to in the text by their roman numerals. In addition, some unpublished data are also presented.
I Nieminen P, Arte S, Pirinen S, Peltonen L, and Thesleff I (1995). Gene defect in hy-podontia - exclusion of MSX1 and MSX2 as candidate genes. Human Genetics 96,305-308.
II Nieminen P, Arte S, Tanner D, Paulin L, Alaluusua S, Thesleff I, and Pirinen S (2001). Identification of a nonsense mutation in the PAX9 gene in molar oligodontia. European Journal of Human Genetics 9, 743-746.
III Nieminen P, Kotilainen J, Aalto Y, Knuutila S, Pirinen S, and Thesleff I (2003). MSX1 gene is deleted in Wolf-Hirschhorn syndrome patients with oligodontia. Jour-nal of Dental Research 82 , 1012-1016.
IV Nieminen P, Arte S, Luonsi E, Pirinen S, Peltonen L, and Thesleff I. A genome-widesearch for hypodontia locus in families, manuscript.
V Nieminen P, Pekkanen M, Åberg T, and Thesleff I (1998). A graphical www-database on gene expression in tooth. European Journal of Oral Sciences 106, 7-11.
7
ABBREVIATIONS
ADULT acro-dermato-ungual-lacrimal-tooth syndromeAEC ankyloblepharon-ectodermal dysplasia-clefting syndromeAI amelogenesis imperfectaAPC adenomatous polyposis coliBMP/Bmp bone morphogenetic protein CLPED cleft lip/palate-ectodermal dysplasia syndromeDKK1/Dkk1 dickkopf-1 DLX/Dlx distalless homeobox homolog DNA deoxyribonucleid acidE embryonic dayEDA/Eda anhidrotic ectodermal dysplasia EDAR/Edar EDA receptorEDA-ID anhidrotic ectodermal dysplasia with immunodeficiency EEC ectrodactyly-ectodermal dysplasia-clefting syndromeEGF/Egf epidermal growth factor ERS epithelial cell rests of MalassezFAP familial adenomatous polyposis coliFGF/Fgf fibroblast growth factor FGFR/Fgfr fibroblast growth factor receptorHERS Hertwig’s epithelial root sheathIP incontinentia pigmentiLEF1/Lef1 lymphoid enhancer factor 1 LMS limb-mammary syndromemRNA messenger RNAMSX/Msx muscle segment homeobox homologNMD nonsense mediated decay OL-EDA-ID anhidrotic ectodermal dysplasia-immunodeficiency-osteopetrosis-
lymphoedema.PAX/Pax paired box family memberPCR polymerase chain reaction RNA ribonucleic acidRUNX/Runx runt homologSHH/Shh sonic heghehogSNP single nucleotide polymorphismSRA short root anomalySTRP short tandem repeat polymorphismTGFA transforming growth factor TGF /Tgf transforming growth factor TNF/Tnf tumor necrosis factor
8
SUMMARY
Tooth agenesis is one of the most common developmental anomalies in man. The common forms, in which one or a few teeth are absent, may cause cosmetic or occlusal harm, while severe forms which are relatively rare require clinical attention to support and maintain the dental function. Observation of tooth agenesis and especially the severe forms is also impor-tant for diagnosis of malformation syndromes.
Some external factors like pollutants or cancer therapy may cause developmental defects andagenesis in dentition. However, twin and family studies have shown the predominant role of inheritance in the etiology of agenesis. Furthermore, studies on inherited tooth agenesis as well as mouse null mutants have identified several of the genetic factors and helped to un-derstand the molecular mechanisms of tooth development. However, so far success has only been made in identifying the genes involved in syndromic or rare dominant forms of tooth agenesis, while the genes and defects responsible for the majority of cases of tooth agenesis, especially the common and less severe forms, are largely unknown.
In this study, different types of tooth agenesis were studied. It was shown that a dominantnonsense mutation in PAX9 was responsible for severe agenesis (oligodontia) affecting espe-cially permanent molars in a Finnish family. In a study of tooth agenesis associated with Wolf-Hirschhorn syndrome, it was shown that severe tooth agenesis was present if the causative deletion in the short arm of chromosome 4 spanned the MSX1 locus. A conclusionfrom these studies was that severe tooth agenesis was caused by haploinsufficiency of thesetranscription factors. During this work several other gene defects in MSX1 and PAX9 have been identified by us and others, and according to an analysis of the associated phenotypespresented in this thesis, similar but significantly different agenesis phenotypes are associatedwith defects in MSX1 and PAX9, apparently reflecting distinctive roles for these two tran-scription factors during the development of human dentition.
The original aim of this work was to identify gene defects that underlie the common incisor and premolar hypodontia. For this purpose, several candidate genes were first excluded. Af-ter a genome-wide search with seven families in which tooth agenesis was inherited in anautosomal dominant manner, a promising locus in chromosome 18 was identified for secondpremolar agenesis in one family. This finding was supported by results from other families.The results also implied existence of other loci both for second premolar agenesis and for incisor agenesis. On the other hand the results from this study did not lend support for com-prehensive involvement of the most obvious candidate genes in the etiology of incisor and premolar hypodontia. Rather, they suggest remarkable genetic heterogeneity of tooth agen-esis.
Despite the increasing knowledge of the molecular background of tooth agenesis, the patho-logical and developmental mechanisms of tooth agenesis have only become clarified in a few cases. The available evidence suggests that human tooth agenesis usually is a conse-quence of quantitative defects which predispose to a failure to overcome a developmentalthreshold. However, the stages and causes may be different in the case of different genes.
9
INTRODUCTION
Mammalian teeth develop as ectodermal organs bearing many similarities to other such or-gans like hair, feathers and mammary glands (Pispa and Thesleff, 2003). As such, teeth are serially homologous and the developmental mechanisms that produce different tooth types in an organized fashion have long been debated (Butler, 1939; Osborn, 1978; Weiss et al., 1998). The positioning of teeth, their intricate and species-specific morphologies, timing ofdevelopment and regeneration imply stringent regulatory mechanisms of development and make teeth a relevant and interesting model for several scientific disciplines. Basic problemsin developmental biology, including cell commitment, reciprocal tissue interactions, patternformation, positional information and development of complex morphologies may be ap-proached using teeth and dentitions as a model system (Weiss et al., 1998; Thesleff and Nieminen, 2005). Teeth are useful for the research into evolutionary mechanisms because of the species-specific morphologies based on adaptations of the tooth forms to the changing habitat and lifestyle as well as because of resilience of teeth among the fossil record (Jernvall, 1995; Jernvall et al., 2000). The replacement of teeth and the existence of continu-ously growing teeth offer a model for tissue regeneration and stem cell research (Huysseune and Thesleff, 2004; Wang et al., 2007). Finally, the differentiation of the hard-tissue formingcells and the coupling of the differentiation into the morphogenesis may be studied to answer questions on regulation of cell differentiation (Wang et al., 2004b; Thesleff and Nieminen,2005).
The strict genetic control of tooth development ensures that we all have a similar dentition with anterior and posterior teeth of distinct shapes and times of eruption. However, despite this similarity, all dentitions are unique and part of this individuality is created by variation and features caused by genetic factors. Dental anthropologists have paid attention to various morphological features with a hope that they could be used to clarify population history (Dahlberg, 1945; Irish and Guatelli-Steinberg, 2003). The size and shape variation includes all teeth but especially patterns of molar crowns (Dahlberg, 1945). The most salient features involve abnormalities in tooth number. Developmental failure of one or more teeth, toothagenesis or hypodontia, is one of the most common anomalies in man, and depending on its severity and location may be of aesthetic or clinical significance (Arte, 2001). Recently, a connection between tooth agenesis and colorectal cancer was identified in a Finnish family,suggesting that developmental anomalies of teeth may sometimes be signs of cancer predis-position (Lammi et al., 2004).
As part of a research which aims to understand the molecular mechanisms and genetic net-works regulating tooth development, a research project was started in 1992 to look for thegenetic factors that are responsible for tooth agenesis. During this project, different types of familial tooth agenesis has been studied, and several gene defects and a new gene involvedin tooth agenesis identified. The original aim was to identify gene defects that underlie thecommon type of tooth agenesis, incisor and premolar hypodontia. In this thesis, I present re-sults from studies into rare forms of tooth agenesis, and summarize results from genome-wide searches in several families with common incisor and premolar hypodontia.
10
REVIEW OF THE LITERATURE
OVERVIEW OF TOOTH DEVELOPMENT
Principles of development
Individuals of all animal species develop from a single cell, a fertilized oocyte. The devel-opment includes a massive amount of cell divisions (proliferation), cell differentiation, mi-gration and also cell death. The cells of an early embryo of higher animals are capable toadapt all cell fates, and they may be regarded as embryonic stem cells. During further devel-opment, the cells become parts of tissue layers and their options for regulative developmentbecome more and more limited. Their fates are regulated by their interactions, limiting theiroptions and causing a stepwise commitment to more restricted cell fates (Gilbert, 2003). However, the cells may still retain a capacity to regulation: cells that will contribute to a cer-tain organ may be able to develop into a normal organ even though part of them is removed. For example, if an early mouse tooth germ is split into two, both halves develop into teeth of normal size and morphology (Glasstone, 1963). The terminal differentiation is associated with a reduced capacity to proliferate. In many adult tissues, however, some cells have re-tained stem cell-like properties and a capacity to provide new differentiated cells (Fuchs et al., 2004).
In many animals, the unfertilized oocyte is polarized allowing the sperm entry only on cer-tain regions (Gilbert, 2003). The site of the sperm entry further delineates the future devel-opment, e.g. the planes of the first cell divisions, and creates the basis for polarity in the growing embryo. Further guides for the prospective commitment of the cells is served by their position in the growing embryo and by their interactions with other cell and tissues.Commitment, morphogenesis and differentiation are regulated by inductive interactions be-tween cells and groups of cells. The positional information may be conveyed from organiz-ing tissues through gradients of inductive substances, often called morphogens, as well as of their antagonists (Hogan, 1999; Gilbert, 2003). Inherent for development and morphogenesisof many organs are self-organizing processes that are thought to act for example during for-mation of somites from the paraxial mesoderm as well as during positioning of ectodermalplacodes and cusps of teeth (Weiss et al., 1998; Salazar-Ciudad and Jernvall, 2002; Giudi-celli and Lewis, 2004; Sick et al., 2006)
In instructive interactions, the inducer dictates the commitment of a responder while in per-missive interactions the properties of the inducer are needed to allow the commitment of the responder (Gilbert, 2003). For an induction to happen, the responder must have previously acquired a competence to respond. In the key inductive interaction called primary embryonicinduction the dorsal blastopore lip, the Spemann organizer, inducts the neural tube and the dorsal axis. Subsequent inductive evens leading to the development of individual organs have been called secondary inductions (Saxen and Thesleff, 1992; Gilbert, 2003). For manyorgans, inductive interactions between epithelium and mesenchyme are important, and de-velopment of teeth and hair are examples of reciprocal process of epithelial-mesenchymalinteractions (Mina and Kollar, 1987; Thesleff and Nieminen, 2005).
11
Figure 1. Scheme of principles of signal transduction. (1) Binding of a ligand to a receptor may cause dimerization and phosphorylation of receptors (in the left) as in FGF, TGF and EGF signaling. Alternatively (to the right), it may trigger changes in the conformation of thereceptor proteins that cause changes in the protein-protein interactions inside the plasmamembrane as in hedgehog and canonical WNT signaling. (2) Dimerization and phosphoryla-tion of the receptors may start a cascade of phosphorylation of signal transducing proteins. (3) Receptor activation may lead to a release of an interaction that has inhibited an activity of a signal transducer protein. (4) The active signal transducers enter the nucleus and participate inthe activation of transcription of target genes. (5) The target genes may code for antagonists,that act either inside or outside the cell and attenuate the signal. L, ligand, i,e, the signaling molecule; R, receptor; CoR, coreceptor necessary for ligand binding; SP, scaffolding protein; K, kinase that phosphorylates the signaling transducer and renders it susceptible to degrada-tion; ST, signal transducer; TF, transcription factor; I, antagonist; P, phosphate moiety.
Each cell has the same genome, but they express different sets of genes in different levels. The morphology, behaviour and interactions with other cells as well as the commitment and competence are based on the gene products the cell synthesizes. Aberrations of the regula-tion of gene expression may lead to abnormal growth and cancer. The capacity to gene ex-pression is largely executed through expression of transcription factors that are the proteins regulating the expression of genes. Interactions between cells may be mediated by the adhe-sion molecules in the cell surface and by the extracellular matrix that cells secrete (Gilbert,2003; Thesleff et al., 1991). However, instructive interactions typically involve production of signaling molecules ("signals"), often peptides or proteins, which are then bound to a spe-cific receptor on the surface of (or in some cases, inside) the “receiving” cells (Gilbert,2003; Pires-daSilva and Sommer, 2003; Wang and Thesleff, 2005). The signals may act in
12
paracrine fashion between neighbouring or close-residing cells but they may also exert theireffects on relatively long range and on a concentration dependent manner (Gilbert, 2003; Fan et al., 1995; Gritli-Linde et al., 2001). Most important signals are peptide growth factors that belong to the evolutionarily conserved Wnt, Heghehog and fibroblast growth factor (Fgf)families as well as to the transforming growth factor- (TGF ) superfamily including e.g. TGF s, bone morphogenetic proteins (BMPs), and activins (Logan and Nusse, 2004; Pires-daSilva and Sommer, 2003; Kitisin et al., 2007). Other important signals include the tumornecrosis factors (TNFs), epidermal growth factor (EGF) family, neurotrophins and Notch ligands. In addition to these signals mediated by peptide ligands, retinoid acid has been con-sidered as a morphogenic signal (Gilbert, 2003).
Cells that are competent to receive the signals must express receptors for each signaling pro-tein (ligand) family (Fig. 1). Binding of a ligand to its receptor or receptor complex leads to mediation of the signal into the cell which through protein interactions activates certain tran-scription factors thus regulating gene expression (Gilbert, 2003) (Pires-daSilva and Sommer,2003). The response of a cell to a signal depends on its competence and may be cell division, apoptosis, change of commitment (cell fate), differentiation or production of a reciprocal sig-nal, often of a different signal family, or an extracellular or intracellular antagonist of signal-ing. Different signals may act synergistically or antagonistically and they may be attenuated by signaling antagonists (Hogan, 1999; Wang and Thesleff, 2005). The signaling, the signal transduction, activation of specific transcription factors, and subsequent responses are con-served during the development of different organ systems and through evolution and can be regarded to constitute modules of genetic networks which are used in variable manners and in different combinations during different stages of organogenesis in different species (Gilbert, 2003; Pires-daSilva and Sommer, 2003).
Teeth and dentitions
Vertebrate teeth may be used as weapons in fighting and self-defence, but they also provide the vertebrates the first tool for feeding, making it possible to trap and swallow prey and, es-pecially in the case of mammals, to render food more suitable for digestion in the gastro-intestinal tract (Brown, 1983; Kardong, 1995). The teeth consist of a crown (protruding to the mouth) and root (embedded or attached to the bone). The crown is composed of an ex-ternal mineralized enamel (or enameloid) layer, the hardest mineralized tissue, and an inner mineralized dentin which surrounds the pulpal cavity filled by living cells capable of dentin regeneration and sensory function. In the roots of the mammalian teeth, the dentin and pulp are surrounded by a mineralized cementum and a periodontal ligament that attaches the teeth to the surrounding bone.
The whole dentition is composed of units of separate teeth of serial homology, i.e. having a common evolutionary origin, and has been regarded as an example of merism (Butler, 1995; Weiss et al., 1998). Teeth in various vertebrates may reside on the surfaces of mouth or phar-ynx, but during the evolution they became restricted to a horseshoe-shaped dental arch liningthe oral cavity (Osborn, 1973; Brown, 1983). The fish and reptile teeth may be replaced sev-eral, even hundreds of times during the lifespan of the animal (polyphyodont), but mammals
13
may replace some of them only once (diphyodont dentition). The teeth in different parts of the mouth may have specialized forms in lower vertebrates, but the specialization to true heterodonty with distinct tooth classes, as seen in modern mammalian species, started only during the reptilian evolution (Brown, 1983). The heterodonty of mammals íncludes mor-phologically and developmentally distinct tooth classes or types: the anterior incisors, ca-nines and usually multicusped postcanine teeth, premolars and molars (Butler, 1978). In the ancestral mammalian dentition, three primary incisors, one primary canine and four primarypostcanine teeth (premolars) developed in each jaw quadrant (Fig. 2). These could be re-placed (in this case also called deciduous) with successional (secondary) teeth developingfrom the dental lamina lingual to the predecessor (Butler, 1978; Brown, 1983; Luckett, 1993). In addition, three or more molars may develop posterior to these teeth and have no deciduous predecessors. Together with the unreplaced and secondary teeth they constitutethe permanent dentition. Luckett (1993) and Butler (1978) considered the molars (e.g. hu-man permanent molars) as primary teeth. Teeth may be regarded as primary or secondary according to whether they develop from the surface epithelium or the dental lamina (Luckett, 1993). Most mammalian species, though, have reduced dentitions as they have lost some orseveral of the ancestral teeth. Thus, mouse and other muroid rodents develop in each quad-rant only one incisor and three molars, which are not replaced, the molars presumably being homologous to the posterior-most postcanine teeth (molars) of other species (Cohn, 1957)(Fig. 2). In human dentition, two primary incisors, a primary canine and two primary post-canine teeth (called primary or deciduous molars) are replaced with two permanent incisors, a permanent canine and two permanent premolars, and in addition three permanent molarsdevelop without deciduous predecessors (Ten Cate, 1994). Thus, during evolution, Homosapiens has lost one of the incisors and two anteriormost premolars.
Development of teeth
The mammalian teeth develop from the oral epithelium and the underlying mesenchyme.Their development resembles that of the other ectodermal organs such as hair or the sweat and mammary glands (Pispa and Thesleff, 2003). Tooth development has been studied ex-perimentally in many vertebrate species such as dogs and amphibians (reviewed by Lewin, 1997; reviewed by Lumsden, 1988) but most of the recent knowledge relevant for under-standing of the development of human dentition has been obtained from studies in rodents, especially in the mouse.
Tooth development has been divided to distinct phases of initiation, morphogenesis, differ-entiation and eruption. During each phase, different stages can be distinguished (Fig. 3).
The enamel-producing ameloblasts and Hertwig’s epithelial root sheath originate in the epi-thelium. The mesenchyme contributes to the dentin-forming odontoblasts, dental pulp, ce-mentum and surrounding alveolar bone and originates in the cranial neural crest (for this rea-son also called ectomesenchyme) (Lumsden, 1988). These cells migrate from the midbrainand the hindbrain and populate the branchial arches and facial region before the tooth devel-opment commences, in the mouse during embryonic days (E) 8-10 (Nichols, 1986; Imai et al., 1996; Chai et al., 2000)
14
Figure 2. Comparison of dentitions. One quadrant from the upper jaw is shown. Uppermost, an-cestral mammalian dentition. Middle, human dentition. Bottom, mouse dentition. Most commondesignations of teeth are shown below the teeth. For human teeth, numbers according to the FDInumbering system are shown inside the tooth crowns. Combinations of codes for different quad-rants and numbers shown in figure are commonly used, e.g. 15 denotes maxillary tooth 5 on theright, the second premolar (11 to 18, upper right; 21 to 28, upper left; 31 to 38, lower left; 41 to48, lower right; 51 to 55, 61 to 65, 71 to 75, 81 to 85 primary teeth in the same order). In mouse,the incisor is continuously growing and there is a toothless diastema between the incisor and thefirst molar. Assumed evolutionary homologies are delineated by dotted lines. Please note, thathuman premolars and their predecessors (deciduous molars) correspond to premolars 3 and 4 ofthe ancestral mammalian dental formula. In human dentition the first postcanine tooth to initiate development (“key” or “stem” tooth) is the first deciduous molar dM1, corresponding to dP3 ofthe ancestral formula). dP1 of the ancestral formula is colored grey to indicate that a primary tooth in this position may not be replaced. For incisors, it is assumed that mouse incisor corre-sponds to the I2 of the ancestral formula. For references, see Butler (1978) and Luckett (1993).
15
The dental arches are formed along with the development of the oral cavity from the medialnasal processes and maxillary and mandibular processes of the first branchial arch. In hu-§mans, the medial nasal and maxillary processes fuse on the sixth to seventh weeks of de-velopment (Sadler, 1990) but the first signs of the future tooth positions, the thickening of the epithelium to form the dental lamina may be seen even before that (Tonge, 1969). In mouse, the dental lamina can be observed as a thickened epithelium on E12, but the specific gene expression can be identified even earlier (Mina and Kollar, 1987; Cohn, 1957; Mina and Kollar, 1987; Mucchielli et al., 1997).
Analogous to the development of the other ectodermal organs, the development of individual teeth is initiated when the epithelial placodes form in the dental lamina (Pispa and Thesleff, 2003; Mikkola and Millar, 2006). In mouse, the first placodes appear in the molar and inci-sor regions on E11.5-12. In humans, the placodes for the primary teeth have been observed on the seventh week of gestation (Tonge, 1969).
The placode formation is accompanied with the commencement of the condensation of the underlying mesenchymal cells (Cohn, 1957). Subsequently the epithelium grows into the mesenchyme forming an epithelial bud consisting of outermost basal epithelial layer and in-ner stellate reticulum and surrounded by condensating mesenchyme (“bud stage”). In the tip of the bud the so-called enamel knot of non-dividing cells forms while the epithelium around it continues the growth forming the so-called cervical loops (“cap stage”) (Jernvall et al.,1994). In the mouse molars (and presumably in all multicusped teeth) additional, secondaryenamel knots develop in the epithelium to mark the sites of additional cusps (“bell stage”) (Jernvall et al., 2000). The condensed mesenchyme delimited by the cervical loops forms thedental papilla whereas the outermost mesenchyme surrounding the papilla and the cervicalloops forms the dental follicle. The basal epithelium becomes divided into the inner (facing the papilla) and the outer enamel epithelium (facing the dental follicle) while the stratum in-termedium forms between the inner enamel epithelium and the loose epithelium of the stel-late reticulum.
16
Figure 3. Summary of tooth development and most essential known molecular regulation. Signalsemanating from the epithelium are shown above and signals from the mesenchyme below the scheme.Stages when development is arrested in mouse null mutants are indicated (adapted from Thesleff,2006).
Coupled to the process of morphogenesis, the differentiation of the hard tissue forming cells starts at the tips of future cusps and extends to the cervical direction (Cohn, 1957; Ten Cate, 1994). The mesenchymal cells facing the basement membrane elongate, polarize and termi-nally differentiate into odontoblasts starting to produce predentin matrix. The basementmembrane is digested and the epithelial cells differentiate into ameloblasts that also elon-gate, polarize and start secreting enamel matrix. While the predentin layer thickens the odon-toblasts withdraw, leaving behing processes called dentinal tubules, and trigger mineraliza-tion of the predentin to form dentin. In the maturation of the enamel, the organic matrix is processed by digestion and simultaneous mineralization. The differentiation of the hard tis-sue producing cells marks also the fixation of the final form of the tooth crown, except for the contribution by the increasing thickness of the enamel layer.
The morphogenesis of teeth is accompanied by alveolar osteogenesis in the surroundingmesenchyme and the dental follicle and followed by innervation and vascularization of the dental pulp (Cohn, 1957; Gaunt, 1964; Ten Cate, 1994; Luukko, 1997). Because of the for-mation of the alveolar bone, teeth become enclosed in bony crypts delineated by the dental follicle cells. Therefore, the eruption of teeth requires resorption of the alveolar bone.
In teeth that develop roots, as all human teeth and mouse molars, the differentiation to theameloblasts ceases when the differentiation front reaches the future cemento-enamel junc-tion. The epithelium now forms a bilayer structure called Hertwig’s epithelial rooth sheath (HERS) which continues its growth into the underlying mesenchyme (Ten Cate, 1994; Thesleff and Nieminen, 2005). The epithelial bilayer that is left behind becomes fragmentedand forms the so-called epithelial cell rests of Malassez (ERS). Along with the growth of HERS, the differentiation of the dental papilla mesenchymal cells continues, leading to the deposition and mineralization of the root dentin. Cells from the dental follicle differentiateinto cementoblasts that deposit cementum on the surface of the root dentin. Dental folliclecells also form the fibrous periodontal ligament that connects the root to the bone and con-
17
tribute to the alveolar bone itself. In the multicusped teeth, the developing root may get bi-furcated leading to the development of several separate root apices.
In different animal species, various modifications of the general process outlined above mayexist. In mouse and other rodents, the incisors grow continuously and only cells on the labial aspect differentiate into ameloblasts (Tummers and Thesleff, 2003). For the continuous growth of these teeth, new ameloblasts must differentiate continuously in the labial cervical loop during the whole life span of the animal, i.e. the epithelium of the cervical loop is never switched from the ameloblast forming fate to the root fate. In other rodents, such as siblingvoles and rabbits, also the molars may grow continuously (Tummers and Thesleff, 2003).
In humans and many other mammals, the secondary teeth develop from the lingual exten-sions of the dental lamina that are connected to the enamel organ of the primary tooth (Luckett, 1993; Ten Cate, 1994). According to Luckett (1993), the development of the sec-ondary tooth usually becomes detectable after the primary predecessor has reached the bell stage or after the onset of the terminal differentiation of odontoblasts and ameloblasts in theprimary tooth. A similar kind of relationship may be present between the developing molars.
Initiation of teeth of different tooth classes (i.e. incisors, canines and premolars/molars) tend to follow a certain timetable and order in different species. Thus, thickenings for the central-most incisor, the canine and a premolar appear first in different parts of the dental lamina. In the incisor region the central-most incisors are initiated first, although the initiation of the other incisors may happen almost simultaneously (Luckett, 1993). For the postcanine teeth, the first teeth to be initiated are either the teeth corresponding to the third or fourth post-canine teeth of the ancestral formula, and this is followed by initiation of the more anteriorand posterior teeth (Butler, 1978; Luckett, 1993). In humans and other primates, the first postcanine tooth to be initiated is the anterior-most deciduous molar (corresponding to dP3 of the ancestral formula). The first permanent molars are initiated early, presumably before the successional permanent teeth, while the more posterior molars develop postnatally from a distal extension of the dental lamina (Ten Cate, 1994). The morphogenesis and the miner-alization of the secondary teeth is slow and it takes years before the tooth erupts into the oral cavity. The mineralization of all human deciduous teeth starts early during prenatal devel-opment, while mineralization of first permanent molars starts perinatally and that of otherpermanent teeth except third molars usually before three years of age (Pirinen and Thesleff, 1995). The deciduous teeth erupt during the first postnatal years and the permanent first mo-lars in an age of six to seven years. There is individual variation in the ages of shedding of the deciduous teeth and eruption of the secondary teeth but usually this happens between six and twelve years of age, beginning from the incisors. Second permanent molars usually erupt after 11 years of age. Mineralization of the third molars usually starts before age of 10 but both the mineralization and eruption varies remarkably between individuals.
18
Commitment, morphogenesis and inductive interactions
For understanding the regulatory mechanisms of tooth development, it is relevant to compare it to the development of other ectodermal organs, and to understand the teeth as units with serial homology (Pispa and Thesleff, 2003; Butler, 1978; Weiss et al., 1998). Tooth devel-opment shares many similarities with that of other ectodermal organs, including initiationfrom an epithelial placode, and, analogous to a mammary line, a preceding epithelial thick-ening, reciprocal interactions of the epithelial and mesenchymal component, activa-tion/inhibition mechanisms to create the separate meristic units, and, analogous to hair cy-cling, renewal (reviewed by Mikkola and Millar, 2006). As distinctive features, teeth de-velop complex and genetically stable morphologies, and contain cells that are able to pro-duce specialized mineralized hard tissues.
After comparative anatomical examination of dentitions and morphology of teeth in different species, Butler (1939) proposed the so-called field model. According to Butler’s model, de-velopment of mammalian dentitions in each jaw quadrant is dictated by the existence ofmorphogenetic fields for each tooth class, incisors, canines and molars/premolars which co-incide with a series of tooth forming locations (Butler, 1978). Different mammalian dental formulas and different morphologies could be explained by alterations of strengths and rela-tive placement of the morphogenetic field and the tooth forming locations. The concept ex-plains why morphological features usually exhibit a gradient inside a tooth class and why a morphological alteration usually affects several teeth although to a different extent. The con-cept also predicts that no separate genes are needed for each tooth but that the different toothtypes and morphologies are created by differential regulation of one set of genes (Butler,1978; see also Miles and Grigson, 1990).
As an experimental support for the existence of a dental morphogenetic field, Glasstone (1963; 1967) showed that teeth developed in tissue culture of parts of mouse mandibles froman E11 embryo, i.e. when the culture was started before tooth initiation. The experimentsalso showed that the identities and locations of the incisors and molars were already at that time determined (Glasstone, 1963; Glasstone, 1967; Miller, 1969). Glasstone (1963) also showed that individual cap stage tooth germs from various species developed teeth with normal morphology in culture, as did even teeth cut in two halves. Thus, tooth developmentfrom at least from cap stage onwards was shown to be independent of the surrounding tissue and teeth showed capacity to regulation, which are the key features of the morphogeneticfield concept (see Gilbert, 2003). The commitment of dental cells for tooth development hasalso been shown by development of tooth-like structures after reaggregation of dissociated cells from tooth germs (e.g. Slavkin et al., 1968; Duailibi et al., 2004).
Knowledge from the development of other ectodermal appendages (reviewed by Hardy, 1992; Pispa and Thesleff, 2003; Gilbert, 2003), as well as from tissue implantation studies in amphibians (reviewed by Lumsden, 1988; MacKenzie et al., 1992), suggested that neural crest-derived mesenchyme contained the instructive potential for tooth development. In sup-port for the instructive role of the dental mesenchyme in tooth development, cultures of re-combined tissues showed that mouse E13 or older mandibular mesenchyme recombined with limb bud epithelium was able to instruct tooth development and that incisor or molar mesen-
19
chyme recombined with enamel organs instructed the development of a tooth type according to their source (Kollar and Baird, 1969; Kollar and Baird, 1970).
Lumsden (1979) cultured mouse first molar germs in the anterior chamber of the mouse eye and showed that E12 or older germs were able to give rise also to the second and third mo-lars. He concluded that the results supported an intrinsic control of development and there-fore a morphogenetic gradient field was not necessary. Accordingly, Osborn (1978) pre-sented a new model explaining the development of different dentitions, which, according to him, could better explain the diverse morphological aspects in different species (see criticismby Butler, 1978; see also Miles and Grigson, 1990). The “clone model” suggested the pres-ence of specific determined cells, presumably in the mesenchyme of the neural crest origin, that contained the information for the development of the different tooth classes. These cells were able to form and instruct the development of teeth by clonal expansion regulated by inherent inhibition mechanisms. The limited capacity of these cells to expand would be re-sponsible for limiting the extent of tooth rows, and the gradual diminishing of the capacity would be reflected as progressively simplified morphology of the later developing teeth.
The role of the mesenchyme as the instructive tissue was challenged by Miller (1969) who showed that the E11 to E12 mouse incisor or molar dental epithelium was able to instruct the tooth type in the recombination tissue culture on the chick chorioallantoic membrane. Mina and Kollar (1987) recombined the first and second branchial arch epithelia and mesenchymefrom mouse embryos and cultured them in the anterior eye chamber. They showed that thefirst arch epithelium instructed the tooth development with the second branchial arch ec-tomesenchyme until E11.5, but not thereafter, whereas the first arch mesenchyme instructedtooth development with the second arch epithelium in E12,5 or older embryos. Thus, the in-structive potential was present in the oral epithelium until first signs of tooth development,but shifted to the dental mesenchyme at the time when the dental placodes are formed. Con-temporarily, Lumsden (1988) showed that the cultured mouse E9 or E10 mandibular epithe-lia together with cranial neural crest cells allowed tooth development, confirming the induc-ing role of the early epithelium and the odontogenic capacity of mouse neural crest cells. Furthermore, his results showed that the odontogenic capacity was largely limited to the cra-nial neural crest, and that any instructive interactions during the neural crest cell migrationwere not necessary. The capacity of the early epithelium to instruct tooth type specificationhas also been shown (Kollar and Mina, 1991). More recently, the instructive role of early mandibular epithelium has also been shown in cell reconstitution experiments with bone marrow cells (Ohazama et al., 2004; Li et al., 2007). The instructive potential of the mousedental tissues have also been shown by recombination experiments with chick tissues in which variable stages of morphogenesis and differentiation have been observed (Mitsiadis et al., 2003 and references therein).
Tissue interactions are crucial also during later stages for differentiation of hard tissue form-ing cells and for the development of the alveolar bone (reviewed by Thesleff and Nieminen,2005). Recently, stem cell properties have been described for ameloblast, odontoblast andperiodontal ligament forming cells (Harada et al., 1999; Gronthos et al., 2002; Sonoyama et al., 2006; Wang et al., 2007).
20
gtto
oth
phen
otyp
ein
-he
r.tra
it, s
yndr
ome
(OM
IM n
o)m
ol.
pat.
toot
h ph
enot
ype
cellu
lar/d
evel
opm
enta
lco
nseq
uenc
ere
fere
nces
Act
A -/
-pa
rtial
age
nesi
s, a
rres
t at
bud
sta
gefa
ilure
of m
es. s
igna
ling
to
epith
eliu
mM
atzu
k et
al.,
199
5
Act
RIIA
-/-
man
d. in
ciso
r ag
enes
is in
22
%
failu
re o
f mes
. sig
nalin
g to
ep
ithel
ium
Mat
zuk
et a
l., 1
995
Act
RIIA
;A
ctR
IIB +
/-; -/-m
olar
and
man
d. in
c ag
enes
is in
29
%
failu
re o
f mes
. sig
nalin
g to
ep
ithel
ium
Ferg
uson
et a
l., 2
000
AP
Cad
aden
omat
ous
poly
posi
s co
li, G
ardn
er s
yndr
ome
no fu
nc-
tion?
*)su
pern
um. t
eeth
, od
onto
mas
dere
gula
tion
of W
nt s
igna
l tra
nsdu
ctio
nId
a et
al.,
198
1; W
olf
et a
l., 1
986
AX
IN2
adse
vere
age
nesi
s,
colo
rect
al c
ance
rha
plo-
insu
ff.se
vere
age
nesi
sde
regu
latio
n of
Wnt
sig
nal
trans
duct
ion
Lam
mi e
t al.,
200
4
Bm
pr1a
-/-
epit.
arre
st a
t ear
ly b
ud
stag
eim
paire
d B
MP
sig
nalin
g in
ep
it., E
K fa
ilure
?A
ndl e
t al.,
200
4
BC
OR
Xd
Ocu
lofa
cioc
ardi
oden
tal
synd
rom
e (3
0016
6)no
func
-tio
n**)
mal
e le
thal
, age
nesi
s,
fuse
d te
eth
in fe
mal
esab
norm
al tr
ansc
riptio
nal
regu
latio
n?N
g et
al.,
200
4
BC
OR
Xr
Lenz
mic
ropt
halm
ia
(309
800)
hypo
dont
ia (i
ncis
ors)
abno
rmal
tran
scrip
tiona
l re
gula
tion?
Ng
et a
l., 2
004
CO
L1A
1/2
adO
steo
gene
sis
im-
perfe
cta,
type
I (1
6620
0)ha
plo-
insu
ff.hy
podo
ntia
abno
rmal
ext
race
llula
r m
atrix
Luki
nmaa
et a
l., 1
987
Dkk
1o.
e.ep
it.ar
rest
bef
ore
or a
t pl
acod
e st
age
decr
ease
d W
nt s
igna
ling
in
early
epi
t., p
laco
de fa
ilure
?A
ndl e
t al.,
200
2
Dlx
1;D
lx2
-/-; -/-
arre
st b
efor
e or
at
plac
ode
stag
efa
ilure
of m
es. c
ompe
tenc
e or
sig
nalin
gTh
omas
et a
l., 1
997
DTD
ST
arD
iast
roph
ic d
yspl
asia
(2
2260
0)no
func
-tio
nhy
podo
ntia
in 3
1 %
, hy
popl
asia
impa
ired
prot
eogl
ycan
sy
nthe
sis
Kar
lste
dt e
t al.,
199
6
Ect
odin
-/-
supe
rnum
. mes
ial
mol
ar, i
ncre
ased
cus
p di
stan
ce
dere
gula
ted
BM
P a
nd W
nt
sign
alin
gK
assa
i et a
l., 2
005
EV
C -/
-ag
enes
is o
r fus
ion
of
max
. inc
, hyp
opla
sia
arE
llis-
Van
Cre
veld
sy
ndro
me
(225
500)
no fu
nc-
tion
agen
esis
(inc
), co
nica
l te
eth,
AI,
taur
odon
tism
abno
rmal
Shh
/Ihh
sign
alin
gR
uiz-
Per
ez e
t al.,
20
00; R
uiz-
Per
ez e
t al
., 20
07
Tabl
e 1.
Mou
se m
utan
ts a
nd h
uman
dis
ease
s w
ith to
oth
agen
esis
or s
uper
num
erar
y to
oth
form
atio
n
mou
sehu
man
gene
gtto
oth
phen
otyp
ein
-he
r.tra
it, s
yndr
ome
(OM
IM n
o)m
ol.
pat.
toot
h ph
enot
ype
cellu
lar/d
evel
opm
enta
lco
nseq
uenc
ere
fere
nces
mou
sehu
man
gene
EV
C2
arE
llis-
Van
Cre
veld
sy
ndro
me
(225
500)
no fu
nc-
tion
agen
esis
(inc
), co
nica
l te
eth,
AI,
taur
odon
tism
Rui
z-P
erez
et a
l., 2
003
Eda
/ED
AY
/-pa
rtial
age
nesi
s,
redu
ced
size
and
m
orph
olog
yX
rA
nhid
rotic
ect
oder
mal
dy
spla
sia,
X-li
nked
(3
0510
0)
no fu
nc-
tion*
*)se
vere
age
nesi
s,
cone
/peg
sha
pere
duce
d ep
ithel
ial a
nd E
K
sign
alin
gK
ere
et a
l., 1
996;
S
rivas
tava
et a
l., 1
997
ED
AX
rse
vere
age
nesi
shy
po-
mor
phs
?
seve
re a
gene
sis,
ge
nera
l or i
nc o
nly
redu
ced
epith
elia
l and
EK
si
gnal
ing
Tao
et a
l., 2
006;
Ta
rpey
et a
l., 2
007
Eda
o.e.
epit.
supe
rnum
. mes
ial
man
d. m
olar
, im
paire
d am
elob
. diff
eren
tiatio
n
over
activ
atio
n of
Eda
si
gnal
ing
in e
pith
eliu
m
Mus
tone
n et
al.,
200
3;
Mus
tone
n et
al.,
200
4;
Kan
gas
et a
l., 2
04
Eda
r/E
DA
R
-/-
or +/dn
parti
al a
gene
sis,
re
duce
d si
ze a
nd
mor
phol
ogy
ad,
arA
nhid
rotic
ect
oder
mal
dy
spla
sia
(129
490)
dn o
r no
func
tion
seve
re a
gene
sis,
co
ne/p
eg s
hape
redu
ced
epith
elia
l and
EK
si
gnal
ing
Hea
don
and
Ove
rbee
k,
1999
; Mon
real
et a
l.,
1999
Eda
radd
/E
DA
RA
DD
-/-
parti
al a
gene
sis,
re
duce
d si
ze a
nd
mor
phol
ogy
arA
nhid
rotic
ect
oder
mal
dy
spla
sia
(224
900)
nofu
nctio
nse
vere
age
nesi
s,
cone
/peg
sha
pere
duce
d ep
ithel
ial a
nd E
K
sign
alin
gH
eado
n et
al.,
200
1
Fgf8
-/-
epit.
mol
ar a
gene
sis,
ve
stig
ial i
ncis
ors
failu
re o
f epi
t. si
gnal
ing
to
mes
ench
yme
Trum
pp e
t al.,
199
9
FGFR
1ad
Kal
lman
n sy
ndro
me,
au
toso
mal
(147
950)
hapl
o-in
suff.
agen
esis
of m
ax.
late
ral i
ncis
ors
decr
ease
d FG
F si
gnal
tra
nsdu
ctio
nD
ode
et a
l., 2
003
Fgfr2
IIIb
/FG
FR2
-/-, dn
arre
st a
t bud
sta
gead
Ape
rt sy
ndro
me
(101
200)
gain
of
func
tion
supe
rnum
., hy
podo
ntia
in
41
%, c
row
ding
, de
laye
d er
uptio
n
failu
re o
f epi
thel
ial a
nd E
K
FGF
sign
al tr
ansd
uctio
n
Cel
li et
al.,
199
8; d
e M
oerlo
oze
et a
l., 2
000;
Le
tra e
t al.,
200
7
Fst
-/-
redu
ced
man
d.
inci
sors
, sha
llow
cu
sps
in m
olar
s
failu
re o
f reg
ulat
ion
of T
GF
sign
alin
gM
atzu
k et
al.,
199
5;
Wan
g et
al.,
200
4a
gtto
oth
phen
otyp
ein
-he
r.tra
it, s
yndr
ome
(OM
IM n
o)m
ol.
pat.
toot
h ph
enot
ype
cellu
lar/d
evel
opm
enta
lco
nseq
uenc
ere
fere
nces
mou
sehu
man
gene
Fst
o.e.
epit.
agen
esis
of 3
rd
mol
ars,
abe
rran
t cus
p pa
ttern
, fai
lure
of
amel
obla
stdi
ffere
ntia
tion
decr
ease
d TG
F s
igna
ling
in e
pith
eliu
mW
ang
et a
l., 2
004a
GJA
1ad
Ocu
lode
ntod
igita
lsy
ndro
me
(164
200)
dom
.ne
g.sm
all t
eeth
, AI?
abno
rmal
gap
junc
tions
Paz
neka
s et
al.,
200
3
Gas
1 -/
-fu
sed
max
. inc
isor
sab
norm
al S
hh s
igna
ling
Sep
pälä
et a
l, 20
07
Gli2
-/-
fuse
d m
ax. i
ncis
ors
failu
re o
f Shh
sig
nal
trans
duct
ion
Har
dcas
tle e
t al.,
199
8
Gli2
;Gli3
-/-;-
/ -ar
rest
bef
ore
or a
t pl
acod
e st
age
failu
re o
f Shh
sig
nal
trans
duct
ion
and
mes
. co
mpe
tenc
e or
sig
nalin
gH
ardc
astle
et a
l., 1
998
IB
dnse
vere
ly fl
atte
ned
cusp
s, 3
rd m
olar
a g
enes
isad
ED
A-ID
(300
291)
dom
.ne
g.ag
enes
is, c
onic
al te
eth
redu
ced
epith
elia
l and
EK
si
gnal
ing
Cou
rtois
et a
l., 2
003
Ikk
-/-
flatte
ned
cusp
s,
inci
sor e
pit.
eva g
inat
es
redu
ced
epith
elia
l and
EK
si
gnal
ing
Oha
zam
a et
al.,
200
4
Ikk
/ IK
KY
/-, +/-
mal
e le
thal
, fe
mal
es
as IP
with
im
mun
odef
icie
ncy
Xd
Inco
ntin
entia
pig
men
ti (3
0830
0)no
func
-tio
n**)
mal
e le
thal
, age
nesi
s,
coni
cal t
eeth
in
fem
ales
redu
ced
epith
elia
l and
EK
si
gnal
ing
Mak
ris e
t al.,
200
0;
Rud
olph
et a
l., 2
000;
S
mah
i et a
l., 2
000
Ikk
/ IK
KX
rO
L-E
DA
-ID (3
0029
1,
3003
01)
hypo
-m
orph
mal
e le
thal
, age
nesi
s,
coni
cal t
eeth
in
fem
ales
redu
ced
epith
elia
l and
EK
si
gnal
ing
Zona
na e
t al.,
2000
; Du -
puis
-Giro
d et
al.,
2002
IRF6
adV
an d
er W
oude
sy
ndro
me
(119
300)
hapl
o-in
suff.
agen
esis
in 2
0 %
(2nd
pr
emol
ars)
epith
elia
l com
pete
nce
and
sign
alin
g?K
ondo
et a
l., 2
002
Lef1
-/-
arre
st a
t lat
e bu
d st
age
failu
re o
f ena
mel
kno
t si
gnal
ing
(FG
F4)
van
Gen
dere
n et
al.,
19
94; K
rato
chw
il et
al.,
20
02
Msx
1/M
SX
1 -/
-ar
rest
at b
ud s
tage
adse
vere
age
nesi
sha
plo-
insu
ff.se
vere
age
nesi
s (2
nd
prem
olar
s, 3
rd m
olar
s)
failu
re o
f mes
. sig
nalin
g (B
MP
4, F
GF3
; EK
failu
re) o
r co
nden
satio
n
Sat
okat
a, M
aas
1994
; V
asta
rdis
et a
l., 1
996
gtto
oth
phen
otyp
ein
-he
r.tra
it, s
yndr
ome
(OM
IM n
o)m
ol.
pat.
toot
h ph
enot
ype
cellu
lar/d
evel
opm
enta
lco
nseq
uenc
ere
fere
nces
mou
sehu
man
gene
Msx
1;M
sx2
-/-;-
/-ar
rest
bef
ore
or a
t pl
acod
e st
age
failu
re o
f mes
. sig
nalin
g (B
MP
, FG
F?)
Sat
okat
a, M
aas
2000
OFD
1X
dO
ro-fa
cial
-dig
ital s
yn-
drom
e ty
pe 1
(311
200)
no fu
nc-
tion*
*)
mal
e le
thal
, age
nesi
s (in
c, c
an),
hypo
plas
ia
in fe
mal
es
cilia
form
atio
n? p
atte
rnin
g of
neu
ral t
ube?
Ferr
ante
et a
l.,20
01;
Thau
vin-
Rob
inet
et
al.,2
006
p63/
P63
-/-
arre
st b
efor
e pl
acod
e st
age
ad
EE
C (6
0429
2), H
ay-
Wel
ls (A
EC
, 106
220)
, LM
S (6
0354
3), A
DU
LT
(103
285)
syn
drom
es
dive
rse
agen
esis
, con
ical
teet
hfa
ilure
of e
pith
elia
l di
ffere
ntia
tion
and
sign
alin
g
Mill
s et
al.,
199
9; Y
ang
et a
l., 1
999;
Cel
li et
al
., 19
99; v
an
Bok
hove
n, M
cKeo
n,
2002
Pax
6 -/
-su
pern
um. m
ax.
inci
sors
abno
rmal
ect
oder
mal
sp
ecifi
catio
n?K
auffm
an e
t al.,
199
5
Pax
9/P
AX
9 -/
-ar
rest
at b
ud s
tage
adS
ever
e to
oth
agen
esis
hapl
o-in
suff.
seve
re a
gene
sis
(esp
ecia
lly m
olar
s)
failu
re o
f mes
. sig
nalin
g,
com
pete
nce,
con
dens
atio
n,
EK
failu
re
Pet
ers
et a
l., 1
998;
S
tock
ton
et a
l., 2
000
Pitx
2/P
ITX
2 -/
-ar
rest
bef
ore
or a
t pl
acod
e st
age
adR
iege
r syn
drom
e (1
8050
0)ha
plo-
insu
ff.
agen
esis
of m
ax. i
nc,
som
etim
es m
and.
inc
and
prem
olar
s
failu
re o
f epi
thel
ial
com
pete
nce
or s
igna
ling
Sem
ina
et a
l.,19
96;
Lin
et a
l.,19
99; L
u et
al
.,199
9
Pol
aris
hmsu
pern
um. m
esia
l m
olar
abno
rmal
Shh
sig
nalin
gZh
ang
et a
l., 2
003
PV
RL1
arC
LPE
D1
(225
060)
no fu
nc-
tion
seve
re a
gene
sis,
hy
popl
asia
impa
ired
cell
adhe
sion
Suz
uki e
t al.,
200
0;
Söz
en e
t al.,
200
1
Run
x2/
RU
NX
2 -/
-ar
rest
at l
ate
bud
stag
ead
Cle
idoc
rani
al d
yspl
asia
(1
1960
0)ha
plo-
insu
ff.su
pern
umer
ary
teet
hfa
ilure
of m
es. c
ompe
tenc
e or
sig
nalin
g (F
GF3
), E
K
failu
re
Jens
en, K
reib
org,
19
90; M
undl
os e
t al.,
19
97; Å
berg
et a
l.,
2004
Shh
/ SH
H -/
- ep
it.hy
popl
astic
, ret
arde
d an
d fu
sed
teet
had
Hol
opro
senc
epha
ly(1
4294
5)hy
po-
mor
phfu
sed
cent
ral i
ncis
ors
impa
ired
sign
alin
g an
d gr
owth
; mid
line
defe
ct
Das
sule
, McM
ahon
20
00; N
anni
et a
l.,
1999
Sm
ad2
+/-
inci
sor,
man
d. m
olar
ag
enes
is in
27
%
failu
re o
f sig
nal t
rans
duct
ion
(act
ivin
)Fe
rgus
on e
t al.,
200
1
gtto
oth
phen
otyp
ein
-he
r.tra
it, s
yndr
ome
(OM
IM n
o)m
ol.
pat.
toot
h ph
enot
ype
cellu
lar/d
evel
opm
enta
lco
nseq
uenc
ere
fere
nces
mou
sehu
man
gene
Sm
o -/
- ep
it.
mol
ars
fuse
d an
d re
duce
d, a
bnor
mal
am
elob
last
s
failu
re o
f Shh
sig
nal
trans
duct
ion,
cel
l pr
olife
ratio
n/di
ffere
ntia
tion
Grit
li-Li
nde
et a
l., 2
002
Spr
outy
2 -/
-su
pern
um. m
and.
m
esia
l mol
arov
erac
tivat
ion
of F
GF
sign
al
trans
duct
ion
Kle
in e
t al.,
200
6
Spr
outy
4 -/
-su
pern
um. m
and.
m
esia
l mol
arov
erac
tivat
ion
of F
GF
sign
al
trans
duct
ion
Kle
in e
t al.,
200
6
TBX
3ad
Uln
ar-m
amm
ary
synd
rom
e (1
8145
0)ha
plo-
insu
ff.ag
enes
is, h
ypop
lasi
a (c
anin
es)
failu
re o
f epi
thel
ial s
igna
ling
Bam
shad
et a
l., 1
997
TFA
P2B
adC
har s
yndr
ome
(169
100)
dom
.ne
g.ag
enes
is o
f pre
mol
ars
and
perm
anen
t mol
ars
decr
ease
d tra
nscr
iptio
nal
activ
atio
n, n
c sp
ecifi
catio
n?S
atod
a et
al.,
200
0
Traf
6 -/
-fa
ilure
of e
rupt
ion,
sh
orte
ned
inci
sors
, m
olar
cus
ps re
duce
d
redu
ced
epith
elia
l and
EK
si
gnal
ing
Nai
to e
t al.,
200
2;
Oha
zam
a et
al.,
200
4
Trea
cle
adTr
each
er-C
ollin
ssy
ndro
me
(154
500)
hapl
o-in
suff.
agen
esis
in 3
3 %
, hy
popl
asia
, AI
failu
re o
f nuc
lear
traf
ficki
ng?
da S
ilva
Dal
ben
et a
l.,
2006
WN
T10A
arO
dont
o-on
ycho
-der
mal
dysp
lasi
a (2
5798
0)no
func
-tio
nse
vere
age
nesi
s,
cone
/peg
sha
pefa
ilure
of p
laco
de a
nd
enam
el k
not s
igna
ling?
Ada
imy
et a
l., 2
007
*) n
o fu
nctio
n: b
oth
alle
les
nonf
unct
iona
l; in
cas
e of
AP
C, t
his
has
been
sho
wn
for c
olor
ecta
l neo
plas
ms
**) c
ompl
ete
loss
of f
unct
ion
in m
ales
, and
in fe
mal
es, i
nact
ivat
ion
in ~
50 %
of c
ells
(or s
kew
ed)
Abb
revi
atio
ns: a
d, a
utos
omal
dom
inan
t; ar
, aut
osom
al re
cess
ive;
can
, can
ine;
dn
or d
om. n
eg. (
or re
pres
sor f
orm
), do
min
ant n
egat
ive;
EK
, ena
mel
kno
t; ep
it., e
pith
eliu
m; h
aplo
insu
ff., h
aplo
insu
ffici
ency
; hm
, hyp
omor
ph; i
nc, i
ncis
or; i
nher
., in
herit
ance
; man
b., m
andi
bula
r; m
es. m
esen
chym
e; m
ax. m
axill
ary;
m
ol. p
at.,
mol
ecul
ar p
atho
gene
sis;
o.e
., ov
erex
pres
sion
; sup
ernu
m.,
supe
rnum
erar
y; X
d, X
-link
ed d
omin
ant;
Xr,
X-li
nked
rece
ssiv
e
Molecular regulation of tooth development
During the last two decades after the advent of molecular biology and genetics, the new tech-nologies have been extensively used to elucidate developmental mechanisms and the genetic regulation of tooth development. The most usual model has been the mandibular molar teethof the mouse, the most practical laboratory animal that develops teeth. Immunohistology and in situ hybridization have been used to study gene expression during mouse tooth develop-ment and differentiation. Natural and transgenic mutant mice have been utilized to revealgene function. Tissue culture of whole tooth or jaw explants as well as culture of recombinedtissues has been used to study effects of proteins and mutations. This knowledge is applica-ble to humans and other mammals because of the conservation of the basic genetic and de-velopmental mechanisms. However, the molecular genetic studies in humans, including the positional cloning of several genes that cause different developmental dental anomalies, have significantly contributed to understanding of the genetic regulation of development and pat-terning of the human dentition (Table 1).
Reciprocal signaling and signaling centers
Molecular studies have revealed that the instructive and permissive tissue interactions duringmouse tooth development described above are mainly mediated by growth factor signaling (reviewed by Thesleff and Mikkola, 2002; Wang and Thesleff, 2005). Development from initiation to eruption is governed by a sequential and reciprocal signaling process rather than simple one-way messages (Fig. 3). The signaling involves all major signaling pathways, in-cluding TGF , FGF, Shh and Wnt as well as Eda, Notch, and EGF signaling, and studies with mouse mutants have shown that they are needed simultaneously during critical stages of development (Table 1). Expression of signals is often redundant: several FGFs are expressed in the initiation stage epithelium (Fgf8, -9), in the enamel knot (Fgf3, -4, -9, -20) and in the dental mesenchyme (Fgf3, -10) and they signal to receptors expressed differentially by mes-enchymal and epithelial cells (Kettunen et al., 1998; Kettunen et al., 2000; reviewed by Wang and Thesleff, 2005). Similar co-expressions are evident for BMP and Wnt signals (Åberg et al., 1997; Sarkar and Sharpe, 1999).
The signaling pathways act in an hierarchical, interactive and iterative manner. One pathwayoften elicits a reciprocal signal of another pathway or different pathways antagonize eachother to limit the extent of the cellular response. For example, Wnt signaling is needed forthe expression of Fgf4 in the enamel knots as well as Eda in the early epithelium, which sub-sequently works upstream of Shh and BMP antagonists (Kratochwil et al., 2002; Pummila et al., 2007). Antagonism of FGF and BMP signaling is thought to act to delineate the positionsof tooth initiation, to specify tooth identity and to regulate cusp morphogenesis (Neubuser et al., 1997; Tucker et al., 1998; Peters and Balling, 1999; Salazar-Ciudad and Jernvall, 2002). Induction of specific inhibitors have been shown to be important for the fine-tuning of the signaling effects and proper morphogenesis and possibly to tooth renewal (Wang et al., 2004a; Wang et al., 2004b; Kassai et al., 2005; Lammi et al., 2004). BMP4 acts as an itera-tive signal early in the determination of the tooth positions, has a critical role during morpho-
26
genesis, and finally as an inducer of the differentiation of both odontoblasts and ameloblasts(Neubuser et al., 1997; Vainio et al., 1993; Jernvall et al., 1998; Wang et al., 2004b; re-viewed by Wang and Thesleff, 2005).
During development, some parts of an organ rudiment may organize patterning and morpho-genesis by active signaling (Hogan, 1999; Gilbert, 2003). Well-characterized examples of such “organizers” or “signaling centers” from vertebrates are the dorsal blastopore lip, thenotochord, the zone of polarizing activity in the limb buds, and the isthmus between the de-veloping midbrain and hindbrain. In ectodermal organs, the epithelial placodes that initiate hair, tooth and gland development are thought to signal to the underlying mesenchyme and instruct condensation and gene expression as well as to the surrounding epithelium to pattern the positioning of neighbouring placodes (reviewed by Pispa and Thesleff, 2003; Mikkola and Millar, 2006). In teeth, the enamel knots that form in the late bud stage epithelium signal to the surrounding epithelium to activate proliferation and to the mesenchyme to induce re-ciprocal signals and inhibitors (reviewed by Thesleff et al., 2001; Wang and Thesleff, 2005). Through this activity, enamel knots mark and stimulate the formation of tooth cusps and pat-tern tooth crown morphogenesis presumably by regulating formation of additional (secon-dary) enamel knots (Jernvall et al., 2000; Salazar-Ciudad and Jernvall, 2002).
Transcription factors
Transcription factors are intracellular proteins that bind to DNA and regulate expression of the target genes. They typically contain one or more protein motifs that are able to bind tospecific sequence motifs in DNA or to interact with other proteins that are necessary for the activation of transcription. Especially the DNA-binding motifs are conserved and used to classify different factors.
Hox proteins contain a DNA-binding homeobox. The nested expression of the genes of the Hox clusters define the anterio-posterior identities in the trunk and neural tube as well as the proximo-distal and anterio-posterior axes in the limbs (Gilbert, 2003). The homeobox is pre-sent also in many transcription factors coded by genes outside the Hox clusters. These genes have important roles in the development for example in the craniofacial region where the genes of the Hox clusters are not expressed (reviewed by Jernvall and Thesleff, 2000; De-pew et al., 2005). Other DNA-binding motifs of the transcription factors taking part in cell regulation during development include e.g. helix-loop-helix, leucine zipper, paired, fork-head, T-box, LIM and runt motifs (reviewed by Dahl et al., 1997; Packham and Brook, 2003;Friedman and Kaestner, 2006; Gilbert, 2003).
Adding or removing expression of a single transcription factor may change a cell's commit-ment or capacity for differentiation. Manipulations of expression of the Hox genes may lead to changes in the identity of body parts, the so-called homeotic changes. Nested expression of the Dlx homeobox genes specifies the identities of cell populations in the developing jaws (Depew et al., 2002). Inactivation of the Runx2 gene blocks all bone differentiation (Otto et al., 1997). As described below, expression of specific transcription factors during different stages of tooth development is necessary for the competence, commitment and signaling. It
27
is apparent that expression of specific transcription factor genes are needed for the dental specification of the early epithelium and for the regulation of the instructing signaling activ-ity. On the other hand, expression of several transcription factors in the mesenchyme, regu-lated by signals from the epithelium, are needed for the activation of the odontogenic net-works in the mesenchyme. Furthermore, a central role for specific transcription factors hasbeen shown in mediation of the reciprocal signaling networks critical for the tooth morpho-genesis and cellular differentiation (reviewed by Peters and Balling, 1999; Jernvall and Thesleff, 2000; Tucker and Sharpe, 2004).
MSX1 and PAX9
MSX1 and PAX9 are transcription factors intimately involved in the genetic networks regu-lating tooth development. MSX1 contains a homeobox which binds to specific target se-quences in the DNA but is also capable to protein-protein interactions. MSX1 has often been considered rather as a repressor than activator of gene expression (Catron et al., 1995; re-viewed by Bendall and Abate-Shen, 2000). The mouse Msx1 gene codes also for an an-tisense transcript which may have a role in the regulation of Msx1 expression (Blin-Wakkachet al., 2001). Mouse Msx1 is expressed during the development and migration of the neural crest as well as during craniofacial and limb development (Tribulo et al., 2003; Monsoro-Burq et al., 2005; reviewed by Bendall and Abate-Shen, 2000). Msx1 is induced by epithelialsignals in the dental mesenchyme (Vainio et al., 1993; Kettunen et al., 1998; Tucker et al., 1998; Kettunen et al., 2005), where it is necessary for the expression of the reciprocal sig-nals, especially Bmp4 and Fgf3, as well as for expression of the Shh receptor Patched andthe transcription factors Lef1 and Runx2 (Chen et al., 1996; Zhang et al., 1999; Åberg et al., 2004). MSX1 is able to activate transcription from the Bmp4 promoter in vitro (Ogawa et al., 2006). Msx1 null mutant mice exhibit a cleft palate and other craniofacial anomalies as wellas a lack of teeth, the development of which is arrested at the bud stage (Satokata and Maas, 1994). In these mice the condensation of the ectomesenchymal cells is impaired. In double null mutants of Msx1 and its homolog Msx2 tooth development usually does not reach theplacode stage suggesting that earlier than the bud stage Msx1 function may be redundant with Msx2 (Satokata et al., 2000).
PAX9 belongs to the paired-box containing transcription factor family, and is one of the ear-liest mesenchymal markers of the future tooth forming positions in mouse (Neubuser et al., 1997). Pax9 is regulated by epithelial signals, especially FGF8, and it apparently regulates reciprocal signaling from the mesenchyme (Neubuser et al., 1997; Peters and Balling, 1999). In the Pax9 null mutant mice, expression of mesenchymal Bmp4 is impaired at the bud stage and that of Msx1 and Lef1 slightly later (Peters et al., 1998). It has been shown that PAX9 is capable to bind the MSX1 protein and synergistically with MSX1 activate Msx1 and Bmp4transcription in vitro (Ogawa et al., 2006). In mouse null mutants of Pax9, tooth develop-ment is arrested at the bud stage, the condensation of the ectomesenchymal cells is reduced, and, in addition to tooth agenesis and cleft palate, several derivatives of the pharyngeal pouches fail to develop and limb abnormalities are observed (Peters et al., 1998). In micewith hypomorphic Pax9 mutations, a partial failure of tooth development was observed, af-
28
fecting in a dose-dependent manner the third molars and incisors and to a smaller extent the other molars. The ameloblast differentiation and dentinogenesis were also affected (Kist et al., 2005).
It has been suggested that the key role of Msx1 and Pax9 is to facilitate the bud to cap stage transition (Peters and Balling, 1999; Thesleff, 2006). Mesenchymal Msx1 expression is ini-tially activated by the epithelial BMP4 signal, and needed for a reciprocal BMP4 signal fromthe mesenchyme. Bmp4 and Msx1 thus form an autoregulatory loop (Chen et al., 1996). TheBMP4 signal to the epithelium is crucial for the formation of the epithelial signaling center,the enamel knot, and the arrest of the development in Msx1 null mutant teeth can be rescued by external BMP4 or transgenically activated Bmp4 expression (Chen et al., 1996; Bei and Maas, 1998; Zhang et al., 2000). The expression of Pax9 is apparently needed to maintainand, by the synergism with Msx1, to enhance this loop. However, as shown by the mice with hypomorphic mutations, Pax9 is also needed later in tooth development (Kist et al., 2005).
Loss of function defects in MSX1 and PAX9 in humans cause partial failure of tooth devel-opment, tooth agenesis. As described in the Results and discussion, these defects are selec-tive: defects in MSX1 associate especially with agenesis of second premolars and third mo-lars, whereas the defects in PAX9 affect particularly the permanent molars. The size of thepermanent teeth may also be reduced. In one of the families with a defect in MSX1, somepatients also presented with nail dysplasia and in another family with oral clefts (Jumlongraset al., 2001; van den Boogaard et al., 2000). Several other sequence changes in MSX1 havealso been described in connection with oral clefting (Jezewski et al., 2003; Suzuki et al., 2004). In addition, a microsatellite allele in the intron of MSX1 has been associated with both tooth agenesis and oral clefting, and two promoter region SNP alleles of PAX9 with toothagenesis (Lidral et al., 1998; Suzuki et al., 2004; Vieira et al., 2004; Peres et al., 2005).
Initiation
In mammals, teeth develop on a special horseshoe-shaped area of a thickened epithelium, thedental lamina (Cohn, 1957; Tonge, 1969). The lamina spans epithelia originating in separate facial processes. The identity of these processes is instructed by specification of neural crest cells by pharyngeal endoderm during their migration (Couly et al., 1998). On the other hand, the growth and identity of these processes is also under the control of signaling from the sur-face epithelium (Lee et al., 2001; Stottmann et al., 2001; reviewed by Richman and Lee, 2003). It is also assumed that the regional specification of the processes is associated with differential expression of epithelial signals (Tucker et al., 1998; Trumpp et al., 1999; Ha-worth et al., 2004). As reflections of the specification and signaling, several transcription factors show selective or graded expression patterns during the early jaw development(reviewed by Jernvall and Thesleff, 2000; Tucker and Sharpe, 2004; Depew et al., 2005).
The dental lamina apparently defines the region for future tooth development, and subse-quently individual dental placodes are initiated at specific positions along the lamina. For hair and mammary glands, it has been assumed that the initial, perhaps permissive, signal is provided by the mesenchyme (Hardy, 1992; reviewed by Pispa and Thesleff, 2003; Mikkola
29
and Millar, 2006). As described above, initial instructive capacity for tooth development ap-pears to reside in the oral epithelium (Mina and Kollar, 1987). However, it is apparent that both epithelial and mesenchymal signaling are needed for the formation of the dental pla-codes. In several mouse mutants, formation of the placodes is impaired and it appears that inthe initiation several signaling pathways interact (reviewed by Mikkola and Millar, 2006).
It has been suggested that the position of odontogenic epithelium is originally defined by sig-naling organized by the oral-aboral boundary (Harris et al., 2006). Neubuser and colleagues (1997) suggested that tooth positions are defined by antagonistic interactions of FGFs and BMPs, perhaps under organizing control of the ectodermal-endodermal boundary. The ex-pression of Pitx2 becomes restricted to the lamina in mouse embryos at E10.5 (St Amand et al., 2000). Its expression is dependent on Fgf8 (agonist) and Bmp4 (antagonist) (St Amand etal., 2000). Pitx2 is itself needed for the restriction of the epithelial Fgf8 expression to thelamina as well as for tooth development past the placode stage (Lin et al., 1999; Lu et al., 1999). In man, defects in PITX2 cause selective tooth agenesis in the Rieger syndrome(Semina et al., 1996). In addition, it has been shown that e.g. signaling genes Shh, Bmp2 and Wnt10b become expressed early in the odontogenic epithelium, and subsequently upregu-lated in the placodes (Dassule and McMahon, 1998; reviewed by Wang and Thesleff, 2005).Interestingly, Wnt7b and Shh showed complementary expression patterns in the oral epithe-lium, and forced expression of Wnt7b antagonized expression of Shh and arrested futuretooth development, suggesting that antagonism between Wnt and Shh signaling is involved in positioning of the tooth placodes (Sarkar et al., 2000).
The epithelial transcription factor p63 is indispensable for tooth development because in the p63 null mutant mice both tooth and hair placodes fail to form (Mills et al., 1999; Yang et al., 1999). In man, mutations in P63 cause tooth agenesis associated with ectrodactyly-ectodermal dysplasia-clefting (EEC) and other allelic syndromes (Celli et al., 1999; reviewed by van Bokhoven and McKeon, 2002). The expression of mouse p63 is not limited to the tooth forming areas, and normal Fgf8 and Bmp4 expression was observed in the null mutants (Laurikkala et al., 2006). However, p63 is upstream of several signaling molecules including Bmp7, Fgfr2, -catenin and Edar, thus regulating the signaling that is involved in the initia-tion and positioning of the dental placodes (Laurikkala et al., 2006).
The formation of the epithelial dental placodes is marked by the expression of several genes, including transcription factor genes Msx2 and Lef2 and signaling genes Shh, Bmp2, Fgf8,Fgf20, Wnt10a, Wnt10b, and Edar (reviewed by Wang and Thesleff, 2005). The role of thesegenes is apparently to regulate gene expression in the placodes themselves, and signal to the surrounding epithelium and mesenchyme. Shh and FGFs also stimulate the proliferation in the epithelium, presumably promoting the growth of the tooth bud (Hardcastle et al., 1998; Cobourne et al., 2001; Kettunen et al., 1998).
In the mesenchyme, Pax9 is localized to the future tooth forming position already at the E9.5 (molars) to E10 (incisors) in mouse (Neubuser et al., 1997). As shown by inactivating Fgf8in the epithelium or using an antagonist of FGF signaling in tissue culture, early expression of Pax9 as well as several other transcription factor genes in the mesenchyme is dependenton FGF signaling from the epithelium, but becomes independent of FGFs already before the
30
formation of the dental placodes and the observed shift of the odontogenic potential to the mesenchyme (Trumpp et al., 1999; Mandler and Neubuser, 2001). In tissue culture experi-ments, it has been shown that FGFs, BMPs, Wnts and Shh, that are expressed in vivo in theepithelium and the placodes, are able to induce expression of specific transcription factorgenes in the mesenchyme. FGF8-containing beads induced Msx1, Pax9, Barx1, Dlx1, Dlx2,Lhx6, and Lhx7 (Neubuser et al., 1997; Kettunen and Thesleff, 1998; Tucker et al., 1998; Grigoriou et al., 1998), BMP4 and WNT4 induced Msx1, and Shh induced Gli1 as well as its own receptor, Patched (Vainio et al., 1993; Kettunen et al., 2005; Dassule and McMahon, 1998; Hardcastle et al., 1998). Tooth development may be arrested already prior the placode stage in the double null mutants of Msx1;Msx2, Dlx1;Dlx2 and Gli2;Gli3, which is explained by the need of these transcription factors for induction of reciprocal signals in the mesen-chyme (Satokata et al., 2000; Thomas et al., 1997; Hardcastle et al., 1998).
One of the earliest placodal markers, Edar, is originally expressed throughout the oral epi-thelium and epidermis, but becomes limited to the placodes at an early stage (Laurikkala et al., 2001). In Tabby, the mouse mutant devoid of the function of Eda, the Edar ligand, the limitation to the hair placodes does not happen (Laurikkala et al., 2002). In these mice as well as in mutants of Edar and Edaradd, a gene coding for an Eda signal transduction pro-tein, however, the placode development is not completely inhibited. On the other hand, when Eda was overexpressed in the epithelium, the hair and tooth placodes became larger, proba-bly due to an increased amount of the cells destined to become placode cells (Mustonen et al., 2004). Thus, Eda signaling probably acts rather as a modulator of ectodermal placode formation than as an initiator. Eda signaling may be important as a mediator of effects ofWnts to activate Shh and antagonize BMPs (Pummila 2007). Mutations in the EDA, EDARand EDARADD genes in humans cause X-linked and autosomal anhidrotic ectodermal dys-plasias (EDAs) characterized by sparse hair, failure of sweat gland development, tooth agen-esis and size reduction of teeth (microdontia) (reviewed by Mikkola and Thesleff, 2003).
For several reasons, Wnt signaling has been a strong candidate for an ectodermal placode initiator. Wnt reporters become activated in the hair and mammary placodes, and several Wnt ligands are expressed in the dental tissues (Sarkar and Sharpe, 1999; reviewed by Pispa and Thesleff, 2003; Wang and Thesleff, 2005; Mikkola and Millar, 2006). Necessity of Wntsignaling for placode formation was shown by epithelial expression of a Wnt antagonistDkk1 under the keratin 14 promoter which arrested tooth as well as hair development beforethe placode stage (Andl et al., 2002). On the other hand, experimental accumulation of theintracellular Wnt signaling mediator, -catenin, under the keratin 14 promoter in epithelium lead to de novo formation of hair follicles (Gat et al., 1998). Forced overexpression of Lef1in ectoderm caused extra tooth-like budding in oral epithelium (Zhou et al., 1995). Further-more, the expression of Eda was induced by Wnts in mouse tissue culture and absent in the early dental epithelium of the Lef1 null mutant mice (Laurikkala et al., 2001).
As a summary, it appears that different signaling pathways have different and partially re-dundant roles in the initiation of dental placodes. It is assumed that FGFs and Wnts as well as Eda promote placode formation, and BMPs and TGF s antagonize it, analogous to the formation of other ectodermal placodes (reviewed by Wang and Thesleff, 2005; Mikkola and Millar, 2006).
31
Morphogenesis
The most complex morphological variation in mammalian teeth involves the crown patternsof multicusped teeth. The regulatory and molecular basis of morphogenesis of multicuspedteeth as well as establishing different cusp arrangements have begun to be understood (Jernvall et al., 2000; Salazar-Ciudad and Jernvall, 2002). Even a quantitative manipulationof one or a few gene activities during molar tooth development may lead to remarkably dif-ferent cusp arrangements and crown patterns (Kangas et al., 2004; Wang et al., 2004a; Kas-sai et al., 2005).
In the late bud stage, a group of cells at the tip of the epithelial bud, the primary enamel knot, cease to proliferate and are later removed by apoptosis (Jernvall et al., 1994; Vaahtokari et al., 1996). The enamel knot deviates significantly from the surrounding epithelium because of its gene expression. It expresses several transcription factors and numerous signaling molecules as well as signaling inhibitors with a specific schedule of appearance, thus having potential to act as a signaling center that orchestrates the development of the surrounding tissues (reviewed by Thesleff et al., 2001; Wang and Thesleff, 2005). The primary enamelknot is apparently induced and maintained by signals emanating from the underlying mesen-chyme (Jernvall et al., 1998; Kratochwil et al., 2002). On the other hand, formation of the primary knot seems to be a prerequisite for the advancing of the tooth development to the cap stage. This is suggested by several mouse null mutants (Msx1, Pax9, Runx2, Lef1,FGFR2IIIb, Bmpr1a) in which tooth development is arrested at the bud stage, apparentlybecause of a failure of formation or function of the primary enamel knots (van Genderen et al., 1994; Satokata and Maas, 1994; Peters et al., 1998; Åberg et al., 2004). In the Msx1,Pax9, and Runx2 mutants, the mesenchyme fails to activate signaling to the epithelium and to induce or maintain the enamel knot (Chen et al., 1996; Jernvall et al., 1998; Bei and Maas, 1998; Åberg et al., 2004). In the Lef1 mutants, the epithelium fails to activate the expressionof Fgf4, which leads to a failure of growth of the cervical loops and reciprocal signaling with the mesenchyme (Kratochwil et al., 2002). Shh expressed by the enamel knot induced prolif-eration in the epithelium, probably by inducing mesenchymal signals, and FGFs both in the epithelium and the mesenchyme (Jernvall et al., 1994; Kettunen et al., 1998; Cobourne et al., 2001; Gritli-Linde et al., 2002). Thus, the enamel knot has potential to guide the formationof the epithelial cervical loops and the dental papilla, the landmarks of the cap stage of tooth development.
In mouse molars, similar structures called secondary enamel knots are formed subsequentlyin certain positions in the epithelium undergoing folding morphogenesis and these appar-ently correspond to the positions of the later forming cusps of the molar teeth (Jernvall et al., 2000). It is assumed that the formation and positions of the secondary knots are dependent on the signaling activity of the primary knot, possibly via induction of signals in the mesen-chyme (Salazar-Ciudad and Jernvall, 2002). The size of the primary enamel knot and the de-velopment of the mouse molar cusps are dependent on Eda signaling (Pispa et al., 1999; Kangas et al., 2004) as well as on normal amounts of follistatin and ectodin, inhibitors ofactivin, BMP, and Wnt signaling (Wang et al., 2004a; Kassai et al., 2005). Modelling of the molar tooth development has also suggested that positions and sizes of the secondary knots
32
are dependent on slight alterations in the concentrations and diffusion properties of distinct activators and inhibitors of knot differentiation (Salazar-Ciudad and Jernvall, 2002). Quanti-tative adjustment of these parameters may be sufficient to change a mouse type of molartooth to resemble the molars of another rodent, the vole.
The main difference between the premolars and molars and the other tooth types, incisorsand canines, is in the amount of cusps, suggesting that the tooth type specification is associ-ated with the capacity to form the secondary enamel knots. As known from the tissue recom-bination studies, at the morphogenetic stages the dental mesenchyme is able to instruct tooth development also in a heterologous epithelium as well as to determine the tooth type (Kollar and Baird, 1969). Accordingly, the mesenchyme apparently is competent to instruct whether the secondary enamel knots are induced. However, as the epithelium is able to instruct the tooth type specification during the early stages (Kollar and Mina, 1991), it appears that the early epithelium instructs the dental mesenchyme competent to decide whether and how the secondary knots will de induced. This competence of the mesenchyme could be dependent on specific transcription factor activities. Although the serial homology of teeth suggests that no separate genetic programs exist for each tooth, differences of gene activities must existduring development of teeth of different classes. These differences may be mainly quantita-tive but at least some genes show specific expression only during development of one tooth class. A LIM-domain transcription factor gene Islet1 appears to be expressed only in the epi-thelium of the developing incisors, whereas e.g. Barx1, a homeobox transcription factor gene, is specific for the presumptive molar mesenchyme (Mitsiadis et al., 2003; Tissier-Seta et al., 1995).
Inactivations of both Dlx1 and Dlx2, members of the Dlx homeobox gene family, caused an arrest in the development of mouse upper molar teeth only (Thomas et al., 1997), which wassuggested to support the concept of an “odontogenic homeobox-code” (Sharpe, 1995; Tho-mas et al., 1997). However, as described above, the expression of the mesenchymal tran-scription factors is dynamic and dependent on various epithelial signals. Furthermore, in theDlx1;Dlx2 null mutant, there is no homeotic change of a molar to an incisor. The normal de-velopment of lower molars can be explained by redundancy, i.e. the expression of other Dlx genes in the mandibular mesenchyme (Peters and Balling, 1999). The insensitivity of the in-cisors to inactivation of the Dlx genes suggests that the latter are not critical for the incisordevelopment. Thus, Dlx activity appears to be needed not to determine a molar tooth identitybut to make it possible to develop any tooth at a molar location. Interestingly, inactivation of activin A signaling arrests the development of all mandibular teeth and upper incisors (Matzuk et al., 1995a; Ferguson et al., 2001). The insensitivity of the upper molars may beexplained by redundancy of signaling pathways (Ferguson et al., 2001).
Barx1 has been suggested to be a candidate for a factor mediating tooth type determination(Tissier-Seta et al., 1995; Tucker et al., 1998). It is normally expressed only in the presump-tive molar region and inducible by FGF8. However, if the epithelial BMP4 activity is blocked by application of an inhibitor Noggin, the expression domain of Barx1 is expanded to the presumptive incisor region (Tucker et al., 1998). Incisor tooth germs cultured in the presence of Noggin grew large, showing resemblance to molar tooth germs. Similar changehas been described after injection of Barx1 cDNA to the incisor region (Miletich et al.,
33
2005). Thus, it appears that Barx1 activity would be able to mediate the effect of epithelialgradients of Bmp4 anf Fgf8 expression on tooth type specification (Tucker et al., 1998). However, a reciprocal change of a molar to an incisor in absence of Barx1 has not been re-ported.
It is reasonable to assume that the epithelial signaling gradients are involved in tooth type specifications, i.e. in the basis of heterodonty (Tucker et al., 1998). Differential signaling may be mediated to the specification of tooth identity by specific expression of transcriptionfactors as described above. The differential timing of the interactive processes during the ini-tiation may also be involved. Pax9 becomes expressed slightly earlier in the presumptivemolar region than in the incisor region (Neubuser et al., 1997). On the other hand, Shh ex-pression appears to become prominent earlier in the incisor region than in the molar region(Dassule and McMahon, 1998). Still, the question remains how the epithelial gradients are created. Organizing activity of the ectodermal-endodermal boundary has been suggested (Neubuser et al., 1997). Some evidence suggests that the epithelial cells become specified before the growth of the facial processes, possibly by the endoderm (Haworth et al., 2004;Haworth et al., 2007). Furthermore, the gradients should be able to create three separate specifications, i.e. one for each tooth class, e.g. during human tooth development, and the gradients should lead to similar patterning in the maxilla and mandible even though these are formed from fusing facial processes in a different way.
Tooth replacement
Relatively little is known about the molecular regulation of tooth renewal, i.e. shedding ofthe deciduous teeth and development and eruption of the secondary teeth. There appears to exist a regulatory relationship between the development of the primary teeth and the succes-sor (Luckett, 1993), and it may be possible that both activating and inhibitory effects are in-volved.
Within the hair follicle, a specific epithelial compartment, a hair bulge, contains cells with stem cell-like properties. These cells are activated in a certain stage of hair cycling to make itpossible for the hair papilla to activate the follicle to start new anagen stage of cycling(reviewed by Blanpain et al., 2007). Existence of a similar stem cell compartment has been suggested to make tooth renewal possible in fish and possibly in other vertebrates (Huysseune and Thesleff, 2004).
Wnt signaling is involved in the activation of the cells of the hair bulge (reviewed by Alonso and Fuchs, 2003). Several observations suggest the involvement of Wnt signaling also to the regulation of the secondary tooth development. Mutations in the human AXIN2 gene that presumably affect the intracellular negative feedback regulation of Wnt signaling, i.e. -catenin degradation, cause severe tooth agenesis that affects almost exclusively the perma-nent teeth (Lammi et al., 2004). In the human disease adenomatous polyposis coli, a cancer syndrome with massive colon polyposis caused by deregulation of -catenin level as a con-sequence of lack of the functional APC gene product, development of supernumerary teeth is often observed (Ida et al., 1981; Järvinen et al., 1982). Finally, forced overexpression of the
34
epithelial -catenin disturbs the mouse molar morphogenesis by creating supernumerarybudding of the molar epithelium in vivo and, in the kidney capsule culture, numerous tooth structures resembling compound odontomas (Järvinen et al., 2006).
Supernumerary teeth are a regular feature of cleidocranial dysplasia, a syndrome caused by defects in the transcription factor gene RUNX2 (Jensen and Kreiborg, 1990; Mundlos et al., 1997). Whether these teeth reflect a failed suppression of an ancient tooth renewal program is not clear because the teeth seem to develop occlusally to the normal permanent successors.It has been suggested that the development of the supernumerary teeth follows from a failure of degradation of the dental lamina (Jensen and Kreiborg, 1990). Although Runx2 activity is mandatory for tooth development, a reduced amount of RUNX2 may also release the inhibi-tion of tooth renewal, as rudimentary epithelial outgrowths have been observed in the molarsof Runx2 null mutant heterozygotes (Åberg et al., 2004).
35
TOOTH AGENESIS
Developmental anomalies
The development of an individual from an fertilized egg to an adult is a tightly regulatedprocess requiring coordination of the patterning, organogenesis, morphogenesis and differen-tiation. Deviations from normal development may lead to anomalies of structure or function,which when present at birth either as visible or hidden are called birth defects. Structural or anatomical malformations and abnormalities present at birth as signs of abnormal prenatal development are also called congenital anomalies (Gilbert, 2003; Kotilainen, 1996). How-ever, in the case of teeth the development and differentiation continues long after birth, and instead of congenital many anomalies could rather be called developmental anomalies.
Dysmorphic features that may only require cosmetic concern are considered minor anoma-lies, whereas anomalies that require clinical or cosmetic attention are considered majoranomalies (Kotilainen, 1996). Minor anomalies are rather common, and a figure of 15 % waspresented by Marden et al (1964), whereas major anomalies are present in 1-2 % of new-borns (Marden et al., 1964; Sadler, 1990; Gilbert, 2003). Observation of several minoranomalies increases the risk for presence of one or more major anomalies. Presence of sev-eral anomalies may be called a syndrome (Kotilainen, 1996).
Congenital or developmental anomalies may be caused by external factors such as terato-genic agents, radiation, viral infections and even hyperthermia or mechanical forces, and in this case they are called disruptions or deformations (Kotilainen, 1996). These effects mayvary depending on the time of the exposure, and therefore often manifest in an organ- and time-specific fashion (Sadler, 1990). Thalidomide, a drug that was used by pregnant womenin the 1950’s, caused ear defects, truncations of hands and truncations of feet depending on the time of exposure during the fourth and fifth weeks of gestation (Sadler, 1990; Gilbert, 2003). As teeth develop during a long period from six weeks of embryonal development to early adulthood, they are also subject to time-specific effects, which are characterized by dif-ferent defects on the tooth development or the hard tissue formation depending on the timeand nature of the deleterious agent (Alaluusua et al., 1999; Hölttä, 2005). Indeed, because hard tissues of teeth are not remodelled or repaired after eruption, anomalies of hard tissues may serve as biomarkers of an experienced environmental insult (Alaluusua et al., 1999).
Normal development may also by affected by genetic causes, and it has been suggested that the term malformation would be reserved for these anomalies (Kotilainen, 1996; Gilbert, 2003). They may affect only one organ system but often a genetic factor has a pleiotrophic effect on many organs (multiorgan malformation syndrome). These may be related or inde-pendent, reflecting the roles of a certain molecular mechanism in the development of multi-ple organ systems (Gilbert, 2003). A term trait has also been used to describe inherited phe-notypes, which may be regarded either normal variation but may in some cases be classifiedas anomalies (Guttman et al., 2002).
Especially syndromes may result from large-scale chromosomal abnormalities such as dele-tions, translocations or abnormal chromosome number, which affect the functions of several
36
genes. However, syndromes, anomalies, and many other genetic diseases can also be caused by sequence defects in single genes, while other genes may have a modifying effect(Strachan and Read, 1999; Gilbert, 2003). The relationship between a genotype and a pheno-type may be rather complex. The dependence of the phenotype on other genetic factors, “the genetic background”, as well as epigenetic and external factors results in variable expressiv-ity, i.e. different phenotypes among affected individuals, and often as reduced penetrance,i.e. some healthy individuals who have the defective genotype.
Developmental anomalies of teeth
Developmental anomalies of the teeth include deviations in tooth number (agenesis or super-numerary teeth), abnormalities of size and form, failure of eruption or precocious or delayed eruption, malpositions, as well as defects of dental hard tissues. Well-known external factors affecting the dental hard tissue formation are vitamin D deficiency in rickets and excessfluor. Apparently many other environmental factors in modern society may cause defects inthe maturation of hard tissues (Alaluusua et al., 1999). Alleged increased occlusal deviations as well as increased prevalence of impaction of third molars considered as a result of modern diets may also be regarded as defects caused by environmental factors (Corruccini, 1984;Sengupta et al., 1999). On the other hand, both normal quantitative and qualitative variation as well as many developmental anomalies have been attributed to inheritance (Bailit, 1975;Townsend et al., 1998; Thesleff and Pirinen, 2002). Several gene defects are known that af-fect the formation of the dental hard tissues. Amelogenesis imperfecta is a failure of normalformation of enamel and it may result from defects in the structural genes of enamel or in proteases and regulatory genes (Wright, 2006; Hu and Simmer, 2007). Dentinogenesis im-perfecta and dentin dysplasia that primarily affect dentin deposition and mineralization are known to be caused by defects in the genes that code for the structural components of thedentin matrix, collagen I and dentin sialophosphoprotein (Waltimo, 1996; MacDougall et al., 2006; Kim and Simmer, 2007). Anomalies and variation observed in the morphology, size and number of teeth will be discussed below in more detail.
Genetic traits of tooth number and shape
Most of us develop a similar set of teeth, with similar shapes and timing of the development,but also many kind of individual variation exists. The variation may be quantitative or quali-tative, i.e. continuous or discreet, and it is apparent that extremes of quantitative variation may turn into qualitative changes, regarded either as variation or anomalies (Miles and Grig-son, 1990; Bailit, 1975).
Quantitative variation is observed e.g. in the tooth size, the root length and the timing of tooth development, shedding and eruption. Many authors have reported population values and observed variation of tooth sizes (Jensen et al., 1957; Garn et al., 1968) (Steigman et al., 1982; Lysell and Myrberg, 1982) as well as standards and methods of estimation of the tim-ing of development and eruption (Moorrees et al., 1963; Haavikko, 1970; Demirjian, 1978;Kataja et al., 1989). Tooth size, tooth maturation and times of eruption display some differ-
37
ences between populations and men generally have larger teeth than women (Bailit, 1975). On the other hand, different teeth show different magnitudes of size variation.
Qualitative deviations are observed in tooth number, either as agenesis of one of more teethor as development of extra (supernumerary) teeth (Fig. 4), in cusp and root number as well as in presence of abnormal shapes or positions. Several studies have addressed cusp numberand morphology of permanent molar crowns (Dahlberg, 1945; Jörgensen, 1955; Davies, 1968; Lavelle et al., 1970). Considerable variation exist in terms of molar crown shapes and reduction of cusp number among Caucasian populations and also ethnic differences may ex-ist. Other common morphological features include presence of extra cusps in molars, e.g. the so-called Carabelli’s cusp in the medial lingual aspect of the maxillary molars, as well as morphological variation of incisors including shovel-like shape, talon cusps, dens-in-dente/dens invaginatum in the lingual aspect of upper lateral incisors and peg-shape of these teeth (Dahlberg, 1945; Ooshima et al., 1996; Tsai and King, 1998; Alvesalo and Portin, 1969).
Supernumerary teeth
Development of supernumerary teeth is observed in some syndromes, but they also occur in the permanent dentition of about 2-3.5 % of otherwise healthy individuals, with perhaps a slightly higher prevalence among Asian populations than in Caucasians, and in most studies a two-fold higher prevalence among males (Niswander and Sujaku, 1963; Haavikko, 1970;Brook, 1974; Bäckman and Wahlin, 2001; reviewed by Zhu et al., 1996). In the deciduous dentition the occurrence is about one fifth of that in the permanent dentition (Zhu et al., 1996). In Finland the reported prevalences in the permanent and primary dentition are 1.6 % and 0.4 %, respectively (Haavikko, 1970; Järvinen and Lehtinen, 1981). Four fifths of thecases present with one supernumerary tooth and in only 1 % more than two are observed (Zhu et al., 1996). Supernumerary teeth are classified according to their time and place of appearance as well as to their morphology (reviewed by Miles and Grigson, 1990; Zhu et al., 1996; Rajab and Hamdan, 2002). They may be normal by size and morphology (eumorphicor supplemental supernumerary teeth) or they may be rudimentary (conical, tuberculate or molariform). Most commonly the supernumerary teeth develop in the incisor region, and a typical supernumerary tooth is a mesiodens, an extra peg-shaped incisor in the midline be-tween the normal incisors (Russell and Folwarczna, 2003). The majority of anterior super-numerary teeth remain unerupted. Other common findings are supernumerary mandibularpremolars, and molars between the normal molars (paramolars) or posterior to the third mo-lar (distomolar), more commonly in the maxilla (Zhu et al., 1996).
Supernumerary teeth have been considered as reflections of atavism, i.e. reappearance of teeth lost during evolution (reviewed by Miles and Grigson, 1990; Zhu et al., 1996; Rajab and Hamdan, 2002). This is based on an idea that in some cases an ancestral developmentalprogram that is normally suppressed during the development of human dentition becomesactivated. Another suggestion is that supernumeraries develop from local overactivity of thedental lamina or from a dichotomous tooth bud. A third suggestion considers supernumeraryteeth as an expression of a quantitative variation, which in the other end leads to agenesis or
38
size reduction of teeth (Brook, 1984). Support for this view is offered by an observation that supernumerary teeth are often associated with teeth that are bigger than normal in size (Khalaf et al., 2005). These explanations may to some extent represent different aspects (evolutionary, developmental and genetic) of the same explanation, e.g. overactivation of genetic pathways the activity of which may have been reduced during evolution. Studies of mouse mutants have shown that increased quantitative level of signaling may lead to super-numerary teeth (Mustonen et al., 2004; Kassai et al., 2005; Klein et al., 2006).
Development of supernumerary teeth is observed in some syndromes like cleidocranial dys-plasia and familial adenomatous polyposis coli (FAP, also called Gardner syndrome}(Jensen and Kreiborg, 1990; Ida et al., 1981; Wolf et al., 1986) in which the causative genes are known. Gene defects in RUNX2 are responsible for cleidocranial dysplasia and gene de-fects in APC for FAP (Mundlos et al., 1997; reviewed by Järvinen and Peltomäki, 2004). Common to both genes is that they affect well-known signaling pathways and both teeth and the bone. Mouse studies have shown that Runx2 function is obligatory for bone developmentand that some Runx2 expression is needed for the normal tooth development (Otto et al., 1997; Åberg et al., 2004). Paradoxically, Runx2 null mutant mice do not develop teeth at all, while reduced RUNX2 dosage in humans causes supernumerary teeth. As discussed earlier, Runx2 function may be associated with the prevention of tooth renewal (Wang et al., 2005). In FAP, apparently as a result of overactivation of the intracellular Wnt-signaling (reviewedby Giles et al., 2003; reviewed by Segditsas and Tomlinson, 2006), jaw osteomas and odon-tomas or supernumerary teeth are observed in 80 % and 20-30 % of the cases, respectively (Ida et al., 1981; Wolf et al., 1986)..
Tooth agenesis
Terminology
Failure to develop all normally developing 20 deciduous and 32 permanent teeth, toothagenesis, is a common phenomenon and various terms have been used to describe it(reviewed by Schalk-van der Weide, 1992) (Fig. 4). The layman way of speaking about “missing teeth” is prone to cause misunderstandings because teeth may be lost by dental dis-ease or trauma or extracted on clinical grounds. “Congenitally missing teeth” is also prob-lematic, because some teeth start their development only after birth and because of the pres-ence of most of the permanent teeth germs can only be verified during childhood. Tooth aplasia and agenesis have been used to describe developmentally missing teeth. Tooth agen-esis is the suitable term because it directly refers to the developmental failure. To be exact it should need to be complemented e.g. with “partial” or “selective” tooth agenesis (Vastardiset al., 1996). In the literature, the term anodontia (ano, Greek for “none”) has sometimesbeen used to describe tooth agenesis in general even though it should be restricted to the very rare cases of agenesis of whole the dentition. Hypodontia (hypo, Greek for “less”) is the most commonly used term even though it may sound like a scientifically sounding simile of “missing teeth” or may be mixed with reduced size of teeth. The term has been used fortooth agenesis in general, but recently in particular for the common, mild forms. The term oligodontia (oligo, Greek for “few”) has been used for describing more severe forms of
39
agenesis, usually of at least six teeth excluding third molars (Schalk-van der Weide, 1992; Arte, 2001). This definition is, however, somewhat arbitrary, often causes misunderstandingsand may not properly reflect the severity of the phenotype as the third molars are excluded.
Diagnostic challenges
The reliability of the diagnosis of tooth agenesis is dependent on a reliable history of dental treatment, trauma and tooth extractions. Therefore, most studies on the prevalence of toothagenesis focus on children and adolescents. However, for young subjects, radiographic ex-amination is critical for the diagnosis but not always possible, and even then the late-developing teeth may be sometimes scored developmentally missing. Agenesis of the pri-mary teeth can be diagnosed without radiographic examination in three to four year old chil-dren, because all primary teeth are at that age normally visible in mouth. Permanent teethcannot be studied reliably even with radiological methods before the age of six years, and even at that age all the second premolars may not have started mineralization (Arte, 2001). Obviously, the diagnosis of agenesis of third molars is subject to errors caused by a large variation of the onset of mineralization and rather common extractions of these teeth.
Prevalences
Prevalence of tooth agenesis has been addressed by numerous studies (reviewed by Arte, 2001; Polder et al., 2004; Mattheeuws et al., 2004). The reported prevalences show a rather large variation. Extremes are found in some isolated populations (Mahaney et al., 1990), but in most populations the reported prevalences of agenesis of permanent teeth, excluding third molars, varies from 2.2 to 10.1 % (reviewed by Arte 2001; Polder et al., 2004). In their meta-analysis of 33 studies, Polder and collaegues (2004) did not find any significant increase in prevalences when samples from seven year olds or younger were included. Instead, they de-cided to exclude one study reporting low prevalence because of a possible error due to an exceptionally large sample size. Inspection of the data from the meta-analysis suggests a tendency of lower prevalences also in other studies with large sample sizes, and becausesome of these are from USA, this may undermine their conclusion that tooth agenesis showsa lower prevalence in Northern America. They also noticed signs of an increasing trend inagenesis during the 20th century, a notion also advocated by Mattheeuws and colleagues (2004). While the available data are not sufficient for confirmation of this trend, the data support the conclusion that in Caucasian populations the prevalence of permanent tooth agenesis apart from the third molars is generally in a range of 5 to 8 %. The data also support the conclusion that the prevalence is higher among females than among males (Polder et al., 2004). In the two studies of African Americans, the prevalences were comparable to those ofWhite subjects, whereas in two studies from Saudi-Arabia prevalences of 2.2 and 4 % were reported (Polder et al., 2004). Studies among Japanese and among school children of Chi-nese origin in Hongkong reported prevalences of 6.6 % and 6.9 %, respectively (Niswander and Sujaku, 1963; Davis, 1987).
40
Figure 4. Panoramic tomographies of developmental dental anomalies. Asterisks mark de-velopmentally missing teeth. A. Agenesis of the mandibular second premolars and the rightmaxillary third molar in a 15 years old boy. B. Agenesis of the left mandibular central incisorand a peg-shaped right maxillary lateral incisor (arrow) in a nine years old girl. C. Severeagenesis (oligodontia) in a six years old boy. D. Unerupted supernumerary incisor, so-calledmesiodens, between the maxillary central incisors (arrow) in a nine years old boy.
Agenesis of third molars is much more common than that of other teeth, but because of prob-lems referred above, also much more challenging to study. The reported figures suggest that one or more third molars fail to develop in more than 20 % in populations of Caucasian ori-gin (Grahnen, 1956; Haavikko, 1971). On the other hand, agenesis of deciduous teeth is much more rare, the prevalences among Caucasian populations ranging from 0.3 to 0.9 %, the highest prevalence being reported among Finnish 3-4 year olds (Järvinen and Lehtinen, 1981; reviewed by Arte, 2001). In a study from Japan, a remarkably higher prevalence of 2.4 % was reported (Yonezu et al., 1997).
Thus, tooth agenesis is a very common developmental anomaly. However, if the absense of more than a few teeth is considered, the prevalences become progressively smaller. There-fore, agenesis of more than two teeth (third molars excluded) happens in ~1 % of the popula-tion, while the prevalences are in a range of 0.1 to 0.3 % for agenesis of at least six teeth (Grahnen, 1956; Hunstadbraten, 1964; Haavikko, 1971; Rölling, 1980; Rölling and Poulsen,2001; reviewed by Polder et al., 2004). In the primary dentition, the distribution is similarwith the majority of cases lacking only one tooth (Daugaard-Jensen et al., 1997a).
Patterns of agenesis
No general difference in the frequency of agenesis between the left and right sides exists,and for permanent teeth no significant difference between maxilla and mandible has been reported although for individual teeth in different jaws the frequencies differ. For the pri-mary teeth, agenesis is more common in the maxilla (Daugaard-Jensen et al., 1997a).
41
Apart from the third molars, many studies among Caucasian populations have scored thelower second premolars most commonly affected, followed by upper lateral incisors and up-per second premolars, while some studies have found that upper lateral incisors are most of-ten affected (Grahnen, 1956; Haavikko, 1971; reviewed by Graber, 1978; Arte, 2001; Polder et al., 2004) (Fig. 5). These differences may reflect diagnostic or real population differences. Among Asian populations agenesis of lower central incisors is much more common than among Caucasians, this tooth actually being the most often affected, and also in the primarydentition (Yonezu et al., 1997). The third molars may account for about 75 % of all affectedteeth (Haavikko, 1971). If they are not considered, agenesis of second premolars and upper lateral incisors account for 85 % of all affected teeth among Caucasian populations (as calcu-lated from data by Polder et al., 2004), and their proportion is still higher if cases with agen-esis of only one or two teeth are considered. Prevalences of agenesis for all other permanentteeth, third molars excluded, are less than 0.36 % or as proportions of all affected teeth, 3.5 % or less. The most commonly affected other teeth are, in order, lower incisors, maxillaryfirst premolars, mandibular first premolars, maxillary canines and mandibular second mo-lars. Prevalences of agenesis of all other teeth are less than 0.075 %, corresponding to pro-portions below 0.7 %, and the most stable teeth are maxillary central incisors (prevalence of agenesis 0.016 %) and mandibular first molars and canines (prevalences of agenesis about 0.03 %).
In the primary dentition, the maxillary lateral incisors account for over 50 % and togetherwith mandibular incisors for 90 % of all affected teeth (Daugaard-Jensen et al., 1997a; Jär-vinen and Lehtinen, 1981; Magnusson, 1984; Whittington and Durward, 1996). A correla-tion of agenesis of primary and secondary teeth also exist: agenesis of a primary tooth is nearly always followed by agenesis of the corresponding secondary tooth (Daugaard-Jensen et al., 1997b; Whittington and Durward, 1996).
Bilateral agenesis is observed for most teeth in almost half of the possible occurrences, i.e. when at two teeth are affected (Grahnen, 1956; Haavikko, 1971; Davis and Brook, 1986;Rasmussen, 1999; Polder et al., 2004; Kirkham et al., 2005). Bilaterality may be more com-mon for maxillary lateral incisors than for premolars in either jaw (Thompson and Popovich, 1974; Davis and Brook, 1986; Polder et al., 2004). In families the occurrence of agenesiswithin one tooth class appears more common than agenesis of different tooth classes(Grahnen, 1956; Chosack et al., 1975; Arte et al., 2001). However, if agenesis of third mo-lars were taken into account, the tendencies to bilaterality and familial concordance would probably be weakened. According to Grahnen (1956), agenesis of third molars was observ-able in approximately half of the subjects with agenesis of other teeth.
The teeth that are most often affected, i.e. the third molars as well as the second premolarsand upper lateral incisors of the permanent dentition, are the last to develop in their respec-tive tooth classes. This suggests that quantitative mechanisms are involved in the pathogene-sis (see below). The tendency to bilaterality and familial concordance, on the other hand, support the existence of mechanisms that tend to affect different tooth classes differentially.
42
Figure 5. Prevalences of agenesis of different tooth types. Prevalences from teeth on the left and right are combined. Figures indicate per-centages. Darkness of color indicates the prevalence. Figures inside the crowns of themaxillary permanent teeth are the second dig-its of the FDI codes. Prevalences of permanentteeth except third molars according to table 4 in Polder et al., 2004.
Tooth agenesis in syndromes
As can be reasoned from the prevalence figures, tooth agenesis is usually an isolated anom-aly, without any other observable malformations. It is, however, a constant feature associated with oral clefts and tens of well-defined malformation syndromes (Schalk-van der Weide, 1992; Arte, 2001) (Table 1). In association with oral clefts, agenesis may happen in the re-gion of the cleft, but agenesis in other regions of the mouth is also more common than in the general population, reflecting common etiology (Ranta, 1986). Tooth agenesis that is associ-ated with different malformation syndromes vary in severity but syndromic agenesis ac-counts for a remarkable proportion of all cases of severe agenesis (Schalk-van der Weide, 1992). In many syndromes there is a typical pattern of agenesis and in some cases it is strik-ingly different from the frequencies in non-syndromic cases (Table 1). On the other hand, in the association of severe agenesis, occurrence of minor ectodermal anomalies is often ob-served (Schalk-van der Weide, 1992; Pirinen et al., 2001; Nordgarden et al., 2001).
Dental anomalies associated with agenesis
For dental clinicians, it is familiar that tooth agenesis is associated with other anomalies ofteeth. Tooth agenesis is prone to cause abnormal occlusion, the severity of which is depend-ent on the amount of missing teeth. Agenesis may also affect craniofacial development, and especially maxillary retrognathism and reduced anterior facial height have been reported (Mattheeuws et al., 2004; Nodal et al., 1994; Endo et al., 2006). A reduction in jaw size hasalso been described (Lavelle et al., 1970). However, as these may be considered secondary to agenesis, they will not be discussed further here. Several studies have addressed associationsof agenesis and other dental anomalies (Lai and Seow, 1989; Schalk-van der Weide, 1992; Ooshima et al., 1996; Baccetti, 1998; Bjerklin et al., 1992; Bäckman and Wahlin, 2001). Agenesis is often associated with reduction in tooth dimensions and morphology, delays of development, root anomalies, abnormal positions and also enamel hypoplasia (Ahmad et al., 1998; Baccetti, 1998) (Table 2). However, these studies have not, with some exceptions,considered different subtypes of agenesis. While the following refers to studies concerning
43
isolated tooth agenesis, these anomalies are rather often present in syndromic forms of tooth agenesis (reviewed by Arte, 2001).
Reduction of tooth size and morphology
The term microdontia has been used for occurrence of teeth with reduced tooth size (Brook, 1984), but some authors have reserved this term to extreme size reduction, e.g. to a reduction observable without measurements (Hölttä, 2005), or defined a limit for the deviation (Ooshima et al., 1996). Small but measurable decreases of mesio-distal tooth dimensions were reported in association with the agenesis of the third molars (Garn et al., 1961; Garn etal., 1964; Lavelle et al., 1970), but these were on the average only in a range of a few per-cent. Somewhat more remarkable decreases of size have been observed in association with agenesis of other teeth, and correlations between the amount of missing teeth and the extent of size reduction have been reported (Lysell, 1953; Garn and Lewis, 1970; Baum and Cohen, 1971; Rune and Sarnäs, 1974; Schalk-van der Weide, 1992; Brook et al., 2002). Even then, the tooth sizes were reduced less than 20 % of the normal size. The labio-lingual/palatal di-mensions have also been shown to be reduced in association with agenesis (Baum andCohen, 1971; Schalk-van der Weide, 1992; McKeown et al., 2002). Reduced tooth sizes have also been observed within the healthy relatives of patients with severe tooth agenesis(Schalk-van der Weide and Bosman, 1996; McKeown et al., 2002). From several of these studies it appears that the size reduction affects most strongly the anterior teeth, even in as-sociation with the third molar agenesis (Garn and Lewis, 1970; Schalk-van der Weide, 1992; Brook et al., 2002), and, on the other hand, that agenesis is accompanied by an increase of the tooth size variability, and especially that of the posterior teeth (Garn and Lewis, 1970; Schalk-van der Weide, 1992). Reduced tooth size of affected family members has also been reported in association of identified gene defects in MSX1 and PAX9 (see Results).
In addition to reduction in tooth dimensions, agenesis is also associated with changes of tooth crown morphology, especially with simplification of tooth shapes. The occurrence of peg-shaped upper lateral incisors is associated with the absence of a contralateral tooth and occurrence of agenesis of upper lateral incisors among relatives (Mandeville, 1949; Grahnen, 1956; Chosack et al., 1975; Alvesalo and Portin, 1969; Arte et al., 2001), and association of peg-shaped laterals has also been reported to be assosiated with agenesis of other teeth (Grahnen, 1956; Baccetti, 1998). Alvesalo and Portin (1969) concluded that peg shape and agenesis of laterals incisors are different expressions of the same genetic trait while the re-duction of mesio-distal size is not. They also proposed that in different populations a com-bined frequency of missing and peg-shaped teeth may be of the same magnitude while pro-portions of individual defects may vary.
Several studies have addressed the lower molar cusp patterns in relation to agenesis. Somestudies have found that reduction of cusp number from 5 to 4 is increased in association with agenesis (Garn et al., 1966; Davies, 1968) while others have failed to confirm this (Lavelle et al., 1970). Other morphological features possibly associated with agenesis include conicality of canines and reduction of cusps of premolars (Schalk-van der Weide, 1992).
44
Table 2. Anomalies associated with tooth agenesis
cont-rols
agene-sis
group
agene-sis
among*)
sample notes
% % %Peg or small maxillary lateral incisors
Grahnen, 1956 1.7 50 Swedish schoolchildren andstudents
agenesis of contralateralincisor
Alvesalo and Portin, 1969 1.3 50 43 Finnish island population
Lai and Seow, 1989 0 8.9**) Australian pediatric dentistrypatients mean n of missing teeth 4.7
Baccetti, 1998 4.7 18 42 Italian orthodontic patients agenesis of 2nd premolars
Short root anomaly
Lind, 1972 2.4 46 Swedish schoolchildren max incisors; crown/root > 1.1
Apajalahti et al., 1999 1.3 12 Finnish university students all teeth; crown/root > 1 onboth sides
Taurodontism
Seow and Lai, 1989 7.5 35 Australian pediatric dentistrypatients mandibular 1st molars
Schalk-van der Weide, 1992 9.9 22 Dutch patients with severeagenesis
Arte et al., 2001 22 41 Finnish 6-21 y 1st and 2nd permanentmolars
Ectopic caninesBjerklin et al., 1992 1.8 7.2 5.5 Swedish schoolchildren
Palatally displaced caninesBaccetti, 1998 5.2 16 18 Italian orthodontic patients agenesis of 2nd premolarsPirinen et al., 1996 8 36 Finnish orthodontic patients
Infrapositioned/ankylosed primary molars
Lai and Seow, 1989 1.5 66 Australian pediatric dentistrypatients mean n of missing teeth 4.7
Bjerklin et al., 1992 10.3 19.6 19.4 Swedish schoolchildrenBaccetti, 1998 5.6 15 20 Italian orthodontic patients agenesis of 2nd premolars
Ectopic eruption of first molarsBjerklin et al., 1992 4.3 3.1 6.5 Swedish schoolchildrenBaccetti, 1998 4.6 11 12 Italian orthodontic patients agenesis of 2nd premolars
Enamel hypoplasia
Lai and Seow, 1989 0 12 Australian pediatric dentistrypatients mean n of missing teeth 4.7
Baccetti, 1998 4.2 11 16 Italian orthodontic patients agenesis of 2nd premolars
*) percentage of subjects with tooth agenesis among subjects with the anomaly**) bold indicates statistical significance as evaluated by the authors
Delayed development and eruption
Delayed development of posterior permanent teeth in association with the third molar agen-esis was reported by Garn and colleagues (Garn et al., 1961). Rune and Sarnäs (1974) re-ported an average delay of two years, however with great variation, in a group of 85 patients with agenesis of on the average seven permanent teeth. They also reported excessive retarda-tion of development of teeth contralateral to missing teeth. Schalk-van der Weide (1992) re-
45
ported a tendency of early developing teeth of males to be retarded in association with severe agenesis, and in females with severe agenesis second mandibular molars to be significantly delayed in development (only mandibular teeth were studied). In a sample of 135 cases, 50 % of whom had agenesis of one or two permanent teeth, an average delay of 1.5 years was recorded (Uslenghi et al., 2006), and this delay correlated with the extent of agenesis and was most prominent in positions next to the teeth that had failed to develop.
Root abnormalities
Two types of root abnormalities have been described in association with tooth agenesis. Theroots may be shorter which with certain criteria is defined as short root anomaly (SRA). The prevalence of SRA was reported as 2.4 % among Swedish school children, 2.7 % amongBritish school children and 1.3 % among Finnish university students (Lind, 1972; Brook and Holt, 1978; Apajalahti et al., 1999). The Swedish and British studies considered only the maxillary central incisors and applied a criteria of crown to root ratio bigger than 1.1, while the Finnish study measured also other permanent teeth, but required that the teeth on both sides would fill a less stringent crown to root ratio of 1. In another abnormality of root de-velopment, so-called taurodontism, root bifurcation in molars is observed on an abnormallyapical level. Different methods of diagnosing taurodontism have been used and modified (Seow and Lai, 1989; Shifman and Chanannel, 1978), the main difference being the selection of reference points for the crown height and the level of root bifurcation. The reported popu-lation prevalences show a considerable variation from 7.5 to 22 %, reflecting probably dif-ferences in the study plans more than in real frequencies, i.e. whether only mandibular first molars or all molars were studied (Seow and Lai, 1989; Schalk-van der Weide, 1992; Arte et al., 2001).
Regardless of different ways of measurement and definitions, both root shortening and tauro-dontism have been reported to be more common in association with tooth agenesis. Tooth agenesis was reported in 46 % of Swedish school children and in 12 % of Finnish students with SRA (Lind, 1972; Apajalahti et al., 1999). In the Australian study, taurodontism wasalmost five and in a Finnish study two times more frequent among subjects with tooth agen-esis (Seow and Lai, 1989; Arte et al., 2001), while among Dutch patients with severe agen-esis it was three times more common than among controls (Schalk-van der Weide, 1992)
Root abnormalities have been attributed to an epithelial defect and more specifically to a de-fect of the function of the Hertwig's epithelial root sheath (Hamner et al., 1964; Seow and Lai, 1989; Apajalahti et al., 1999; Arte et al., 2001). The association between root abnor-malities and tooth agenesis suggests the existence of a common primary defect. It may exert its effect independently on different processes or root abnormalities may follow secondarily from an earlier defective event. So far, taurodontism has been associated with defects in the homeobox gene DLX3 in the tricho-dento-osseous-syndrome (TDO) and defects in the EVC,presumably a Shh signaling regulator, in Ellis-van Creveld syndrome (Price et al., 1998; Ruiz-Perez et al., 2007). Shortened roots are observed in association with developmental de-fects of dentin formation, caused by defective collagen I and DSP/DPP. Increased frequency of tooth agenesis has also been observed in connection with osteogenesis imperfecta
46
(Lukinmaa et al., 1987). Abnormalities of root development were observed in the NFI-C null mutant mice as well as in mice with defective Patched, the Shh receptor (Steele-Perkins et al., 2003; Nakatomi et al., 2006).
Abnormal positions of teeth
Teeth developing in an abnormal position in relation to the dental arch, i.e., ectopically posi-tioned teeth, have been associated with tooth agenesis. Prevalence of ectopically eruptedteeth has been estimated to be 4 to 7.8 % in the general population (Bergström, 1977; Kimmel et al., 1982; Bjerklin et al., 1992). The prevalence of ectopic maxillary canines has been reported as about 2 % (Shah et al., 1978; Ericson and Kurol, 1986), and the prevalence of palatally displaced canines among Israeli teenagers as 1.5 % (Brin et al., 1986). A longi-tudinal Swedish study reported that in the last examination (mean age 17.8 years) impacted canines were found in 1.8 % of study subjects, and that half of them were palatally displaced (Thilander and Jakobsson, 1968). According to this study, dental crowding was mostly re-lated to the buccal displacement of a canine, and the persistence of a deciduous canine seenin six of the 10 cases was rather a consequence than reason for displacement of the perma-nent successor. Becker and colleagues (1981) showed that the risk for palatal displacementof a maxillary canine was six times higher in association with an abnormal (absent, peg-shaped or mesiodistally reduced) adjacent lateral incisor (Becker et al., 1981; Brin et al.,1986), and that the association was also detected among the relatives of the probands (Zilberman et al., 1990). On the basis of these observations, the palatal displacement was suggested to be based on local etiology, possibly due to the disturbed role of the lateral inci-sor root in the guidance of eruption of the maxillary canine, rather than general malocclusionor crowding (Brin et al., 1986; Brin et al., 1986; Zilberman et al., 1990).
Palatal displacement of permanent maxillary canines is associated with a four-fold higherprevalence with agenesis of second premolars (Bjerklin et al., 1992; Baccetti, 1998). Palatal canines did also occur in families together with agenesis of incisors, premolars and third mo-lars (Svinhufvud et al., 1988; Pirinen et al., 1996). Thus, a general and presumably geneticetiology related to tooth agenesis, was suggested.
Rotation of premolars and that of maxillary lateral incisors have been found to be associated with the agenesis of the same teeth (Baccetti, 1998; Arte, 2001). Half of the patients withtransposition of maxillary canines and first premolars may also present with tooth agenesis(Peck et al., 1993; Camilleri, 2005).
In the molar region, agenesis of permanent premolars and infraposition of primary molars are associated (Bjerklin et al., 1992; Baccetti, 1998). Malposition of first permanent molarsoccurs with a prevalence of 4.3 % (Bjerklin and Kurol, 1981) and may show familial accu-mulation (Kurol and Bjerklin, 1982). It has been shown to be increased among patients with premolar agenesis (Bjerklin et al., 1992; Baccetti, 1998). However, eruption failure of first molars was reported to have a significant association with rotated lateral incisors, malposi-tions of canines, and infraposition of the primary molars, but not with tooth agenesis or peg-shaped lateral incisors (Baccetti, 2000).
47
Enamel defects
Some authors have reported a high incidence of enamel hypoplasia among patients with tooth agenesis (Lai and Seow, 1989; Baccetti, 1998). Enamel hypoplasia was also describedas a phenotypic feature in a family with recessive inheritance of tooth agenesis (Ahmad etal., 1998). The co-occurrence of enamel hypoplasia and agenesis could be explained by an underlying defect in the epithelium or a defect in signaling between the tissue layers. Failureof tooth development and enamel defects has been linked e.g. by mutants of Msx2 and Pax9and disruption of the epithelial Shh signaling affect both tooth formation and ameloblast dif-ferentiation in mouse (Aioub et al., 2007; Kist et al., 2005; Gritli-Linde et al., 2002).
Etiology of tooth agenesis
While several potential and verified environmental (postgenetic) etiological factors for tooth agenesis have been presented, there is definitive proof that genetic factors play a major role in the etiology (reviewed by Burzynski and Escobar, 1983; Graber, 1978; Vastardis, 2000). The role of the genetic factors was suggested by observed familial occurrence, prevalence differences between populations, and association with heritable syndromes as well as by twin and family studies, but definitive evidence has been acquired during the molecular ge-netic era: defects in several genes have been shown to cause agenesis and anomalies in size and morphology (Table 1). On the other hand, the findings have also confirmed the complex-ity of the relations between genotypes and phenotypes. Postgenetic events are important even for the final manifestation of truly dominant gene defects and it is obvious that they are even more critical for action of predisposing variants considered as risk alleles.
As described above, agenesis and reduction of tooth sizes are associated. As this association is relevant from the pathogenetic point of view, some etiological factors that affect tooth size will also be discussed in the following.
Environmental factors
Tooth agenesis and tooth size reductions have been related to trauma, maternal systemic dis-ease and various external factors (reviewed by Grahnen, 1956; Schalk-van der Weide, 1992; Arte, 2001; Hölttä, 2005). Among the maternal systemic disease, diabetes and different in-fections have been suggested. For example, developmental dental anomalies and tooth size reduction have been described in association of maternal rubella infection during pregnancy (Kraus et al., 1969). Maternal diabetes and hypothyroidism as well as high birth weight and length have been associated with an increase in tooth size and hypertension and low birth weight and length with a decrease in tooth dimensions (Garn et al., 1979). Small mesio-distaldimensions of the primary teeth among low birth-weight children has been described (Fearne and Brook, 1993; Seow and Wan, 2000) whereas contradictory results were obtained when permanent teeth were studied (Harila-Kaera et al., 2001; reviewed by Paulsson et al., 2004). In animal experiments, maternal low-protein diet were shown to decrease molar size and cusp number of the third molars as well as cause a delay of eruption (Holloway et al., 1961).
48
Definitive evidence for the involvement of environmental pollutants has been presented after studies of the victims of the dioxin accidents in Italy, Taiwan and Japan (Rogan et al., 1988; Wang et al., 2003; Alaluusua et al., 2004). The observed anomalies included natal teeth, de-layed eruption of permanent teeth, disturbed root development, agenesis of permanent teeth and enamel defects. In utero or lactational exposure for dioxins leads to increased agenesis of the third molars as well as reduction of the size of other molars in rats (Lukinmaa et al.,2001; Kattainen et al., 2001) and increase of tooth agenesis and anomalies in rhesus mon-keys (Yasuda et al., 2005). Maternal tobacco smoking has been associated with small butstatistically significant reduction of tooth size (Heikkinen et al., 1994). Same kind of effectsof other toxic compounds produced in urban society may be suspected.
The sensitivity of tooth development for childhood anti-cancer treatment by radiotherapy,chemotherapy and stem cell transplantation conditioned by whole body irradiation has beenshown in many studies (Jaffe et al., 1984; Näsman et al., 1997; Hölttä, 2005; reviewed by Dahllöf and Huggare, 2004). The dental effects may include agenesis, microdontia (i.e. con-siderable size reduction), developmental delays, root anomalies and calcification defects. The effects are dependent on the age when the treatment is given. A retrospective study by Hölttä (2005) showed a correlation between the age of the anticancer therapy and the effecton specific teeth. Agenesis of first premolars was mostly observed in the patients, who hadreceived treatment before the age of two years, whereas agenesis and microdontia of second premolars and second molars were common in the patients who were treated before the age of five years. However, in the youngest recipients under the age of two, second molars ap-peared unharmed. Advancing mineralization may protect the tooth from agenesis, even though a therapy coinciding with a late stage of development of a specific tooth may lead to microdontia. The correlations seem to show that the treatments are most deleterious at a rather late stage of development at the time of differentiation, suggesting that the tooth germ may regress although the morphogenesis has been nearly completed.
Is is generally held that while tooth development is under strict genetic control, jaw growth is dependent on functional demands, principally masticatory activity and needs, and also modified in the case of incomplete dentition (e.g.Brown, 1983). However, some authors con-sider agenesis of third molars as secondary to a reduction in jaw size (e.g. Kajii et al., 2004).Sengupta et al (1999) presented that, presumably as a result of more processed food, the fail-ure of eruption (impaction) of the third molars has significantly increased since the MedievalAges and especially since prehistoric times. The prevalence of agenesis could not be studiedin the prehistoric samples, and they could not find a significant difference in the agenesis between the Medieval and modern samples even though the data they presented showed higher prevalence for agenesis in the modern samples. It is difficult to envision an evolution-ary process or even relaxed selection acting on human dentition in such a short length oftime. While the reduction of size of the second and third molars during the hominid evolu-tion has been suggested to be driven by adaptation to the limitation of the available space in the jaws, this process has been considered as a result of selection of genotypes during a con-siderable length of time (e.g. Sofaer et al., 1970; Sofaer et al., 1972; see also Graber, 1978).
49
Tooth size variation and heritability
Tooth dimensions show some variation in the normal populations. The relative contributions to this variation of genetic and environmental (postgenetic) causes have been estimated ei-ther by studying correlations between first degree relatives (Sofaer et al., 1970; Alvesalo and Tigerstedt, 1974; Townsend, 1980; Potter et al., 1983) or differences in the correlations be-tween mono- and dizygotic twins (Osborne et al., 1958; Potter et al., 1976; Dempsey et al., 1995; Boraas et al., 1988; Dempsey and Townsend, 2001). Generally, the studies among the first degree relatives have shown a considerable genetic component for both mesio-distal and labio-lingual/palatal dimensions but the heritability estimates have been rather variable.Some studies suggested lowest heritability estimates as well as higher size variation for thelate developing teeth, suggesting that environmental factors would be more significant in the determination of the size of these teeth (Sofaer et al., 1970; Alvesalo and Tigerstedt, 1974). However, heritability estimates from twin studies have not supported specifically smallheritabilities for the size of the later-developing teeth (Dempsey et al., 1995; Dempsey and Townsend, 2001). In their studies with 149 monozygotic and 149 dizygotic twin pairs from Australia, Dempsey and collaegues (1995; 2001) estimated that the additive genetic compo-nent would in most cases account for over 80 % of the tooth size variation. Interestingly, they found only a 60 % genetic component for first molar dimensions, explained mostly by the relatively large contribution of shared environment. For the teeth most often affected by agenesis, they found only slightly less than average heritabilities for mesio-distal dimensions of maxillary second premolars (mean 76 %) and for labio-palatal dimensions of maxillary lateral incisors (mean 72 %). These estimates imply that agenesis of these teeth is predomi-nantly genetically determined and that the size of these teeth can independently be affected by selection and by an evolutionary process.
Twin studies on agenesis
Several studies have described tooth agenesis in identical (monozygous) and non-identical (dizygous) twins (Table 3). From these studies, it is obvious that non-identical twins have more disconcordant phenotypes. However, in several studies at least some pairs of identical twins were disconcordant for agenesis. Boruchov and Green (1971), and Townsend and col-laegues (1995; 2005) found that in majority of pairs of identical twins they studied, only one of the twins presented with tooth agenesis. In addition, if monozygotic twins were concor-dant for agenesis, they could have had different teeth missing. In a study by Townsend (2005), three of the pairs had identical phenotypes, eight pairs had different agenesis pheno-types and in 13 pairs only one of the twins was affected. Interestingly in all 11 pairs concor-dant for agenesis, teeth of the same class were affected, suggesting a genetic component un-derlying the phenotype. These studies showed that tooth agenesis cannot be fully explained by genotype. The variability of phenotypes of identical twins suggests a relatively low pene-trance of agenesis and rather high variability of phenotypic expression. Some authors have suggested that the role of genes has been overestimated (Boruchov and Green, 1971), while others consider the heredity as the most important factor but stress the variable expression and reduced penetrance. The latter has been explained by maternal factors as well as by the
50
Table 3. Twin studies on tooth agenesis
n pairs1)
prev
alnc
e of
agen
esis
(%)
n
conc
orda
nt
conc
orda
nt w
ithva
riabl
e ex
pres
sion
conc
orda
nt fo
rto
oth
grou
p
disc
onco
rdan
t
n
conc
orda
nt
conc
orda
nt w
ithva
riabl
e ex
pres
sion
disc
onco
rdan
t
Boruchov and Green, 1971 369 5.7 USA 9 2 2 ?2) 5 32 3 3 26
Gravely and Johnson, 1971 3 UK 3 0 3 2 0
Markovic, 1982 99; 66 Yugoslavia 9 ? 82) ? 1 5 0 0 5
Markovic, 1992 11 Yugoslavia 6 63) 0 6 0 6 0 0 6
Townsend et al., 19954) 122; 101 2.2 Australia 5 33) 0 3 2 3 0 0 3
Kotsomitis et al., 19965) 59; 42 8.4 Australia,Belgium 8 2 6 ? 0
Townsend et al., 20056) 278 6.3 Australia 24 3 8 11 13
1) pairs of monozygotic twins; pairs of dizygotic twins. In three studies, only monozygotic twin pairs were examined.2) identities of affected teeth not available3) identities of affected teeth identical if peg shape included4) includes agenesis of incisors only5) dizygotic twins significantly less correlated, but exact figures were not reported6) includes agenesis of maxillary lateral incisors and second premolars only
monozygotic dizygotic
intrinsic randomness of the developmental process, and especially by its self-organizing na-ture (Gravely and Johnson, 1971; Townsend et al., 1995; Townsend et al., 2005).
Segregation analyses in families
Different modes of inheritance for tooth agenesis have been suggested . For a definite evaluation of modes of inheritance, a segregation analysis in a large population sample to-gether with the access to phenotype data from first degree relatives is mandatory. Grahnen (1956) performed a segregation analysis of 171 families with tooth agenesis and found that altogether 26 % of sibs and 41 % of parents of the probands were affected and that in 73 % of the families at least one of the parents was affected. He concluded that the data were mostcompatible with an autosomal dominant inheritance with reduced penetrance and variable expression. His data have been revisited, however, with contradictory conclusions. Suarez and Spence (1974) concluded that Grahnen’s data was best fitted to a polygenic inheritance model, while Burzynski and Escobar (1983) reinstated Grahnen’s original conclusions.
A segregation analysis by Chosack and collaegues (1975) concluded that tooth agenesis was determined by polygenic inheritance. The conclusion was based on segregation of agenesis of distinct tooth classes. Thus, agenesis of incisors or premolars were considered as separate traits even inside a family.
Schalk-van der Weide (1992) analysed segregation with cases of severe agenesis as probands while family members with any type of agenesis and even microdontia were considered as affected. Thus, severe agenesis, observed only in some family members, did not segregate in
51
the families. The conclusions were compatible with Grahnen (1956), even though the author made reservations in favor for the polygenic inheritance model.
Special attention has also been paid to agenesis and reduced maxillary lateral incisors. Man-deville (1949) and Alvesalo and Portin (1969) concluded that agenesis of these teeth fol-lowed autosomal dominant inheritance and regarded peg shape as variable expression of the same gene.
Based on prevalence and family studies, Brook (1984) presented a modification of the etio-logical model of Bailit (1975) combining tooth agenesis with a quasicontinuous variation of tooth size. In this model, variation of tooth size is considered to be determined by a quantita-tive trait. Overcoming certain thresholds leads to agenesis or formation of supernumeraryteeth, i.e. continuous quantitative variation predisposes to discreet qualitative phenomena.Observations on which the model was based include association of reduced tooth dimensions(“microdontia") with agenesis and macrodontia with supernumerary teeth formation, de-pendence of magnitude of tooth size deviation on the amount of agenetic teeth, and a higher risk for the relatives of patients of multiple agenesis (Brook, 1984). Brook modified themodel to take into account the sex differences, i.e. smaller tooth dimensions and higher prevalence of agenesis in females and higher prevalence of supernumerary teeth in males, by including separate curves of variation and separate thresholds of agenesis and supernumeraryteeth formation for males and females. While proposing that the model is able to accommo-date the observations, he also made a reservation that in some cases a dominant inheritancemay be involved (Brook, 1984).
Arte and colleagues (2001) presented the dental characteristics in eleven Finnish familieswith apparent autosomal dominant inheritance of agenesis of one or more permanent teethcalled incisor and premolar hypodontia (IPH). The characteristics of these families included:
An apparent autosomal dominant inheritance, however with cases of obligatory gene car-riers who had normal dentition, especially in older generations, reflecting either reduced penetrance or difficulties of ascertainment.Concordance of agenesis phenotypes. In all families except two, primarily or exclusivelyeither incisor, usually maxillary lateral incisors, or second premolars were affected. Association of dental anomalies with agenesis. In addition to peg-shape of maxillary lat-eral incisors, especially taurodontic molars, ectopic canines and rotated premolars were found to be associated with agenesis in these families.
Molecular genetics
The most compelling evidence for the genetic etiology of tooth agenesis has been provided by the identification of gene defects associated with different types of tooth agenesis (Table 1 and references therein). In many cases, these results are complemented by experimentalmouse mutants. So far, gene defects have been identified that either cause severe tooth agen-esis (oligodontia) as a sole malformation (isolated or non-syndromic agenesis) or agenesis in association with multiorgan malformation syndromes. The tooth agenesis phenotypes associ-ated with syndromes in which the causative genes are known vary from extremely severe
52
e.g. in anhidrotic ectodermal dysplasias (EDAs) to phenotypes in which tooth agenesis re-sembling common hypodontia is observed only in a subgroup of patients.
Dominant defects in MSX1, PAX9 and AXIN2 have been described in families with isolatedsevere tooth agenesis (see Results and discussion). However, in association with defects inMSX1, nail dysplasia and some patients with oral clefts have each been described in single families (Jumlongras et al., 2001; van den Boogaard et al., 2000). In addition to causing se-vere tooth agenesis phenotype, a defect in AXIN2 also predisposed to colorectal cancer(Lammi et al., 2004). Recently, two defects that affected only dentition were also describedin EDA (Tao et al., 2006; Tarpey et al., 2007). All these gene defects cause severe types of agenesis. However, evidence for association of specific intragenic polymorphisms to tooth agenesis, apparently consisting mostly of common types of tooth agenesis, has been pre-sented for MSX1, PAX9, AXIN2, TGFA, IRF6 and FGFR1 (Vieira et al., 2004; Peres et al., 2005; Mostowska et al., 2006; Vieira et al., 2007).
The syndromes include, among others, ectodermal dysplasias and syndromes with oral cleft-ing, revealing common genetic pathways for development of teeth and other ectodermal or-gans as well as teeth and craniofacial structures. Striking examples are EDAs, in which de-fects in genes coding for the signaling ligand, its receptor and intracellular mediators of thesignal cause rather similar clinical phenotypes affecting teeth, hair and ectodermal glands (reviewed by Mikkola and Thesleff, 2003).
Observation of syndromic features in association with oligodontia in general (Schalk-van der Weide, 1992; Pirinen et al., 2001; Nordgarden et al., 2001) and with defects in MSX1 sug-gests that especially from the etiological point of view it is difficult to make strict distinctionbetween syndromic and isolated types of tooth agenesis. Furthermore, as described above, e.g. in the Msx1 and Pax9 null mutant mice several other defects besides tooth agenesis are observed, and so far a regulatory gene that would affect only tooth development has not been identified. Therefore, a qualitative distinction between syndromic and isolated phenotypes can be made mainly concerning individual phenotypes, which may reflect different positionson an etiological scale.
In general, the identified genes that are affected in isolated or syndromic agenesis, are almostexclusively regulatory genes the functions of which in many cases have been studied in mouse. Together, identified human and mouse genes in which defects affect tooth develop-ment involve all major signaling pathways and the transcription factors mediating these sig-nals.
Pathogenesis of tooth agenesis
While the studies described above have shown that genetic factors are most critical in the etiology of tooth agenesis in humans, they have not clarified the pathogenetic mechanisms.The studies in mouse mutants have helped to understand the underlying genetic networksand developmental consequences of disturbed gene function.
53
It has been suggested that specific vulnerability of certain teeth is explained by their ana-tomical position either in the distal end of the dental lamina (second premolars) or in the ar-eas of fusion of the facial processes (maxillary lateral incisors and mandibular central inci-sors) (Svinhufvud et al., 1988). On the other hand, it is also well-recognized that those teeth in each tooth class are most often affected that are initiated and develop latest (Dahlberg,1945; Clayton, 1956; Miles and Grigson, 1990). In accordance with the morphogenetic mod-els, this suggests that agenesis follows from a quantitative defect. In terms of Butler’s field theory, agenesis can be regarded as a critical decrease of the morphogenetic potential in the periphery of the field, following either from decrease of the field strength in general orchange of the steepness of the field gradient. Analogously, in terms of the clone theory, agenesis may be interpreted to follow from a decrease of odontogenic potential of the initial clones or a change in how this potential is consumed or regulated by activation or inhibition. Reduction of tooth number during evolution usually also affects the teeth that are initiatedlatest (Miles and Grigson, 1990; Weiss et al., 1998), suggesting that mechanisms affected in the evolutionary change may also underlie tooth agenesis. Indeed, some authors have re-garded the teeth that are affected by agenesis as vestigial organs (Clayton, 1956).
Mechanisms dependent on quantitative aspects are also suggested by associations of tooth size reduction to tooth agenesis, as described above. This association and observed features of quantitative trait genetics in familial tooth agenesis were used as foundations for the mod-els presented by Bailit (1975) and Brook (1984), which explained tooth size variation by an underlying multifactorial quantitative trait and tooth agenesis and supernumerary teeth for-mation mainly as extreme expressions of this variation. These concepts were supported by observations of Grüneberg (1951) in an inbred mouse strain. In this strain, the variation of the size of the third molars, determined by a quantitative trait, extended to such exceptionallysmall values that predisposed for agenesis, apparently precipitated by prenatal conditions. However, tooth agenesis and reduction of tooth sizes are linked also in association of defects in single genes, e.g. in EDA and also in families with mutations in PAX9 (e.g. Lammi et al., 2003). Thus, it is clear that tooth agenesis may not be solely explained by predisposition be-cause of quantitative variation, acknowledged also by reservations made by Brook (1984). Instead, it is probable that in the pathogenesis of tooth agenesis quantitative aspects play an important role, both on the level of tooth classes and on the level of individual teeth.
Tooth size variation is limited to a certain range, apparently by regulative developmentalmechanisms capable also to compensate for earlier deviations (Glasstone, 1963). Occurrence of truly microdontic teeth as observed after childhood cancer treatments (Hölttä, 2005) ap-pears to be rather rare (personal communications). Thus, if agenesis follows from a quantita-tive failure, the quantitative defect must somehow be converted to a qualitative change dur-ing development. Regressing rudimentary tooth germs in wild-type animals suggests exis-tence of developmental thresholds that need to be overcome for the development to proceed (Tureckova et al., 1995; Keränen et al., 1999). Developmental thresholds are also recognized from experimental mouse null mutants in which inactivation of specific genes arrest tooth development at specific stages (Table 1). In many of these mutants, complete inactivation ofa gene arrested the development of all teeth or a whole tooth class, while heterozygotes for these mutants usually develop normal dentition. Transgenic mice with hypomorphic allelesof Pax9 showed that quantity of activity of a single gene is critical for tooth development
54
and that decreasing this activity leads to gradually more severe phenotypes, the most sensi-tive teeth being the ones that develop latest. These mice also connected retarded develop-ment to agenesis and suggested that developmental arrest may happen at several stages, even at late bell stage (Kist et al., 2005).
Models for the effects of a quantitative change in the amount of a single gene product arealso provided by mutants, in which a signaling gene is overactivated or the level of an an-tagonist is manipulated (Table 1). Particularly interesting are mutants in which Eda is over-expressed in the epithelium or in which signaling antagonists ectodin (antagonist of BMP and Wnt signaling), Sprouty2 or Sprouty4 (antagonists of FGF signaling) are inactivated (Mustonen et al., 2004; Kassai et al., 2005; Klein et al., 2006): in these mice supernumeraryteeth develop from rudiments that are arrested in wildtype mice, thus overcoming develop-mental thresholds. Arrest of organ development at certain stages have been seen as a mecha-nism for evolutionary change in dentition (Keränen et al., 1999; Peterkova et al., 2002; Klein et al., 2006) but these mice may also serve as useful models for tooth agenesis in humansand for the role of individual genes and genetic networks.
The pathogenesis of human tooth agenesis is perhaps best understood in anhidrotic ectoder-mal dysplasias. In this case the molecular pathogenesis and the phenotypes in human patients and mouse mutants are directly comparable. The gene defects in EDA, EDAR, EDARADD,IKK and their mouse homologs, i.e. the signaling ligand, its receptor and the intracellularmediators of the signaling, cause complete inactivation of this signaling pathway (reviewed by Mikkola and Thesleff, 2003). In the mutant mice, incisors and third molars commonly fail to develop and first molars are hypoplastic, while in the patients with anhidrotic ectodermaldysplasia, both dentitions are severely affected and tooth morphology is simplified (Pispa et al., 1999; Präger et al., 2006; Lexner et al., 2007). The phenotypes of the mice with impair-ment or overexpression of Eda signaling suggest that early defects of ectodermal placodes and, in teeth, the enamel knots would explain the ectodermal defects in human patients (Pispa et al., 1999; Mustonen et al., 2004). Thus, failure of signaling at an early stage leads to anomalies that are present also in the deciduous dentition. On the other hand, as the mu-tant and disease phenotypes are caused by complete inactivation of the signaling pathway, the partial albeit severe tooth agenesis phenotypes suggest redundancy in the function of thesignaling pathways, i.e. that different signaling pathways have overlapping functions. Thisredundancy adds a further element explaining how different gene defects may cause partial agenesis.
In the report of the first identified gene defect in MSX1, the authors suggested that the partial and selective tooth agenesis reflected a patterning defect possibly related to the “odontogenic homeobox code” underlying the development of different teeth (Vastardis et al., 1996). They suggested that the defect had a dominant negative effect but showed later that it caused loss of function (Hu et al., 1998). As described later (see Results and discussion), the gene de-fects in human MSX1 and PAX9 are essentially loss of function mutations and cause haploin-sufficiency by reducing the amount of the functional protein to one half (Hu et al., 1998; Daset al., 2002; Nieminen et al., 2003). Thus, it is probable that the selective tooth agenesis is explained by differential sensitivity to gene dosage. The phenotypes of the hypomorphicPax9 mutants (Kist et al., 2005) show that the late developing posterior molars are especially
55
sensitive for a reduced Pax9 dose. The functions of mouse Msx1 and Pax9 are best under-stood as regulators of the signaling needed for the formation of the enamel knots (Peters and Balling, 1999; Jernvall and Thesleff, 2000), and this function has been connected with tooth agenesis in humans (Thesleff, 2006). It is not clear, however, how this relates to the selective tooth agenesis that affects mainly some teeth in the permanent dentition, i.e. secondary teeth and permanent molars. The pathogenesis of MSX1 and PAX9 defects will be discussed fur-ther in the General discussion.
The phenotypes in the family segregating a nonsense mutation of AXIN2 are striking in a sense that even in the two cases when only three permanent teeth had developed, the primarydentition was intact (Lammi et al., 2004). This suggested that AXIN2 function is especiallyimportant for the processes involved in tooth replacement and development of the permanentmolars. So far, excess -catenin levels have been mainly associated with enhancement of development and renewal of ectodermal organs (Gat et al., 1998; Alonso and Fuchs, 2003; Järvinen et al., 2006; Blanpain et al., 2007). The function of AXIN2 as a negative feedbackregulator suggests that it is needed at defined stages of tooth development to downregulate
-catenin activity. However, no data exist on the consequences of overactivation of -catenin activity in the dermis or dental mesenchyme. Furthermore, it has been shown that the Axin2 null mutant mice develop a craniosynostosis phenotype as a result of increased prolif-eration and differentiation potential of calvarial osteogenic cells (Yu et al., 2005). AXIN2haploinsufficiency may affect the regulation of the relationship between the tooth germs and the bone which may be critical for the long development of the teeth that were affected in association with the AXIN2 gene defects.
Tooth agenesis and cancer
The connection between tooth agenesis and cancer predisposition as a consequence of AXIN2 defects is explained by the critical role of Wnt signaling in tooth development (Andl et al., 2002; van Genderen et al., 1994; Järvinen et al., 2006) and the major contribution ofthe deregulation of intracellular -catenin levels to carcinogenesis (reviewed by Segditsas and Tomlinson, 2006; Giles et al., 2003). It is intriguing to consider a more general connec-tion between tooth agenesis and cancer predisposition and that tooth agenesis could in somecases be an indication of the latter.
Importance of epigenetic events for the outcome of tooth agenesis suggests that agenesis may in some cases reflect inherited developmental instability. Increased cancer risk has been associated with developmental instability, developmental anomalies and evolutionary change (Narod et al., 1997; Galis, 1999; Galis and Metz, 2003). On the other hand, it has been sug-gested that major hereditary contribution to cancer is given by largely unknown alleles of low penetrance (Amundadottir et al., 2004; de la Chapelle, 2004), and some of these alleles may also contribute to the background of tooth agenesis. It is conceivable that defects in other genes, in addition to AXIN2, involved in Wnt signaling and regulation of -cateninlevel may also link tooth agenesis and cancer predisposition. Interestingly, it has been shown that expression of MSX1 is reduced in cervical cancer cells and that MSX1 stabilizes p53, awell known tumor suppressor protein (Park et al., 2005).
56
HUMAN GENETICS AND GENE DEFECTS
The human genome
During the last hundred years, significant understanding of the basis and mechanisms of he-redity has accumulated. Major steps in this process include recognition of the significance ofMendel’s laws, understanding that chromosomes carry the heritable determinants, discovery of the structure of DNA and deciphering of the genetic code, development of the recombina-tion DNA technology, and, finally, ability to catalogue whole genomes at the DNA sequence level (reviewed by Dunwell, 2007). Application of increasingly powerful genetic mappingand positional cloning methodology has led to the identification of thousands of disease causing loci, and tens of thousands of individual gene defects. The international efforts to catalogue the DNA sequence of the whole human genome, first drafts of which were pub-lished in 2001, made identification of disease causing gene defects even more straightfor-ward, and have made it possible to understand genotype-phenotype relationships at a higher, whole genome level. This is facilitated by technological as well as conceptual advances re-garding the genome structure and abilities to consider, in addition to single genes, whole gene networks, and to extract information based on conservation of sequences in the ge-nomes of different species (reviewed by Kidd et al., 2004; Boffelli et al., 2004).
Human genome consists of 22 pairs of autosomes, two sex-determining chromosomes, and the mitochondrial DNA. One of the sex-chromosomes with one from each autosome pair constitute a haploid genome, which is inherited from each parent and after random segrega-tion and crossover events transferred to a child. MtDNA is inherited in the ovum from the mother to the child. In a process of producing gametes, meiosis, approximately 35 crossover events reshuffle parts of the parental chromosome pairs, and the resulting jigsaws becometransmitted to the progeny, thus determining the so-called genetic length of the genome as 35 Morgans. A haploid genome of a gamete contains approximately 3.1 * 109 basepairs. Ac-cording to current statistics, the human genome contains approximately 20000-25000 pro-tein-coding genes (Little, 2005; see also http://www.ensembl.org). In addition, the gene maps in public access internet databases contain a lot of potential predicted genes. The usageof alternative transcription start sites and an alternative mRNA-processing (“splicing”)makes it possible to produce a much larger amount of different proteins than is the amount of genes in the genome. The gene content is also complemented by an increasing amount of non-protein-coding RNA genes including the micro-RNAs (Cobb and Duboule, 2004; Hobert, 2007). The genomic length covered by the genes accounts only for one fourth of the whole genome length, and the actual protein coding sequence has been estimated as only two % of the genome length. However, the non-coding sequence contains important regulatory and structural elements affecting gene expression and genome maintenance, and also a lot of conserved elements of as yet unknown significance. Remarkable part of the genome is cov-ered by different types of repeat elements (Levy et al., 2007). Several gene families existwhere extensive gene duplications create variation between individuals (Freeman et al.,2006). Finally, whole genome sequencing has revealed the extent of genetic variation, rang-ing from large sequence blocks to single nucleotide changes (reviewed by Kidd et al., 2004; Feuk et al., 2006).
57
Figure 6. Common types of sequence changes in an idealized “gene” (exons and introns are usually significantly longer!). Exonic sequences are written with capital letters and promoterand introns with lowercase. Examples of sequence changes are shaded. Codons and a CA-repeat in the intron are underlined. Sequence changes that do NOT change an amino acid, af-fect the reading frame or create a stop codon, may affect regulation of the gene activity ormRNA processing (splicing). Appearance of a termination (“stop”) codon as a result of a mu-tation often leads to degradation of the mRNA instead of translation to a truncated protein.
Variation
Chromosomal aneuploidies and major chromosomal abnormalities account for the mostgross, usually rare forms of genetic variation. While aneuploidies and most abnormalities(large deletions, partial trisomies and most translocations) are not inheritable, some of theless deleterious deletions and translocations may be transmitted to progeny. The genetic variation transmitted from a generation to another includes duplications and deletions of large sequence segments as well as repeat elements (Kidd et al., 2004; reviewed by Feuk etal., 2006; Levy et al., 2007). The repetitive sequences are common in the centromeric re-gions of chromosomes (satellite DNA) but they may also exist in regions of euchromaticDNA, and involve functional genes. Repetitive sequences of short fragments from two to a few basepairs (short tandem repeat polymorphisms, STRPs, also called microsatellites) havebeen extensively used as genomic markers in construction of genetic maps and in localiza-tion (mapping) of disease genes (Weissenbach et al., 1992; Dib et al., 1996). Most abundant variation, however, consists of single nucleotide polymorphisms (SNPs), insertions and dele-tions (Kidd et al., 2004) (Fig. 6). The human genome contains over 10 million SNPs (Feuk etal., 2006; Estivill and Armengol, 2007). On the average a polymorphic SNP occurs once in 300 basepairs (Feuk et al., 2006). In the genome of one individual more than two millionsites may be heterozygous (Levy et al., 2007). Different genomic variants and alternative
58
sequences of the polymorphisms are called alleles. While only a small fraction of the varia-tion affects protein structure (variation in exons affecting codons), silent changes and varia-tion outside the coding regions are regarded potentially important for gene regulation and evolutionary change.
Sequencing of whole human genomes has also revealed a substructure of chromosomes,called haplotype blocks (reviewed by Wall and Pritchard, 2003). These blocks reflect differ-ent magnitudes of linkage disequilibrium between SNPs made possible by uneven distribu-tion of meiotic crossing-over events during generations.
Already before the whole genome sequencing, the observed sequence variation made it pos-sible to construct high density genetic maps of the human genome to serve as frameworks inthe disease gene mapping (Donis-Keller et al., 1987; Weissenbach et al., 1992; Dib et al., 1996). The first maps were based largely on restriction length polymorphisms, usually caused by SNPs (Donis-Keller et al., 1987), followed by microsatellite maps (Weissenbachet al., 1992; Dib et al., 1996). These were followed by the physical maps and subsequent whole genome sequencing (Cohen et al., 1993). Along with the whole genome sequencing, SNP-based mapping methodology has become reasonable (Kruglyak et al., 1997).
From genotypes to phenotypes
Malformations and other genetic diseases may be caused by a defect (“mutation”1) in a sin-gle gene and usually then follow Mendelian inheritance (OMIM, http: //www.ncbi.nlm.nih.gov/OMIM; Fig. 6). Gene defect may cause a disorder either when present as one copy, i.e. in a heterozygous state (dominant diseases) or only when both gene copies are defective (ho-mozygotes or compound heterozygotes in recessive disorders). The consequence of a genedefect may be loss of function, gain of a new function or it may also prevent the function of the unaffected allele (dominant negative). The genetic factors present in an individual consti-tute the individual’s genotype. The phenotype (the appearance, fitness and health of an in-dividual) is a result of an interplay of the genotype and postgenetic factors, i.e. epigenetic,maternal, and environmental factors.
Similar phenotypes may be caused by defects in different genes (genetic heterogeneity) as seen in many malformation syndromes such as craniosynostosis syndromes or anhidrotic ectodermal dysplasias (reviewed by Wilkie, 1997; Mikkola and Thesleff, 2003). Allelic het-
1 Sequence variants that cause a phenotype and are rare (e.g. gene frequency less than 0.01) have traditionallybeen called mutations, whereas more common variants have been classified as polymorphisms. This relates to the thinking that rare causative sequence variants are considered results of recent mutation events because dueto harmfulness they tend to vanish from the population gene pool. However, recessive gene defects can be veryold because of no selection against them. Furthermore, all sequence variants are results of mutations. A fre-quency criterium does neither reflect the real contribution of a sequence variant to the pathogenesis. For thisreason, it could be more appropriate e.g. to use terms gene defect for variants that have high penetrance andrisk allele for variants that have low penetrance (and may be common in the population). Still, there remainsthe problem of determining the limit between high and low penetrance. One criterium could be whether thedisease phenotype caused by the variant can or can not be shown, respectively, to follow Mendelian inheri-tance.
59
erogeneity, a form of genetic heterogeneity in which a disease may be caused by different gene defects in a single gene, is according to current view rather a rule than exception when malformations or single gene diseases are considered (Weiss, 1996; Wilkie, 1997). In somecases, allelic – or even identical - gene defects may also cause phenotypes or diseases thatare or have been considered separate entities as in the case of gene defects in p63, IRF6 and the genes for the FGF receptors (reviewed by van Bokhoven and McKeon, 2002; Kurotaki et al., 2002; reviewed by Wilkie, 1997). For example, defects in the FGFR2 have been found in several craniosynostosis syndromes, and in some cases identical amino acid changes have been identified in patients with diagnoses of different syndromes (Wilkie, 1997).
In many diseases, the correlation between the genotype and phenotype is strong and they fol-low Mendelian inheritance. In these cases, such as many diseases of the so-called Finnish disease inheritage, it has been relatively straigthforward to localize the disease-causing gene.However, the relationship between a genotype and a phenotype may also be rather complex.The dependence of the phenotype on other genetic factors (“modifier” genes or “genetic background”), epigenetic and external factors is reflected as different degrees of variableexpressivity (different phenotypes among individuals) and often as reduced penetrance(some individuals with no disease even though the individual carries the gene defect or geno-type associated with the disease). Redundancy between genes and genetic pathways maymask the effects of loss of function mutations. Diseases, in which a single gene has a majoreffect, usually follow Mendelian inheritance patterns (exceptions are diseases with genomicimprinting, i.e. effect of a parent's sex, and diseases caused by repeat expansion), albeit often with reduced penetrance and variable expressivity. These may include hypomorphic defects that by definition cause only a partial loss of function of the affected allele (Strachan and Read, 1999). It is thought that non-Mendelian or "complex" diseases are caused by defects (or rather risk variants or risk alleles1) that have low penetrance which may be consideredas having only a predisposing effect and usually require contribution of other genetic factors (polygenic diseases) or extrinsic factors (multifactorial diseases) to cause the disease(Strachan and Read, 1999; Reich and Lander, 2001; Peltonen et al., 2006). The borderline between "Mendelian diseases" and "complex diseases" may often be, however, rather arbi-trary, as are borderlines between alleles of "high" and "low" penetrance. It is assumed that defects in single gene diseases usually reside in the protein coding region, affecting the read-ing frame or the protein sequence, while risk variants rather affect the sequences importantfor the regulation of gene expression (Reich and Lander, 2001; Peltonen et al., 2006) (Fig. 6). Genes, in which coding region defects have been identified, are often first candidates also in search of the risk variants.
Gene identification
To identify gene defects that cause a genetic disease, two approaches exist. It is possible ei-ther to study candidate genes or perform a genome-wide search. Candidate genes can be sub-jected to sequence analysis, either by sequencing or indirect methods, or, if possible, the ex-pression levels in the patients can be compared to those of healthy controls. Candidate genescan also be studied by genetic analysis based on linkage or association. Genetic analysis isusually able to detect also the involvement of sequence variants that reside outside the cod-
60
ing region and may affect the regulation of gene expression. However, genetic analysis is possible only if a reasonable amount of patients is available. If the candidate gene approach has not provided positive results or is not feasible and a suitable sample of patients is avail-able, a genome-wide search, also called positional cloning, can be performed.
Figure 7. Recombinants and non-recombinants.During meiosis, parental chromosomes are ran-domly segregated to the gametes. An individualis a recombinant with respect to two genes or polymorphisms (A and B) if he or she inherits alleles (A/a and B/b) originating in differentgrandparents. Expected proportion of recombi-nant progeny decreases from 50 % if the loci are located so near each other that the expected amount of crossovers of the parental chromo-somes between the loci during meiosis de-creases.
Two properties (diseases, phenotypes, sequence variation) are segregated randomly if theirgenotypic determinants reside in different chromosomes or in the same chromosome but rea-sonably far from each other, allowing a good chance for crossover events between them(Terwilliger and Ott, 1994; Strachan and Read, 1999). In this case, recombinant and non-recombinant progeny are observed with similar frequency (individual who inherits alleles oftwo genes from one parent that originated in different grandparents is called a recombinant,see Fig. 7). If they are located relatively near each other in a chromosome, crossovers be-tween them are rare. As a result, they will segregate nonindependently, i.e. be in linkage,and a fraction of recombinants will be less than one half. Thus, the estimate of the recombi-nation fraction can be used to estimate the genetic distance of two genotypic determinants,forming the basis of linkage analysis (Terwilliger and Ott, 1994).
With experimental or domestic animals, the recombination fraction can be estimated simplyby counting the progeny with different phenotypes and evaluating the statistical significanceof the observations. In human genetics, for diseases following (reasonably closely) Mende-lian inheritance, a mathematical method based on evaluating observations from pedigrees may be used. In this method, a total likelihood is calculated for the observations assumingdifferent hypotheses, these in this case being different recombination fractions, i.e. distance of the disease locus and the analysed DNA marker. A 10-based logarithm of a likelihood ra-tio assuming linkage (recombination fraction less than 0.5) and non-linkage (recombination fraction 0.5), usually called the lod (logarithm of odds) score is used as an indicator of sig-nificance of results (Terwilliger and Ott, 1994). A lod score > 3 was initially considered sig-nificant, this score meaning that, with a given recombination fraction, a linkage is 1000
61
times more probable than the null hypothesis of non-linkage. A more stringent limit than e.g. the commonly used limit of p-value of 0.05 is necessary because of the inherent multiple testing. Even more stringent limits for significance have been suggested, based on experi-ence and theoretical considerations, especially in complex diseases (Strachan and Read, 1999).
In practice, the lod score method of gene mapping can be utilized if a reasonably large single family or many separate families are available (the lod scores are additive if the familiesshare a common genetic background). For traits following dominant inheritance, it may bepossible to obtain significant evidence for linkage with a single pedigree of 10-15 affected individuals, or alternatively, with several pedigrees. Recessive traits require several familieswith at least two affected children. Increasing the sample size provides better possibilities for limiting the locus size in terms of a recombinant free region. The locus identification be-comes less cumbersome, if a founder effect can be assumed in the history of the population or as a verified consanquinity loop (Terwilliger and Ott, 1994; Kere, 2001). In these cases linkage disequilibrium may be utilized. In recessive traits with a founder effect, regions ofhomozygosity have been searched utilizing samples of just a few affecteds (Nikali et al., 1995; Pekkarinen et al., 1998). Etiologic or genetic heterogeneity and high disease gene fre-quency, on the other hand, tend to make the analysis less straightforward. The same followsfrom reduced penetrance. The stringency of a genotype to a phenotype relation becomesweaker, decreasing the power of the statistical analysis.
Several computer programs have been developed for the estimation of the recombination fraction. The popular programs were based on the algorithm by Elston and Stewart (Lathrop et al., 1984). However, more effective algorithms have been developed for purposes of mul-tipoint analysis that evaluate linkage along a haplotype rather than with a single polymorphic marker. These are implemented e.g. in GeneHunter and Simwalk (Kruglyak et al., 1996; So-bel and Lange, 1996).
In the case of the so-called complex diseases, the penetrance is so low that an inheritancepattern can not be determined (Strachan and Read, 1999; Freimer and Sabatti, 2004). In these situations the so-called non-parametric methods of analysis can be applied. These are based on estimations of allele sharing among affecteds, either as identical-by-state (ibs) or as identical-by-descent (ibd). Software packages such as Mendel, GeneHunter and Simwalk implement these algorithms to offer elaborate statistical indicators for linkage (Kruglyak et al., 1996; Sobel and Lange, 1996).
Within complex phenotypes or diseases, because of a low occurrence of affecteds in one family, a different kind of strategy based on analysis of allelic association may be used (Strachan and Read, 1999; Freimer and Sabatti, 2004). A presumption for this analysis is that the affected individuals to a large extent share same predisposing genetic factors, i.e. ances-tral sequence variants. Instead of collecting large families, allele and genotype frequenciesmay be measured in a large sample of unrelated affected individuals and compared to fre-quencies among an equivalent sample of unaffected controls (case-control-design). Devia-tions from expected frequencies may be taken as proof of a causative role of the studied vari-ant itself or of a linkage disequilibrium with a causative genetic factor. An inherent problem
62
of the selection of an adequate control group can be avoided if instead of allele frequencies, frequencies of transmission of alleles from parents to offspring is estimated (e.g. transmis-sion disequilibrium test, TDT). The results of association analyses should be regarded criti-cally, and for reliable results, large samples shall often be studied, or positive results repli-cated in other studies.
A further methodology in genetic reseach involves mapping of quantitative traits. The sam-pling strategies are similar as in association analysis but instead of discrete phenotypes, cor-relations of quantitative measures to the observed allele frequencies are estimated (Mackay2001).
Technological development has greatly increased the possibilities for genome-wide studies. Instead of microsatellites, SNP genotyping using DNA-arrays is becoming a method ofchoice (Carlson et al., 2004). The final step of the process, sequence analysis, has also be-come fast and economical and new technologies are emerging. Thus the greatest limitation, in addition to funding, most probably is the identification and recruiting of a reasonable large sample of patients.
63
AIMS
The aim of the present study was to identify genes and gene networks that participate in thedevelopment of teeth and dentition. For this purpose, the study into the congenital defects of human dentition was undertaken. More specifically, the aim was to study
the inheritance of the incisor and premolar hypodontia, one of the most common con-genital malformations in humans, and identify causative genes the involvement of candidate genes into the etiology of the incisor and premolar hypo-dontiathe involvement of the candidate genes into the severe tooth agenesis in humansthe co-expression of genes during tooth development by developing a bioinformatic tool for this purpose.
64
MATERIALS AND METHODS
Subjects
The criterion (I, IV) for selecting persons with hypodontia (probands) was the congenital ab-sence of one to six permanent teeth or the presence of peg-shaped permanent upper lateral incisors. The probands were non-syndromic patients at the Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki. The probands and/or their par-ents were interviewed of the occurrence of hypodontia in their families. The study popula-tion comprised nine probands with hypodontia and their family members, totaling 149 indi-viduals in nine Finnish families (Fig. 8; Table 4). From these, five families with 42 familymembers participated in the study on involvement of MSX1 and MSX2 to tooth agenesis (I). Seven families were selected for the genome wide search (IV).
Information concerning general health was obtained by interview. A clinical dental examina-tion of the probands and their family members was performed by three experienced ortho-dontists (S.A., S.P., I.T.). In addition to hypodontia, other visible dental abnormalities were recorded. Panoramic radiographs were taken, if this was necessary for the diagnosis. In somecases, information on hypodontia was confirmed from documents and radiographs in dental files. In addition, retrospective dental data were collected by questionnaires and from dental files. Agenesis of the third molars was excluded because reliable retrospective data on themwere incomplete. Children under six years of age were excluded from the study.
The proband of family 1 in (II) was originally referred for treatment to the Pediatric Dental Department of the Hospital for Children and Adolescents, Helsinki University Central Hos-pital. The proband of family 2 was referred for consultation and treatment to the Departmentof Pedodontics and Orthodontics. The diagnosis of missing teeth was based on clinical and radiographic examinations. Retrospective dental information was collected from dental files. Agenesis of third molars was not possible to diagnose in the proband and in two brothers of the proband in family 1 because of their young ages.
We studied eight individuals with a deletion in the short arm of chromosome 4 (III). Seven of them had been diagnosed as Wolf-Hirschhorn syndrome patients while one was included in the study because of the presence of a 4p deletion. Their ages ranged from 5.8 to 21.7 yrs.Initial diagnoses had been made in the University Hospitals of Helsinki, Turku, or Tampereand been confirmed in early childhood with cytogenetics or fluorescence in situ hybridiza-tion (FISH). Congenitally missing teeth were assessed from panoramic radiographs. Of two patients from Rinnekoti Central Institute, two panoramic radiographs with several years' in-terval were available. In case of obscure regions in radiographs, the number of erupted teeth was confirmed in clinical examination. Signs of enamel hypoplasia and severely worn denti-tion were also recorded. The anatomy of the palate and structure of hair and nails were re-corded in a clinical examination or obtained from patient records.
The studies were approved by the Ethics Committee of the Institute of Dentistry, Universityof Helsinki. The study was conducted with the consent of the parents and the Rinnekoti Cen-tral Institute.
65
Table 4. Agenesis phenotypes in the incisor and premolar hypodontia families
family gen:id*) agenesis**) family gen:id*) agenesis
1 II:1 15 9 IV:6 peg 121 II:4 35 9 IV:8 351 II:6 35 9 IV:10 351 III:1 25, 35, 45 9 IV:11 151 III:2 35 9 IV:13 351 III:4 45 9 IV:17 35, 451 IV:1 35, 45 11 II:2 252 II:3 31, 41 11 II:4 35, 452 III:3 peg 12, peg 22 11 III:2 12, 22, 15, 25, 35, 452 IV:2 12, 22 11 III:3 35, 452 IV:3 12, 22 11 III:5 453 II:2 31 12 II:4 35, 45, peg 12, 223 III:1 peg 12 12 II:6 premolars6 I:1 12, 25, peg 22 12 II:8 13, premolars6 II:2 12, peg 22 12 II:10 15, 25, 35, 456 II:4 15, 35 12 II:12 14, 15, 25, 31, 35, 41, 456 II:5 peg 12, 22 12 III:4 35, peg 156 III:3 15, 35, 45 12 III:8 12, 22, 53, 637 I:1 peg 22 12 III:10 35, 457 II:1 15, 25 12 III:11 12, 22, 41, peg 317 III:1 15, 25 12 III:12 31, 41, 357 III:2 25 12 IV:1 15, 25, 35, 45, 27, 349 II:2 35 20 I:2 15, 259 III:4 peg 12 20 II:5 15, 25, 359 III:9 35, 45 20 II:7 15, 259 III:13 15, 25, 35 20 III:2 12, 35, 459 III:15 35 20 III:3 15, 259 III:18 14, 15, 24, 25, 35, 45 20 III:7 359 III:19 15, 25 20 IV:1 35, 459 III:22 35 20 IV:2 35, 45, cleft soft palate9 IV:1 25 20 IV:3 peg 229 IV:3 31, peg 12 20 IV:4 15, 35, 45
*) generation:subject in order from the left (compare to Fig. 8)**) missing teeth expressed as the FDI notation; peg, peg shaped incisor
DNA isolation
Venous blood samples, 10 to 20 ml, were taken for DNA analyses from all available familymembers. DNA was extracted from leukocytes according to standard procedures (Vanden-plas et al., 1984). DNA-samples of family 12 were isolated from venous blood samples by the DNA isolation service of the National Public Health Institute of Finland, Biomedicum,Helsinki, using a Autopure TM DNA purification system (Gentra, Minneapolis, MN, USA).
66
Figure 8. Pedigrees of families with autosomal dominant inheritance of incisor and premolarhypodontia. Squares, males; circles, females, black, affected; open, unaffected; ?, possibly af-fected; dot, carrier. For description of phenotypes, see table 4. Please note that different num-bers for families were used in Arte, 2001, and Arte et al., 2001.
Genotyping
The polymerase chain reaction (PCR) with amplifiable microsatellite markers was used forassessing the genotypes of the individuals (I, IV). PCR primers were obtained from Ge-nethon, France, or from the Department of Clinical Genetics, University Hospital of Upp-sala, Sweden, or they were synthesized in the Laboratory of Human molecular genetics ofthe National Public Health Institute, Finland, or bought from TAGC, Copenhagen, Denmarkor Oligomer Oy, Helsinki, Finland. When radioactive detection of PCR products was used, one of the primers was 5‘- end–labeled with 32P-phosphate with T4 kinase (Amersham, UK;Pharmacia, Sweden). PCR reactions were done in a Perkin-Elmer Cetus Thermal Cycler 480 (Norwalk, CT, USA) or DNA Engine (MJ Research, MA, USA) in a total volume of 15 µl containing 4 ng/ul chromosomal DNA, 0.4 uM of each of the primers, 0.2 mM of each of the deoxynucleotides, 0.25 U of enzyme, and 1.5 mM MgCl2 in a standard PCR buffer. Either Taq-polymerase (Amplitaq, Perkin Elmer Cetus, Ca), Dynazyme II or Dynazyme Ext (Finn-zymes, Finland) were used. 32P-labeled PCR products were made 50% of formamide and 10 mM of EDTA, pH 8.0, and separated in a 5% sequencing gel with 7.5 M urea in an IBI gel apparatus. Alleles were detected by autoradiography with Kodak films exposed for 15 to 48 hours and analyzed manually. Fluorescently labeled PCR products were analyzed in an ABI 377 sequencer (Applied Biosystems, Foster City, CA). Fluorescent alleles were detected
67
with ABI Genescan software and identified with ABI Genotyper software. For families 11,12, and 20 genome-wide genotyping of 365 microsatellites was provided by the Finnish Ge-nome Center, Biomedicum, University of Helsinki, Finland. The genotype data were stored and organized with dBase IV 5.0 for Windows software (Borland International, USA).
Linkage analysis (I, IV)
In the linkage studies (I, IV), the lod score method served for evaluation of the existence oflinkage (Ott, 1974). The hypodontia locus was modeled as an autosomal dominant, two-allele system with a gene frequency of the hypodontia allele of 8%. A penetrance of hypo-dontia of 86% was used (Burzynski and Escobar, 1983). The informativeness of the familymaterial was evaluated with the Slink software package, assuming an autosomal dominantmodel and gene homogeneity (Ott, 1989). Allele frequencies for marker alleles were calcu-lated from observed genotypes if data from a reasonable amount of founders was available, otherwise equal allele frequencies were used. The pairwise lod scores for different recombi-nation fractions were estimated by the Mlink and Ilink options of the Linkage package, ver-sion 5.1 7 (Lathrop et al., 1984). The multipoint location scores (corresponding to lod scores)were estimated with Simwalk software (Sobel and Lange, 1996) which was also used fortesting of genetic heterogeneity. In affecteds-only analyses, the phenotypes of the unaffectedindividuals were coded as unknowns.
Sequencing (II, IV)
For the sequencing analysis, exons of MSX1, PAX9, AXIN2 and TGFA were amplified in PCR by Dynazyme Ext polymerase (Finnzymes, Espoo, Finland). For analysis of exons of PAX9 in II, PCR products were purified from agarose gels by Qiaquick gel extraction kit (Qiagen, Bothell, Wa). Both strands of the PCR products were sequenced in both directions with ABI BigDye terminator chemistry (Applied Biosystems, Foster City, CA) and analyzed on an ABI 377XXL DNA sequencer. For other sequencings, PCR products were purified with ExoSAP-it reagent (USB, Cleveland, Ohio) and sequenced in both directions with ABI BigDye v.3.1 sequencing reagents. Sequencing products were analysed in the ABI 3730 cap-illary instrument in Molecular Medicine Sequencing laboratory, Biomedicum Helsinki. Primers as well as PCR and sequencing conditions were as described earlier (Nieminen etal., 2001; Lammi et al., 2003; Lammi et al., 2004) or as summarized in Table 7. Sequencing results were compared by BLAST2 (http://ncbi.nlm.nih.com/gorf/ bl2.html) with EMBL en-tries M76731, M76732 (MSX1), AJ238381, AJ238382, and AJ238383 (PAX9) as well as ge-nomic sequence entries from NCBI NT_010783.13 (AXIN2) and NT_022184.14 (TGFA).
FISH Analysis (III)
Chromosome preparations for FISH were made from cultures of blood lymphocytes. DNA samples from cosmid clones 2A1 and 15A2, spanning a region of 40 kb and containing the entire MSX1 coding region (gift from Dr. Jane E. Hewitt), were labeled with biotin 14-dATP by means of a BRL-nick translation kit (Bethesda Research Laboratories, Gaithersburg, MD, USA). Denaturation of the target cells, hybridization, and detection were carried out as de-scribed elsewhere (el-Rifai et al., 1995).
68
Table 7. Conditions and primers for the sequence analysis of MSX1 and TGFA
exon primer sequence*) ann. T, cycles**)
addDMSO
ann.T***) add
MSX1 1 F CCCGGAGCCCATGCCCGGCGGCTG hot 64 32x 5 % 60R CTCCCTCTGCGCCTGGGTTCTGGCT
2 F ACTTGGCGGCACTCAATATC hot 59 32x 2 % 59R AGAGGCACCGTAGAGCGAG
TGFA 1 F GGTAGCCGCCTTCCTATTTC hot 58 32x 58R GCAGCCAGGTAAGCAGGTAG
2 F GTGCTTTTCATGGGCATTTT hot 58 32x 58R GAGCTCTTGAGGAGCCACAC
3 F TGGAAAGCACGCTATACAGG hot 58 32x 58R CCATGAGTGACCTGAGATGC
4 F CTCCAGGATTTGGCACAGTC hot 58 32x 58R ATACTGCGGATGTCCCTGGT
5 F GGGTAGCCAACAGATGCTTT hot 58 32x 58R TTCCTTTTCTCCTCTCTTCCTG
6 F CCACCCCTTACAGGATCTGA hot 58 32x 58R CCGTCTCTTTGCAGTTCTTTT
*) all primers were used in the final concentration of 1 uM**) hot start, annealing temperature, number of cycles***) annealing T, 25 cycles
sequencingPCR
1 MBetaine
Gene expression data collection (V)
The data on expression of genes were collected mostly from published literature and to a smaller extent from direct submissions from the researchers. The data was first collected to a form on paper and subsequently stored to tables designed in dBase 5.0 for Windows soft-ware. Standardized schematic drawings were used to indicate subtissue-level resolution and gradients of expression when unambiguous illustrations were available. The drawings were made in CorelDraw v. 5 to 8 (Corel Corporation, Ottawa, Canada) and exported in JPEG format.
WWW implementation (V)
dBase 5.0 for Windows scripts were written to produce WWW-pages in HTML format forgene lists, pages for individual genes and notes. The pages were stored in the WWW-serverof the Institute of Biotechnology, University of Helsinki, Finland, and updated with regular basis.
69
RESULTS AND DISCUSSION
MSX1 and PAX9 in dominantly inherited severe tooth agenesis (publica-tions II and III)
During the studies described in this thesis, researchers elsewhere made important contribu-tions to clarify the genetic basis of human tooth agenesis. It was shown that the mouse null mutants of Msx1 and Pax9 did not develop any teeth, but development was arrested at an early stage (Satokata and Maas, 1994; Peters et al., 1998). Vastardis and collaegues in the Harvard university (1996) identified a missense mutation in the MSX1 homeobox that wasassociated with dominantly inherited severe tooth agenesis (oligodontia) in a family of Afri-can origin. Later this mutation was shown to disturb the three-dimensional folding of the MSX1 protein and its ability to bind to its cognate DNA sequences (Hu et al., 1998). A few years later, Stockton and collaegues (2000) identified a frameshift mutation within the DNA-binding paired domain of the human PAX9 gene in an American family segregating severe agenesis. These first findings suggested that defects in these two genes were associated with somewhat different types of agenesis. In the family segregating the MSX1 mutation, the agenesis rather uniformly affected second premolars and third molars, in addition to variableagenesis of some other teeth. On the other hand, the PAX9 mutation was strikingly associ-ated with agenesis of permanent molars, however, with variable agenesis of other teeth inthis case, too.
These findings inspired the studies of dominant severe tooth agenesis in Finnish families.First families to be studied were two small nuclear families with one of the parents and one or two of the children affected (Table 1 and Fig.1 in II). In a family with predominantly per-manent molar agenesis, resembling the phenotypes in the family described by Stockton et al (2000), a c. 1143A>T mutation creating a nonsense change Lys144Stop was identified in the paired box domain (Fig.2 in II). The same mutation was later identified in another Finnish oligodontia patient with no known relationship to the original family (unpublished). As thestop codon appeared in the middle of the DNA binding paired box, it was reasoned that it would cause loss of function. In another family no defects in MSX1 or PAX9 were identified.However, further family members were later recruited and a genome-wide scan with samplesfrom this family was conducted in collaboration with the Finnish Genome Center. This work led to the identification of a nonsense mutation in the AXIN2 gene (Lammi et al., 2004).
In another line of investigation of the genetic basis of tooth agenesis, the involvement of MSX1 to the tooth agenesis phenotype in association with the Wolf-Hirschhorn syndromewas investigated (III). This syndrome is caused by deletions in the short arm of chromosome4, and involves craniofacial abnormalities and mental retardation as the most prominent fea-tures. In some patients, tooth agenesis had also been reported, while on the other hand dental features may in many cases have become overlooked (Burgersdijk and Tan, 1978). The strong candidate for causation of tooth agenesis in Wolf-Hirschhorn syndrome patients was MSX1 in 4q32 (Ivens et al., 1990). A group of Finnish patients with Wolf-Hirschhorn syn-drome was studied and tooth agenesis recorded (Table 1 and Fig. in III). In a subsequentFISH analysis with a genomic MSX1 probe, it was shown that in all five patients affected by severe agenesis, the observed deletion spanned the MSX1 locus, presumably causing MSX1
70
haploinsufficiency (Table 1 in III). In one patient with a less severe agenesis, both copies of the MSX1 gene were found to be present. The severe agenesis phenotypes of the five patients roughly correlated with previous findings from families with defects in MSX1. This study offered direct evidence that the tooth agenesis associated with MSX1 defects was a result ofreduced amounts of the MSX1 protein, i.e. haploinsufficiency, thus corroborating the results from functional studies of the MSX1 protein with a missense mutation R196P in the ho-meobox (Hu et al., 1998).
Table 6. Gene defects in MSX1 , PAX9 and AXIN2 that cause tooth agenesis
gene exon type DNA (coding region) protein
Nieminen et al., 2004 gene deletions1 Kim et al., 2006 insertion 62-63insG G22RfsX1681 Lidral et al., 2002 missense 182T>A M61K1 van den Boogaard et al., 2000 nonsense 314C>A S105X2 de Muynck et al., 2004 nonsense 559C>T Q187X2 Vastardis et al., 1996 missense 587G>C R196P2 Jumlongras et al., 2001 nonsense 605C>A S202X2 Arte et al. (unpublished) deletion 690delG K231SfsX2322 Chishti et al., 2006 missense 655G>A A219T
Das et al., 2002 gene deletionDevos et al., 2006 gene deletion
1 Klein et al., 2005 nonsense 1A>G M1V2 Das et al., 2003 missense 62T>C L21P2 Lammi et al., 2003 missense 76C>T R26W2 Jumlongras et al., 2004 missense 83G>C R28P2 Zhao et al., 2005 insertion 109-110insG I37SfsX412 Zhao et al., 2005 missense 139C>T R47W2 Mostowska et al., 2003 missense 151G>A G51S2 Tallon Walton et al. (in press) nonsense 175C>T R59X2 Das et al., 2003 insertion 175-176ins288bp R59QfsX1772 Stockton et al., 2000 insertion 218-219insG S74QfsX3172 Kapadia et al., 2006 missense 259A>T I87F2 Das et al., 2003 missense 271A>G K91E2 Nieminen et al., 2001 nonsense 340A>T K114X2 Mostowska et al., 2005 delins 619_621delATCins24bp I207Y_X2114 Frazier-Bowers et al., 2002 insertion 792-793insC V265RfsX315
7 Lammi et al., 2004 nonsense 1966C>T R656X7 Lammi et al., 2004 insertion 1994-1995insG N666QfsX706
MSX1
PAX9
AXIN2
71
Figure 9. Genomic structures and known gene defects in MSX1, PAX9, and AXIN2. Num-bers below the schemes indicate amino acid positions. Standard amino acid codes are used in the description of mutations. X, appearance of a stop codon (nonsense or frameshift mu-tations); fs, a frameshift as a result of an insertion or a deletion; light grey, exons; mediumgrey, coding region; dark grey, code for the DNA binding domain; hb, code for the ho-meobox.
Until today, altogether 24 different sequence defects in addition to whole gene deletions in PAX9 and MSX1 have been published in association with dominant severe tooth agenesis (Fig. 9; Table 6). Our laboratory has been involved in identification of five mutations inPAX9, (II , Lammi et al., 2003; Klein et al., 2005; Tallon-Walton et al, in press; unpublished)and two in MSX1 (unpublished), in addition to the syndromic deletions described above. Thedefects have included nonsense and frameshift as well as missense mutations. In PAX9,whole gene deletions in two families and a mutation destroying the start codon in one familyhave been described (Das et al., 2002; Klein et al., 2005; Devos et al., 2006). For the first described defect, a frameshift in the paired box (Stockton et al., 2000), the mutated protein was shown to be unable to bind to known PAX target DNA sequences and to activate tran-scription (Mensah et al., 2004). Inability to bind to target DNA was also shown for two mis-sense defects (Jumlongras et al., 2004; Kapadia et al., 2006). For the mutation affecting theexon 2 – intron 3 junction, no mRNA carrying the mutated sequence was found in patientlymphocytes, presumably because of the degradation of the abnormal RNA by the nonsensemediated decay (NMD) mechanism (Mostowska et al., 2005). Although not studied, all mis-sense defects in exon 2 of PAX9 are susceptible to NMD (Wilusz et al., 2001). These results strongly suggest that, analogous to the defects in MSX1, the principal effect of known PAX9mutations is to reduce the amount of functional PAX9 protein, i.e. haploinsufficiency. This is also supported by the essential similarity of the associated phenotypes. Recognizing hap-
72
loinsufficiency as the cause of severe tooth agenesis implicates a dose effect of MSX1 and PAX9 protein in the pathogenetic mechanism.
The summary that can be built from the phenotypes associated with these mutations supportsthe conclusion drawn from the families first described: defects in MSX1 are characteristicallyassociated with agenesis of second premolars and third molars (frequencies of agenesis over80 %) whereas defects in PAX9 affect most strongly all the permanent molars (except for mandibular first molar, frequencies of agenesis are over 80 %)(Fig. 10; Table 7). It is alsoprobable that even though tooth size within the affecteds has been commented in only a fewreports (Nieminen et al., 2001; Jumlongras et al., 2001; Lammi et al., 2003; Jumlongras et al., 2004; Klein et al., 2005; Chishti et al., 2006), reduced dimensions, shortened roots and simplified forms are common in association with the defects in MSX1 and PAX9.
The increased amount of agenesis phenotypes associated with different mutations provides a possibility to attempt statistical analysis. Such an attempt is presented in Table 7, consisting of 39 patients with 7 defects in MSX1 and 63 patients with 13 defects in PAX9. As no sig-nificant differences between the frequency of agenesis in the left and right sides were ob-served, the frequencies from both sides were combined. Significant differences (p<0.001)were found between the maxilla and the mandible. For phenotypes associated with defects inMSX1, the first premolars in the maxilla were missing significantly more often than in the mandible, whereas in association with defects in PAX9, the second premolars and the first molars were missing significantly more often in the maxilla than in the mandible. In the inci-sor region, the central incisors were much more often affected in the mandible and the lateralincisors in the maxilla in association with the defects of both genes, a difference observedalso in the general population. In association with the defects in MSX1, agenesis of the lat-eral incisors in the manbible was almost as frequent as that of the central incisors, but thismay reflect difficulties in identifying the missing tooth in the mandible.
When the phenotypes associated with the defects in different genes were compared, a sig-nificantly higher frequency of agenesis was found for the maxillary first and second premo-lars and the mandibular second premolars in association with defects in MSX1 than with de-fects in PAX9, whereas agenesis of the maxillary first and second molars and the mandibularsecond molars was significantly more common in association with defects in PAX9. In addi-tion, the mandibular central incisors were significantly more frequently affected in associa-tion with defects in PAX9 than in MSX1, but as the relationship was the opposite in the case of the mandibular lateral incisors, these differences may again be explained by difficulties to distinguish agenesis of mandibular central and lateral incisors.
Results of this part of the analysis are similar to those presented by Kim et al (2006). In addi-tion to the results provided by Kim et al (2006), a significantly (p<0.001) higher frequency of agenesis of maxillary first molars in association of defects in PAX9 was observed. Thus, the most salient differences between the phenotypes are observed in the agenesis of premo-lars, especially the maxillary first premolars (higher frequency in association with defects in MSX1), and the second molars in both jaws as well as the maxillary first molars (higher fre-quency in association with defects in PAX9). These differences may be useful when differen-tiating severe agenesis caused by defects in PAX9 and MSX1. However, a further comment
73
concerning the agenesis of the third molars is warranted. Kim and collaegues (2006) did not take the agenesis of the third molars into account on the basis that because of the high fre-quency of the third molar agenesis in the population, it would be redundant for the purposes of the analysis. However, in view of the reported phenotypes in the literature (Table 7),agenesis of third molars is clearly an essential feature of phenotypes in association with de-fects in MSX1 or PAX9. While some patients who have defects, especially in MSX1, have developed at least some of the third molars, it is also possible that published reports may un-derestimate the third molar agenesis because of problems in diagnosis. This probably also explains the observed significant difference for agenesis of mandibular third molars in asso-ciation with defects in MSX1 (Table 7). It appears that the agenesis of third molars is strongly associated with defects in both genes, and presence of third molars should cause doubt whether these genes are involved in etiology.
It is also relevant to compare phenotypes in association with different defects in MSX1 and PAX9, i.e. to look for genotype-phenotype correlations. In the case of PAX9, the whole gene deletions and the start codon mutation appear to cause the most severe defects extending to the premolars and primary molars (Das et al., 2002; Klein et al., 2005). It has also been pre-sented earlier that missense defects in PAX9 are associated with slightly different phenotypes than other defects in this gene (Lammi et al., 2003). The analysis of figures in Table 7 (seealso Fig. 10) shows that agenesis of the first and second molars is significantly less common in association with missense defects in PAX9 than in association with other kinds of defects(p<0.05 for the mandibular second molars, p<0.001 for the other molars). Interestingly, agenesis of the maxillary canines appears to be more common in association with missensedefects. Thus, the missense defects more often leave the first permanent molars unaffected (Lammi et al., 2003). The differences may be explained by the assumption that in the case of nonsense, frameshift and especially missense defects, some functional activity of the protein is retained, possibly through a residual DNA-binding ability and especially through protein-protein interactions. For different mutations in MSX1, the genotype-phenotype correlations are less straightforward although also in this case it appears that deletion and nonsense muta-tions are associated with more severe phenotypes than missense mutations (Table 7).
Attempts to unravel the genetic basis of common tooth agenesis (incisor and premolar hypodontia) (publications I, IV)
The research summarized in this thesis was started with an effort to identify the genetic fac-tors, i.e. causative genes, that cause dominantly inherited common tooth agenesis, incisor and premolar hypodontia. Originally five Finnish families (1 ,2, 3, 6 and 7 in Fig. 8) were recruited into the study (I). In these families agenesis of one or a few second premolars,mandibular central incisors or upper lateral incisors, or in some cases, peg-shaped upper lat-eral incisors, had been observed to follow an apparently dominant inheritance. In one of these original families, only second premolars, and in two only incisors were affected, while in the remaining families both classes of teeth could be affected (Table 4). One obligatorycarrier was observed in these initial families, reflecting the reduced penetrance.
74
Table 7. Summary of tooth agenesis phenotypes associated with defects in MSX1 and PAX9
n /teeth
n / 3rdmolars
maxilla 1 2 3 4 5 6 7 8MSX1 all 78 72 0 27 5.1 72 94 18 12 85MSX1 missense 28 24 0 18 0 68 93 0 0 100PAX9 all 126 122 1.6 22 9.5 21 70 81 91 98PAX9 missense 50 48 0 36 24 26 60 62 80 96
mandibleMSX1 all 78 72 21 19 3.8 14 90 40 22 92MSX1 missense 28 26 7.1 21 0 14 93 32 7.1 96PAX9 all 126 122 47 7.1 1.6 6.3 45 40 88 97PAX9 missense 50 48 62 4 4 8 54 22 78 92
p values from chi2 tests1 2 3 4 5 6 7 8
MSX1, maxilla v. mandible <0.001 ns ns <0.001 ns <0.05 ns nsPAX9, maxilla v. mandible <0.001 <0.001 <0.05 <0.001 <0.001 <0.001 ns ns
max ns ns ns <0.001 <0.001 <0.001 <0.001 <0.001mand <0.001 <0.05 ns ns <0.001 ns <0.001 nsmax ns ns ns ns ns <0.05 <0.05 <0.05
mand <0.05 ns ns ns ns ns <0.05 nsmax ns <0.05 <0.001 ns ns <0.001 <0.001 ns
mand <0.05 ns ns ns ns <0.001 <0.05 <0.05
*) bold, frequency of agenesis > 60 %**) non-missense: deletions, frameshifts, nonsense, splicing mutations
MSX1 missense v. non-missense**)
PAX9 missense v. non-missense**)
MSX1 v. PAX9
agenesis % *)
As the first step, involvement of the most promising candidate genes was studied. In the ini-tial analysis, microsatellite markers in the MSX1 and MSX2 genes were genotyped in all available DNA samples (I). These paralogous genes were obvious candidate genes because of the known expression patterns of them during the mouse tooth development, also suggest-ing functional redundance (MacKenzie et al., 1991; MacKenzie et al., 1992). Further support for the role of these genes was provided by the findings that a mutation in MSX2 was respon-sible for the Boston-type craniosynostosis in man (Jabs et al., 1993). After the completion of our analysis, it also became known that inactivation of Msx1 in mouse leads to an arrest of tooth development at an early stage (Satokata and Maas, 1994).
Using the five families and intragenic microsatellite polymorphisms in the MSX1 and MSX2genes, exclusively negative total lod scores were obtained for the total family material, andno significant support for linkage was either observed in the individual families (Table 2 inI). When the segregation of the microsatellite alleles in the pedigrees was inspected, it wasobserved that in most families the affected family members had inherited different alleles forthese markers (Fig. 1 in I).
Subsequently, we presented a similar study on the involvement of other candidate genes, EGF, EGFR, FGF3 and FGF4. In this study, a few additional families (including family 9 in Fig.8) with comparable phenotypes were included. Also in this study the principal conclu-sion was that these genes did not explain tooth agenesis in the families studied (Arte et al.,1996).
75
Figure 10. Comparison of phenotypesassociated with gene defects in MSX1and PAX9. Only permanent teeth areshown. Darkness of the color ex-presses the frequency of agenesis.“PAX9 missense” includes only mis-sense defects, i.e. single amino acidchanges. Compare to table 7.
The investigation was expanded to other known candidate genes and finally to genome-wideefforts to identify causative loci (IV). For a genome-wide genotyping, only samples from the most informative families (1, 2, 6 and 9 in Fig. 8) and even a reduced set of samples fromthese families were used. After recruiting a further set of families (11, 12 and 20), samplesfrom these families were subjected to total genome wide genotyping in the Finnish GenomeCenter. In addition to markers included in the genome-wide searches with intervals from 10 to 20 cM, results from candidate gene loci as well as from fine mapping of the most promis-ing regions were used in calculation of the results described below. For these reasons, marker maps and densities for individual families are not identical. Samples of family 12 were analysed for 418 microsatellite markers, those from family 9 with 552 markers and those of the other families with 450-520 markers. However, multipoint analysis offers link-age estimates also from the marker intervals and makes it possible to compare and summateresults from different families.
The location score charts from the multipoint analysis by Simwalk showed that only rela-tively low scores were obtained when all the families were considered together, i.e. a genetic homogeneity was assumed (Fig. 2a,b in IV). The highest scores from the analyses of indi-vidual families are given in Table 8 and the genome-wide location score charts in Figs. 2c-lin IV. The highest scores obtained for family 9, the largest family, were also relatively low as compared to the expectations of the informativeness (Fig. 2i in IV). Indeed, no recombi-nant-free locus in the genome was found in this family, i.e. an area where all affected familymembers would have inherited a shared allele or haplotype. This probably reflected the pres-ence of multiple causative factors in this family, and accordingly the analyses were also con-ducted for subfamilies "91", "93" and “9p” (Fig. 8).
In most families (1, 2, 6, 11, 91, 93, and 9p) multiple positive but insignificant scores in the range of 0.7-2 were obtained (Figs. 2a,b,c,d,j,k,l in IV; Table 8) both in the normal and in theaffecteds-only analyses, reflecting the fact that because of the moderate size of the familiesseveral recombinant-free areas existed in the genome.
76
Table 8. Highest location scores from multipoint analysis by Simwalk
all family members
family chromo-some cM score chromo-
some cM score
1 2 87 1.801 2 87 1.8012 5 28 1.606 5 23 0.7816 7 98 1.691 several 0.77811 7 44 1.567 several 1.04512 12 56 2.431*) 2 59 1.33612 13 30 1.45920 18 39 3.059**) 18 39 2.009**)20 6 5 1.6219 12 88 1.263 21 10 1.60991 5 108 1.710 several 1.23793 1 225 1.576 several 0.797
9pm 8 138 1.804 several 1.168
*) affecteds-only analysis: location score for this locus 0,946; **) see text
affecteds-only
In family 12, the highest peaks in chromosomes 2, 12, and 13 were all obtained in areas, where also at least some recombinant affected family members were observed (Fig. 2g in IV). In family 20, the most promising locus was initially identified in chromosome 6 (Fig. 2h in IV) but after the fine mapping an affected recombinant family member (IV:4) was ob-served in this locus. Subsequent fine mapping of other promising regions led to an identifica-tion of a locus in chromosome 18, in which all the affected family members except IV:3 had inherited the same haplotype (location score 1.970). As IV:3 presented with a different phe-notype (one peg-shaped lateral incisor) than other affected family members and especiallyhis sibs (one or multiple missing second premolars), his phenotype was marked as unknown and a significant location score 3.059 was obtained (Figs. 2h and 3 in IV).
When the results from all the families were compared, there were some overlap of the sug-gested loci. The chromosome 2 locus where the highest score in family 1 was obtained over-lapped peaks from families 11 and 91. The locus in chromosome 18, that was identified infamily 20, was recombinant-free for the affecteds also in family 11, and the analyses offamilies 12 and 9p also gave positive scores in this region. Overlap of positive peaks were also observed in 8qtel, 10p and 17q. When gene heterogeneity was allowed in the analysis of all the families in these regions, support for linkage was obtained in chromosome 18 fromthe analysis that included family 9p (Fig. 3 in IV). In the other regions, allowing gene het-erogeneity gave suggestive but not significant scores (data not shown).
Results from the genome-wide search were also studied in relation to the known candidate genes, implicated either by known gene defects in man or by mouse mutants. While identi-fied defects in several of these genes show a strong dominant effect, it has been suggested that common types of tooth agenesis, such as incisor and premolar hypodontia in the familiesdescribed in this study, could result e.g. from hypomorphic alleles, and perhaps from alleles considered only as risk alleles (Vieira, 2003). For 6 cM wide regions around the most obvi-ous candidate genes, only negative or non-supporting scores were usually obtained (Table 4
77
in IV). The results excluded MSX1 and several other genes. AXIN2 could not be excluded in families 2 and 11, and MSX2 and PAX9 in family 6. For families 1, 2, 6, 11, 91 and 93, re-gions of at least one studied candidate gene gave suggestive scores. The highest peak from family 1 overlapped the TGFA locus, and the highest peak from family 11 with the AXIN2locus. However, as described above, in both families several other regions were identified in which affected family members had inherited a shared haplotype.
Sequence variants that have a strong dominant effect usually severely affect the coding se-quence whereas sequence variants for risk alleles affect the gene regulation and tend to re-side outside the coding region. Linkage analysis reveals also the involvement of sequence variants in non-coding regions. To complement the results from the linkage analysis, we also performed sequence analyses of exons and flanking sequences of MSX1, PAX9, AXIN2 andTGFA in the samples of the probands and some other affected family members. No sequencealterations besides common SNPs were identified in this analysis. This is in line with some previous studies, in which no sequence alterations were found in the coding regions of MSX1and PAX9 in association with common types of tooth agenesis (Scarel et al., 2000; Frazier-Bowers et al., 2003).
In conclusion, the results from the genome-wide search do not support the existence of a sin-gle or a major locus for incisor and premolar hypodontia or involvement of several candidate genes, especially MSX1. On the other hand, the results are most compatible with existence of several loci, some of which may contain a previously known candidate gene. However, mostcandidate genes could be excluded in our families. The strongest support was provided to anovel locus in chromosome 18. While it was initially presumed that incisor and premolarhypodontia would be caused by one or only a few causative genes, the results imply a re-markable genetic heterogeneity of incisor and premolar hypodontia, a fact that also signifi-cantly reduced the possibilities for identification of the loci.
Construction of the gene expression database (V)
The amount of data on gene expression in the developing tooth has increased rapidly since insitu hybridization methodology began to be applied in several laboratories. This created a need to collect existing data into a database which would help researchers to easily find data on gene expression, often published in papers not necessarily concentrating on tooth devel-opment, and to enable detection of co-expression of genes. As an additional benefit, collect-ing the data according to common principles and storing it in a common, formalized struc-ture, would also help to assess the quality of the data. To make it possible for everyone to browse the collected data, a WWW-based solution was the natural choice.
We fitted the data into six developmental stages: initiation, bud, cap, bell, differentiation and secretory stages. Later a specific stage covering root development was added. In the tables ofthe database, the expression data was coded for each tissue present during different stages of tooth development. However, when unambiguous visual view of the expression was avail-able, e.g. as illustrations of the publications, additional standardized schematic drawings were used to indicate subtissue-level resolution and gradients of expression. The data was
78
presented as lists selected from different viewpoints (tissue, stage, species, molecule class,methodology) and as separate pages for each gene containing the schematic illustrations and notes. In addition to minimum information, we included data on the methodology, properties of genes and literature references as well as on functional and experimental data, if available.Several links to other internet databases were added later.
The data was stored as tables in Borland dBase 5.0 for Windows software, and the WWW-pages in HTML format were produced by dBase-scripts. The schematic drawings were in-cluded to the WWW pages in the JPG format. Thus the WWW-site presented static, but regularly updated and intuitively organized pages.
The Gene expression in tooth (http://bite-it.helsinki.fi) site was first published on the eve ofthe 6th Tooth morphogenesis and differentiation meeting in Gothenburg 1998, and was posi-tively received by the researchers in the field. Currently the database contains altogether 435 gene expression records, but because of separate pages for different species and for expres-sion on the mRNA and protein levels, the amount of different gene homologs is smaller, cur-rently 330. 267 of them describe expression in mouse, while other species included are rat, human, sibling vole, cow, hamster and pig, listed in the order of the amount of the genes from each species. 323 pages describe expression on the mRNA level and 118 on the protein level. Half of the genes are signaling genes and one fourth transcription factors, reflectingthe interests of the researchers in the field.
During recent years, biological data in the internet accessible databases have remarkably in-creased, especially accelerated by the genome projects. Most of the data concern DNA and protein sequences and derived information, but also an increasing amount of expression data that have been produced by DNA-microarray methodology is available. So far, microarrayexpression data from developing teeth has not been made available in public databases. Re-cently a database offering in situ expression data has been launched by researchers in the Max-Planck-Institute (http://Genepaint.org). This database offers primary in situ hybridiza-tion views into gene expression in whole embryos with spatial resolution high enough to re-veal details in the the craniofacial region. Expression in teeth has been annotated. While of-fering data of a large amount of genes, ultimately covering all mouse genes, the database is so far limited to only certain stages of development. Thus, in terms of coverage of different stages and annotations, Gene expression in tooth has still retained an important function.
79
GENERAL DISCUSSION
Uncovering the genetic background of tooth agenesis
In the work presented in this thesis, we have clarified the genetic basis of dominantly inher-ited severe tooth agenesis (oligodontia). We have identified a nonsense loss of function mu-tation in PAX9 that segregated with agenesis in a Finnish family and shown that deletions of MSX1 are associated with severe agenesis. These findings contribute to the understanding that reduced amount of functional PAX9 or MSX1 protein, haploinsufficiency, is able to cause the severe, partial agenesis. On the other hand, we have studied the genetic back-ground of the common type of tooth agenesis, incisor and premolar hypodontia, in a set ofFinnish families where hypodontia phenotype follows autosomal dominant inheritance. As conclusions of this study, we found no support for the remarkable role of the most importantcandidate genes but found strong support for existence of at least one novel locus involved in the etiology of this phenotype.
The results confirm the heterogeneous genetic etiology of tooth agenesis. Together withother results from our and other laboratories, they help to clarify the genetic background of tooth agenesis in general.
So far, gene defects have been identified in association of either well-defined multiorgansyndromes or non-syndromic severe agenesis, oligodontia. For the latter, gene defects have been identified from families with fully penetrant oligodontia, that follows either dominant inheritance or results from de novo, dominantly acting, mutations. Gene defects associated with syndromes usually also have a strong effect on the molecular level, i.e. result in loss of function, dominant negative effect or possibly gain of function, but in different syndromesthe effect on tooth development may be strong or less penetrant and variable (Table 1). Re-gardless of the incomplete penetrance of tooth agenesis, diagnosis of a syndrome has been possible because of other salient features. Thus, it is common for the identified gene defectsthat they generally have a strong effect on the molecular function and have been identified from patients with relatively unequivocal diagnosis and mode of inheritance.
In our laboratory we have identified the causative gene defect in seven Finnish families withsevere agenesis, oligodontia (II; Lammi et al., 2003;.Lammi et al., 2004; unpublished). In addition, mutational analysis of MSX1, PAX9 and AXIN2 as well as of some other genes has been conducted with negative results in several other families with dominantly inherited se-vere agenesis. As our mutational screening covers only the exons, the immediate flanking sequences and immediate promoter regions, mutations in the important regulatory regions may have been left undetected. However, the sequence variation in the non-coding region has rather been associated with risk alleles (Reich and Lander, 2001), and it may be consid-ered unlikely that non-coding regulatory region sequence variants would remarkably con-tribute to this phenotype. Thus, it is premature to evaluate the relative contribution of MSX1,PAX9, or AXIN2 to the dominantly inherited non-syndromic severe tooth agenesis (see also Kapadia et al., 2007). It seems likely that as yet unrecognized genes defective in this kind of families will be identified in the future. EDA and its downstream partners may belong to these as shown by the recent reports (Tao et al., 2006; Tarpey et al., 2007).
80
In an ongoing study (unpublished), we have also studied a large group of patients whose par-ents or other family members did not present with severe agenesis. In fact, these constitute abigger group than the probands of families with dominant inheritance. So far we have been able to identify three gene defects in these probands. However, these represent either uncer-tainties of the parenthood or de novo mutations, which most probably are dominant by na-ture.
The majority of genetic causes of tooth agenesis remain largely unidentified. These include a remarkable fraction of severe agenesis, and especially those with no apparent dominant in-heritance, as well as all cases of common, less severe types of agenesis, including incisor and premolar hypodontia. Apparently, in the latter cases, defects and variants in genes in which strong defects already have been identified are most tempting candidates for causative fac-tors (Vieira, 2003). These could be hypomorphic defects (reduced activity instead of com-plete loss of function), or variants considered to represent "risk alleles". Studies exploringthe polymorphisms in MSX1, TGF PAX9, AXIN2, IRF6 and FGFR1 in association withtooth agenesis have reported associations with variable significance to specific alleles andhaplotypes (Vieira et al., 2004; Peres et al., 2005; Mostowska et al., 2006; Vieira et al., 2007). So far, it is reasonable to wait whether these results can be confirmed by further stud-ies. However, especially the associations of third molar agenesis to SNPs in the PAX9 pro-moter and tooth agenesis to SNPs in the exon 7 and intron 2 of AXIN2 seem promising(Peres et al., 2005; Mostowska et al., 2006). It is possible that these SNPs exert their effect either by affecting the binding of transcription factors or splicing efficiency, and would con-form to the idea that common phenotypes are caused by changes that affect the regulation of gene expression rather than the structure of the protein. Interestingly, the 169 bp allele of the intragenic microsatellite in the MSX1 gene appears to be associated with both tooth agenesis and oral clefting (Vieira et al., 2004; Suzuki et al., 2004), although the functional explana-tion remains obscure.
Our results from the families with apparent autosomal dominant inheritance of incisor and premolar hypodontia do not lend strong support for the involvement of the MSX1, TGFPAX9, AXIN2, IRF6 and FGFR1 or several other loci. Rather, our results suggest the exis-tence of previously unidentified loci for tooth agenesis. The strongest evidence is shown forsuch a locus in chromosome 18, but further studies are needed to confirm and map this locus more precisely as well as to confirm the involvement with tooth agenesis of the other ge-nomic regions indicated in this study.
The molecular nature of the genetic factors residing in the loci we identified remains un-known. They may represent hypomorphic defects (or “high risk alleles”) that however by themselves have a major effect. They may also represent stronger defects, e.g. with loss of function and haploinsufficiency, as shown by the identification of such defects in the asso-ciation with syndromic phenotypes that resemble common types of tooth agenesis (e.g. van der Woude and Kallmann syndromes, see table 1). Functional redundancy between different genes and genetic pathways may limit the consequences of a haploinsufficient defect, thus allowing the effect to become visible only as a relatively mild form of tooth agenesis. Con-sidering the phenotypes in syndromes as well as in the families studied by us and in other
81
family studies (Grahnen, 1956; Chosack et al., 1975), it is also probable that the effects of many of such genetic factors would be selective, i.e. primarily affect only one class of teeth.
Evidence of tooth agenesis as a result of a combination of genetic factors has been provided by cases of severe agenesis where both parents have presented with less severe tooth anoma-lies ("non-dominant severe agenesis") or from reports of recessive inheritance (Schalk-vander Weide, 1992; Lyngstadaas et al., 1996; Ahmad et al., 1998; Pirinen et al., 2001; Chishti et al., 2006). Taking the already verified genetic heterogeneity into account, it appears that it is much more frequent to find cases with defects or risk alleles of two or more genes than to find recessive inheritance, even as compound heterozygotes of allelic defects. Recessive in-heritance is most probable in consanguinous situations (Ahmad et al., 1998; Chishti et al., 2006) or in populations with a strong possibility of a founder effect (Pirinen et al., 2001). Depending on the effect on the regulatory pathways, all combinations of alleles of different genes may not necessarily be additive as may be expected for the recessive inheritance, and one allele may have a major contribution while the other has a modifying function. Combi-nations of different kind of alleles may largely satisfy the premises on which the quasicon-tinuous quantitative trait models of polygenic/multifactorial etiology were based (Bailit 1975; Brook, 1984).
In summary, non-syndromic tooth agenesis may follow from different genotypes. Strong de-fects in critical genes, often loss of function defects that cause haploinsufficiency, cause dominantly inherited severe agenesis. Similar defects, either present in less critical genes or masked by redundancy, may also underlie more common types of dominantly inherited tooth agenesis such as incisor and premolar hypodontia. The latter kind of phenotypes may also be caused by hypomorphic defects or high risk alleles. Tooth agenesis without dominant inheri-tance may follow from combinations of haploinsufficient, hypomorphic or risk alleles, in-cluding recessive inheritance.
Implications for the pathogenetic mechanisms of tooth agenesis
One of the main conclusions from the results presented in this thesis is that defects in PAX9and MSX1 exert their effect through haploinsufficiency. Reduced amount of functional MSX1 or PAX9 protein in the tooth forming cells is able to cause severe and selective toothagenesis. Another conclusion, based on the analysis of the phenotypes associated with the known defects in these genes, is that the phenotypes associated with the defects in MSX1 and those associated with the defects in PAX9 are different. Despite the similarities, there areclearcut differences in the frequency of agenesis of specific teeth.
As described in the Review of the literature, most types of tooth agenesis can be consideredto be caused by quantitative mechanisms affecting especially those teeth that are initiatedand develop latest in their respective tooth class. In terms of the morphogenetic field and clone theories this can be regarded as exhaustion or change of the field strength or odonto-genic potential. Historically, critically reduced size of the dental lamina or tooth germs havebeen considered as causes of agenesis (Grüneberg, 1951; Bailit, 1975; Brook, 1984). How-ever, in modern thinking based on the molecular and genetic studies of tooth development,
82
tooth agenesis is a consequence of a qualitatively or quantitatively impaired function of ge-netic networks, which regulate tooth development (Thesleff, 2006). Understanding a regula-tory failure as a cause of agenesis is in line with the concepts implying morphogenetic fields and self-organizing cell populations.
As shown by studies in mouse, impaired functions of the genetic networks are reflected as reduced signaling or impaired signal regulation, cell proliferation, migration, commitmentand differentiation. The most critical are the stages of formation of the signaling centers that have an organizing role for the future development. It is conceivable that these and other critical stages of tooth development may work as thresholds at which a somehow reduced “tooth forming potential” of the regulatory networks is converted to partial tooth agenesis. The other stages may include e.g. differentiation and activation of a program for secondary tooth formation. Overcoming the thresholds appears more critical in the late developing teeth. The reduction of the “tooth forming potential” may follow from a reduced functional activity of a single gene as in the case of the heterozygous defects in MSX1 and PAX9. It may also result from complete inactivation of a single signaling pathway the function of which is partially redundant as in the case of impaired EDA signaling. Thus, reduced size and function of the dental signaling centers as a result of impaired EDA signaling has been suggested as a major cause of tooth defects in anhidrotic ectodermal dysplasias (Mustonen et al., 2004). AXIN2 haploinsufficiency may specifically affect the onset of the program needed for secondary tooth development (Lammi et al., 2004).
In the case of MSX1 and PAX9, tooth agenesis has been related to the critical function of themouse homologues of these genes in the formation of the enamel knot and the subsequent transition from bud to cap stage (e.g. Thesleff, 2006). The MSX1 haploinsufficiency, how-ever, appears to affect only the secondary teeth and permanent molars, and it is not obvious how a weakened enamel knot function, which presumably follows from a reduced amount of functional MSX1 protein, is linked to impaired secondary tooth development. It is possible that the late developing teeth are more sensitive to impaired enamel knot function. The de-velopment of these teeth normally is a long lasting process and happens surrounded by the alveolar bone. It can also be speculated that enamel knots may somehow regulate the pro-gram leading to the secondary tooth formation.
Both Msx1 and Pax9 are also needed for the mesenchymal cell condensation around the growing epithelial bud (Satokata and Maas, 1994; Peters et al., 1998). The reduced conden-sation which is also seen in the Pax9 hypomorphic mutants, perhaps indicating a decreased amount of committed dental mesenchymal cells, may be related to tooth agenesis (Kist et al., 2005). As Msx1 is known to be important for the commitment of the neural crest, an earlydefect in the commitment or migration of the neural crest cells could also be responsible for the tooth agenesis, if it caused a reduction in the amount of competent ectomesenchymalcells.
The analysis presented in this thesis shows that MSX1 and PAX9 haploinsufficiency and dif-ferent types of PAX9 defects are associated with slightly but distinctly different agenesisphenotypes. While third molars are affected in the association with defects in both genes, themost essential differences between the phenotypes are that premolars are more often affected
83
in association with defects in MSX1 and first and second molars in association with defectsin PAX9. As PAX9 apparently is upstream of MSX1 and acts synergistically with it (Peters et al., 1998; Ogawa et al., 2006), it is conceivable that the effect of PAX9 haploinsufficiency is mediated by reduced MSX1 activity. However, the differences in phenotypes suggest that PAX9 also has functions not mediated by MSX1.
In patients with defects that reduce the amount of PAX9 mRNA and protein, the agenesis appears to “grow” in a posterior-to-anterior direction in a way that agenesis of a tooth is as-sociated with the agenesis of all the more posterior teeth. The whole gene deletions and thestart codon mutation affected all the postcanine teeth, including the primary molars showing that the whole postcanine dentition is sensitive to the PAX9 dose, and that a posterior-to-anterior sensitivity gradient (Kist et al., 2006) may extend to the anterior-most of these teeth, the primary first molar which is regarded as the “key” or “stem” tooth of the human post-canine dentition. The less severe agenesis phenotypes observed in association with the mis-sense defects in PAX9 may relate to the fact that while these defects reduce or impair theDNA binding ability of the PAX9 protein, the protein still is capable to protein-protein inter-actions. As shown by Ogawa and colleagues (2006), such mutated PAX9 protein was able to bind MSX1, but its capacity to transcriptional activation alone or in synergism with MSX1 was remarkably reduced. It is possible that the observed residual transcriptional activationcapacity accounts for the less severe phenotypes. Alternatively, these may be explained by interactions of PAX9 with other protein partners.
The pathogenetic mechanisms that mediate the effect of reduced amounts of functional MSX1 and PAX9 protein may serve as models for pathogenesis of tooth agenesis caused by other gene defects. These may exert their effect by affecting MSX1 or PAX9 function or the same genetic networks. Further research of genetic and pathogenetic mechanisms of MSX1and PAX9 is warranted to shed light into the pathogenesis of tooth agenesis in general. This is especially true for MSX1 because defects in this gene affect the teeth that are most oftenaffected in the population.
84
CONCLUDING REMARKS
The studies summarized in this thesis were started with an aim to identify genes that affecthuman tooth development and are involved in inherited tooth anomalies. More specifically, we wanted to identify the gene defect that caused a common type of tooth agenesis, domi-nantly inherited incisor and premolar hypodontia, in a group of Finnish families. Originally,it was presumed that agenesis in these families would share a common genetic background,i.e. to be caused by defects in one or a few genes. During the work it became obvious that this was not the case, but instead, the genetic background of this phenotype was rather het-erogeneous, which was one of the main conclusions of these studies. The heterogeneity hampered the possibilities to identify causative loci and to pinpoint the defective genes. The observed heterogeneity is in line with the increasing understanding of the complex genetic networks regulating the development of dentition. This understanding, however, also sup-ports the idea that gene defects with dominant effects may be responsible for the incisor and premolar hypodontia.
In this work evidence was presented for novel causative loci, especially in chromosome 18. Further studies will be required to confirm and refine these results and eventually to identifythe causative sequence variants. Basic approaches for this end would be to recruit additionalpatients and families as well as to take advantage of an eventual common ancestral etiology,which would allow the utilization of single nucleotide polymorphisms to fine-map the dis-ease loci. The causative defects may rather affect the expression than the protein structureand reside outside the coding regions. Therefore, mutational analysis could be comple-mented by analysis of RNA expression.
In an other line of investigation into the genetics of tooth agenesis presented in this thesis,causes of dominantly inherited severe tooth agenesis, oligodontia, were identified. It wasshown that haploinsufficient defects of PAX9 and MSX1 cause tooth agenesis with specificpatterns. Thus, the pathogenesis of specific types of tooth agenesis involves reduced activityof these important regulatory genes, which presumably affects the essential genetic networks necessary for normal development of dentition. During the work it has also become obvious that defects in the so far identified three genes MSX1, PAX9 and AXIN2 may not explain all cases of non-syndromic oligodontia with dominant inheritance. Furthermore, mutationalanalysis of these genes in other patients with severe tooth agenesis, i.e. patients without fa-milial background of this phenotype, has been successful in only a few cases. Etiology of this kind of severe tooth agenesis may largely be explained by combinations of genetic fac-tors, i.e. polygenic inheritance. One way to clarify the etiology in these cases is to identifyfactors that cause common familial incisor and premolar hypodontia.
The results presented in this thesis, especially those on severe tooth agenesis, provide tools for diagnosis, genetic counseling and planning of treatment. However, the main impact of the results is to provide insights into the biological mechanisms that underlie normal and ab-normal development of teeth and development in general. Thus, the results contribute to the biological basis of dental science, and eventually to development of diagnosis and therapy.
85
ACKNOWLEDGEMENTS
My part in the work presented in this thesis was started in 1993 at the sixth floor laboratory of the Institute of Dentistry in Ruskeasuo. I also visited the Department of Pedodontics and Orthodontics at the third floor as well as the Laboratory of Human molecular genetics at the nearby building of the National Public Health Institute. From 1996, I mostly worked in the Institute of Biotechnology at the new Biocenter in Viikki. In 2001, I set up a corner of a laboratory in Biomedicum, brand new, under the auspices of the Institute of Dentistry.
I am greatly indebted to professor Sinikka Pirinen whose scientific work, aspirations and vi-sions at the Department of Pedodontics and Orthodontics were the foundations to start themolecular genetic studies of human tooth agenesis. During these years she has been not only the Professor but also a friend, whose ability to encourage and take you over the critical moments has been invaluable.
I entered the laboratory of professor Irma Thesleff even some years before the start of the work with tooth agenesis. During the completion of my studies in biochemistry, I greated an interest in developmental biology. I have retained this interest, even though I became routed to the world of human molecular genetics. Irma has been the most essential person for the work I have done: she inspired and guided the work with her scientific knowledge and vision and provided the bulk of the basic support. She has shown an encouraging trust without which my work, including this thesis, wouldn’t have been possible.
At the very beginning of the project, I became to know Sirpa Arte, then a dentist finishing her specialization in orthodontics. Sirpa recruited and examined most of the patients and has thus been elementary for the investigation. During the years we have spent a lot of time with pipetting, scoring alleles, and discussing. Although Sirpa now has a busy position as a senior orthodontist, she still finds time to participate in the research and share her specialist knowl-edge. I’m especially grateful to Sirpa for the friendship and support.
In the beginning of these studies, I had the pleasure to get acquainted with Leena Peltonen-Palotie, then a professor of human molecular genetics in the National Public Health Institute.She took a personal and warm interest in our efforts, gave me wonderful supervision, al-lowed the use of many of her facilities and introduced me to a lot of helpful people in her laboratory.
I’m grateful to professor Satu Alaluusua for all the support, scientific, economical and social, during my years in Biomedicum as well as for her scientific alertness which opened new avenues for my research.
I warmly thank Johanna Kotilainen whose work offered us the possibility to study an inter-esting group of patients with Wolf-Hirschhorn syndrome. I want also express my gratitude to professor Sakari Knuutila and to Yan Aalto in his laboratory for the FISH analysis of sam-ples from these patients.
86
I thank all the people in the tooth development group for their help and companionship. I want especially to thank Johanna Pispa for discussions and help, Thomas Åberg for joint ac-tivities and friendship, David Rice for the excursions to sporting events, Maija Kaski for herfriendship and the contribution to the Gene expression database, and Merja Mäkinen and Riikka Santalahti for all the help I have received during these years. I’m grateful to Jukka Jernvall for discussions and his readiness to share his scientific knowledge. I greatly appreci-ate the help of Lars Paulin in the sequencing laboratory of the Institute of Biotechnology. I thank professor, director Mart Saarma for the support and all encouraging words.
My warm thanks go to Carin Sahlberg for her company at the laboratory and during travels, and also for her advice how to care Tommi, my cat. I wish to thank Janna Waltimo-Siren,Pirjo-Liisa Lukinmaa and Anna-Maija Partanen for all the discussions and support. I’m grateful to Laura Lammi, Elina Luonsi and other young dentists for their contributions in many projects as well as for refreshing the life in the laboratory. My warmest thanks go to Annikki Siren and Anneli Sinkkonen for their help in the laboratory and especially to Mar-jatta Kivekäs and Maarit Hakkarainen for their invaluable help in many respects. I’m grate-ful to Kirsti Kari for her help and support in the laboratory. I thank professor Jarkko Hieta-nen for support and appreciation of my work.
I’m grateful to Raila Salminen and Elina Waris for their help and friendliness. I also thank all the people in the computer support at the Institutes of Dentistry and Biotechnology.
Numerous people in the laboratory of the National Public Health Institute and in the Molecu-lar Medicine Sequencing Laboratory have helped me during these years: Johanna Aaltonen, Anne Vikman, Iiris Hovatta, Petra Pekkarinen, Joe Terwilliger, Teppo Varilo, Maija Parkki-nen, Mari Sipilä, Pekka Ellonen, Elli Kempas, Heli Keränen and Susanna Anjala. I also thank Päivi Lahermo and Aarno Palotie at the Finnish Genome Center for the invaluablehelp in the genome-wide searches.
Many times during the work I have tempted to ignore my friends. The friendship of Mervi and Petra Erkkilä in all the turns of life during these years has helped me enormously. Thecompany of Ilkka Leskinen and all the travels together have been essential for survival, and so have the activities organized by Cetin Sahin, Ilppo Kivivuori and Anne Ojanperä.
I’m fully aware of the importance of my late father in waking my interest in studies and edu-cation. I’m grateful for my mother for all the care and love.
In addition to the Institutes and the grants of the seniors, I have received financial support from the Finnish Cultural Foundation, the University of Helsinki funds and HUCH EVO.
Finally, I’m indebted to Jan Huggare and Anu Wartiovaara who as reviewers gave a remark-able contribution to this thesis.
Vantaa, November 2007
Pekka Nieminen
87
REFERENCES
Adaimy L, Chouery E, Megarbane H, Mroueh S, Delague V, Nicolas E, Belguith H, de MazancourtP, and Megarbane A (2007). Mutation in WNT10A is associated with an autosomal recessiveectodermal dysplasia: the odonto-onycho-dermal dysplasia. Am J Hum Genet 81: 821-828.
Ahmad W, Brancolini V, ul Haque FM, Lam H, ul Hague HS, Haider M, Maimon A, Aita VM,Owen J, Brown D, Zegarelli DJ, Ahmad M, Ott J, and Christiano AM (1998). A locus for autosomal recessive hypodontia with associated dental anomalies maps to chromosome 16q12.1. Am J Hum Genet 62: 987-991.
Aioub M, Lezot F, Molla M, Castaneda B, Robert B, Goubin G, Nefussi JR, and Berdal A (2007).Msx2 -/- transgenic mice develop compound amelogenesis imperfecta, dentinogenesis imperfectaand periodental osteopetrosis. Bone 41: 851-859.
Alaluusua S, Calderara P, Gerthoux PM, Lukinmaa PL, Kovero O, Needham L, Patterson DGJ, Tuomisto J, and Mocarelli P (2004). Developmental dental aberrations after the dioxin accident in Seveso. Environ Health Perspect 112: 1313-1318.
Alaluusua S, Lukinmaa PL, Torppa J, Tuomisto J, and Vartiainen T (1999). Developing teeth as biomarker of dioxin exposure. Lancet 353: 206
Alonso L and Fuchs E (2003). Stem cells in the skin: waste not, Wnt not. Genes Dev 17: 1189-1200.
Alvesalo L and Portin P (1969). The inheritance pattern of missing, peg-shaped and strongly mesio-distally reduced upper lateral incisors. Acta Odontol Scand 27: 563-573.
Alvesalo L and Tigerstedt PM (1974). Heritabilities of human tooth dimensions. Hereditas 77: 311-318.
Amundadottir LT, Thorvaldsson S, Gudbjartsson DF, Sulem P, Kristjansson K, Arnason S, GulcherJR, Bjornsson J, Kong A, Thorsteinsdottir U, and Stefansson K (2004). Cancer as a ComplexPhenotype: Pattern of Cancer Distribution within and beyond the Nuclear Family. PLoS Med 1(e65): 229-236.
Andl T, Ahn K, Kairo A, Chu EY, Wine-Lee L , Reddy ST, Croft NJ, Cebra-Thomas JA, Metzger D, Chambon P, Lyons KM, Mishina Y, Seykora JT, Crenshaw EB, and Millar SE (2004). EpithelialBmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential fortooth development. Development 131: 2257-2268.
Andl T, Reddy ST, Gaddapara T, and Millar SE (2002). WNT signals are required for the initiationof hair follicle development. Dev Cell 2: 643-653.
Apajalahti S, Arte S, and Pirinen S (1999). Short root anomaly in families and its association with other dental anomalies. Eur J Oral Sci 107: 97-101.
Arte S (2001). Phenotypic and genotypic features of familial hypodontia. Thesis. Institute of Dentistry, University of Helsinki, Finland. http://ethesis.helsinki.fi.
Arte S, Nieminen P, Apajalahti S, Haavikko K, Thesleff I, and Pirinen S (2001). Characteristics of incisor-premolar hypodontia in families. J Dent Res 80: 1445-1450. 2001.
Arte S, Nieminen P, Pirinen S, Thesleff I, and Peltonen L (1996). Gene defect in hypodontia:exclusion of EGF, EGFR, and FGF-3 as candidate genes. J Dent Res 75: 1346-1352.
88
Baccetti T (1998). A controlled study of associated dental anomalies. Angle Orthod 68: 267-274.
Baccetti T (2000). Tooth anomalies associated with failure of eruption of first and second permanentmolars. Am J Orthod Dentofacial Orthop 118: 608-610.
Bailit HL (1975). Dental variation among populations. An anthropologic view. Dent Clin North Am19: 125-139.
Baum BJ and Cohen MM (1971). Agenesis and tooth size in the permanent dentition. Angle Orthod41: 100-102.
Becker A, Smith P, and Behar R (1981). The incidence of anomalous maxillary lateral incisors inrelation to palatally-displaced cuspids. Angle Orthod 51: 24-29.
Bei M and Maas R (1998). FGFs and BMP4 induce both Msx1-independent and Msx1-dependentsignaling pathways in early tooth development. Development 125: 4325-4333.
Bendall AJ and Abate-Shen C (2000). Roles for Msx and Dlx homeoproteins in vertebratedevelopment. Gene 247: 17-31.
Bergström K (1977). An orthopantomographic study of hypodontia, supernumeraries and otheranomalies in school children between the ages of 8-9 years. An epidemiological study. SwedDent J 1: 145-157.
Bjerklin K and Kurol J (1981). Prevalence of ectopic eruption of the maxillary first permanent molar.Swed Dent J 5: 29-34.
Bjerklin K, Kurol J, and Valentin J (1992). Ectopic eruption of maxillary first permanent molars andassociation with other tooth and developmental disturbances. Eur J Orthod 14: 369-375.
Blanpain C, Horsley V, and Fuchs E (2007). Epithelial stem cells: turning over new leaves. Cell128: 445-458.
Blin-Wakkach C, Lezot F, Ghoul-Mazgar S, Hotton D, Monteiro S, Teillaud C, Pibouin L, Orestes-Cardoso S, Papagerakis P, MacDougall M, Robert B, and Berdal A (2001). Endogenous Msx1antisense transcript: in vivo and in vitro evidences, structure, and potential involvement inskeleton development in mammals. Proc Natl Acad Sci USA 98: 7336-7341.
Boffelli D, Nobrega MA, and Rubin EM (2004). Comparative genomics at the vertebrate extremes.Nat Rev Genet 5: 456-465.
Boraas JC, Messer LB, and Till MJ (1988). A genetic contribution to dental caries, occlusion, and morphology as demonstrated by twins reared apart. J Dent Res 67: 1150-1155.
Boruchov MJ and Green LJ (1971). Hypodontia in human twins and families. Am J Orthod 60: 165-174.
Brin I, Becker A, and Shalhav M (1986). Position of the maxillary permanent canine in relation to anomalous or missing lateral incisors: a population study. Eur J Orthod 8: 12-16.
Brook AH (1974). Dental anomalies of number, form and size: their prevalence in British schoolchildren. J Int Assoc Dent Child 5: 37-53.
Brook AH (1984). A unifying aetiological explanation for anomalies of human tooth number andsize. Arch Oral Biol 29: 373-378.
89
Brook AH, Elcock C, al-Sharood MH, McKeown HF, Khalaf K, and Smith RN (2002). Further studies of a model for the etiology of anomalies of tooth number and size in humans. ConnectTissue Res 43: 289-295.
Brook AH and Holt RD (1978). The relationship of crown length to root length in permanentmaxillary central incisors. Proc Br Paedod Soc 8: 17-20.
Brown K (1983). Evolution of dentition. Birth Defects: Original Article Series : 29-66.
Burgersdijk R and Tan HL (1978). Oral symptoms of the Wolf syndrome: report of case. J Dent Children 45: 488-489.
Burzynski N and Escobar V (1983). Classification and genetics of numeric anomalies of dentition. Birth Defects 13: 95-106.
Butler PM (1939). Studies of the mammalian dentition. Differentiation of the postcanine dentition. Proc Zool Soc Lond 109B: 329-356.
Butler PM (1978). The ontogeny of mammalian heterodonty. J Biol Buccale 6: 217-228.
Butler PM (1995). Ontogenetic aspects of dental evolution. Int J Dev Biol 39: 25-34.
Bäckman B and Wahlin YB (2001). Variations in number and morphology of permanent teeth in 7-year-old Swedish children. Int J Paediatr Dent 11: 11-17.
Camilleri S (2005). Maxillary canine anomalies and tooth agenesis. Eur J Orthod 27: 450-456.
Carlson CS, Eberle MA, Kruglyak L, and Nickerson DA (2004). Mapping complex disease loci inwhole-genome association studies. Nature 429: 446-452.
Catron KM, Zhang H, Marshall SC, Inostroza JA, Wilson JM, and Abate C (1995). Transcriptionalrepression by Msx-1 does not require homeodomain DNA-binding sites. Mol Cell Biol 15: 861-871.
Celli G, Larochelle WJ, Mackem S, Sharp R, and Merlino G (1998). Soluble dominant-negativereceptor uncovers essential roles for fibroblast growth factors in multi-organ induction and patterning. EMBO J 17: 1642-1655.
Celli J, Duijf P, Hamel BCJ, Bamshad M, Kramer B, Smits APT, Newbury-Ecob R, HennekamRCM, Van Buggenhout G, van Haeringen B, Woods, CG, van Essen AJ, de Waal R, Vriend G,Haber DA, Yang A, McKeon F, Brunner HG, and van Bokhoven H (1999). Heterozygousgermline mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell 99: 143-153.
Chai Y, Jiang X, Ito Y, Bringas PJ, Han J, Rowitch DH, Soriano P, McMahon AP, and Sucov HM (2000). Fate of the mammalian cranial neural crest during tooth and mandibular morphogenesis.Development 127: 1671-1679.
Chen Y, Bei M, Woo I, Satokata I, and Maas R (1996). Msx1 controls inductive signaling in mammalian tooth morphogenesis. Development 122: 3035-3044.
Chishti MS, Muhammad D, Haider M, and Ahmad W (2006). A novel missense mutation in MSX1underlies autosomal recessive oligodontia with associated dental anomalies in Pakistani families.J Hum Genet
Chosack A, Eidelman E, and Cohen T (1975). Hypodontia: A polygenic trait - a family study amongIsraeli jews. J Dent Res 54: 16-19.
90
Clayton JM (1956). Congenital dental anomalies occurring in 3557 children. ASDC J Dent Child: 206-208.
Cobb J and Duboule D (2004). Tracing microRNA patterns in mice. Nat Genet 36: 1033-1034.
Cobourne MT, Hardcastle Z, and Sharpe PT (2001). Sonic hedgehog regulates epithelial proliferationand cell survival in the developing tooth germ. J Dent Res 80: 1974-1979.
Cohen D, Chumakov I, and Weissenbach J (1993). A first-generation physical map of the humangenome. Nature 366: 698-701.
Cohn SA (1957). Development of the molar teeth in the albino mouse. Am J Anat 101: 295-319.
Corruccini RS (1984). An epidemiologic transition in dental occlusion in world populations. Am J Orthod 86: 419-426.
Couly G, Grapin-Botton A, Coltey P, Ruhin B, and Le Douarin NM (1998). Determination of theidentity of the derivatives of the cephalic neural crest: incompatibility between Hox gene expression and lower jaw development. Development 125: 3445-3459.
Courtois G, Smahi A, Reichenbach J, Döffinger R, Cancrini C, Bonnet M, Puel A, Chable-Bessia C,Yamaoka S, Feinberg J, Dupuis-Girod S, Bodemer C, Livadiotti S, Novelli F, Rossi P, Fischer A, Israel A, Munnich A, Le Deist F, and Casanova JL (2003). A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cellimmunodeficiency. J Clin Invest 112: 1108-1115.
da Silva Dalben G, Costa B, and Gomide MR (2006). Prevalence of dental anomalies, ectopiceruption and associated oral malformations in subjects with Treacher Collins syndrome. OralSurg Oral Med Oral Pathol Oral Radiol Endod 101: 588-592.
Dahl E, Koseki H, and Balling R (1997). Pax genes and organogenesis. Bioessays 19: 755-765.
Dahlberg AA (1945). The changing dentition in man. Journal of American Dental Association :676-690.
Dahllöf G and Huggare J (2004). Orthodontic considerations in the pediatric cancer patients: a review. Semin Orthod 10: 266-276.
Das P, Hai M, Elcock C, Leal SM, Brown DT, Brook AH, and Patel PI (2003). Novel missensemutations and a 288-bp exonic insertion in PAX9 in families with autosomal dominanthypodontia. Am J Med Genet 118A: 35-42.
Das P, Stockton DW, Bauer C, Shaffer LG, D'Souza RN, Wright T, and Patel PI (2002).Haploinsufficiency of PAX9 is associated with autosomal dominant hypodontia. Hum Genet110: 371-376.
Dassule HR, Lewis P, Bei M, Maas R, and McMahon AP (2000). Sonic hedgehog regulates growth and morphogenesis of the tooth. Development 127: 4775-4785.
Dassule HR and McMahon AP (1998). Analysis of epithelial-mesenchymal interactions in the initialmorphogenesis of the mammalian tooth. Dev Biol 202: 215-227.
Daugaard-Jensen J, Nodal M, and Kjaer I (1997a). Pattern of agenesis in the primary dentition: a radiographic study of 193 cases. Int J Paediatr Dent 7: 3-7.
91
Daugaard-Jensen J, Nodal M, Skovgaard LT, and Kjaer I (1997b). Comparison of the pattern of agenesis in the primary and permanent dentitions in a population characterized by agenesis in theprimary dentition. Int J Paediatr Dent 7: 143-148.
Davies PL (1968). Relationship of cusp reduction in the permanent mandibular first molar toagenesis of teeth. J Dent Res 47: 499
Davis PJ (1987). Hypodontia and hyperdontia of permanent teeth in Hong Kong schoolchildren.Community Dent Oral Epidemiol 15: 218-220.
Davis PJ and Brook AH (1986). The presentation of talon cusp: diagnosis, clinical features,associations and possible aetiology. Br Dent J 160: 84-88.
de la Chapelle A (2004). Genetic predisposition to colorectal cancer. Nat Rev Cancer 4: 769-780.
De Moerlooze L, Spencer-Dene B, Revest J, Hajihosseini M, Rosewell I, and Dickson C (2000). Animportant role for the IIIb isoform of fibroblast growth factor receptor 2 (FGFR2) inmesenchymal-epithelial signalling during mouse organogenesis. Development 127: 483-492.
De Muynck S, Schollen E, Matthijs G, Verdonck A, Devriendt K, and Carels C (2004). A novelMSX1 mutation in hypodontia. Am J Med Genet 128A: 401-403.
Demirjian A (1978). [Dental development: index of physiologic maturation]. Med Hyg 36: 3154-3159.
Dempsey PJ and Townsend GC (2001). Genetic and environmental contributions to variation inhuman tooth size. Heredity 86: 685-693.
Dempsey PJ, Townsend GC, Martin NG, and Neale MC (1995). Genetic covariance structure of incisor crown size in twins. J Dent Res 74: 1389-1398.
Depew MJ, Lufkin T, and Rubenstein JL (2002). Specification of jaw subdivisions by Dlx genes. Science 298: 381-385.
Depew MJ, Simpson CA, Morasso M, and Rubenstein JL (2005). Reassessing the Dlx code: the genetic regulation of branchial arch skeletal pattern and development. J Anat 207: 501-561.
Devos D, Vuillaume I, de Becdelievre A, de Martinville B, Dhaenens CM, Cuvellier JC, CuissetJM, Vallee L, Lemaitre MP, Bourteel H, Hachulla E, Wallaert B, Destee A, Defebvre L, andSablonniere B (2006). New syndromic form of benign hereditary chorea is associated with a deletion of TITF-1 and PAX-9 contiguous genes. Mov Disord 21: 2237-2240.
Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, SebounE, Lathrop M, Gyapay G, Morissette J, and Weissenbach J (1996). A comprehensive genetic mapof the human genome based on 5,264 microsatellites. Nature 380: 152-154.
Dode C, Levilliers J, Dupont JM, De Paepe A, Le Du N, Soussi-Yanicostas N, Coimbra RS, Delmaghani S, Compain-Nouaille S, Baverel F, Pecheux C, Le Tessier D, Cruaud C, Delpech M, Speleman F, Vermeulen S, Amalfitano A, Bachelot Y, Bouchard P, Cabrol S, Carel JC,Delemarre-van dW, Goulet-Salmon B, Kottler ML, Richard O, Sanchez-Franco F, Saura R, Young J, Petit C, and Hardelin JP (2003). Loss-of-function mutations in FGFR1 cause autosomaldominant Kallmann syndrome. Nat Genet 33: 463-465.
Donis-Keller H, Green P, Helms C, Cartinhour S, Weiffenbach B, Stephens K, Keith TP, BowdenDW, Smith DR , and Lander ES (1987). A genetic linkage map of the human genome. Cell 51:319-337.
92
Duailibi MT, Duailibi SE, Young CS, Bartlett JD, Vacanti JP, and Yelick PC (2004). Bioengineeredteeth from cultured rat tooth bud cells. J Dent Res 83: 523-528.
Dunwell JM (2007). 100 years on: a century of genetics. Nat Rev Genet 8: 231-235.
Dupuis-Girod S, Corradini N, Hadj-Rabia S, Fournet JC, Faivre L, Le Deist F, Durand P, Döffinger R, Smahi A, Israel A, Courtois G, Brousse N, Blanche S, Munnich A, Fischer A, Casanova JL,and Bodemer C (2002). Osteopetrosis, lymphedema, anhidrotic ectodermal dysplasia, andimmunodeficiency in a boy and incontinentia pigmenti in his mother. Pediatrics 109: e97.
Döffinger R, Smahi A, Bessia C, Geissmann F, Feinberg J, Durandy A, Bodemer C, Kenwrick S, Dupuis-Girod S, Blanche S, Wood P, Rabia SH, Headon DJ, Overbeek PA, Le Deist F, HollandSM, Belani K, Kumararatne DS, Fischer A, Shapiro R, Conley ME, Reimund E, Kalhoff H, Abinun M, Munnich A, and Casanova JL (2001). X-linked anhidrotic ectodermal dysplasia withimmunodeficiency is caused by impaired NF-kappa B signaling. Nat Genet 27: 277-285.
el-Rifai W, Leisti J, Kahkonen M, Pietarinen A, Altherr MR, and Knuutila S (1995). A patient with Wolf-Hirschhorn syndrome originating from translocation t(4;8) (p16.3;q24.3)pat. J Med Genet32: 65-67.
Endo T, Ozoe R, Yoshino S, and Shimooka S (2006). Hypodontia patterns and variations incraniofacial morphology in Japanese orthodontic patients. Angle Orthod 76: 996-1003.
Ericson S and Kurol J (1986). Longitudinal study and analysis of clinical supervision of maxillarycanine eruption. Community Dent Oral Epidemiol 14: 172-176.
Estivill X and Armengol L (2007). Copy Number Variants and Common Disorders: Filling the Gaps and Exploring Complexity in Genome-Wide Association Studies. PLoS Genet 19;3: e190:-1787-1798.
Fan CM, Porter JA, Chiang C, Chang DT, Beachy PA, and Tessier-Lavigne M (1995). Long-rangesclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product andmodulation by the cyclic AMP signaling pathway. Cell 81: 457-465.
Fearne JM and Brook AH (1993). Small primary tooth-crown size in low birthweight children. EarlyHum Dev 33: 81-90.
Ferguson CA, Tucker AS, Heikinheimo K, Nomura M, Oh P, Li E, and Sharpe PT (2001). The role of effectors of the activin signalling pathway, activin receptors IIA and IIB, and Smad2, in patterning of tooth development. Development 128: 4605-4613.
Ferguson CA, Tucker AS, and Sharpe PT (2000). Temporospatial cell interactions regulating mandibular and maxillary arch patterning. Development 127: 403-412.
Ferrante MI, Giorgio G, Feather SA, Bulfone A, Wright V, Ghiani M, Selicorni A, Gammaro L, Scolari F, Woolf AS, Sylvie O, Bernard L, Malcolm S, Winter R, Ballabio A, and Franco B (2001). Identification of the gene for oral-facial-digital type I syndrome. Am J Hum Genet 68:569-576.
Feuk L, Carson AR, and Scherer SW (2006). Structural variation in the human genome. Nat Rev Genet 7: 85-97.
Frazier-Bowers SA, Guo DC, Cavender A, Xue L, Evans B, King T, Milewicz D, and D'Souza RN (2002). A novel mutation in human PAX9 causes molar oligodontia. J Dent Res 81: 129-133.
93
Frazier-Bowers SA, Pham KY, Le EV, Cavender AC, Kapadia H, King TM, Milewicz DM, and D'Souza RN (2003). A unique form of hypodontia seen in Vietnamese patients: cinical andmolecular analysis. J Med Genet 40: E79
Freeman JL, Perry GH, Feuk L, Redon R, McCarroll SA, Altshuler DM, Aburatani H, Jones KW, Tyler-Smith C, Hurles ME, Carter NP, Scherer SW, and Lee C (2006). Copy number variation: new insights in genome diversity. Genome Res 16: 949-961.
Freimer N and Sabatti C (2004). The use of pedigree, sib-pair and association studies of commondiseases for genetic mapping and epidemiology. Nat Genet 36: 1045-1051.
Friedman JR and Kaestner KH (2006). The Foxa family of transcription factors in development andmetabolism. Cell Mol Life Sci 63: 2317-2328.
Fuchs E, Tumbar T, and Guasch G (2004). Socializing with the neighbors: stem cells and their niche.Cell 116: 769-778.
Galis F (1999). Why do almost all mammals have seven cervical vertebrae? Developmentalconstraints, Hox genes, and cancer. J Exp Zool 285: 19-26.
Galis F and Metz JA (2003). Anti-cancer selection as a source of developmental and evolutionaryconstraints. Bioessays 25: 1035-1039.
Garn SM, Dahlberg AA, Lewis AB, and Kerewsky RS (1966). Cusp number, occlusal groove pattern and human taxonomy. Nature 210: 224-225.
Garn SM and Lewis AB (1970). The gradient and the pattern of crown-size reduction in simplehypodontia. Angle Orthod 40: 51-58.
Garn SM, Lewis AB, and BONNE B (1961). Third molar polymorphism and the timing of tooth formation. Nature 192: 989
Garn SM, Lewis AB, and Kerewsky RS (1964). Third molar agenesis and variation in size of the remaining teeth. Nature 201: 839
Garn SM, Lewis AB, and Walenga AJ (1968). Genetic basis of the crown-size profile pattern. J DentRes 47: 1190
Garn SM, Osborne RH, and McCabe KD (1979). The effect of prenatal factors on crown dimensions.Am J Phys Anthropol 51: 665-678.
Gat U, DasGupta R, Degenstein L, and Fuchs E (1998). De novo hair follicle morphogenesis and hair tumors in mice expressing a truncated beta-catenin in skin. Cell 95: 605-614.
Gaunt WA (1964). Changes in the form of the jaws of the albino mouse during ontogeny. Acta Anat 58: 37-61.
Gilbert, S.F. (2003). Developmental biology. 6th edition. Sinauer, Sunderland.
Giles RH, van Es JH, and Clevers H (2003). Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta 1653: 1-24.
Giudicelli F and Lewis J (2004). The vertebrate segmentation clock. Curr Opin Genet Dev 14: 407-414.
94
Glasstone S (1963). Regulative changes in tooth germs grown in tissue culture. J Dent Res 42:SUPPL 1364-1368.
Glasstone S (1967). Morphodifferentiation of teeth in embryonic mandibular segments in tissue culture. J Dent Res 46: 611-614.
Graber LW (1978). Congenital absence of teeth: a review with emphasis on inheritance patterns. JAm Dent Assoc 96: 266-275.
Grahnen H (1956). Hypodontia in the permanent dentition. Odont Revy 7: 1-100.
Gravely JF and Johnson DB (1971). Variation in the expression of hypodontia in monozygotic twins.Dent Pract Dent Rec 21: 212-220.
Grigoriou M, Tucker AS, Sharpe PT, and Pachnis V (1998). Expression and regulation of lhx6 and lhx7, a novel subfamily of lim homeodomain encoding genes, suggests a role in mammalian headdevelopment. Development 125: 2063-2074.
Gritli-Linde A, Bei M, Maas R, Zhang XM, Linde A, and McMahon AP (2002). Shh signaling within the dental epithelium is necessary for cell proliferation, growth and polarization. Development129: 5323-5337.
Gritli-Linde, A., Lewis, P., McMahon, A.P., and Linde, A. (2001). The whereabouts of a morphogen:Direct evidence for short- and graded long-range activity of Hedgehog signaling peptides. DevBiol 236: 364–386
Gronthos S, Brahim J, Li W, Fisher LW, Cherman N, Boyde A, DenBesten P, Robey PG, and Shi S(2002). Stem cell properties of human dental pulp stem cells. J Dent Res 81: 531-535.
Grüneberg H (1951). The Genetics of Tooth Defect in the Mouse. Proc R Soc Lond B : 437-451.
Guttman, B., Griffiths, A., Suzuki, D., and Cullis, T. (2002). Genetics (Oxford: Oneworld).
Haavikko K (1970). The formation and the alveolar and clinical eruption of the permanent teeth. An orthopantomographic study. Suom Hammaslaak Toim 66: 103-170.
Haavikko K (1971). Hypodontia of permanent teeth. Proc Finn Dent Soc 67: 219-225.
Hamner JE, Witkop CJJ, and Metro PS (1964). Taurodontism; Report of a Case. Oral Surg OralMed Oral Pathol 18:409-18.: 409-418.
Harada H, Kettunen P, Jung HS, Mustonen T, Wang YA, and Thesleff I (1999). Localization of putative stem cells in dental epithelium and their association with Notch and FGF signaling. JCell Biol 147: 105-120.
Hardcastle Z, Mo R, Hui CC, and Sharpe PT (1998). The shh signalling pathway in tooth development - defects in gli2 and gli3 mutants. Development 125: 2803-2811.
Hardy MH (1992). The secret life of the hair follicle. Trends Genet 8: 55-61.
Harila-Kaera V, Heikkinen T, Alvesalo L, and Osborne RH (2001). Permanent tooth crown dimensions in prematurely born children. Early Hum Dev 62: 131-147.
Harris MP, Hasso SM, Ferguson MW, and Fallon JF (2006). The development of archosaurian first-generation teeth in a chicken mutant. Curr Biol 16: 371-377.
95
Haworth KE, Healy C, Morgan P, and Sharpe PT (2004). Regionalisation of early head ectoderm is regulated by endoderm and prepatterns the orofacial epithelium. Development 131: 4797-4806.
Haworth KE, Wilson JM, Grevellec A, Cobourne MT, Healy C, Helms JA, Sharpe PT, and Tucker AS (2007). Sonic hedgehog in the pharyngeal endoderm controls arch pattern via regulation ofFgf8 in head ectoderm. Dev Biol 303: 244-258.
Headon DJ, Emmal SA, Ferguson BM, Tucker AS, Justice MJ, Sharpe PT, Zonana J, and OverbeekPA (2001). Gene defect in ectodermal dysplasia implicates a death domain adapter indevelopment. Nature 414: 913-916.
Headon DJ and Overbeek PA (1999). Involvement of a novel TNF receptor homologue in hair follicle induction. Nat Genet 22: 370-374.
Heikkinen T, Alvesalo L, Osborne RH, and Tienari J (1994). Maternal smoking and tooth formationin the foetus. II. Tooth crown size in the permanent dentition. Early Hum Dev 40: 73-86.
Hobert O (2007). miRNAs Play a Tune. Cell 131: 22-24.
Hogan BL (1999). Morphogenesis. Cell 96: 225-233.
Holloway PJ, Shaw JH, and Sweeney EA (1961). Effects of various sucrose: casein ratios in purifieddiets on the teeth and supporting structures of rats. Arch Oral Biol 3:185-200.: 185-200.
Hu G, Vastardis H, Bendall AJ, Wang Z, Logan M, Zhang H, Nelson C, Stein S, Greenfield N, Seidman CE, Seidman JG, and Abate-Shen C (1998). Haploinsufficiency of MSX1: a mechanismfor selective tooth agenesis. Mol Cell Biol 18: 6044-6051.
Hu JC and Simmer JP (2007). Developmental biology and genetics of dental malformations. OrthodCraniofac Res 10: 45-52.
Hunstadbraten K (1964). Hypodonti i det permanente tannsett. Nor Tandlaegeforen Tid : 64-69.
Huysseune A and Thesleff I (2004). Continuous tooth replacement: the possible involvement ofepithelial stem cells. Bioessays 26: 665-671.
Hölttä P (2005). Developmental aberrations of permanent teeth after high-dose anticancer therapy in childhood : A study on stem cell transplant recipients. Thesis. Institute of Dentistry, University ofHelsinki, Finland. http://ethesis.helsinki.fi.
Ida M, Nakamura T, and Utsunomiya J (1981). Osteomatous changes and tooth abnormalities found in the jaw of patients with adenomatosis coli. Oral Surg Oral Med Oral Pathol 52: 2-11.
Imai H, Osumi-Yamashita N, Ninomiya Y, and Eto K (1996). Contribution of early-emigratingmidbrain crest cells to the dental mesenchyme of mandibular molar teeth in rat embryos. DevBiol 176: 151-165.
Irish JD and Guatelli-Steinberg D (2003). Ancient teeth and modern human origins: an expanded comparison of African Plio-Pleistocene and recent world dental samples. J Hum Evol 45: 113-144.
Ivens A, Flavin N, Williamson R, Dixon M, Bates G, Buckingham M, and Robert B (1990). Thehuman homeobox gene HOX7 maps to chromosome 4p16.1 and may be implicated in Wolf-Hirschhorn syndrome. Hum Genet 84: 473-476.
96
Jabs EW, Muller U, Li X, Ma L, Luo W, Haworth IS, Klisak I, Sparkes, Warman ML, and Mulliken JB (1993). A mutation in the homeodomain of the human MSX2 gene in a family affected with autosomal dominant craniosynostosis. Cell 75: 443-450.
Jaffe N, Toth BB, Hoar RE, Ried HL, Sullivan MP, and McNeese MD (1984). Dental and maxillofacial abnormalities in long-term survivors of childhood cancer: effects of treatment with chemotherapy and radiation to the head and neck. Pediatrics 73: 816-823.
Jensen BL and Kreiborg S (1990). Development of the dentition in cleidocranial dysplasia. J OralPathol Med 19: 89-93.
Jensen E, Kai-Jen YEN, Moorrees CF, and Thomsen SO (1957). Mesiodistal crown diameters of thedeciduous and permanent teeth in individuals. J Dent Res 36: 39-47.
Jernvall J (1995). Mammalian molar cusp patterns: Developmental mechanisms of diversity. ActaZool Fennica 198: 1-61.
Jernvall J, Keränen SV, and Thesleff I (2000). Evolutionary modification of development inmammalian teeth: quantifying gene expression patterns and topography [In Process Citation].Proc Natl Acad Sci U S A 97: 14444-14448.
Jernvall J, Kettunen P, Karavanova I, Martin LB, and Thesleff I (1994). Evidence for the role of the enamel knot as a control center in mammalian tooth cusp formation: non-dividing cells express growth stimulating Fgf-4 gene. Int J Dev Biol 38: 463-469.
Jernvall J and Thesleff I (2000). Reiterative signaling and patterning during mammalian toothmorphogenesis. Mech Dev 92: 19-29.
Jernvall J, Åberg T, Kettunen P, Keränen S, and Thesleff I (1998). The life history of an embryonicsignaling center: BMP-4 induces p21 and is associated with apoptosis in the mouse tooth enamelknot. Development 125: 161-169.
Jezewski PA, Vieira AR, Nishimura C, Ludwig B, Johnson M, O'Brien SE, Daack-Hirsch S, Schultz RE, Weber A, Nepomucena B, Romitti PA, Christensen K, Orioli IM, Castilla EE, Machida J,Natsume N, and Murray JC (2003). Complete sequencing shows a role for MSX1 in non-syndromic cleft lip and palate. J Med Genet 40: 399-407.
Jumlongras D, Bei M, Stimson JM, Wang WF, DePalma SR, Seidman CE, Felbor U , Maas R, Seidman JG, and Olsen BR (2001). A nonsense mutation in MSX1 causes Witkop syndrome.Am J Hum Genet 69: 67-74.
Jumlongras D, Lin JY, Chapra A, Seidman CE, Seidman JG, Maas RL, and Olsen BR (2004). A novel missense mutation in the paired domain of PAX9 causes non-syndromic oligodontia. HumGenet 114: 242-249.
Järvinen E, Salazar-Ciudad I, Birchmeier W, Taketo MM, Jernvall J, and Thesleff I (2006).Continuous tooth generation in mouse is induced by activated epithelial Wnt/beta-cateninsignaling. Proc Natl Acad Sci USA 103: 18627-18632.
Järvinen HJ, Peltokallio P, Landtman M, and Wolf J (1982). Gardner's stigmas in patients with familial adenomatosis coli. Br J Surg 69: 718-721.
Järvinen HJ and Peltomäki P (2004). The complex genotype-phenotype relationship in familialadenomatous polyposis. Eur J Gastroenterol Hepatol 16: 5-8.
97
Järvinen S and Lehtinen L (1981). Supernumerary and congenitally missing primary teeth in Finnishchildren. An epidemiologic study. Acta Odontol Scand 39: 83-86.
Jörgensen KD (1955). The Dryopithecus pattern in recent Danes and Dutchmen. J Dent Res 34:195-208.
Kajii TS, Sato Y, Kajii S, Sugawara Y, and Iida J (2004). Agenesis of third molar germs depends on sagittal maxillary jaw dimensions in orthodontic patients in Japan. Angle Orthod 74: 337-342.
Kangas AT, Evans AR, Thesleff I, and Jernvall J (2004). Nonindependence of mammalian dentalcharacters. Nature 432: 211-214.
Kapadia H, Frazier-Bowers S, Ogawa T, and D'Souza RN (2006). Molecular characterization of a novel PAX9 missense mutation causing posterior tooth agenesis. Eur J Hum Genet
Kapadia H, Mues G, and D'Souza R (2007). Genes affecting tooth morphogenesis. OrthodCraniofac Res 10: 105-113.
Kardong, K. (1995). Vertebrates: Comparative Anatomy, Function, Evolution (McGraw-Hill).
Karlstedt E, Kaitila I, and Pirinen S (1996). Phenotypic features of dentition in diastrophic dysplasia.J Craniofac Genet Dev Biol 16: 164-173.
Kassai Y, Munne P, Hotta Y, Penttila E, Kavanagh K, Ohbayashi N, Takada S , Thesleff I, Jernvall J, and Itoh N (2005). Regulation of mammalian tooth cusp patterning by ectodin. Science 309:2067-2070.
Kataja M, Nystrom M, and Aine L (1989). Dental maturity standards in southern Finland. Proc FinnDent Soc 85: 187-197.
Kattainen H, Tuukkanen J, Simanainen U, Tuomisto JT, Kovero O, Lukinmaa PL, Alaluusua S,Tuomisto J, and Viluksela M (2001). In utero/lactational 2,3,7,8-tetrachlorodibenzo-p-dioxinexposure impairs molar tooth development in rats. Toxicol Appl Pharmacol 174: 216-224.
Kaufman MH, Chang HH, and Shaw JP (1995). Craniofacial abnormalities in homozygous small eye(sey/sey) embryos and newborn mice. J Anat 186: 607-617.
Kere J (2001). Human population genetics: lessons from Finland. Annu Rev Genomics Hum Genet2: 103-128.
Kere J, Srivastava AK, Montonen O, Zonana J, Thomas N, Ferguson B, Munoz F, Morgan D, ClarkeA, Baybayan P, Chen EY, Ezer S, Saarialho-Kere U, de la Chapelle A, and Schlessinger D (1996). X-linked anhidrotic (hypohidrotic) ectodermal dysplasia is caused by mutation in a novel transmembrane protein. Nat Genet 13: 409-416.
Keränen SV, Kettunen P, Åberg T, Thesleff I, and Jernvall J (1999). Gene expression patternsassociated with suppression of odontogenesis in mouse and vole diastema regions. Dev GenetEvol 209: 495-506.
Kettunen P, Karavanova I, and Thesleff I (1998). Responsiveness of developing dental tissues tofibroblast growth factors - expression of splicing alternatives of FGFR1, -2, -3, and of FGFR4 -and stimulation of cell proliferation by FGF-2, -4, -8, and -9. Dev Genet 22: 374-385.
Kettunen P, Laurikkala J, Itaranta P, Vainio S, Itoh N, and Thesleff I (2000). Associations of FGF-3 and FGF-10 with signaling networks regulating tooth morphogenesis. Dev Dyn 219 : 322-332.
98
Kettunen P, Loes S, Furmanek T, Fjeld K, Kvinnsland IH, Behar O, Yagi T, Fujisawa H, Vainio S, Taniguchi M, and Luukko K (2005). Coordination of trigeminal axon navigation and patterning with tooth organ formation: epithelial-mesenchymal interactions, and epithelial Wnt4 and Tgf{beta}1 regulate semaphorin 3a expression in the dental mesenchyme. Development 132:323-334.
Kettunen P and Thesleff I (1998). Expression and function of FGFs-4, -8, and -9 suggest functional redundancy and repetitive use as epithelial signals during tooth morphogenesis. Dev Dyn 211:256-268.
Khalaf K, Robinson DL, Elcock C, Smith RN, and Brook AH (2005). Tooth size in patients withsupernumerary teeth and a control group measured by image analysis system. Arch Oral Biol50: 243-248.
Kidd KK, Pakstis AJ, Speed WC, and Kidd JR (2004). Understanding human DNA sequence variation. J Hered 95: 406-420.
Kim JW and Simmer JP (2007). Hereditary dentin defects. J Dent Res 86: 392-399.
Kim JW, Simmer JP, Lin BP, and Hu JC (2006). Novel MSX1 Frameshift Causes Autosomal-dominant Oligodontia. J Dent Res 85: 267-271.
Kimmel NA, Gellin ME, Bohannan HM, and Kaplan AL (1982). Ectopic eruption of maxillary first permanent molars in different areas of the United States. ASDC J Dent Child 49: 294-299.
Kirkham J, Kaur R, Stillman EC, Blackwell PG, Elcock C, and Brook AH (2005). The patterning of hypodontia in a group of young adults in Sheffield, UK. Arch Oral Biol 50: 287-291.
Kist R, Watson M, Wang X, Cairns P, Miles C, Reid DJ, and Peters H (2005). Reduction of Pax9 gene dosage in an allelic series of mouse mutants causes hypodontia and oligodontia. Hum MolGenet
Kitisin K, Saha T, Blake T, Golestaneh N, Deng M, Kim C, Tang Y, Shetty K, Mishra B, and MishraL (2007). Tgf-Beta signaling in development. Sci STKE 2007 : cm1
Klein ML, Nieminen P, Lammi L, Niebuhr E, and Kreiborg S (2005). Novel Mutation of theInitiation Codon of PAX9 Causes Oligodontia. J Dent Res 84: 43-47.
Klein OD, Minowada G, Peterkova R, Kangas A, Yu BD, Lesot H, Peterka M, Jernvall J, and Martin GR (2006). Sprouty genes control diastema tooth development via bidirectional antagonism of epithelial-mesenchymal FGF signaling. Dev Cell 11: 181-190.
Kollar EJ and Baird GR (1969). The influence of the dental papilla on the development of toothshape in embryonic mouse tooth germs. Journal of Embryology and Experimental Morphology21: 131-148.
Kollar EJ and Baird GR (1970). Tissue interactions in embryonic mouse tooth germs. I. Reorganization of the dental epithelium during tooth-germ reconstruction. Journal ofEmbryology and Experimental Morphology 24: 159-171.
Kollar EJ and Mina M (1991). Role of the early epithelium in the patterning of the teeth and Meckel's cartilage. J Craniofac Genet Dev Biol 11: 223-228.
Kotilainen J (1996). Development of dentition in conditions with multiple congenital anomalies. Thesis. Institute of Dentistry, University of Helsinki, Finland.
99
Kotsomitis N, Dunne MP, and Freer TJ (1996). A genetic aetiology for some common dental anomalies: a pilot twin study. Aust Orthod J 14: 172-178.
Kratochwil K, Galceran J, Tontsch S, Roth W, and Grosschedl R (2002). FGF4, a direct target of LEF1 and Wnt signaling, can rescue the arrest of tooth organogenesis in Lef1(-/-) mice. GenesDev 16: 3173-3185.
Kraus BS, Ames MD, and Clark GR (1969). Effects of maternal rubella on dental crowndevelopment. Clin Pediatr 8: 204-215.
Kruglyak L (1999). The use of a genetic map of biallelic markers in linkage studies. Nat Genet 17:21-24.
Kruglyak L, Daly MJ, Reeve-Daly MP, and Lander ES (1996). Parametric and nonparametric linkageanalysis: a unified multipoint approach. Am J Hum Genet 58: 1347-1363.
Kurol J and Bjerklin K (1982). Ectopic eruption of maxillary first permanent molars: familialtendencies. ASDC J Dent Child 49: 35-38.
Kurotaki N, Imaizumi K, Harada N, Masuno M, Kondoh T, Nagai T, Ohashi H , Naritomi K,Tsukahara M, Makita Y, Sugimoto T, Sonoda T, Hasegawa T, Chinen Y, Tomita HH, KinoshitaA, Mizuguchi T, Yoshiura KK, Ohta T, Kishino T, Fukushima Y, Niikawa N, and Matsumoto N (2002). Haploinsufficiency of NSD1 causes Sotos syndrome. Nat Genet 30: 365-366.
Lai PY and Seow WK (1989). A controlled study of the association of various dental anomalies withhypodontia of permanent teeth. Pediatr Dent 11: 291-296.
Lammi L, Arte S, Somer M, Järvinen H, Lahermo P, Thesleff I, Pirinen S , and Nieminen P (2004).Mutations in AXIN2 Cause Familial Tooth Agenesis and Predispose to Colorectal Cancer. Am J Hum Genet 74: 1043-1050.
Lammi L, Halonen K, Pirinen S, Thesleff I, Arte S, and Nieminen P (2003). A missense mutation inPAX9 in a family with distinct phenotype of oligodontia . Eur J Hum Genet 11: 866-871.
Lathrop GM, Lalouel JM, Julier C, and Ott J (1984). Strategies for multilocus linkage analysis inhumans. Proc Natl Acad Sci U S A 81: 3443-3446.
Laurikkala J, Mikkola M, Mustonen T, Åberg T, Koppinen, Pispa J, Nieminen P, Galceran J, Grosschedl R, and Thesleff I (2001). TNF signaling via the ligand-receptor pair ectodysplasinand edar controls the function of epithelial signaling centers and is regulated by Wnt and activin during tooth organogenesis. Dev Biol 229: 443-455.
Laurikkala J, Mikkola ML, James M, Tummers M, Mills AA, and Thesleff I (2006). p63 regulatesmultiple signalling pathways required for ectodermal organogenesis and differentiation. Development 133: 1553-1563.
Laurikkala J, Pispa J, Jung HS, Nieminen P, Mikkola M, Wang X, Saarialho-Kere U, Galceran J,Grosschedl R, and Thesleff I (2002). Regulation of hair follicle development by the TNF signalectodysplasin and its receptor Edar. Development 129: 2541-2553.
Lavelle CL, Ashton EH, and Flinn RM (1970). Cusp pattern, tooth size and third molar agenesis inthe human mandibular dentition. Arch Oral Biol 15: 227-237.
Lee SH, Fu KK, Hui JN, and Richman JM (2001). Noggin and retinoic acid transform the identity of avian facial prominences. Nature 414: 909-912.
100
Letra A, de Almeida AL, Kaizer R, Esper LA, Sgarbosa S, and Granjeiro JM (2007). Intraoralfeatures of Apert's syndrome. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 103: e38-e41
Levy S, Sutton G, Ng PC, Feuk L, Halpern AL, Walenz BP, Axelrod N, Huang J, Kirkness EF, Denisov G, Lin Y, Macdonald JR, Pang AW, Shago M, Stockwell TB, Tsiamouri A, Bafna V, Bansal V, Kravitz SA, Busam DA, Beeson KY, McIntosh TC, Remington KA , Abril JF, Gill J, Borman J, Rogers YH, Frazier ME, Scherer SW, Strausberg RL, and Venter JC (2007). The Diploid Genome Sequence of an Individual Human. PLoS Biol 5 (e254): 21132144
Lewin DL (1997). Evolutions:mammalian tooth development. The Journal of NIH Research : 75-80.
Lexner MO, Bardow A, Hertz JM, Nielsen LA, and Kreiborg S (2007). Anomalies of tooth formationin hypohidrotic ectodermal dysplasia. Int J Paediatr Dent 17: 10-18.
Li ZY, Chen L, Liu L, Lin YF, Li SW, and Tian WD (2007). Odontogenic potential of bone marrowmesenchymal stem cells. J Oral Maxillofac Surg 65: 494-500.
Lidral AC and Reising BC (2002). The role of MSX1 in human tooth agenesis. J Dent Res 81: 274-278.
Lidral AC, Romitti PA, Basart AM, Doetschman T, Leysens NJ, Daack-Hirsch S, Semina EV,Johnson LR, Machida J, Burds A, Parnell, TJ, Rubenstein JL, and Murray JC (1998).Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet 63:557-568.
Lin CR, Kioussi C, O'Connell S, Briata P, Szeto D, Liu F, Izpisua-Belmonte JC, and Rosenfeld MG (1999). Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and toothmorphogenesis. Nature 401: 279-282.
Lind V (1972). Short root anomaly. Scand J Dent Res 80: 85-93.
Little PF (2005). Structure and function of the human genome. Genome Res 15: 1759-1766.
Logan CY and Nusse R (2004). The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20:781-810.: 781-810.
Lu MF, Pressman C, Dyer R, Johnson RL, and Martin JF (1999). Function of Rieger syndrome genein left-right asymmetry and craniofacial development. Nature 401: 276-278.
Luckett, W.P. (1993). An Ontogenetic Assessment of Dental Homologies in Therian Mammals. InMammal Phylogeny. F.S. Szalay, M.J. Novacek, and M.C. McKenna, eds. (New York: Springer-Verlag), pp. 182-204.
Lukinmaa PL, Ranta H, Ranta K, Kaitila I, and Hietanen J (1987). Dental findings in osteogenesisimperfecta: II. Dysplastic and other developmental defects. J Craniofac Genet Dev Biol 7: 127-135.
Lukinmaa PL, Sahlberg C, Leppaniemi A, Partanen AM, Kovero O, Pohjanvirta R, Tuomisto J, andAlaluusua S (2001). Arrest of rat molar tooth development by lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 173: 38-47.
Lumsden AG (1979). Pattern formation in the molar dentition of the mouse. J Biol Buccale 7: 77-103.
101
Lumsden AG (1988). Spatial organization of the epithelium and the role of neural crest cells in theinitiation of the mammalian tooth germ. Development 103 Suppl: 155-169.
Luukko K (1997). Neuronal cells and neurotrophins in odontogenesis. Thesis. Institute of Dentistryand Institute of Biotechnology, University of Helsinki, Finland.
Lyngstadaas SP, Nordbo H, Gedde-Dahl TJ, and Thrane PS (1996). On the genetics of hypodontiaand microdontia: synergism or allelism of major genes in a family with six affected members. J Med Genet 33: 137-142.
Lysell L (1953). [14 Selected cases of hypodontia with observations on tooth size in these cases.].Sven Tandlak Tidskr 46: 281-302.
Lysell L and Myrberg N (1982). Mesiodistal tooth size in the deciduous and permanent dentitions.Eur J Orthod 4: 113-122.
MacDougall M, Dong J, and Acevedo AC (2006). Molecular basis of human dentin diseases. Am J Med Genet A
Mackay TFC (2001): The genetic architecture of quantitative traits. Annu Rev Genet 35: 303-339.
MacKenzie A, Ferguson MW, and Sharpe PT (1991). Hox-7 expression during murine craniofacialdevelopment. Development 113: 601-611.
MacKenzie A, Ferguson MW, and Sharpe PT (1992). Expression patterns of the homeobox gene, Hox-8, in the mouse embryo suggest a role in specifying tooth initiation and shape. Development115: 403-420.
Magnusson TE (1984). Hypodontia, hyperodontia, and double formation of primary teeth in Iceland. An epidemiological study. Acta Odontol Scand 42: 137-139.
Mahaney MC, Fujiwara TM, and Morgan K (1990). Dental agenesis in the Dariusleut HutteriteBrethren: comparisons to selected Caucasoid population surveys. Am J Phys Anthropol 82: 165-177.
Makris C, Godfrey VL, Krahn-Senftleben G, Takahashi T, Roberts JL, Schwarz T, Feng L, JohnsonRS, and Karin M (2000). Female mice heterozygous for IKK gamma/NEMO deficiencies develop a dermatopathy similar to the human X-linked disorder incontinentia pigmenti. Molecular Cell 5: 969-979.
Mandeville L (1949). Congenital absence of permanent maxillary lateral incisor teeth; a preliminaryinvestigation. Ann Eugen 15: 1-10.
Mandler M and Neubuser A (2001). FGF signaling is necessary for the specification of theodontogenic mesenchyme. Dev Biol 240: 548-559.
Marden PM, Smith DW, and McDonald MJ (1964). Congenital Anomalies In The Newborn Infant,Including Minor Variations. A Study Of 4,412 Babies By Surface Examination For AnomaliesAnd Buccal Smear For Sex Chromatin. J Pediatr 64:357-71.: 357-371.
Markovic M (1982). Hypodontia in twins. Swed Dent J 15 Suppl: 153-162.
Markovic M (1992). At the crossroads of oral facial genetics. Eur J Orthod 14: 469-481.
Mattheeuws N, Dermaut L, and Martens G (2004). Has hypodontia increased in Caucasians duringthe 20th century? A meta-analysis. Eur J Orthod 26: 99-103.
102
Matzuk MM, Kumar TR, and Bradley A (1995a). Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 374: 356-360.
Matzuk MM, Kumar TR, Vassalli A, Bickenbach JR, Roop DR, Jaenisch R, and Bradley A (1995b).Functional analysis of activins during mammalian development. Nature 374: 354-356.
McKeown HF, Robinson DL, Elcock C, al-Sharood M, and Brook AH (2002). Tooth dimensions in hypodontia patients, their unaffected relatives and a control group measured by a new imageanalysis system. Eur J Orthod 24: 131-141.
Mensah JK, Ogawa T, Kapadia H, Cavender AC, and D'Souza RN (2004). Functional analysis of amutation in PAX9 associated with familial tooth agenesis in humans. J Biol Chem 279: 5924-5933.
Mikkola ML and Millar SE (2006). The mammary bud as a skin appendage: unique and shared aspects of development. J Mammary Gland Biol Neoplasia 11: 187-203.
Mikkola ML and Thesleff I (2003). Ectodysplasin signaling in development. Cytokine GrowthFactor Rev 14: 211-224.
Miles, A.E.W. and Grigson, C. (1990). Colyer's Variations and diseases of the teeth in animals.Cambridge University Press, Cambridge.
Miletich I, Buchner G, and Sharpe PT (2005). Barx1 and evolutionary changes in feeding. J Anat207: 619-622.
Miller WA (1969). Inductive changes in early tooth development. I. A study of mouse tooth development on the chick chorioallantois. J Dent Res 48: 719-725.
Mills AA, Zheng BH, Wang XJ, Vogel H, Roop DR, Bradley A, and abradley (1999). p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature 398: 708-713.
Mina M and Kollar EJ (1987). The induction of odontogenesis in non-dental mesenchyme combinedwith early murine mandibular arch epithelium. Arch Oral Biol 32: 123-127.
Mitsiadis TA, Angeli I, James C, Lendahl U, and Sharpe PT (2003). Role of Islet1 in the patterningof murine dentition. Development 130: 4451-4460.
Mitsiadis TA, Cheraud Y, Sharpe P, and Fontaine-Perus J (2003). Development of teeth in chick embryos after mouse neural crest transplantations. Proc Natl Acad Sci USA 100: 6541-6545.
Monreal AW, Ferguson BM, Headon DJ, Street SL, Overbeek PA, and Zonana J (1999). Mutationsin the human homologue of mouse dl cause autosomal recessive and dominant hypohidroticectodermal dysplasia. Nat Genet 22: 366-369.
Monsoro-Burq AH, Wang E, and Harland R (2005). Msx1 and Pax3 Cooperate to Mediate FGF8 and WNT Signals during Xenopus Neural Crest Induction. Dev Cell 8: 167-178.
Moorrees CF, Fanning EA, and Hunt EEJ (1963). Age Variation of Formation Stages for TenPermanent Teeth. J Dent Res 42:1490-502.: 1490-1502.
Mostowska A, Biedziak B, and Jagodzinski PP (2006). Axis inhibition protein 2 (AXIN2)polymorphisms may be a risk factor for selective tooth agenesis. J Hum Genet 51: 262-266.
Mostowska A, Biedziak B, and Trzeciak WH (2005). A novel mutation in PAX9 causes familialform of molar oligodontia. Eur J Hum Genet 14:173-179.
103
Mostowska A, Kobielak A, Biedziak B, and Trzeciak WH (2003). Novel mutation in the paired boxsequence of PAX9 gene in a sporadic form of oligodontia. Eur J Oral Sci 111: 272-276.
Mucchielli ML, Mitsiadis TA, Raffo S, Brunet JF, Proust JP, Goridis, and C. (1997). Mouse Otlx2/RIEG expression in the odontogenic epithelium precedes tooth initiation and requires mesenchyme-derived signals for its maintenance. Dev Biol 189: 275-284.
Mundlos S, Otto F, Mundlos C, Mulliken JB, Aylsworth AS, Albright S, Lindhout D, Cole WG, Henn W, Knoll JH, Owen MJ, Mertelsmann R, Zabel, BU, and Olsen BR (1997). Mutationsinvolving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 89: 773-779.
Mustonen T, Ilmonen M, Pummila M, Kangas AT, Laurikkala J, Jaatinen R, Pispa J, Gaide O,Schneider P, Thesleff I, and Mikkola ML (2004). Ectodysplasin A1 promotes placodal cell fate during early morphogenesis of ectodermal appendages. Development 131: 4907-4919.
Mustonen T, Pispa J, Mikkola ML, Pummila M, Kangas AT, Pakkasjarvi L, Jaatinen R, and ThesleffI (2003). Stimulation of ectodermal organ development by Ectodysplasin-A1. Dev Biol 259:123-136.
Naito A, Yoshida H, Nishioka E, Satoh M, Azuma S, Yamamoto T, Nishikawa S, and Inoue J (2002). TRAF6-deficient mice display hypohidrotic ectodermal dysplasia. Proc Natl Acad Sci USA 99: 8766-8771.
Nakatomi M, Morita I, Eto K, and Ota MS (2006). Sonic hedgehog signaling is important in tooth root development. J Dent Res 85: 427-431.
Narod SA, Hawkins MM, Robertson CM, and Stiller CA (1997). Congenital anomalies andchildhood cancer in Great Britain. Am J Hum Genet 60: 474-485.
Neubuser A, Peters H, Balling R, and Martin GR (1997). Antagonistic interactions between fgf andbmp signaling pathways - a mechanism for positioning the sites of tooth formation. Cell 90:247-255.
Ng D, Thakker N, Corcoran CM, Donnai D, Perveen R, Schneider A, Hadley DW, Tifft C, Zhang L,Wilkie AO, van der Smagt JJ, Gorlin RJ, Burgess SM, Bardwell VJ, Black GC, and BieseckerLG (2004). Oculofaciocardiodental and Lenz microphthalmia syndromes result from distinct classes of mutations in BCOR. Nat Genet 36: 411-416.
Nichols DH (1986). Formation and distribution of neural crest mesenchyme to the first pharyngeal arch region of the mouse embryo. Am J Anat 176: 221-231.
Nieminen P, Arte S, Tanner D, Paulin L, Alaluusua S, Thesleff I, and Pirinen S (2001). Identificationof a nonsense mutation in the PAX9 gene in molar oligodontia. Eur J Hum Genet 9: 743-746.
Nieminen P, Kotilainen J, Aalto Y, Knuutila S, Pirinen S, and Thesleff I (2003). MSX1 Gene isDeleted in Wolf-Hirschhorn Syndrome Patients with Oligodontia. J Dent Res 82: 1013-1017.
Nikali K, Suomalainen A, Terwilliger J, Koskinen T, Weissenbach J, and Peltonen L (1995).Random search for shared chromosomal regions in four affected individuals: the assignment of a new hereditary ataxia locus. Am J Hum Genet 56: 1088-1095.
Niswander JD and Sujaku C (1963). Congenital Anomalies of Teeth in Japanese Children. Am J Phys Anthropol 21: 569-574.
Nodal M, Kjaer I, and Solow B (1994). Craniofacial morphology in patients with multiplecongenitally missing permanent teeth. Eur J Orthod 16: 104-109.
104
Nordgarden H, Jensen JL, and Storhaug K (2001). Oligodontia is associated with extra-oralectodermal symptoms and low whole salivary flow rates. Oral Dis 7: 226-232.
Näsman M, Forsberg CM, and Dahllöf G (1997). Long-term dental development in children after treatment for malignant disease. Eur J Orthod 19: 151-159.
Ogawa T, Kapadia H, Feng JQ, Raghow R, Peters H, and D'Souza RN (2006). FunctionalConsequences of Interactions between Pax9 and Msx1 Genes in Normal and Abnormal ToothDevelopment. J Biol Chem 281: 18363-18369.
Ohazama A, Courtney JM, Tucker AS, Naito A, Tanaka S, Inoue J, and Sharpe PT (2004). Traf6 is essential for murine tooth cusp morphogenesis. Dev Dyn 229: 131-135.
Ohazama A, Hu Y, Schmidt-Ullrich R, Cao Y, Scheidereit C, Karin M, and Sharpe PT (2004). A dual role for Ikk alpha in tooth development. Dev Cell 6: 219-227.
Ohazama A, Modino SA, Miletich I, and Sharpe PT (2004). Stem-cell-based tissue engineering of murine teeth. J Dent Res 83: 518-522.
Ooshima T, Ishida R, Mishima K, and Sobue S (1996). The prevalence of developmental anomaliesof teeth and their association with tooth size in the primary and permanent dentitions of 1650 Japanese children. Int J Paediatr Dent 6: 87-94.
Osborn JW (1973). The evolution of dentitions. The study of evolution suggests how the development of mammalian dentitions may be controlled. Am Sci 61: 548-559.
Osborn, J.W. (1978). Morphogenetic gradients: fields versus clones. In Development, Function and Evolution of Teeth. P.M. Butler and K.A. Joysey, eds. (New York: Academic Press), pp. 171-201.
Osborne RH, Horowitz SL, and de George FV (1958). Genetic variation in tooth dimensions: a twinstudy of the permanent anterior teeth. AmJ Hum Genet 10: 350-356.
Ott J (1974). Estimation of the recombination fraction in human pedigrees: efficient computation of the likelihood for human linkage studies. Am J Hum Genet 26: 588-597.
Ott J (1989). Computer-simulation methods in human linkage analysis. Proc Natl Acad Sci USA 86:4175-4178.
Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, and Owen MJ (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89:765-771.
Packham EA and Brook JD (2003). T-box genes in human disorders. Hum Mol Genet 12: R37-R44
Park K, Kim K, Rho SB, Choi K, Kim D, Oh SH, Park J, Lee SH, and Lee JH (2005). HomeoboxMsx1 interacts with p53 tumor suppressor and inhibits tumor growth by inducing apoptosis.Cancer Res 65: 749-757.
Paulsson L, Bondemark L, and Soderfeldt B (2004). A systematic review of the consequences ofpremature birth on palatal morphology, dental occlusion, tooth-crown dimensions, and toothmaturity and eruption. Angle Orthod 74: 269-279.
105
Paznekas WA, Boyadjiev SA, Shapiro RE, Daniels O, Wollnik B, Keegan CE, Innis JW, DinulosMB, Christian C, Hannibal MC, and Jabs EW (2003). Connexin 43 (GJA1) mutations cause the pleiotropic phenotype of oculodentodigital dysplasia. Am J Hum Genet 72: 408-418.
Peck L, Peck S, and Attia Y (1993). Maxillary canine-first premolar transposition, associated dental anomalies and genetic basis. Angle Orthod 63: 99-109.
Pekkarinen P, Hovatta I, Hakola P, Jarvi O, Kestila M, Lenkkeri U, Adolfsson R, Holmgren G, Nylander PO, Tranebjaerg L, Terwilliger JD, Lonnqvist J, and Peltonen L (1998). Assignment ofthe locus for PLO-SL, a frontal-lobe dementia with bone cysts, to 19q13. Am J Hum Genet 62:362-372.
Peltonen L, Perola M, Naukkarinen J, and Palotie A (2006). Lessons from studying monogenicdisease for common disease. Hum Mol Genet 15 Spec No 1: R67-R74
Peres RC, Scarel-Caminaga RM, do ESA, and Line SR (2005). Association between PAX-9promoter polymorphisms and hypodontia in humans. Arch Oral Biol 50: 861-871.
Peterkova R, Kristenova P, Lesot H, Lisi S, Vonesch JL, Gendrault JL, and Peterka M (2002). Different morphotypes of the tabby (EDA) dentition in the mouse mandible result from a defect in the mesio-distal segmentation of dental epithelium. Orthod Craniofac Res 5: 215-226.
Peters H and Balling R (1999). Teeth - where and how to make them. Trends Genet 15: 59-65.
Peters H, Neubuser A, Kratochwil K, and Balling R (1998). Pax9-deficient mice lack pharyngealpouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev 12:2735-2747.
Pires-daSilva A and Sommer RJ (2003). The evolution of signalling pathways in animaldevelopment. Nat Rev Genet 4 : 39-49.
Pirinen S, Arte S, and Apajalahti S (1996). Palatal displacement of canine is genetic and related tocongenital absence of teeth. J Dent Res 75: 1742-1746.
Pirinen S, Kentala A, Nieminen P, Varilo T, Thesleff I, and Arte S (2001). Recessively inheritedlower incisor hypodontia. J Med Genet 38: 551-556.
Pirinen, S. and Thesleff, I. (1995). Development of the dentition. In Orthodontics. B. Thilander and O. Rönning, eds. pp 41-53. Gothia, Karlshamn.
Pispa J, Jung HS, Jernvall J, Kettunen P, Mustonen T, Tabata MJ, Kere J, and Thesleff I (1999).Cusp patterning defect in Tabby mouse teeth and its partial rescue by FGF. Dev Biol 216: 521-534.
Pispa J and Thesleff I (2003). Mechanisms of ectodermal organogenesis. Dev Biol 262: 195-205.
Polder BJ, Van't Hof MA, Van der Linden FP, and Kuijpers-Jagtman AM (2004). A meta-analysis ofthe prevalence of dental agenesis of permanent teeth. Community Dent Oral Epidemiol 32: 217-226.
Potter RH, Nance WE, Yu PL, and Davis WB (1976). A twin study of dental dimension. II.Independent genetic determinants. Am J Phys Anthropol 44: 397-412.
Potter RH, Rice JP, Dahlberg AA, and Dahlberg T (1983). Dental size traits within families: pathanalysis for first molar and lateral incisor. Am J Phys Anthropol 61: 283-289.
106
Price JA, Bowden DW, Wright JT, Pettenati MJ, and Hart TC (1998). Identification of a mutation inDLX3 associated with tricho-dento-osseous (TDO) syndrome. Hum Mol Genet 7: 563-569.
Präger TM, Finke C, and Miethke RR (2006). Dental findings in patients with ectodermal dysplasia.J Orofac Orthop 67: 347-355.
Pummila M, Fliniaux I, Jaatinen R, James MJ, Laurikkala J, Schneider P, Thesleff I, and MikkolaML (2007). Ectodysplasin has a dual role in ectodermal organogenesis: inhibition of Bmpactivity and induction of Shh expression. Development 134: 117-125.
Rajab LD and Hamdan MA (2002). Supernumerary teeth: review of the literature and a survey of 152 cases. Int J Paediatr Dent 12: 244-254.
Ranta R (1986). A review of tooth formation in children with cleft lip/palate. Am J OrthodDentofacial Orthop 90: 11-18.
Rasmussen P (1999). Severe hypodontia: diversities in manifestations. J Clin Pediatr Dent 23: 179-188.
Reich DE and Lander ES (2001). On the allelic spectrum of human disease. Trends Genet 17: 502-510.
Richman JM and Lee SH (2003). About face: signals and genes controlling jaw patterning and identity in vertebrates. Bioessays 25: 554-568.
Rogan WJ, Gladen BC, Hung KL, Koong SL, Shih LY, Taylor JS, Wu YC, Yang D, Ragan NB, andHsu CC (1988). Congenital poisoning by polychlorinated biphenyls and their contaminants inTaiwan. Science 241: 334-336.
Rudolph D, Yeh WC, Wakeham A, Rudolph B, Nallainathan D, Potter J, Elia AJ , and Mak TW (2000). Severe liver degeneration and lack of NF-kappaB activation in NEMO/IKKgamma-deficient mice. Genes Dev 14: 854-862.
Ruiz-Perez VL, Blair HJ, Rodriguez-Andres ME, Blanco MJ, Wilson A, Liu YN, Miles C, Peters H,and Goodship JA (2007). Evc is a positive mediator of Ihh-regulated bone growth that localisesat the base of chondrocyte cilia. Development 134: 2903-2912.
Ruiz-Perez VL, Ide SE, Strom TM, Lorenz B, Wilson D, Woods K, King L, Francomano C, Freisinger P, Spranger S, Marino B, Dallapiccola B, Wright M, Meitinger T, PolymeropoulosMH, and Goodship J (2000a). Mutations in a new gene in Ellis-van Creveld syndrome andWeyers acrodental dysostosis. Nat Genet 24: 283-286.
Ruiz-Perez VL, Tompson SW, Blair HJ, Espinoza-Valdez C, Lapunzina P, Silva EO, Hamel B, Gibbs JL, Young ID, Wright MJ, and Goodship JA (2003b). Mutations in two nonhomologousgenes in a head-to-head configuration cause Ellis-van Creveld syndrome. Am J Hum Genet 72:728-732.
Rune B and Sarnäs KV (1974). Tooth size and tooth formation in children with advancedhypodontia. Angle Orthod 44 : 316-321.
Russell KA and Folwarczna MA (2003). Mesiodens--diagnosis and management of a commonsupernumerary tooth. J Can Dent Assoc 69: 362-366.
Rölling S (1980). Hypodontia of permanent teeth in Danish schoolchildren. Scand J Dent Res 88:365-369.
107
Rölling S and Poulsen S (2001). Oligodontia in Danish schoolchildren. Acta Odontol Scand 59:111-112.
Sadler, T.W. (1990). Langman's medical embryology. 6th edition. Williams & Wilkins, Baltimore.
Salazar-Ciudad I and Jernvall J (2002). A gene network model accounting for development andevolution of mammalian teeth. Proc Natl Acad Sci U S A 99: 8116-8120.
Sarkar L, Cobourne M, Naylor S, Smalley M, Dale T, and Sharpe PT (2000). Wnt/Shh interactionsregulate ectodermal boundary formation during mammalian tooth development. Proc Natl Acad Sci U S A 97: 4520-4524.
Sarkar L and Sharpe PT (1999). Expression of Wnt signalling pathway genes during tooth development. Mech Dev 85: 197-200.
Satoda M, Zhao F, Diaz GA, Burn J, Goodship J, Davidson HR, Pierpont ME, and Gelb BD (2000). Mutations in TFAP2B cause Char syndrome, a familial form of patent ductus arteriosus. NatGenet 25: 42-46.
Satokata I, Ma L, Ohshima H, Bei M, Woo I, Nishizawa K, Maeda T, Takano Y, Uchiyama M,Heaney S, Peters H, Tang Z, Maxson R, and Maas R (2000). Msx2 deficiency in mice causespleiotropic defects in bone growth and ectodermal organ formation. Nat Genet 24: 391-395.
Satokata I and Maas R (1994). Msx1 deficient mice exhibit cleft palate and abnormalities ofcraniofacial and tooth development. Nat Genet 6: 348-356.
Saxen L and Thesleff I (1992). Epithelial-mesenchymal interactions in murine organogenesis . CibaFound Symp 165: 183-98.
Scarel RM, Trevilatto PC, Di HOJ, Camargo LE, and Line SR (2000). Absence of mutations in the homeodomain of the MSX1 gene in patients with hypodontia. Am J Med Genet 92: 346-349.
Schalk-van der Weide Y. Oligodontia. A clinical, radiographic and genetic evaluation. 1992. Thesis. Rijksuniversiteit Utrecht.
Schalk-van der Weide Y and Bosman F (1996). Tooth size in relatives of individuals with oligodontia. Arch Oral Biol 41: 469-472.
Schmidt-Supprian M, Bloch W, Courtois G, Addicks K, Israel A, Rajewsky K, and Pasparakis M (2000). NEMO/IKK gamma-deficient mice model incontinentia pigmenti. Molecular Cell 5:981-992.
Segditsas S and Tomlinson I (2006). Colorectal cancer and genetic alterations in the Wnt pathway.Oncogene 25: 7531-7537.
Semina EV, Reiter R, Leysens NJ, Alward WL, Small KW, Datson NA, Siegel-Bartelt J, Bierke-Nelson D, Bitoun P, Zabel BU, Carey JC, Murray JC, Alward WLM, Datson NAXSJ, Bierkenelson D, Murray, and JC. (1996). Cloning and characterization of a novel bicoid-relatedhomeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet 14: 392-399.
Sengupta A, Whittaker DK, Barber G, Rogers J, and Musgrave JH (1999). The effects of dental wear on third molar eruption and on the curve of Spee in human archaeological dentitions. Arch OralBiol 44: 925-934.
108
Seow WK and Lai PY (1989). Association of taurodontism with hypodontia: a controlled study . Pediatr Dent 11: 214-219.
Seow WK and Wan A (2000). A controlled study of the morphometric changes in the primarydentition of pre-term, very-low-birthweight children. J Dent Res 79: 63-69.
Seppälä M, Depew MJ, Martinelli DC, Fan CM, Sharpe PT, and Cobourne MT (2007). Gas1 is amodifier for holoprosencephaly and genetically interacts with sonic hedgehog. J Clin Invest117: 1575-1584.
Shah RM, Boyd MA, and Vakil TF (1978). Studies of permanent tooth anomalies in 7,886 Canadian individuals. I: impacted teeth. Dent J 44: 262-264.
Sharpe PT (1995). Homeobox genes and orofacial development. Connect Tissue Res 32: 17-25.
Shifman A and Chanannel I (1978). Prevalence of taurodontism found in radiographic dental examination of 1,200 young adult Israeli patients. Community Dent Oral Epidemiol 6: 200-203.
Sick S, Reinker S, Timmer J, and Schlake T (2006). WNT and DKK determine hair follicle spacing through a reaction-diffusion mechanism. Science 314: 1447-1450.
Slavkin HC, Beierle J, and Bavetta LA (1968). Odontogenesis: cell-cell interactions in vitro. Nature217: 269-270.
Smahi A, Courtois G, Vabres P, Yamaoka S, Heuertz S, Munnich A, Israel A, Heiss NS, Klauck SM, Kioschis P, Wiemann S, Poustka A, Esposito T, Bardaro T, Gianfrancesco F, Ciccodicola A,D'U, Woffendin H, Jakins T, Donnai D, Stewart H, Kenwrick SJ, Aradhya S, Yamagata T, LevyM, Lewis RA, and Nelson DL (2000). Genomic rearrangement in NEMO impairs NF-kappaB activation and is a cause of incontinentia pigmenti. The International Incontinentia Pigmenti (IP) Consortium. Nature 405: 466-472.
Sobel E and Lange K (1996). Descent graphs in pedigree analysis: applications to haplotyping,location scores, and marker-sharing statistics. Am J Hum Genet 58: 1323-1337.
Sofaer JA, Bailit HL, and MacLean CJ (1970). A developmental basis for differential tooth reduction during hominid evolution. Evolution 25: 509-517.
Sofaer JA, MacLean CJ, and Bailit HL (1972). Heredity and morphological variation in early and late developing human teeth of the same morphological class. Arch Oral Biol 17: 811-816.
Sonoyama W, Liu Y, Fang D, Yamaza T, Seo BM, Zhang C, Liu H, Gronthos S, Wang CY, Shi S, and Wang S (2006). Mesenchymal stem cell-mediated functional tooth regeneration in Swine.PLoS ONE 1 (e79): 1-8.
Srivastava AK, Pispa J, Hartung AJ, Du Y, Ezer S, Jenks T, Shimada, T., Pekkanen M, Mikkola ML, Ko MS, Thesleff I, Kere J, and Schlessinger D (1997). The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons andencodes a protein (ectodysplasin-A) with collagenous domains. Proc Natl Acad Sci U S A 94:13069-13074.
St.Amand TR, Zhang Y, Semina EV, Zhao X, Hu Y, Nguyen, Murray JC, and Chen Y (2000).Antagonistic signals between BMP4 and FGF8 define the expression of Pitx1 and Pitx2 in mousetooth-forming anlage. Developmental Biology 217: 323-332.
109
Steele-Perkins G, Butz KG, Lyons GE, Zeichner-David M, Kim HJ, Cho MI, and Gronostajski RM (2003). Essential role for NFI-C/CTF transcription-replication factor in tooth root development. Mol Cell Biol 23: 1075-1084.
Steigman S, Harari D, and Kuraita-Landman S (1982). Relationship between mesiodistal crowndiameter of posterior deciduous and succedaneous teeth in israeli children. Eur J Orthod 4: 219-227.
Stockton DW, Das P, Goldenberg M, D'Souza RN, and Patel PI (2000). Mutation of PAX9 is associated with oligodontia. Nat Genet 24: 18-19.
Stottmann RW, Anderson RM, and Klingensmith J (2001). The BMP antagonists Chordin andNoggin have essential but redundant roles in mouse mandibular outgrowth. Dev Biol 240: 457-473.
Strachan, T. and Read, A.P. (1999). Human Molecular Genetics. 2nd edition. BIOS ScientificPublishers Ltd, Oxford.
Suarez BK and Spence A (1974). The genetics of hypodontia. J Dent Res 53: 781-785.
Suzuki K, Hu D, Bustos T, Zlotogora J, Richieri-Costa A, Helms JA, and Spritz RA (2000). Mutations of PVRL1, encoding a cell-cell adhesion molecule/herpesvirus receptor, in cleftlip/palate-ectodermal dysplasia. Nat Genet 25: 427-430.
Suzuki Y, Jezewski PA, Machida J, Watanabe Y, Shi M, Cooper ME, Viet lT, Nguyen TD, Hai H, Natsume N, Shimozato K, Marazita ML, and Murray JC (2004). In a Vietnamese population,MSX1 variants contribute to cleft lip and palate. Genet Med 6: 117-125.
Svinhufvud E, Myllarniemi S, and Norio R (1988). Dominant inheritance of tooth malpositions andtheir association to hypodontia. Clin Genet 34: 373-381.
Sözen MA, Suzuki K, Tolarova MM, Bustos T, Fernandez IJ, and Spritz RA (2001). Mutation of PVRL1 is associated with sporadic, non-syndromic cleft lip/palate in northern Venezuela. NatGenet 29: 141-142.
Tao R, Jin B, Guo SZ, Qing W, Feng GY, Brooks DG, Liu L, Xu J, Li T, Yan Y, and He L (2006). Anovel missense mutation of the EDA gene in a Mongolian family with congenital hypodontia. JHum Genet : 498-502.
Tarpey P, Pemberton TJ, Stockton DW, Das P, Ninis V, Edkins S, Andrew FP, Wooster R, KamathS, Nayak R, Stratton MR, and Patel PI (2007). A novel Gln358Glu mutation in ectodysplasin A associated with X-linked dominant incisor hypodontia. Am J Med Genet A 143: 390-394.
Ten Cate, A.R. (1994). Oral Histology. Development, structure and function. 4th edition. Mosby, StLouis.
Terwilliger, J.D. and Ott, J. (1994). Handbook of Human Genetic Linkage. The Johns Hopkins University Press, Baltimore and London.
Thauvin-Robinet C, Cossee M, Cormier-Daire V, Van Maldergem L, Toutain A, Alembik Y, BiethE, Layet V, Parent P, David A, Goldenberg A, Mortier G, Heron D, Sagot P, Bouvier AM, Huet F, Cusin V, Donzel A, Devys D, Teyssier JR, and Faivre L (2006). Clinical, molecular, and genotype-phenotype correlation studies from 25 cases of oral-facial-digital syndrome type 1: a French and Belgian collaborative study. J Med Genet 43: 54-61.
110
Thesleff I (2006). The genetic basis of tooth development and dental defects. Am J Med Genet A140: 2530-2535.
Thesleff I, Keränen S, and Jernvall J (2001). Enamel knots as signaling centers linking toothmorphogenesis and odontoblast differentiation. Adv Dent Res 15: 14-18.
Thesleff I and Mikkola ML (2002). Death receptor signaling giving life to ectodermal organs. SciSTKE 2002: E22
Thesleff I and Nieminen P. (2005) Tooth induction. http://www.els.net. Encyclopedia of Life Sciences. Nature Publishing Group, Macmillan Publishers Ltd.
Thesleff I, Partanen AM, and Vainio S (1991). Epithelial-mesenchymal interactions in toothmorphogenesis: the roles of extracellular matrix, growth factors, and cell surface receptors. JCraniofac Genet Dev Biol 11: 229-237.
Thesleff I and Pirinen S. (2005) Genetics of Dental Anomalies. http://www.els.net. Encyclopedia of Life Sciences. Nature Publishing Group.
Thilander B and Jakobsson SO (1968). Local factors in impaction of maxillary canines. ActaOdontol Scand 26: 145-168.
Thomas BL, Tucker AS, Qiu M, Ferguson CA, Hardcastle Z, Rubenstein, JL, and Sharpe PT (1997).Role of Dlx-1 and Dlx-2 genes in patterning of the murine dentition. Development 124: 4811-4818.
Thompson GW and Popovich F (1974). Probability of congenitally missing teeth: results in 1,191 children in the Burlington Growth centre in Toronto. Community Dent Oral Epidemiol 2: 26-32.
Tissier-Seta JP, Mucchielli ML, Mark M, Mattei MG, Goridis C, and Brunet JF (1995). Barx1, a newmouse homeodomain transcription factor expressed in cranio-facial ectomesenchyme and the stomach. Mech Dev 51: 3-15.
Tonge CH (1969). The time-structure relationship to tooth development in human embryogenesis. JDent Res 48: 745-752.
Townsend G, Rogers J, Richards L, and Brown T (1995). Agenesis of permanent maxillary lateral incisors in South Australian twins. Aust Dent J 40: 186-192.
Townsend GC (1980). Heritability of deciduous tooth size in Australian aboriginals. Am J PhysAnthropol 53: 297-300.
Townsend GC, Aldred MJ, and Bartold PM (1998). Genetic aspects of dental disorders. Aust Dent J43: 269-286.
Townsend GC, Richards L, Hughes T, Pinkerton S, and Schwerdt W (2005). Epigenetic influences may explain dental differences in monozygotic twin pairs. Aust Dent J 50: 95-100.
Tribulo C, Aybar MJ, Nguyen VH, Mullins MC, and Mayor R (2003). Regulation of Msx genes by a Bmp gradient is essential for neural crest specification. Development 130: 6441-6452.
Trumpp A, Depew MJ, Rubenstein JL, Bishop JM, and Martin GR (1999). Cre-mediated geneinactivation demonstrates that FGF8 is required for cell survival and patterning of the first branchial arch. Genes Dev 13: 3136-3148.
111
Tsai SJ and King NM (1998). A catalogue of anomalies and traits of the permanent dentition ofsouthern Chinese. J Clin Pediatr Dent 22: 185-194.
Tucker A and Sharpe P (2004). The cutting-edge of mammalian development; how the embryomakes teeth. Nat Rev Genet 5: 499-508.
Tucker AS, Matthews KL, and Sharpe PT (1998). Transformation of tooth type induced by inhibition of BMP signaling. Science 282: 1136-1138.
Tummers M and Thesleff I (2003). Root or crown: a developmental choice orchestrated by the differential regulation of the epithelial stem cell niche in the tooth of two rodent species.Development 130: 1049-1057.
Tureckova J, Sahlberg C, Åberg T, Ruch JV, Thesleff I, and Peterkova R (1995). Comparison ofexpression of the msx-1, msx-2, BMP-2 and BMP-4 genes in the mouse upper diastemal and molar tooth primordia. Int J Dev Biol 39: 459-468.
Uslenghi S, Liversidge HM, and Wong FS (2006). A radiographic study of tooth development inhypodontia. Arch Oral Biol 51: 129-133.
Vaahtokari A, Åberg T, Jernvall J, Keränen S, and Thesleff I (1996). The enamel knot as a signalingcenter in the developing mouse tooth. Mech Dev 54: 39-43.
Vainio S, Karavanova I, Jowett A, and Thesleff I (1993). Identification of BMP-4 as a signal mediating secondary induction between epithelial and mesenchymal tissues during early toothdevelopment . Cell 75: 45-58.
van Bokhoven H and McKeon F (2002). Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans. Trends Mol Med 8: 133-139.
van den Boogaard MJH, Dorland M, Beemer FA, and van Amstel HKP (2000). MSX1 mutation is associated with orofacial clefting and tooth agenesis in humans. Nat Genet 24: 342-343.
van Genderen C, Okamura RM, Farinas I, Quo RG, Parslow TG, Bruhn L, and Grosschedl R (1994).Development of several organs that require inductive epithelial-mesenchymal interactions is impaired in LEF-1- deficient mice. Genes Dev 8: 2691-2703.
Vastardis H (2000). The genetics of human tooth agenesis: new discoveries for understanding dental anomalies. Am J Orthod Dentofacial Orthop 117: 650-656.
Vastardis H, Karimbux N, Guthua SW, Seidman JG, and Seidman CE (1996). A human MSX1homeodomain missense mutation causes selective tooth agenesis. Nat Genet 13: 417-421.
Vieira AR (2003). Oral clefts and syndromic forms of tooth agenesis as models for genetics of isolated tooth agenesis. J Dent Res 82: 162-165.
Vieira AR, Meira R, Modesto A, and Murray JC (2004). MSX1, PAX9, and TGFA contribute to tooth agenesis in humans. J Dent Res 83: 723-727.
Vieira AR, Modesto A, Meira R, Barbosa AR, Lidral AC, and Murray JC (2007). Interferonregulatory factor 6 (IRF6) and fibroblast growth factor receptor 1 (FGFR1) contribute to humantooth agenesis. Am J Med Genet A 143: 538-545.
Wall JD and Pritchard JK (2003). Haplotype blocks and linkage disequilibrium in the humangenome. Nat Rev Genet 4 : 587-597.
112
Wallis DE, Roessler E, Hehr U, Nanni L, Wiltshire T, Richieri-Costa A, Gillessen-Kaesbach G,Zackai EH, Rommens J, and Muenke M (1999). Mutations in the homeodomain of the humanSIX3 gene cause holoprosencephaly. Nat Genet 22: 196-198.
Waltimo J. Developmental defects of human dentine matrix. 1996. Institute of Dentistry, Universityof Helsinki, Finland.
Wang SL, Chen TT, Hsu JF, Hsu CC, Chang LW , Ryan JJ, Guo YL, and Lambert GH (2003).Neonatal and childhood teeth in relation to perinatal exposure to polychlorinated biphenyls and dibenzofurans: observations of the Yucheng children in Taiwan. Environ Res 93: 131-137.
Wang XP, Aberg T, James MJ, Levanon D, Groner Y, and Thesleff I (2005). Runx2 (Cbfa1) InhibitsShh Signaling in the Lower but not Upper Molars of Mouse Embryos and Prevents the Buddingof Putative Successional Teeth. J Dent Res 84: 138-143.
Wang XP, Suomalainen M, Felszeghy S, Zelarayan LC, Alonso MT, Plikus MV, Maas RL, ChuongCM, Schimmang T, and Thesleff I (2007). An integrated gene regulatory network controls stem cell proliferation in teeth. PLoS Biol 5: e159
Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Wankell M, Werner S, and Thesleff I (2004a).Modulation of activin/bone morphogenetic protein signaling by follistatin is required for the morphogenesis of mouse molar teeth. Dev Dyn 231: 98-108.
Wang XP, Suomalainen M, Jorgez CJ, Matzuk MM, Werner S, and Thesleff I (2004b). Follistatinregulates enamel patterning in mouse incisors by asymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev Cell 7: 719-730.
Wang, X.P. and Thesleff, I. (2005). Tooth development. In Cell signaling and growth factors in development. K. Unsicker and K. Krieglstein, eds. pp. 719-754. Wiley-VCH & C0, Weinheim.
Weiss KM (1996). Is there a paradigm shift in genetics? Lessons from the study of human diseases.Mol Phylogenet Evol 5: 259-265.
Weiss KM, Stock DW, and Zhao Z (1998). Dynamic interactions and the evolutionary genetics of dental patterning. Crit Rev Oral Biol Med 9: 369-398.
Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, and Lathrop M(1992). A second-generation linkage map of the human genome. Nature 359: 794-801.
Whittington BR and Durward CS (1996). Survey of anomalies in primary teeth and their correlationwith the permanent dentition. N Z Dent J 92: 4-8.
Wilkie AO (1997). Craniosynostosis: genes and mechanisms. Hum Mol Genet 6: 1647-1656.
Wilusz CJ, Wang W, and Peltz SW (2001). Curbing the nonsense: the activation and regulation ofmRNA surveillance. Genes Dev 15: 2781-2785.
Wolf J, Järvinen HJ, and Hietanen J (1986). Gardner's dento-maxillary stigmas in patients with familial adenomatosis coli. Br J Oral Maxillofac Surg 24: 410-416.
Wright JT (2006). The molecular etiologies and associated phenotypes of amelogenesis imperfecta. Am J Med Genet A 140: 2547-2555.
Yang A, Schweitzer R, Sun DQ, Kaghad M, Walker N, Bronson RT, Tabin, Sharpe A, Caput D, Crum C, and McKeon F (1999). p63 is essential for regenerative proliferation in limb,craniofacial and epithelial development. Nature 398: 714-718.
113
Yasuda I, Yasuda M, Sumida H, Tsusaki H, Arima A, Ihara T, Kubota S, Asaoka K, Tsuga K, andAkagawa Y (2005). In utero and lactational exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin(TCDD) affects tooth development in rhesus monkeys. Reprod Toxicol 20: 21-30.
Yonezu T, Hayashi Y, Sasaki J, and Machida Y (1997). Prevalence of congenital dental anomalies of the deciduous dentition in Japanese children. Bull Tokyo Dent Coll 38: 27-32.
Yu HM, Jerchow B, Sheu TJ, Liu B, Costantini F, Puzas JE, Birchmeier W, and Hsu W (2005). Therole of Axin2 in calvarial morphogenesis and craniosynostosis. Development 132: 1995-2005.
Zhang Q, Murcia NS, Chittenden LR, Richards WG, Michaud EJ, Woychik RP, and Yoder BK (2003). Loss of the Tg737 protein results in skeletal patterning defects. Dev Dyn 227: 78-90.
Zhang Y, Zhang Z, Zhao X, Yu X, Hu Y, Geronimo B, Fromm SH, and Chen YP (2000). A new function of BMP4: dual role for BMP4 in regulation of Sonic hedgehog expression in the mouse tooth germ. Development 127 : 1431-1443.
Zhang YD, Zhao X, Hu YP, St Amand T, Zhang MF, Ramamurthy R, Qiu MS, and Chen YP (1999). Msx1 is required for the induction of Patched by Sonic hedgehog in the mammalian tooth germ.Dev Dyn 215: 45-53.
Zhao JL, Chen YX, Bao L, Xia QJ, Wu TJ, and Zhou L (2005). [Novel mutations of PAX9 gene inChinese patients with oligodontia]. Zhonghua Kou Qiang Yi Xue Za Zhi 40: 266-270.
Zhou P, Byrne C, Jacobs J, and Fuchs E (1995). Lymphoid enhancer factor 1 directs hair follicle patterning and epithelial cell fate. Genes Dev 9: 700-713.
Zhu JF, Marcushamer M, King DL, and Henry RJ (1996). Supernumerary and congenitally absentteeth: a literature review. J Clin Pediatr Dent 20: 87-95.
Zilberman Y, Cohen B, and Becker A (1990). Familial trends in palatal canines, anomalous lateral incisors, and related phenomena. Eur J Orthod 12: 135-139.
Zonana J, Elder ME, Schneider LC, Orlow SJ, Moss C, Golabi M, Shapira SK, Farndon PA, Wara DW, Emmal SA, and Ferguson BM (2000). A novel X-linked disorder of immune deficiency and hypohidrotic ectodermal dysplasia is allelic to incontinentia pigmenti and due to mutations in IKK-gamma (NEMO). Am J Hum Genet 67: 1555-1562.
Åberg T, Cavender A, Gaikwad JS, Bronckers AL, Wang X, Waltimo-Siren J, Thesleff I, and D'Souza RN (2004). Phenotypic Changes in Dentition of Runx2 Homozygote-null Mutant Mice.J Histochem Cytochem 52: 131-140.
Åberg T, Wang XP, Kim JH, Yamashiro T, Bei M, Rice R, Ryoo HM, and Thesleff I (2004). Runx2mediates FGF signaling from epithelium to mesenchyme during tooth morphogenesis. Dev Biol270: 76-93.
Åberg T, Wozney J, and Thesleff I (1997). Expression patterns of bone morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles in morphogenesis and cell differentiation.Dev Dyn 210: 383-396.
114
