Proc. Nat!. Acad. Sci. USAVol. 86, pp. 5395-5399, July 1989Cell Biology

Mouse Mos protooncogene product is present and functionsduring oogenesis

(oncogene/meiosis/v-/c-mos/maturation-promoting factor/antisense oligonucleotides)

RICHARD S. PAULES*, ROBERTO BUCCIONEt, ROBERT C. MOSCHEL*, GEORGE F. VANDE WOUDE*t,AND JOHN J. EPPIGtt*BRI-Basic Research Program, National Cancer Institute-Frederick Cancer Research Facility, Frederick, MD 21701;and tThe Jackson Laboratory, 600 Main Street, Bar Harbor, ME 04609

Communicated by Howard L. Bachrach, March 10, 1989 (received for review December 16, 1988)

ABSTRACT We have identified the mouse Mos-encodedprotein product, p391, in maturing mouse oocytes and haveshown that it is indis hable from the product expressed inMos-transformed NIH 3T3 cells. p39 is detected in oocytesarrested in the first meiotic prophase, during germinal-vesiclebreakdown, metaphase I, anaphase I, and in ovulated eggs. Weshow that microinjection of three different Mos antisense (butnot sense) oligodeoxyribonucleotides into germinal vesicle-stage oocytes prevents first polar-body emission and thereforeinterrupted the normal progression of meiosis. These resultsshow that in mouse oocytes, as in the amphibian Xenopus[Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J. &Vande Woude, G.F. (1988) Nature (London) 335, 519-525], theproduct of Mos is necessary for normal meiotic maturation.

c-mos, the cellular homolog of the Moloney murine sarcomavirus (Mo-MSV) transforming gene, v-mos, was the firstprotooncogene to be characterized (1, 2) and shown to beactivated as an oncogene by proviral long terminal repeats (1,3). The c-mos protooncogene (1, 4-8) is unusual whencompared to other protooncogenes, since it consists of asingle coding exon and is less well-conserved between spe-cies than other members of the src family of protein kinases(6, 9). RNA transcripts of c-mos have been detected indeveloping embryos and in adult tissues (6-8, 10, 11), andwhere characterized, the mRNA is not processed and is adirect copy of the genome (6, 8, 10, 11). The highest level ofexpression is found in gonadal tissues (6-8, 10, 11) and isrestricted to germ cells (11-14).

Biochemical characterization of the mos protein has beenlimited to the v-mos gene product expressed in cells acutelyinfected with or transformed by Mo-MSV (15-18) or ex-pressed in Escherichia coli (19) and yeast (20). These studieshave shown that it is a soluble cytoplasmic protein (21) withserine/threonine kinase activity (17, 18). It also has beenshown that the product of v-mos is an ATPase (19) and hasATP-dependent nucleic acid-binding activity (22). Both v-mos and the mouse c-mos, designated Mos, have equivalentbiological transforming activities in NIH 3T3 cell transfectionassays (23). Identification of the c-mos protooncogene pro-tein expressed in normal tissues has been unsuccessful untilrecently (8) and, therefore, comparison with the oncogeneproduct has not been possible. Recently, it has been shownin Xenopus that the c-mos protooncogene is expressed asmaternal mRNA during oocyte development and that theprotooncogene product, p39mos, is required for oocyte mat-uration (8) and is a candidate initiator of maturation-promoting factor (24).

Murine oocytes are arrested around the time of birth at thedictyate stage of meiotic prophase I (germinal vesicle- orGV-stage resting oocytes) and are enclosed by a single layerof flattened granulosa cells. Meiotic arrest is maintainedduring oocyte growth and granulosa cell proliferation bysomatic follicular cells until pituitary gonadotropins initiatethe complex program of oocyte maturation, which includesthe dissolution of the nuclear membrane [GV breakdown(GVBD)], emission of the first polar body (PB), and subse-quent block of the oocytes at metaphase II until fertilization.The mechanism for the resumption of oocyte meiosis in vivois not clear (25-27), but isolated fully grown murine oocytesundergo maturation "spontaneously " [without stimulationby exogenous gonadotropins in vitro (28)] unless meioticarrest is maintained by membrane-permeable analogs ofcAMP, by phosphodiesterase inhibitors such as 1-isobutyl-3-methylxanthine (IBMX) (29, 30), or by naturally occurringpurines (31). The successful completion ofoocyte maturationrequires continued protein synthesis. Mouse oocytes, ifincubated with protein synthesis inhibitors, undergo GVBDbut do not produce the first PB, and meiosis is blocked at thebivalent stage (32).Here we show that the Mos protooncogene-encoded pro-

tein is expressed in mouse oocytes, is required for oocytematuration, and is indistinguishable from the Mos oncogeneproduct expressed in transformed NIH 3T3 cells.

MATERIALS AND METHODSCells and Cell Culture. pTS-1-transformed NIH 3T3 cells

(23) used for these studies were derived from a single cellclone. For metabolic labeling of proteins, exponentiallygrowing cells were incubated for 30 min in 5 ml of methionine-and cysteine-free Dulbecco's modified Eagle's medium(GIBCO) containing 10o (vol/vol) dialyzed fetal bovineserum and then incubated for 30 or 60 min in the presence of1.0 mCi (1 Ci = 37 GBq) each of L-t35S]methionine (>1000Ci/mmol; New England Nuclear) and L-[35S]cysteine (>900Ci/mmol; New England Nuclear). Phosphate-buffered saline(PBS; GIBCO)-rinsed cells were solubilized in 1 ml of radio-immunoprecipitation assay (RIPA) buffer plus protease in-hibitors [1% Nonidet P-40, 0.5% sodium deoxycholate, and0.1% sodium dodecyl sulfate (SDS) in PBS plus 2.5 mMphenylmethylsulfonyl fluoride and 60 kallikrein inhibitorunits of aprotinin (Boehringer Mannheim) per ml]. Celllysates were clarified by centrifugation at 100,000 x g for 1hr at 4°C.

Abbreviations: GV, germinal vesicle; GVBD, GV breakdown;RIPA, radioimmunoprecipitation assay; PB, polar body; IBMX1-isobutyl-3-methylxanthine; MPF, maturation-promoting factor;hCG, human chorionic gonadotropin; Mo-MSV, Moloney murinesarcoma virus.tTo whom reprint requests should be addressed.

5395

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Apr

il 13

, 202

1

Proc. Natl. Acad. Sci. USA 86 (1989)

Oocyte Isolation and Metabolic Labeling. Groups of =500-700 oocytes were metabolically labeled by incubation in250-Al drops of Whitten's medium (WM; ref. 58) supple-mented with 3 mg of polyvinylpyrrolidone (Calbiochem) perml (WM/PVP) and containing 2 mCi of Tran35S-label (ICN)per ml under paraffin oil for 3 hr. The samples were thenwashed in WM/PVP, freed from surrounding somatic cells,and transferred into RIPA buffer. Oocytes, eggs, and zygoteswere isolated and prepared as follows. Granulosa cell-enclosed growing oocytes were isolated from 10-day-oldprepuberal mice by partial digestion of the ovaries in PBScontaining 5 mg of collagenase (Worthington) per ml (33).Fully grown GV-stage oocytes were isolated from the ovariesof 22-day-old mice 48 hr after an i.p. injection of 5 interna-tional units of pregnant mare's serum gonadotropin (Dio-synth, Oss, Holland) and placed in minimal essential medium(MEM) supplemented with 3 mg ofbovine serum albumin perml and 0.1 mM IBMX. Isolated oocyte-cumulus cell com-plexes were either (i) radiolabeled in the presence of 0.1 mMIBMX to maintain meiotic arrest, (it) immediately radiola-beled, or (iii) allowed to mature for various times and thenradiolabeled. At the end of incubations, fully grown oocyteswere denuded of cumulus cells and transferred to RIPAbuffer. All oocytes were radiolabeled as described above.To radiolabel oocytes maturing in vivo, mice were injected

i.p. with 5 international units of human chorionic gonado-tropin (hCG; Gestyl, Organon) 48 hr after the pregnantmare's serum gonadotropin injection; 5 or 8 hr after the hCGinjection, granulosa cell-maturing oocyte complexes wereisolated and radiolabeled. Ovulated metaphase II oocytes(eggs or ova) enclosed in their mucified cumulus oophoriwere isolated from the oviduct ampulla inWM 13-15 hr afterhCG injection. Oocytes and ova were denuded by adding 250,Al ofWM/PVP containing 2 mg of hyaluronidase (Sigma) perml to the incubation droplet and transferred to RIPA buffer.Pronuclear stage-one cell embryos were obtained by in vitrofertilization of ovulated eggs with capacitated epididymalsperm in WM as described (34). Embryos were radiolabeledas described above, washed, and transferred to RIPA buffer.

Antibodies and Immunoprecipitations. Anti-Mos-(6-24) an-tiserum was raised against a peptide corresponding to 19amino acids in the N terminus of Mos-encoded p39mos (res-idues 6-24; Ser-Leu-Cys-Arg-Tyr-Leu-Pro-Arg-Glu-Leu-Ser-Pro-Ser-Val-Asp-Ser-Arg-Ser-Cys) (6). Anti-Mos-(334-343) was raised against the last 10 C-terminal aminoacids of Mos-encoded p39mOS plus an additional tyrosineresidue [residues 334-343; (Tyr)-Asp-Leu-Lys-Ala-Phe-Arg-Gly-Ala-Leu-Gly] (6). Anti-BM is a polyclonal rabbitantiserum elicited in rabbits immunized with a bacteriallyexpressed vmosHT1 fusion protein (19). Immunoprecipita-tions of proteins from clarified lysates were performed asdescribed (8) with an additional washing of immune-complexpellets twice with ice-cold high-salt buffer (1 M NaCl/10mMTris HCI, pH 7.25/0.5% Triton X-100). Proteins of the im-mune complexes were resolved by electrophoresis on 12.5%SDS/polyacrylamide gels (35), and gels then were treatedwith Amplify (Amersham), dried, and exposed to x-ray film(X-Omat AR, Kodak) at -80°C. Apparent molecular weightswere determined relative to [14C]methylated protein stan-dards (Amersham).

Oligodeoxyribonucleotides. All oligodeoxyribonucleotides(oligonucleotides) were synthesized on an Applied Biosys-tems 380B DNA synthesizer. Phosphorothioates containingsulfur at each internucleotide linkage were prepared bysulfurization of the corresponding oligonucleotide hydrogenphosphonates by using Applied Biosystems recommendedsynthesis cycles and adaptations of previously describedmethods (36-38).The sequences of the sense oligonucleotides or oligonu-

cleotide phosphorothioates were the same as the 20 nucleo-

tides surrounding the first ATG codon (sense oligo I, GAG-GGTGTAATGCCTTCGCC), the second ATG codon (senseoligo II, GGTATGTCTGATGCATAGGC), or the third ATGcodon (sense oligo III, CCATAATCATGGAGTTTGGG) ofthe Mos open reading frame (4). The sequences of the anti-sense oligonucleotides or oligonucleotide phosphorothioateswere complementary to these (i.e., antisense oligo I, GGC-GAAGGCATTACACCCTC; antisense oligo II, GCCTA-TGCATCAGACATACC; and antisense oligo III, CCCAAA-CTCCATGATTATGG).

Oligonucleotide Injection into Mouse Oocytes. Cumuluscell-enclosed fully grown oocytes were collected in MEMcontaining 0.1 mM IBMX as described above. Oligonucleo-tides were resuspended in PBS to achieve a final concentra-tion of 1 mg/ml, and 10 pl of oligonucleotide solution wasinjected into each cumulus-enclosed oocyte. Oocytes wereinjected in the presence of surrounding cumulus cells, whichgreatly improved the survival rate of the oocytes from about50% to 80% and, furthermore, allowed the continuous inter-action of the oocyte with the surrounding somatic cells inculture. After microinjection, oocyte-cumulus complexeswere washed in MEM and incubated overnight (12-15 hr) toallow meiotic maturation. Oocytes were denuded of cumuluscells and scored for GV and PB production. Uninjectedcumulus-enclosed oocytes were cultured as described aboveand scored for PB production for each microinjection exper-iment.(C57BL/6J x SJL/J)F1 mice were used in all experiments.

RESULTSp39" in Transformed Cells and Mouse Oocytes. Protein

extracts from mouse oocytes metabolically labeled in vitrohave been analyzed for the presence ofMos-encoded protein.Fully grown prophase I-arrested oocytes in the GV stagewere allowed to progress through meiotic maturation for 8 hrand then were metabolically labeled for 3 hr. Oocyte proteinextracts were immunoprecipitated by using three Mos-specific antisera (Fig. 1, lanes 8-13) and compared directly tosimilarly processed immunoprecipitates prepared from met-abolically labeled pTS-1-transformed NIH 3T3 cells (Fig. 1,lanes 1-7). These analyses show that the p39mOs productrecognized by the three Mos-specific antisera in pTS-1-transformed cells was also detected in maturing oocytes. Ineach case, p39mos immunoprecipitation was blocked by com-peting antigen. We conclude that p39mOS is expressed inmaturing mouse oocytes and show that it is indistinguishablein size and in antigenic properties from the product expressedin Mos-transformed cells.p39' in Developing Oocytes. We examined the pattern of

p39mos production during oogenesis. Oocytes were collectedand metabolically labeled during the following stages: grow-ing oocytes; fully grown IBMX-arrested GV oocytes; ma-turing occytes released from meiotic arrest for either 5 or 8hr; metaphase II oocytes; and pronuclear-stage embryos.We detected p39mos in fully grown IBMX-arrested oocytes(Fig. 2A, lanes 1 and 3) as well as in oocytes metabolicallylabeled during meiotic maturation from 5 to 8 hr (Fig. 2A,lanes 5 and 7; Fig. 2B, lanes 1 and 2) and 8-11 hr (Fig. 2B,lanes 3 and 4). We also detected p39mOS in oocytes labeled 2-5hr during meiotic maturation (data not shown) and in ovu-lated eggs (Fig. 2B, lane 5). Using the same metaboliclabeling strategy, we did not detect p39m0s in growing oocytes(data not shown) or in pronuclear- stage embryos (Fig. 2B,lane 6). p39mOs was expressed in oocytes matured either invivo or in vitro (Fig. 2B, lanes 1-4). Two additional proteins,p29 and p24, were detected in oocytes matured in vivo for 8hr (Fig. 2B, lane 4) and corresponded in size to Mos-encodedproducts, initiated at two internal AUG codons, that weredetected in pTS-1-transformed cells (Fig. 2A, lanes 9 and

53% Cell Biology: Paules et al.

Dow

nloa

ded

by g

uest

on

Apr

il 13

, 202

1

Proc. Natl. Acad. Sci. USA 86 (1989) 5397

Maturing Oocytes A

I00-c 0 M

-+ - +

kd

92 -

69 -

--_ p39mOs

Fully Grown, MaturingArrested Oocytes Oocytes

NIH(pTS-1)

o X s o o0Ec m E c Ec n

r cn Crcn cl c

_ + + + + - + - +

46 -

_ p39m°s

30

1 2 3 4 5 6 7 8 9 10 11 12 13

FIG. 1. Immunoprecipitation analyses of Mos-encoded proteinfrom Mos-transformed NIH 3T3 cells and meiotic mouse oocytes.Cells were metabolically labeled with [3IS]methionine and[35S]cysteine for 1 hr [NIH(pTS-1) cells] or 3 hr (maturing oocytes).Aliquots of clarified lysates containing -26 x 106 CCl3COOH-precipitable cpm from NIH(pTS-1) cells or -5.5 x 106 CCl3COOH-precipitable cpm from -560 oocytes, either in the absence (lanes -)or presence (lanes +) of competing antigen, were subjected toimmunoprecipitation analyses using anti-Mos-(6-24), anti-Mos-(334-343), or anti-BM, as defined in text. One aliquot of NIH(pTS-1)cell lysate received only protein A-Sepharose treatment (lane 1).Immunoprecipitated proteins were analyzed by 12.5% SDS/PAGEfollowed by autoradiography for either 3 days (lanes 1-7) or 3 weeks(lanes 8-13). The arrow points to the protein specifically precipitatedby all three Mos-specific antisera from Mos-transformed NIH 3T3cells [NIH(pTS-1)] or maturing mouse oocytes.

1 2 3 4 5 6 7 8 9 10 11 12

B

kd

92 -

69-

Maturing OocytesI

0 0r7 --.coC

u) I).r c, 00.r- N

46-

Ow - p3gIlmOs

11). These short Mos-encoded products have been discussedpreviously (6), and will be described elsewhere.Mos Antisense Oligonucleotides Interrupt Meiotic Matura-

tion. Antisense nucleic acids injected into amphibian ormammalian oocytes have been shown to interrupt geneexpression (8, 39-43). c-mos antisense oligonucleotides in-jected into Xenopus oocytes specifically block progesterone -

induced oocyte maturation (8). We tested whether Mosoligonucleotides would have any effect on maturing mouseoocytes. A mixture of three different Mos antisense or senseoligonucleotides corresponding to unique coding regionswithin Mos mRNA transcripts was injected into cumulus-enclosed, fully grown, GV-arrested oocytes. In this manner,we could test oligonucleotides with different sequences si-multaneously. In addition, we tested similar mixtures ofoligonucleotide phosphorothioates, which are resistant tonuclease digestion within the cellular compartment (44).Microinjection ofthese mixtures into fully grown oocytes didnot prevent GVBD, as observed in amphibian oocytes (8),but inhibited completion of the first meiotic division and firstPB production. Phosphorothioate and normal sense oligonu-cleotide-injected oocytes cultured for 12-15 hr displayed==60% and =-58% PB emission respectively, while uninjectedcontrol oocytes showed -72% PB production. In sharpcontrast, phosphorothioate and normal antisense oligonucle-otides markedly inhibited PB emission to -10% and -15% ofthe injected oocytes, respectively. Since phosphorothioateand normal oligonucleotides gave similar results, only thelatter were tested in further experiments.To evaluate the possibility that the effect of the mixture of

the antisense oligonucleotides might have been due to non-specific effects, oligonucleotides were tested individually

30-

1 2 3 4 5 6

FIG. 2. Production of p39""" during oogenesis. Metabolically35S-labeled proteins were precipitated from extracts of oocytes invarious stages ofoogenesis. (A) Fully grown oocytes were either heldin the presence of IBMX during labeling for 2.5 hr or allowed toprogress through meiosis in vitro for 5 hr prior to labeling for 3 hr.Aliquots of clarified lysates containing the equivalent of 4.1 x 106CC13COOH-precipitable cpm from -350 fully grown GV-arrestedoocytes or 6.3 X 106 CC13COOH-precipitable cpm from -570meiotically maturing oocytes or 24 x 106 CC13COOH-precipitablecpm from NIH(pTS- 1) cells were subjected to immunoprecipitationanalyses. Autoradiography was for either 5 weeks (lanes 1-8) or 1week (lanes 9-12). (B) Groups of 250 oocytes were collected andcultured in vitro for 3 hr in the presence of 35S-labeled amino acids.Lanes: 5-8, fully grown oocytes maturing in vitro for 5 hr prior tolabeling; 5-8 in vivo, oocytes maturing in vivo for 5 hr after hCGtreatment; 8-11, oocytes maturing in vitro for 8 hr prior to labeling;8-11 in vivo, oocytes maturing in vivo 8 hr following hCG treatment;O.E., ovulated eggs arrested in metaphase II; Z, zygotes (i.e.,pronuclear-stage embryos). Clarified lysates were subjected toimmunoprecipitation analyses and contained the following CCI3-COOH-precipitable cpm; 4.2 x 106 (lane 1), 9.6 x 106 (lane 2), 4.6x 106 (lane 3), 6.9 x 106 (lane 4), 1.0 x 106 (lane 5), and 0.4 x 106(lane 6). Autoradiography was for 6 weeks.

(Fig. 3). In these experiments, the control (uninjected)oocytes showed an average of 75% PB production afterIBMX removal. Oocytes injected with any of the three senseoligonucleotides (I, II, and III) showed only a slight reduction

NIH(pTS-1)

kd- + -+

69-

46-

30-

Cell Biology: Paules et al.

Dow

nloa

ded

by g

uest

on

Apr

il 13

, 202

1

Proc. Natl. Acad. Sci. USA 86 (1989)

100

580 203 249

31 7

-oD-

95 58

0- 60 - 84

~0 /7

~~~~81

0

FIG. 3. Blockage of PB emission by Mos oligonucleotides. Cu-mulus cell-enclosed oocytes blocked at the GV stage in IBMX-containing medium were microinjected with one of three differentantisense (solid bars) or sense (hatched bars) oligonucleotides andallowed to mature overnight. Control uninjected oocytes (stippledbars) were examined in each experiment. Numbers over columnsrefer to the number of oocytes examined per group in at least fourseparate experiments. x2 analysis revealed significant differences,with P < 0.01 for sense-injected vs. antisense-injected oocytes.

in PB emission (61%, 58%, and 62%, respectively), whileoocytes injected with individual antisense oligonucleotidesshowed only 10Po-27% PB production. Approximately thesame reduction was observed with the mixture of antisenseoligonucleotides. These studies show that microinjection ofthree different c - mos antisense oligonucleotides complemen-tary to Mos coding regions interrupts meiotic maturation.Chromosome preparations from antisense oligonucleotide -

injected oocytes cultured for 12-15 hr revealed bivalent-stage chromosomes corresponding to metaphase I chromo-somes, while sense-injected or uninjected oocytes presentedmetaphase II chromosomes after the same culture period(data not shown). Cytoplasmic organelles and cytoskeletalcomponents cluster in the perinuclear area at metaphase I inmouse oocytes. Such clustering occurs in the normal prog-ress of maturation, just before GVBD, with dispersal occur-ring shortly thereafter (45). In this regard, dispersal ofcytoplasmic components occurred normally in both controland sense-oligonucleotide-injected oocytes. In sharp con-trast, cytoplasmic organelles remained clustered in the peri-central region and did not disperse normally in antisense-oligonucleotide-injected oocytes (Fig. 4). Moreover, exami-nation of electron micrographs showed that oocytecytoplasmic organelles such as mitochondria were morpho-logically normal (data not shown).We conclude from these analyses that the murine p39mO',

like the c-mos-encoded product in amphibians (8), is re-quired for completion of meiotic maturation. In contrast,

g ~~~~20pmm>FIG. 4. Mouse oocytes injected with Mos oligonucleotides. Cu-

mulus cell-enclosed oocytes blocked at the GV stage in IBMX-containing medium and microinjected with a mixture of sense orantisense oligonucleotides were allowed to mature overnight.Nomarski optics of sense-injected oocytes (A) show PB (pb) emis-

sion and organelles distributed throughout the cytoplasm. Antisense-injected oocytes (B) show organelles clustered (cl) in the pericentralregion.

however, the block in mouse oocyte maturation by Mosantisense oligonucleotides occurs after GVBD.

DISCUSSIONThe results reported here show that the Mos -encoded proteinproduct, p39mOS, is synthesized in fully grown GV-stage andmaturing mouse oocytes as well as in ovulated ova and, underthese experimental conditions, is not detected in growingmouse oocytes and pronuclear stage embryos. Furthermore,the p39mos expressed in normal mouse oocytes is indistin-guishable from the constitutively expressed Mos productdetected in transformed NIH 3T3 cells. We also presentevidence that microinjection of three different Mos antisenseoligonucleotides in fully grown mouse oocytes blocks thecompletion of the first meiotic division at or about metaphaseI, thereby inhibiting the production of the first PB.The p39mOS we detect in mouse oocytes is virtually identical

in size to the Mos protein responsible for transforming NIH3T3 cells but is smaller than a candidate Mos protooncogeneproduct detected in homogenates of mouse testes (59). Tes-ticular Mos RNA transcripts contain additional in-framecodons upstream from the first conserved ATG (11, 46). Invitro translation of a Mos RNA that is structurally similar totesticular transcripts produces a minor product of =43 kDa inaddition to p39mOS (R.S.P., unpublished data). Although thereare other possible explanations, use of an alternative trans-lation initiation codon as described for Myc (47) couldaccount for the larger product reported in testes (59).

Following the microinjection ofany of three Mos antisenseoligonucleotides, oocytes underwent GVBD but wereblocked at or about the first metaphase, displaying a mor-phology similar to that of oocytes blocked with proteinsynthesis inhibitors (32). In Xenopus, c-mos antisense oli-gonucleotides block progesterone-induced GVBD (8). Whilewe cannot exclude differences between regulatory mecha-nisms of oocyte maturation between amphibians and mam-mals, we note that p39mos is present in fully grown, IBMX-arrested GV-stage mouse oocytes (Fig. 2A, lanes 1 and 3).This level may be sufficient for maturation to proceedthrough GVBD.Oocytes from various species are proving to be a useful

experimental model for the study of M phase-related phe-nomena and regulation of cell division because of (i) thedistinct separation between cell growth and meiotic divisionand (it) the development of oocyte culture and micromanip-ulation systems that now allow the dissection of variousaspects of meiosis. In frog oocytes, shortly before GVBD,there appears a cytoplasmic activity called maturation-promoting factor (MPF) (48, 49) that, when transferred toimmature oocytes, induces maturation. This autostimulatoryactivity has been found in maturing oocytes from otherspecies and in somatic cells entering mitosis (50, 51), sug-gesting that MPF is a universal regulator of the G2/Mtransition. A number of interacting gene products have beenidentified in dividing yeast cells that are involved in thecontrol of G2/M transition (52). One such gene product, theprotein kinase encoded by the cdc2+ gene, p34cdc2, is in-volved in the regulation of entry into M phase (53) and hasbeen demonstrated recently to be homologous to the 32-kDaprotein of Xenopus MPF (54, 55). The protein(s) directlyresponsible for MPF activation has yet to be identified, butstudies in Xenopus suggest that p39mOS may play a direct orindirect role in its activation (8, 24). Our results in mouseoocytes are consistent with the mos product having a role inthe regulation of MPF.Hashimoto and Kishimoto (56) suggested that, in the

mouse oocyte, MPF should be considered globally as ametaphase-promoting factor. It is clear that mitosis andmeiosis share common regulatory pathways, and as men-

5398 Cell Biology: Paules et al.

Dow

nloa

ded

by g

uest

on

Apr

il 13

, 202

1

Cell Biology: Paules et al.

tioned above, activated MPF has been found in somatic cellsin M phase (51, 57). We note that Mos protooncogene RNAexpression has been detected in certain adult tissues at very

low levels (10, 11). We present evidence in these studies thatthe constitutive expression of the normal oocyte Mos-encoded protein product in somatic cells induces expressionof the transformed phenotype. Moreover, the expression ofthe v-mos product at high levels during acute Mo-MSVinfection is toxic (16) and causes chromosomal alterations (P.Fischinger, personal communication). Thus, the untimelyinteraction of p39mos with its intercellular target and possiblythe activation of somatic MPF at an inappropriate time in thecell cycle could be responsible for the phenotype of Mos-transformed cells (8) when expressed at low levels and forv-mos-induced toxicity when expressed at high levels.From our studies, we suggest that the synthesis of the Mos

protooncogene product p39mOS is developmentally regulatedin oogenesis and that it is involved in the regulation ofmeiosis. In addition, we propose that the oocyte provides an

excellent system for the study of the normal role of protoon-cogenes in cell division and a tool for the understanding of thephysiological basis of the events that lead to cellular trans-formation and tumorigenesis.

The authors thank F. Propst, N. Sagata, M. Oskarsson, M.Gonzatti, and A. Schroederfor sharing valuable expertise and helpfuldiscussions; S. Showalter and M. Zweig for providing antisera; M.Powers for providing synthetic oligonucleotides; and P. Hoppe forthe use of his microinjection apparatus and part of his laboratoryspace for the oligonucleotide microinjections and for teaching R.B.microinjection techniques with infinite patience and dedicated ex-

pertise. This research was sponsored by the National Cancer Insti-tute under contract NO1-CO-74101 with BRI and Grant HD20575from the National Institute of Child Health and Human Develop-ment.

1. Oskarsson, M., McClements, W. L., Blair, D. G., Maizel,J. V. & Vande Woude, G. F. (1980) Science 207, 1222-1224.

2. Jones, M., Bosselman, R. A., van der Hoorn, F., Berns, A.,Fan, H. & Verma, I. M. (1980) Proc. Natl. Acad. Sci. USA 77,2651-2655.

3. Blair, D. G., McClements, W. L, Oskarsson, M. K., Fisch-inger, P. J. & Vande Woude, G. F. (1980) Proc. Natl. Acad.Sci. USA 77, 3504-3508.

4. Van Beveren, C., van Straaten, F., Galleshaw, J. A. & Verma,I. M. (1981) Cell 27, 97-108.

5. Watson, R., Oskarsson, M. & Vande Woude, G. F. (1982)Proc. Natl. Acad. Sci. USA 79, 4078-4082.

6. Paules, R. S., Propst, F., Dunn, K. J., Blair, D. G., Kaul, K.,Palmer, A. E. & Vande Woude, G. F. (1988) Oncogene 3,59-68.

7. Schmidt, M., Oskarsson, M. K., Dunn, K. J., Blair, D. G.,Hughes, S., Propst, F. & Vande Woude, G. F. (1988) Mol. Cell.Biol. 8, 923-929.

8. Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J. &Vande Woude, G. F. (1988) Nature (London) 335, 519-525.

9. Hanks, S. K., Quinn, A. M. & Hunter, T. (1988) Science 241,42-52.

10. Propst, F. & Vande Woude, G. F. (1985) Nature (London) 315,516-518.

11. Propst, F., Rosenberg, M. P., Iyer, A., Kaul, K. & VandeWoude, G. F. (1987) Mol. Cell. Biol. 7, 1629-1637.

12. Goldman, D. S., Kiessling, A. A., Millette, C. F. & Cooper,G. M. (1987) Proc. Natl. Acad. Sci. USA 84, 4509-4513.

13. Mutter, G. L. & Wolgemuth, D. J. (1987) Proc. Natl. Acad.Sci. USA 84, 5301-5305.

14. Keshet, E., Rosenberg, M. P., Mercer, J. A., Propst, F.,

Vande Woude, G. F., Jenkins, N. A. & Copeland, N. G. (1988)Oncogene 2, 235-240.

Proc. Nati. Acad. Sci. USA 86 (1989) 5399

15. Papkoff, J., Lai, M. H. -T., Hunter, T. & Verma, I. M. (1981)Cell 27, 109-119.

16. Papkoff, J., Verma, I. M. & Hunter, T. (1982) Cell 29, 417-426.17. Maxwell, S. A. & Arlinghaus, R. B. (1985) J. Gen. Virol. 66,

2135-2146.18. Maxwell, S. A. & Arlinghaus, R. B. (1985) Virology 143, 321-

333.19. Seth, A. & Vande Woude, G. F. (1985) J. Virol. 56, 144-152.20. Singh, B., Wittenberg, C., Reed, S. I. & Arlinghaus, R. B.

(1986) Virology 152, 502-506.21. Papkoff, J., Nigg, E. A. & Hunter, T. (1983) Cell 33, 161-172.22. Seth, A., Priel, E. & Vande Woude, G. F. (1987) Proc. Natl.

Acad. Sci. USA 84, 3560-3564.23. Blair, D. G., Oskarsson, M., Wood, T. G., McClements,

W. L., Fischinger, P. J. & Vande Woude, G. F. (1981) Science212, 941-943.

24. Sagata, N., Daar, I., Oskarsson, M., Showalter, S. & VandeWoude, G. F. (1989) Science, in press.

25. Downs, S. M., Daniel, S. A. J. & Eppig, J. J. (1988) J. Exp.Zool. 245, 86-96.

26. Dekel, N. & Beers, W. H. (1978) Proc. Natl. Acad. Sci. USA75, 4369-4373.

27. Dekel, N. & Beers, W. H. (1980) Dev. Biol. 75, 356-362.28. Pincus, G. & Enzmann, E. V. (1935) J. Exp. Med. 62, 655-675.29. Cho, W. K., Stem, S. & Biggers, J. K. (1974) J. Exp. Zool. 187,

383-386.30. Magnusson, C. & Hillensjo, T. (1977) J. Exp. Zool. 201,

139-147.31. Downs, S. M., Coleman, D. L., Ward-Bailey, P. F. & Eppig,

J. J. (1985) Proc. Natl. Acad. Sci. USA 82, 454-458.32. Wassarman, P. M., Josefowicz, W. J. & Letorneau, G. E.

(1976) J. Cell Sci. 22, 531-545.33. Eppig, J. J. & Downs, S. M. (1987) Dev. Biol. 119, 313-321.34. Schroeder, A. C. & Eppig, J. J. (1984) Dev. Biol. 102, 493-497.35. Laemmli, U. K. (1970) Nature (London) 227, 680-685.36. Stec, W. J., Zon, G., Egan, W. & Stec, B. (1984) J. Am. Chem.

Soc. 106, 6077-6079.37. Froehler, B. C., Ng, P. G. & Matteucci, M. D. (1986) Nucleic

Acids Res. 14, 5399-5407.38. Marcus-Sekura, C. J., Woemer, A. M., Shinozuka, K., Zon,

G. & Quinnan, G. V. (1987) Nucleic Acids Res. 15, 5749-5763.39. Kawasaki, E. (1985) Nucleic Acids Res. 13, 4991-5004.40. Dash, P., Lotan, I., Knapp, M., Kandel, E. R. & Goelet, P.

(1987) Proc. Natl. Acad. Sci. USA 84, 7896-7900.41. Jessus, C., Cazenave, C., Ozon, R. & Helene, C. (1988)

Nucleic Acids Res. 16, 2225-2233.42. Shuttleworth, J. & Colman, A. (1988) EMBO J. 7, 427-434.43. Strickland, S., Huarte, J., Belin, D., Vassalli, A., Rickles, R. J.

& Vassalli, J.-D. (1988) Science 241, 680-684.44. Eckstein, F. (1985) Annu. Rev. Biochem. 54, 367-402.45. Calarco, P. G., Donahue, R. P. & Szollosi, D. (1972) J. Cell

Sci. 10, 369-385.46. Wood, T. G., McGeady, M. L., Baroudy, B. M., Blair, D. G.

& Vande Woude, G. F. (1984) Proc. Natl. Acad. Sci. USA 81,7817-7821.

47; Hann, S. R., King, M. W., Bentley, D. L., Anderson, C. W. &Eisenman, R. N. (1988) Cell 52, 185-195.

48. Masui, Y. & Markert, C. L. (1971) J. Exp. Zool. 177, 129-146.49. Smith, L. D. & Ecker, R. E. (1971) Dev. Biol. 25, 232-247.50. Kishimoto, T., Kuriyama, R., Kondo, H. & Kanatani, H.

(1982) Exp. Cell Res. 137, 121-126.51. Sunkara, P. S., Wright, D. A. & Rao, P. N. (1979) Proc. Natl.

Acad. Sci. USA 76, 2799-2802.52. Lee, M. G. & Nurse, P. (1988) Trends Genet. 4, 287-290.53. Russell, P. & Nurse, P. (1987) Cell 49, 559-562.54. Dunphy, W. G., Brizuela, L., Beach, D. & Newport, J. (1988)

Cell 54, 423-431.55. Gautier, J., Norbury, C., Lohka, M., Nurse, P. & Mailer, J.

(1988) Cell 54, 433-439.56. Hashimoto, N. & Kishimoto, T. (1988) Dev. Biol. 126, 242-252.57. Wasserman, W. J. & Smith, L. D. (1978) J. Cell Biol. 78, 15-22.58. Whitten, W. K. (1971) Adv. Biosci. 6, 129-139.59. Herzog, N. K., Singh, B., Elder, J., Lipkin, I., Trauger, R. J.,

Millet, C. F., Goldman, D. S., Wolfes, H., Cooper, G. M. &Arlinghaus, R. B. (1988) Oncogene 3, 225-229.

Dow

nloa

ded

by g

uest

on

Apr

il 13

, 202

1