EFFECTIVE CONCENTRATION AND DETECTION OF HUMAN ENTERIC

VIRUSES IN HAWAIIAN ENVIRONMENTAL WATERS

A THESIS SUBMITTED TO THE GRADUATE DIVISION OF THE UNIVERSITY OF HAWAIʻI AT MĀNOA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

IN

MICROBIOLOGY

MAY 2012

By

Christina Connell

Thesis Committee:

Yuanan Lu, Chairperson Roger Fujioka Hongwei Li

08  Fall  

i  

ACKNOWLEDGEMENT

The completion of this thesis would not have been

possible without the support of several people, to whom the

author is immeasurably indebted.

First, the author would like to thank her superb

advisor, Dr. Yuanan Lu, for his genuine guidance, support,

encouragement, and understanding throughout the duration of

this study. His invaluable attention and direction, as well

as his immense knowledge, are extremely admirable and will

forever be appreciated.

The author also wishes to thank her dedicated lab

members for their gracious assistance and camaraderie. Dr.

Roger Fujioka and Dr. Hongwei Li are gratefully

acknowledged for provision of their time and support

through serving as thesis committee members. And finally,

profound gratitude is expressed toward the author’s

incredibly inspiring family and friends.

ii  

ABSTRACT

Health risks associated with sewage-contaminated

recreational waters are of important public health concern.

Reliable water monitoring systems are therefore crucial.

Current recreational water quality criteria rely

predominantly on the enumeration of bacterial indicators,

while potentially dangerous viral pathogens often remain

undetected. Human enteric viruses have been proposed as

alternative indicators; however, their detection is often

hindered by low viral concentrations present in the aquatic

environment.

Reported here are novel and effective laboratory

protocols for enhanced enteric virus detection in Hawaiian

environmental waters. First, a fine-tuned, highly optimized

assay for the detection of enterovirus, an important

enteric virus subset, was developed by comparatively

evaluating eighteen published enterovirus primer pairs for

detection sensitivity. The primer set exhibiting the lowest

detection limit under optimized conditions, EQ-1/EQ-2, was

validated through testing urban wastewater, and then

utilized in a field survey of 22 recreational bodies of

water located around the island of Oahu, Hawaii. Eleven

sites tested positive for enterovirus, indicating fecal

contamination in a significant portion of Hawaiian waters.

iii  

Additionally, the filter-feeding phenomenon of

indigenous bivalve mollusks was explored as a natural

bioconcentration technique to infer microbial quality of

the surrounding waters. Shellfish were collected from 12

coastal locations and dissected for subsequent nucleic acid

extraction from internal tissues. Optimized RT-PCR/PCR

protocols were then applied to test for the presence of

various enteric viruses, including enterovirus, adenovirus,

norovirus genogroups I and II, and F-specific RNA

coliphage. Shellfish collected from around the island

tested positive for several enteric virus types, indicating

that these animals are indeed natural and competent

bioindicators of water quality. The extremely sensitive and

innovative techniques implemented here are valuable

resources to aid accurate reflection of microbial

contamination in Hawaii’s environmental waters.

iv  

TABLE OF CONTENTS

ACKNOWLEDGEMENT ........................................... i  ABSTRACT ................................................. ii  LIST OF TABLES ............................................ v  LIST OF FIGURES .......................................... vi  CHAPTER 1: INTRODUCTION AND OVERALL PROPOSED STUDY ........ 1  BACKGROUND INFORMATION ................................... 1 STUDY DESIGN ............................................ 17 SPECIFIC AIMS ........................................... 19 SIGNIFICANCE ............................................ 20 REFERENCES .............................................. 21

 CHAPTER 2: ENTEROVIRUS METHOD OPTIMIZATION AND SEWAGE .... 27 VALIDATION  INTRODUCTION ............................................ 27 MATERIALS AND METHODS ................................... 29 RESULTS ................................................. 37 DISCUSSION .............................................. 42 REFERENCES .............................................. 44

 CHAPTER 3: HUMAN ENTEROVIRUS OCCURRENCE IN HAWAIIAN ...... 47 ENVIRONMENTAL WATERS  INTRODUCTION ............................................ 47 MATERIALS AND METHODS ................................... 48 RESULTS ................................................. 54 DISCUSSION .............................................. 58 REFERENCES .............................................. 61

 CHAPTER 4: SHELLFISH-MEDIATED BIOACCUMULATION OF HUMAN ... 63 ENTERIC VIRUSES IN OAHU’S MARINE ENVIRONMENT  INTRODUCTION ............................................ 63 MATERIALS AND METHODS ................................... 68 RESULTS ................................................. 77 DISCUSSION .............................................. 86 REFERENCES ............................................. 100

 CHAPTER 5: CONCLUSIONS .................................. 105    

v  

LIST OF TABLES

1. Enterovirus primer sets employed in comparative ....... 32 analysis

  2. PCR condition brackets included in optimization ....... 34 assay   3. Optimized amplification conditions and detection ...... 39 limits of EnV primer sets employed in comparative

analysis   4. Enterovirus detection in Hawaiian environmental ....... 55 waters   5. Optimized PCR reaction components for enteric virus ... 72

detection   6. Optimized PCR cycle conditions for enteric virus ...... 73

detection   7. Primer sets employed in bioaccumulation study ......... 74   8. Enteric virus detection in shellfish .................. 79    9. Enteric virus detection in corresponding water ........ 80 samples   10. Enterovirus detection correlation between ............ 81 shellfish and water samples   11. Enteric virus strains detected in Hawaiian ........... 84 marine environment  

vi  

LIST OF FIGURES

1. Agarose gel depicting enterovirus detection from ...... 41 urban sewage   2. Geographic locations of environmental water ........... 49 sampling sites on Oahu, HI   3. Nucleotide sequence analysis of EnV isolated from ..... 57

wastewater (multiple clones) and environmental water samples

  4. Geographic locations of twelve sample collection ...... 69 sites included in shellfish-mediated bioaccumulation

study   5. Agarose gel depicting adenovirus detection from ....... 82

shellfish collected at Kualoa Park   6. Agarose gel depicting enterovirus detection from ...... 82 samples collected at Ko Olina Lagoon 3   7. Agarose gel depicting norovirus genogroup I ........... 83 detection from samples collected at Ko Olina Lagoon 3   8. Agarose gel depicting enterovirus detection from ...... 83 samples collected at Kahala Beach

  1  

CHAPTER 1

INTRODUCTION AND OVERALL PROPOSED STUDY

 

BACKGROUND INFORMATION

Sewage-associated recreational waterborne disease

Worldwide, various recreational activities involving

water exposure are quite popular. However, the usage of

recreational waters places the public at risk of

contracting various illnesses associated with waterborne

pathogens. Results of several epidemiological studies have

shown significantly increased illness incidents, including

gastrointestinal, respiratory, ear, ocular, and skin

infections, among those involved in water-based

recreational activities (Sinclair 2009). Since reporting

began in 1978, levels of recreational waterborne disease

are at their highest (Reynolds 2009).

Of paramount public health concern are waters

contaminated by human sewage (Bonkosky 2009). The world’s

oceans receive billions of liters of virus-laden treated

and untreated wastewater on any given day (Rao 1986), and

the negative impacts of fecal-oral waterborne disease

affect more people across the globe than other types of

infectious waterborne disease (Jofre and Blanch 2010). As

demonstrated in 2010 at Rancho Santa Margarita, California,

  2  

a single ruptured sewer line can rapidly release hundreds

of thousands of gallons of untreated sewage into coastal

waters, resulting in fecal pollution along miles of beaches

(Devine 2011).

Current recreational water quality monitoring standards

In order to secure public protection from diseases

associated with fecally-contaminated recreational waters,

effective systems for monitoring water quality are of

crucial importance (U.S. EPA 2011). Because it is not

practically feasible to screen for every possible pathogen

of concern, indicators of human fecal pollution are often

used to assess microbial water quality (Jofre and Blanch

2010). The criteria for an ideal indicator organism are as

follows (Bitton 2005):

  3  

1. The indicator should be part of the human intestinal

microflora.

2. Its presence should correlate with the presence of

fecally-borne pathogens.

3. It must be present in greater numbers than pathogens

of concern.

4. It should be at least equally resistant as pathogens

of concern to environmental factors and wastewater

treatment plant disinfection practices.

5. It should not multiply in the environment.

6. It should be easily, rapidly, and inexpensively

detectable.

7. It should be non-pathogenic.

  4  

Currently, widely accepted microorganisms for water

quality assessment are bacterial indicators, including E.

coli and enterococci (Turbow 2003, Choi 2005).

Epidemiological data has linked increased risk of

contracting gastrointestinal illness with exposure to

waters with elevated concentrations of these fecal

indicator bacteria, and established detection assays are

inexpensive, standardized, and widely available (Lees 2000,

Boehm 2003). Bacterial indicators have been used to infer

microbial water quality for decades (Noble 2001); however,

several drawbacks are associated with this indicator

system, and many bacterial indicators fail to fit all of

the criteria listed above for ideal indicator organisms.

For instance, the presence of fecal indicator bacteria is

not limited to human feces; they may be present in the

excrement of a wide variety of other warm-blooded animals

such sea gulls and pigeons, both of which congregate near

shorelines (Boehm 2003). Also, these indicator bacteria may

multiply in the environment after excretion from their

host, yielding inaccurate estimations of true fecal

pollution levels (Fong and Lipp 2005). Epidemiological

studies yield inconsistent results as to which indicators

are most correlated with illness incidents (Snyder 2009),

  5  

and waterborne outbreaks have occurred in waters free of

standard indicator organisms (Papapetropoulou 1998).

Tropical beaches in the United States receive more

visitors than all temperate beaches combined (Leeworthy

2001). The state of Hawaii has over 400 public beaches,

stretching along roughly 300 miles of Pacific Ocean

Coastline (Dorfman 2011). Therefore, in tropical regions

such as Hawaii, Guam, Puerto Rico, and south Florida,

reliable water quality monitoring methods are of utmost

importance. However, current monitoring techniques

utilizing bacterial indicators are especially questionable

in such regions. Recreational water quality standards

utilizing bacterial indicators have been developed using

data from temperate regions and are then applied worldwide.

However, these standards are not applicable in the tropics,

as bacterial indicators are known to proliferate naturally

in these environments, especially in soil (Fujioka,

University of Hawaii). As soil is frequently introduced

into environmental waters, these organisms then become

members of the normal aquatic microbial community, which in

turn may lead to inaccurate assessments of water pollution

levels (Bernhard 2000, Byamukama 2005, Boehm 2003). In

addition to soil, enterococcus is reported to reproduce in

biofilms found in drainage pipes, concrete channels, river

  6  

rocks, and beach sand; enterococci levels are also often

increased during rainstorms or high surf events

(nonindicative of fecal contamination). For these reasons,

Hawaii utilizes a secondary bacterial indicator,

Clostridium perfringens, to help trace human fecal

pollution. However, a robust, consistent monitoring method

has not yet been developed (HI DOH 2008).

Another major inadequacy of current water quality

management procedures is that bacterial indicators fail to

reliably reflect the presence of pathogenic viruses

(Gabrieli 2007, Sinclair 2009, Terio 2010). Over 100 types

of viral pathogens may be present in sewage-impacted water

(Lipp 2001). Viruses survive longer than indicator bacteria

in both fresh and marine water environments and are

generally more resistant than bacterial indicators during

conventional wastewater treatment processes (Fong and Lipp

2005). This is of significant concern, as viral outbreaks

have been linked to waters that meet state or local

bacterial water quality criteria (Sinclair 2009). Of all

gastrointestinal illnesses contracted in sewage-impacted

recreational waters, viruses are thought to be the primary

etiologic agents (US EPA 2011). Several viruses have been

associated with such outbreaks, including coxsackieviruses,

adenoviruses, echoviruses, hepatitis A virus, astroviruses,

  7  

and noroviruses (Sinclair 2009). Although most viral

illnesses contracted are mild, serious disease can occur,

including aseptic meningitis, encephalitis, poliomyelitis,

hepatitis, myocarditis and diabetes (Pond 2005). In 1995,

an adenovirus outbreak was associated with a contaminated

swimming pool in Greece that tested negative for three

different bacterial indicators – total coliform, fecal

coliform, and fecal streptococci (Papapetropoulou 1998).

Similarly, in 2001, a community-wide enterovirus outbreak

in Germany was tied to bathing in a particular pond that,

despite weekly testing, never contained higher-than-normal

levels of total coliforms, fecal coliforms, enterococci, or

Staphylococcus aureus (Hauri 2005). In 1987, 18 of 41 water

samples collected from Oak Creek, Arizona tested positive

for enterovirus or rotavirus, while the level of fecal

indicators remained within the regulatory range (Rose

1987). A study of the coastal waters in Santa Monica Bay,

California, found no significant relationship between the

presence of enteroviruses and any single routinely

monitored bacterial indicator (Noble 2001). Clearly,

bacterial indicators cannot be solely relied upon to

accurately assess microbial water quality. Alternative

monitoring systems are crucial in order to improve the

surveillance of recreational waters and secure protection

  8  

to the public from waterborne disease (Lees 2000, Gersberg

2006).

Human enteric viruses as alternative indicators

Human enteric viruses, represented by the

astroviruses, rotaviruses, noroviruses, adenoviruses, and

picornaviruses, are commonly harbored in environmental

waters and are suggested as possible alternative indicators

of microbial water quality (US EPA 2011, Lipp 2001, Griffin

2003). According to the US EPA, human enteric viruses cause

a large proportion of illnesses from human-impacted

recreational waters. The presence of human enteric viruses

in recreational waters has been linked with increased

disease risk around the world, including studies in

Australia, United Kingdom, Ireland, Canada, Israel, New

Orleans, and Hong Kong (Sinclair 2009, Terio 2010). Enteric

virus-associated waterborne outbreaks have been associated

with contaminated swimming pools, lakes, ponds, rivers,

reservoirs, oceans, fountains, hot springs, and drinking

water (Fong 2005). Enteric viruses are primarily

transmitted via the fecal-oral route, and viral particles

are shed in extremely high numbers from infected

individuals, typically between 105 and 1011 virions per gram

of stool (Fong 2005). Although most enteric virus

  9  

infections are primarily associated with diarrhea and self-

limiting gastroenteritis, they may also cause hepatitis,

conjunctivitis, and respiratory infections. Additionally,

enteric virus infections may cause aseptic meningitis,

encephalitis, and paralysis in immunocompromised

individuals, resulting in high mortality rates (Fong 2005).

Another concerning characteristic of human enteric viruses

is their low infectious dose; for instance, exposure to a

single rotavirus places an individual at a 31% risk of

infection, and 1 viral plaque forming unit (PFU) is enough

to establish infection in 1% of healthy adults (Fong and

Lipp 2005).

Common wastewater treatment processes fail to

completely inactivate enteric viruses (Fujioka 1980),

rendering recreational waters in areas such as Hawaii,

where primary-treated sewage is discharged into the sea on

a normal basis, vulnerable to viral contamination. Because

of their small size, enteric viruses are easily transported

from original sources of pollution via tidal currents,

water circulation, and prevailing winds (Rao 1986).

Additionally, their resistant protein coat enables

prolonged persistence in the environment under a wide range

of water temperatures, salinities, and pH values (Lipp

2001, Rajtar 2008). The tendency of many viruses to

  10  

associate with various solids in the aquatic environment,

such as sand, clays (montmorillonite, kaolinite, bentonite,

illite), live organisms (algae, bacteria), silts,

sediments, and other protective particles is another

survival-prolonging factor (Lipp 2001, Rao 1986). These

suspended solids and sediments offer safe havens from

enzymes, UV irradiation, and other degrading factors (Fong

and Lipp 2005). Following release into the environment,

enteric viruses can survive within the water column or

associated with particulate matter for weeks to months

(Lees 2000); some viruses have even been reported to

survive and remain infectious for up to 130 days in

seawater, up to 120 days in freshwater and sewage, and up

to 100 days in soil at 20 to 30°C (Fong and Lipp 2005). In

similar environments, fecal indicator bacteria do not

survive nearly as long. Additionally, unlike bacterial

indicators, enteric viruses are obligate intracellular

parasites and are therefore unable to replicate in the

aquatic environment outside of their respective human hosts

(Lees 2000). Due to large viral loads released into sewage-

impacted waters, increased environmental persistence

compared to indicator bacteria, and the significant role

viruses play in waterborne disease, enteric viruses show

promising potential to be used as alternative indicators

  11  

for a more accurate depiction of recreational water quality

(Fong and Lipp 2005).

Enteric viruses included in study

Adenovirus

Adenoviruses (AdV) belong to the Adenoviridae family,

genus Mastadenovirus, containing all human serotypes.

Adenoviral particles are icosahedrons, 80-90 nm in size,

and contain double-stranded DNA. Adenovirus is responsible

for causing a wide range of human illnesses, including

respiratory infections, ocular infections, enteric

infections, encephalitis, pneumonia, and genitourinary

infections. Infections are generally mild; however, a

number of fatal cases have been reported (Pond 2005).

Specific gastroenteritis-causing adenoviruses transmitted

via the fecal-oral route include adenoviruses 40 and 41

(Sinclair 2009); these two serotypes are estimated to cause

5-20% of acute gastroenteritis cases among infants and

young children (Kokkinos 2011).

Highly resistant to physical/chemical agents and

adverse pH conditions, AdV can persist in the aquatic

environment for prolonged periods. AdV are reported to be

60 times more resistant than RNA viruses to UV irradiation

  12  

(Thurston-Enriquez 2003, Fong and Lipp 2005), which is a

commonly used disinfection procedure at sewage treatment

plants, including the Sand Island Wastewater Treatment

Plant here in Hawaii. In raw sewage from around the world,

AdV are consistently more prevalent than enteroviruses

(Jiang 2001). Adenoviruses are frequently present in

polluted environmental waters and are easily detectable by

PCR; they have therefore been suggested as alternative

indicators of human fecal pollution (Lees 2000, Choi 2005).

Enterovirus

Enteroviruses (EnV) are single-stranded, positive-

sense RNA viruses belonging to the Picornaviridae family.

Enteroviral particles are icosahedral, nonenveloped, and

~30 nm in diameter. EnV, including coxsackievirus,

poliovirus, echovirus, and the numbered enteroviruses, are

the most commonly detected enteric viruses in polluted

waters and are estimated to cause 30 - 50 million

infections in the US annually (Donaldson 2002, Gregory

2006). Enteroviral epidemics are predominantly waterborne

(Rajtar 2008). The EnV disease spectrum is wide, including

gastroenteritis, respiratory infection, diabetes, heart

disease, bronchiolitis, conjunctivitis, meningitis,

paralysis, and the common cold (Fong 2005). EnV can remain

  13  

viable at extremely low temperatures (between minus 20°C and

70°C) for years, and for weeks at 4°C (Rajtar 2008). Because

these viruses are common, fecally shed in extremely high

numbers from infected individuals, highly tolerant to

salinity and temperature fluctuations, and stable in the

environment for extended time periods, they have been

suggested as a parameter for evaluating viral pollution of

environmental waters (Hot 2003, Gregory 2006). The

availability of permissive cell lines for determining EnV

infectivity greatly enhances the attractiveness of using

this important enteric virus subset as an alternative

indicator of water quality (Fong 2005).

Norovirus

Noroviruses (NoV), members of the Caliciviridae family

and Norovirus genus, are 27-32 nm in diameter, single-

stranded, non-enveloped RNA viruses. They are the most

common cause of acute, nonbacterial gastroenteritis,

causing ~23 million cases of acute onset vomiting and

diarrhea in the United States per year (Jothikumar 2005,

Mead 1999). Infections also sometimes include fever,

headache, and malaise. Two human genogroups are of interest

here, norovirus genogroups I (NoVI) and II (NoVII), based

on genetic divergence in the polymerase and capsid regions

  14  

(Boxman 2006). NoVII is primarily transmitted via person-

to-person (Siebenga 2007), while NoVI is more often

transmitted via food or environmental contamination

(Maalouf 2010). Waterborne outbreaks of norovirus-

associated gastroenteritis are well documented (Kokkinos

2011). Norovirus is the specific enteric virus suggested by

the EPA to be used as an alternative water quality

indicator (US EPA 2011). An efficient cell culture system

for isolating and propagating norovirus has not been

established (Sinclair 2009).

F-specific RNA coliphage

Although not classified as human enteric viruses,

male-specific FRNA coliphages have been considered suitable

indicators of fecal pollution in the environment (Umesha

2008). These viruses are quite prevalent in wastewater and

exhibit relatively high resistance to disinfection

procedures (Bitton 2005). Using only bacteria as hosts for

replication, these FRNA bacteriophages infect E. coli

carrying the F plasmid, which codes for the F or sex pilus,

to which the phages attach (Bitton 2005, Griffin 2003).

This group of viruses resembles human enteric viruses in

size, shape, and general composition (Sobsey 2006). F-

specific RNA coliphages are easily enumerated and have

  15  

shown slow elimination kinetics, also representative of

human enteric viruses (Hernroth 2002). FRNA coliphages may

be useful for fecal source tracking, as they distinguish

human fecal waste from non-human fecal waste (Sobsey 2006).

1.5 Virological analysis of environmental waters

The basic steps of virological analysis of

environmental waters include sampling, virus concentration,

and detection (either through cell culture or molecular

biology assays) (Fong and Lipp 2005). Although human

enteric viruses are suggested as alternative indicators of

microbial water quality, the low concentration of these

viruses present in environmental waters presents a major

problem (Fout 2003, Griffin 2003, Fong 2005). Therefore,

extremely sensitive detection methods are absolutely

essential if enteric viruses are to be effectively utilized

as alternative indicators of fecal contamination (Ijzerman

1997). Early studies utilized cell culture techniques for

the detection and isolation of enteric viruses; however,

these assays are laborious, expensive, and time-consuming.

Additionally, traditional cell lines are not established

for all enteric virus subsets of interest (Fong and Lipp

2005). RT-PCR-based assays, due to their rapidity,

sensitivity, specificity, and relative ease-of-use, are

  16  

often favored by environmental virologists (Schwab 1996).

These molecular assays have greatly enhanced environmental

enteric virus detection, especially for those viruses for

which no cell culture system is available (Rodriguez 2009).

However, the presence of inhibitory compounds, which can

lead to false-negative viral detection, presents an

additional detection barrier (Fout 2003). Detection

challenges may be overcome by improved methods for viral

concentration, efficient inhibitor removal during nucleic

acid extraction, and extremely sensitive molecular

detection assays (Karamoko 2005).

 

  17  

STUDY DESIGN

The goal of this study is the development and

exploration of novel, highly sensitive methods for

effective enteric virus detection in the Hawaiian aquatic

environment. These approaches are geared toward an ultimate

purpose, involving the utilization of human enteric viruses

as alternative microbial water quality indicators in order

to protect the public from waterborne disease.

First, a side-by-side comparison and optimization of

previously published EnV detection protocols was conducted,

yielding a fine-tuned, highly sensitive and optimized RT-

PCR procedure for the effective detection of EnV from

environmental water samples. As confirmation of the newly

developed protocol, it was applied to urban wastewater

samples at various treatment stages for method validation.

Next, in order to utilize the assay in a practical manner,

an EnV surveillance study of recreational waters around the

island of Oahu was conducted.

Finally, as a technique to enhance viral concentration

from coastal water samples, the bioaccumulation phenomenon

of bivalve shellfish was explored. Indigenous mollusks were

collected from multiple sites around the island of Oahu and

screened for the presence of various enteric viruses, using

individually optimized PCR protocols. Direct water samples

  18  

were simultaneously collected and processed in order to

compare enteric viral detection efficiency. Positive

enteric virus detection from sewage, environmental water,

and shellfish samples was confirmed through DNA sequencing.

 

  19  

SPECIFIC AIMS

Specific aims of this study are as follows:

1. Establishment of a highly sensitive RT-PCR protocol for

EnV detection, accomplished by screening and optimizing

conditions for previously published EnV primer sets;

2. Validation of the established protocol through testing

urban wastewater collected at various treatment stages;

3. Utilization of optimized protocol through environmental

surveillance study: screen 22 local recreational bodies

of water for the presence of EnV;

4. Shellfish-mediated bioaccumulation study to explore a

natural means of enhanced viral concentration. Apply

optimized detection protocols for EnV and other enteric

viruses to nucleic acids extracted from shellfish

collected at 12 Oahu beaches.  

 

  20  

SIGNIFICANCE

The innovative viral concentration and detection

techniques described here may enrich alternative water

quality monitoring methods not only in the state of Hawaii,

but worldwide. These findings contribute to a better

understanding of the prevalence of fecal contamination in

Hawaiian environmental waters. The development and

utilization of novel enteric virus detection assays may be

of great interest to those interested in recreational water

quality, including environmental virologists, public health

officials, researchers, regulators, and even the general

public.

  21  

REFERENCES

Bernhard AE, Field KG (2000) Identification of nonpoint sources of fecal pollution in coastal waters by using host-specific 16S ribosomal DNA genetic markers from fecal anaerobes. Appl Environ Microbiol 66:1587-1594 Bitton G (2005) Microbial indicators of fecal contamination: application to microbial source tracking. Report submitted from Department of Environmental Engineering Sciences, University of Florida to Florida Stormwater Association Boehm AB, Fuhrman JA, Mrse RD, Grant SB (2003) Tiered approach for identification of a human fecal pollution source at a recreational beach: Case study at Avalon Bay, Catalina Island, California. Environ Sci Technol 37: 673-680 Bonkosky M, Hernandez-Delgado EA, Sandoz B, Robledo IE, Norat-Ramirez J, Mattei H (2009) Detection of spatial fluctuations of non-point source fecal pollution in coral reef surrounding waters in southwestern Puerto Rico using PCR-based assays Boxman ILA, Tilburg JJHC, te Loeke NAJM, Vennema H, Jonker K, de Boer E, Koopmans M (2006) Detection of noroviruses in shellfish in the Netherlands. International J Food Microbiol 108: 391-396 Byamukama D, Kansiime F, Mach RL, Farnleitner AH (2000) Determination of Escherichia coli contamination with chromocult coliform agar showed a high level of discrimination efficiency for differing fecal pollution levels in tropical waters of Kampala, Uganda Choi S, Jiang SC (2005) Real-time PCR quantification of human adenoviruses in urban rivers indicates genome prevalence but low infectivity. Appl Environ Microbiol 71: 7426-7433 Devine J (2011) Sources of beachwater pollution. Natural Resources Defense Council Donaldson KA, Griffin DW, Paul JH (2002) Detection, quantitation, and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR. Water Res 36: 2505-2514

  22  

Dorfman M and Rosselot KS (2011) Testing the waters: A guide to water quality at vacation beaches. Twenty-first annual report. Natural Resources Defense Council Fong T, Lipp EK (2005) Enteric viruses of humans and animals in aquatic environments: health risks, detection, and potential water quality assessment tools. Microbiol Mol Bio Rev 69: 357-371 Fout GS, Martinson BC, Moyer MWN, Dahling DR (2003) A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl Environ Microbi 69: 3158-3164 Fujioka RS, Loh PC, Lau LS (1980) Survival of human enteroviruses in the Hawaiian ocean environment: Evidence for virus-inactivating microorganisms. Appl Environ Microbiol 39: 1105-1110 Fujioka R, Loh P, Katz A, Seifried S, Steward G, Tice A, Wilcox B. Microbial pathogens in tropical coastal waters: an ecosystem approach to determine risk and prevent waterborne diseases. Pacific Research Center for Marine Biomedicine, University of Hawaii Gabrieli R, Macaluso A, Lanni L, Saccares S, Di Giamberardino F, Cencioni B, Petrinca AR, Divizia M (2007) Enteric viruses in molluscan shellfish. New Microbiologica 30: 471-475 Gersberg RM, Rose MA, Robles-Sikisaka R, Dhar AK (2006) Quantitative detection of hepatitis A virus and enteroviruses near the United States-Mexico border and correlation with levels of fecal indicator bacteria. Appl Environ Microbiol 72: 7438-7444 Gregory JB, Litaker RW, Noble RT (2006) Rapid one-step quantitative reverse transcriptase PCR assay with competitive internal positive control for detection of enteroviruses in environmental samples. Appl Environ Microbiol 72: 3960-3967 Griffin DW, Donaldson KA, Paul JH, Rose JB (2003) Pathogenic human viruses in coastal waters. Clin Microbiol Rev 16: 129-143 Hauri AM, Schimmelpfennig M, Walter-Domes M, Letz A, Diedrich S, Lopez-Pila J, Schreier E (2005) An outbreak of

  23  

viral meningitis associated with a public swimming pond. Epidemiol Infect 133: 291–298

Hawaii State Department of Health (2008) 2006 State of Hawaii water quality monitoring and assessment report: integrated report to the U.S. Environmental Protection Agency and the U.S. Congress pursuant to sections 303(D) and 305(B) Clean Water Act (P.L. 97-117). Honolulu, HI.

Hernroth BE, Conden-Hansson ACC, Rehnstam-Holm AS, Girones R, Allard AK (2002) Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report. Appl Environ Microbiol 68: 4523-4533 Hot D, Legeay O, Jacques J, Gantzer C, Caudrelier, Y et al (2003) Detection of somatic phages, infectious enteroviruses and enterovirus genomes as indicators of human enteric viral pollution in surface water. Water Res 37: 4703-710 Ijzerman MM, Dahling DR, Fout GS (1997) A method to remove environmental inhibitors prior to the detection of waterborne enteric viruses by reverse transcription-polymerase chain reaction. J Virol Methods 63: 145-153 Jiang S, Noble R, Chu Weiping (2001) Human adenoviruses and coliphages in urban runoff-impacted coastal waters of Southern California. Appl Environ Microbiol 67: 179-184 Jofre J and Blanch AR (2010) Feasibility of methods based on nucleic acid amplification techniques to fulfill the requirements for microbiological analysis of water quality. J of Appl Microbiol 109: 1853-1867 Jothikumar N, Lowther JA, Henshilwood K, Lees DN, Hill VR, Vinje J (2005) Rapid and sensitive detection of noroviruses by using TaqMan-based one-step reverse transcription-PCR assays and application to naturally contaminated shellfish samples. Appl Environ Microbiol 71: 1870-1875 Karamoko Y, Ibenyassine K, Aitmhand R, Idaomar M, Ennaji MM (2005) Adenovirus detection in shellfish and urban sewage in Morocco (Casablanca region) by the polymerase chain reaction. J Virol Methods 126: 135-137 Kokkinos P, Ziros P, Meri D, Filippidou S, Kolla S, Galanis A, Vantarakis A (2011) Environmental surveillance. An additional/alternative approach for virological

  24  

surveillance in Greece? Int J Environ Rese Public Health 8: 1914-1922 Lees D (2000) Viruses and bivalve shellfish. International J Food Microbiol 59: 81-116 Leeworthy VR and Wiley PC (2001) Marine recreation participation and use, national survey on recreation and the environment. National Ocean Service, National Ocean and Atmospheric Administration: Silver Spring, MD Lipp EK, Lukasik J, Rose JB (2001) Human enteric viruses and parasites in the marine environment. Methods in Microbiology 30: 559-588 Maalouf H, Zakhour M, Le Pendu J, Le Saux JC, Atmar RL, Le Guyader FS (2010) Distribution in tissue and seasonal variation of norovirus genogroup I and II ligans in oysters. Appl Environ Microbiol 76:5621-5630 Mead PS, Slutsker L, Dietz V, McCaig LF, Bresee JS, Shapiro C, Griffin PM, Tauxe RV (1999) Food- related illness and death in the United States. Emerg Infect Dis 5: 607–625 Noble RT, Fuhrman JA (2001) Enteroviruses detected by reverse transcriptase polymerase chain reaction from the coastal waters of Santa Monica Bay, California: low correlation of bacterial indicator levels. Hydrobiologica 460: 175-184 Papapetropoulou M and Vantarakis AC (1998) Detection of adenovirus outbreak at a municipal swimming pool by nested PCR amplification. J Infect 36: 101–103 Pond, Kathy (2005) Water recreation and disease - Plausibility of associated infections: acute effects, sequelae and mortality. World Health Organization Rajtar B, Majek M, Polanski L, Polz-Dacewicz M (2008) Enteroviruses in water environment – a potential threat to public health. Ann Agric Environ Med 15: 199-203 Rao VC, Metcalf TG, Melnick JL (1986) Human viruses in sediments, sludges, and soils. Bulletin of the World Health Organization 64: 1-14 Reynolds KA (2009) Recreational waterborne disease at an all-time high. Water Conditioning and Purification April 2009: 56-58

  25  

Rodriguez RA, Pepper IL, Gerba CP (2009) Applicaton of PCR-based methods to assess the infectivity of enteric viruses in environmental samples. Appl Environ Microbiol 75: 297-307 Rose, J.B., Mullinax, R.L., Singh, S.N., Yates, M.V. and Gerba, C.P. (1987) Occurrence of rotaviruses and enteroviruses in recreational waters of Oak Creek, Arizona. Water Res 11, 1375–1381

Schwab KJ, Leon RD, Sobsey MD (1996) Immunoaffinity concentration and purification of waterborne enteric viruses for detection by reverse transcriptase PCR. Appl Environ Microbiol 62: 2086-2094 Siebenga JH, Vennema DP, Zheng J, Vinje, BE, Lee XL et al (2009) Norovirus illness is a global problem: emergence and spread of norovirus GII.4 variants, 2001-2007. J Infect Dis 200:802-812 Sinclair RG, Jones EL, Gerba CP (2009) Viruses in recreational water-borne disease outbreaks: a review. J of Appl Microbiol 107: 1769-1780 Sobsey MD, Love DC, Lovelace GL (2006) F+ RNA coliphages as source tracking viral indicators of fecal contamination. NOAA/UNH Cooperative Institute for Coastal and Estuarine Environmental Technology (CICEET) Terio V, Di Pinto A, Di Pinto P, Martella V, Tantillo G (2010) RNA extraction method for the PCR detection of hepatitis A virus in shellfish. International Journal of Food Microbiology 142: 198-201 Thurston-Enriquez JA, Haas CN, Jacangelo J, Riley K, Gerba CP (2003) Inactivation of feline calicivirus and adenovirus type 40 by UV radiation. Appl Environ Microbiol 69: 577–582 Turbow DJ, Osgood ND, Jiang SC (2003) Evaluation of recreational health risk in coastal waters based on enterococcus densities and bathing patterns. Environmental Health Perspectives 11: 598-603 Umesha KR, Bhavani NC, Venugopal MN, Karunasagar I, Krohne G, Karunasagar I (2008) Prevalence of human pathogenic enteric viruses in bivalve molluscan shellfish and cultured shrimp in south west coast of India. International J Food Microbiology 122: 279-286

  26  

U.S. Environmental Protection Agency (EPA) (2011) Recreational Water Quality Criteria. Office of Water. 66 p Viau EJ, Lee D, Boehm AB (2011) Swimmer risk of gastrointestinal illness from exposure to tropical coastal waters impacted by terrestrial dry-weather runoff. Environmental Sci Technol 45: 7158-7165

  27  

CHAPTER 2

ENTEROVIRUS METHOD OPTIMIZATION AND SEWAGE VALIDATION    INTRODUCTION

The fecally-derived enteric viruses have been proposed

as alternative water quality monitoring indicators.

However, their effective detection is hindered by extremely

low concentrations in diluted recreational waters.

Therefore, a pressing need exists for the development of

sensitive and efficient viral monitoring assays. Optimized

protocols for the detection of several enteric viruses,

including AdV, NoVI, NoVII, and F+, have already been

established in this laboratory (Tong & Lu 2011, Tong et al.

2011). Discussed here is the development of a highly

sensitive protocol for the detection of another important

enteric virus subset, EnV.

Several molecular assays exist for the environmental

detection of EnV, but little is known about their

detection limits and sensitivities. Therefore, eighteen

published EnV primer sets have been analyzed here in a

side-by-side comparative study, and PCR conditions have

been individually optimized for peak sensitivity. The

primer set exhibiting the lowest detection limit under

optimized conditions was then validated through testing

urban wastewater.

  28  

Of various polluted waters, sewage contains the

highest concentrations of microbial pathogens and fecal

indicators (Jofre and Blanch 2010). The microbial content

of raw or inadequately treated sewage reflects the health

status of the population from where it is derived (Pond

2005). Because multiple enteroviral strains are fecally

shed in high loads from infected individuals (Hot 2003),

urban wastewater was used as the nucleic acid source for

optimization of EnV molecular amplification. Wastewater was

obtained from Sand Island Wastewater Treatment Plant, which

receives sewage and other wastewater from businesses and

residences of the City of Honolulu, including Waikiki. This

treatment facility is the largest treatment facility on the

island of Oahu, responsible for processing approximately

85% of the island’s wastewater. As of 2007, approximately

412,000 people were served by the Sand Island plant,

equating to an estimate of 66 million gallons of raw

influent per day. This facility utilizes an advanced

primary treatment, disinfecting sewage via ultraviolet (UV)

radiation before releasing it 1.7 miles offshore into

Mamala Bay via the Sand Island outfall. This outfall rests

approximately 230 feet below the surface of the ocean (US

EPA 2007, Tong 2011).

  29  

MATERIALS AND METHODS

Wastewater sample collection

Wastewater samples were collected in 2-L sterile,

polypropylene containers from the Sand Island Wastewater

Treatment Plant at the following three treatment stages:

raw influent, post-primary clarification/pre-UV

disinfection, and post-UV disinfection/effluent. Samples

were transported on ice to a BSL-2 laboratory located at

the University of Hawaii at Manoa and processed

immediately.

Sample concentration and nucleic acid extraction

Sewage samples were processed using a filtration-based

method adapted from Tong and Lu (2011). In order to enhance

viral absorption to membrane filters, MgCl2 solution was

mixed into samples prior to filtration at a final

concentration of 25 mM. 100 mL of sewage from each of the

three stages were filtered through 0.45-µM pore size, type

HA membranes (Millipore Corporation, MA) on a filtration

manifold under vacuum. (It should be noted that this was

the maximum passable volume before filtration ceased due to

membrane clogging.) RNA was extracted from the recovered

membranes using the PowerWater RNA Isolation Kit, supplied

  30  

by MoBio Laboratories, CA. RNA was stored at -80°C until RT-

PCR was to be performed.

cDNA preparation via RT-PCR

Because enteroviruses are RNA viruses, the extracted

RNA must first be converted to cDNA via RT-PCR before PCR

is performed. Seven microliters of RNA extracted from each

of the three sewage stages were used as RT-PCR templates,

performed with the DyNAmo cDNA synthesis kit (New England

Biolabs, NEB, MA) according to the manufacturer’s

instructions. Random hexamers were used as primers. cDNA

was stored at -20°C until PCR performance.

Comparative analysis of published enterovirus primer sets

While several RT-PCR protocols have already been

established for the detection of EnV, little is known about

their comparative detection sensitivities, which is of

utmost importance when assessing microbial water quality.

Therefore, eighteen published primer sets, specific for

amplifying various regions of the EnV genome, were selected

in this study in a comparative evaluation of detection

sensitivity (Table 1). The primer sets chosen are specific

for all pathogenic but highly diverse human enteroviruses,

with the exception of EvVP1F/EvVP1R, which specifically

  31  

selects for EV71, causative agent of hand, foot, and mouth

disease in children (Tan 2006). All primers were

synthesized by Integrated DNA Technologies (IDT, IA).

Initial PCR test

All primer sets were initially tested under standard

PCR conditions using single-source cDNA from wastewater

influent as the nucleic acid template. Five microliters of

cDNA was added to 20 µL PCR mix containing 1X Taq reaction

buffer (NEB, MA), 2.0 mM MgCl2 solution (NEB, MA), 200 nM of

each dNTP (Sigma-Adrich, MO), 400 nM of forward and reverse

primers (Integrated DNA Technologies, IA), and 2 units of

Taq DNA polymerase (provided by Dr. Tung Hoang, University

of Hawaii at Manoa). Reaction tubes were placed in a

Mastercycler® Gradient (Eppendorf, Germany) for an initial

denaturation at 94°C for 5 min., followed by 40 cycles of

denaturation at 94°C for 30 sec., annealing at 56°C for 20

sec., and extension at 72°C for 30 sec., completed by a

final extension at 72°C for 5 min.

  32  

Table 1. Enterovirus primer sets employed in comparative analysis

 

Primer Sequence (5' - 3') Amplicon size (bp) Ref.

EV1/EV2 CGGCCCCTGAATGCGGC / CACCGGATGGCCAATCCA 196

Gomara et. al 2006 EntAF/R TNCARGCWGCNGARACNGG / ANGGRTTNGTNGMWGTYTGCCA 414

EntBF/R GCNGYNGARACNGGNCACAC / CTNGGRTTNGTNGANGWYTGCC 397

EntCF/R TNACNGCNGTNGANACHGG / TGCCANGTRTANTCRTCCC 395

EQ-1/EQ-2 ACATGGTGTGAAGAGTCTATTGAGCT / CCAAAGTAGTCGGTTCCGC 142 Dierssen et. al 1998

EvVP1F/R GAGAGTTCTATAGGGGACAGT / AGCTGTGCTATGTGAATTAGGAA 204 Tan et. al 2006

2AB/2C3A GAIGYIATGGARCARGG / GGICCYTGRAAIARIGCYTC 1200 Bessaud et. al 2008

EV1/EV2 GGCCCCTGAATGCGGCTAAT / CAATTGTCACCATAAGCAGCCA 54 Hymas et. al 2008

Lees3/4 CATTCAGGGGCCGGAGGA / AAGCACTTCTGTTTCC 256 Lees et. al 1994

P1/P3 CAAGCACTTCTGTTTCCCCGG / ATTGTCACCATAAGCAGCCA 440 Zoll et. al 1991

P2/P3 TCCTCCGGCCCCTGAATGCG / ATTGTCACCATAAGCAGCCA 155

EV-L/-R CCTCCGGCCCCTGAATG / ACCGCGATGGCCAATCCAA 197 Chung et. al 1996

Abba1/2 TGTCACCATAAGCAGCC / TCCGGCCCCTGAATGCGGCT 149 Abbaszadegan et. al 1993

EVZ1/Z2 CAAGCACTTCTGTTTCCCCGG / ACCCATAGTAGTCGGTTCCGC 388 Zhang et. al 2010

EVF/EVR CCTGAATGCGGCTAATCC / ATTGTCACCATAAGCAGCCA 144 Jothikumar et. al 2010

ev1q/ev2q GATTGTCACCATAAGCAGC / CCCCTGAATGCGGCTAATC 146 Fuhrman et. al 2005

Ent1/Ent2 CGGGTACCTTTGTACGCCTGT / ATTGTCACCATAAGCAGCCA 534 Puig et. al 1994

EvUp/Dwn TGTCACCATAAGCAGCC / TCCGGCCCCTGAATGCGGCT 149 Reynolds et. al 1998

  33  

EnV detection was analyzed by gel electrophoresis. 10

µL PCR product + 2 µL 6x loading dye was loaded into the

wells of an ethidium-bromide stained 2% agarose gel in 0.5x

TBE buffer, to which 120V was applied until sufficient

fragment migration had occurred. A 50-bp DNA ladder (NEB,

MA) was used for indication of PCR product fragment size.

The Molecular Imager Gel Doc XR+ system (BioRad

Laboratories, Inc., CA) was used to visualize results under

UV light.

PCR condition optimization

PCR conditions for all primer sets that successfully

detected EnV from untreated wastewater were then adjusted

for optimal sensitivity. Optimization brackets included

annealing temperature, MgCl2 concentration, primer

concentration, and the presence or absence of 0.1 µg/µL

molecular biology grade, protease/nuclease-free, fraction V

BSA (NEB, MA) (Table 2).

 

  34  

Table 2. PCR condition brackets included in optimization assay

 

Condition Test Range

Tanneal 50 - 60°Ca, 2° increments

[MgCl2] 1.5, 2.0, 3.0, 4.0 mM

[Primer] 200, 400, 600, 800, 1000 nM

BSA Presence/Absence (0.1 µg/µL)

a 40-50°C was included if reported Tanneal in literature was <50°C

  35  

Detection limit comparison using optimized PCR conditions

Using the final optimized conditions, primer set

detection limits were determined by PCR using 10-fold

serial dilutions of influent sewage cDNA template.

Detection limits were denoted by the highest dilution

yielding a clear, positive detection signal, visualized by

performing gel electrophoresis after PCR amplification.

Sewage validation

Once PCR conditions had been individually optimized

for all successful primer sets and detection limits had

been determined, the primer set exhibiting the highest

sensitivity, EQ-1/EQ-2, was confirmed using cDNA obtained

from the three sewage stages described earlier (raw

influent, post-clarification/pre-UV disinfection, and post-

UV disinfection/effluent). PCR and subsequent gel

electrophoresis were performed under optimized conditions

as described above.

PCR product sequencing and analysis

In order to confirm true EnV detection and identify

enteroviral strains present in Honolulu wastewater,

selected positive DNA fragments amplified by primer set EQ-

1/EQ-2 were subjected to DNA sequencing. DNA bands were

  36  

excised from the 2% agarose gel and recovered using the

QIAquick Gel Extraction kit (Qiagen, CA), according to the

manufacturer’s instructions. Recovered DNA samples from

sewage were eluted using 30 μL EB buffer and cloned into

pCR®2.1-TOPO® vectors using the TOPO TA Cloning® kit

(Invitrogen, CA) according to the manufacturer’s

instructions. 8 positive clones from a single influent

sewage sample were submitted with the M13 forward primer,

provided by the commercial kit, to the College of Natural

Sciences Advanced Studies of Genomics, Proteomics and

Bioinformatics (ASGPB, University of Hawaii at Manoa) for

DNA sequencing. Resulting genomic sequences were aligned

and compared with all available EnV sequences listed in the

National Center for Biotechnology Information (NCBI)

databank using the Basic Local Alignment Search Tool

(BLAST).

  37  

RESULTS

RT-PCR condition optimization

Of the initial 18 primer sets tested, only 7 generated

PCR products of the expected size from untreated sewage,

indicating positive EnV detection (EQ-1/EQ-2, Primer

1/Primer 3, Primer 2/Primer 3, EV-L/EV-R, EVZ1/EVZ2,

EVF/EVR, ev1qia/ev2qia). Conditions for these 7 pairs were

then optimized for their use in conventional PCR. Optimal

annealing temperatures, salt concentrations, primer

concentrations, and BSA presence/absence for these 7 primer

sets are summarized in Table 3. It was found that the

addition of BSA increased detection strength of all 7 sets

of primer pairs. Although the exact mechanism by which BSA

enhances PCR reactions is unknown, it is thought to relieve

any lingering inhibitory effects (Kreader 1996).

Determination of detection sensitivities

Detection limits significantly varied among these

seven primer sets, differing by as much as 1000-fold (Table

3). The primer set exhibiting the highest sensitivity, EQ-

1/EQ-2, with a detection limit of 10-7 X, was selected for

further experimentation. This primer set generates a 142

base pair amplicon within the highly conserved 5’ UTR

  38  

region of the EnV genome, including parts of domains IV and

V of the internal ribosomal entry site (Dierssen 1998).

  39  

Table 3. Optimized amplification conditions and detection limits of EnV primer sets employed in comparative analysis

 Primer Set

Std test Tanneal [MgCl2] [Primer] BSA Detection

Limita

EQ-1/EQ-2 ✔ 58-60°C 1.5 mM 600 nM + 10-7 X

P1/P3 ✔ 48°C 3.0 mM 800 nM + 10-4 X

P2/P3 ✔ 48°C 1.5 mM 400 nM + 10-4 X

EV-L/-R ✔ 55-58°C 3.0 mM 400 nM + 10-6 X

EVZ1/Z2 ✔ 56°C 2.0 mM 1 µM + 10-4 X

EVF/EVR ✔ 58-60°C 3.0 mM 1 µM + 10-5 X

ev1q/ev2q ✔ 58-60°C 1.5 mM 800 nM + 10-6-7 X

EV1/EV2 ✕ - - - - -

EntAF/R ✕ - - - - -

EntBF/R ✕ - - - - -

EntCF/R ✕ - - - - -

EvVP1F/R ✕ - - - - -

2AB/2C3A ✕ - - - - -

EV.1/EV.2 ✕ - - - - -

Lees3/4 ✕ - - - - -

Abba1/2 ✕ - - - - -

Ent1/Ent2 ✕ - - - - -

EvUp/Dwn ✕ - - - - -

a As determined by lowest 10X serial dilution of wastewater influent cDNA template yielding positive EnV detection, visualized by performing gel electrophoresis after PCR amplification

  40  

Sewage validation

Primer set EQ-1/EQ-2’s optimized PCR conditions were

confirmed using urban wastewater retrieved from the Sand

Island Wastewater Treatment Plant, resulting in positive

EnV detection bands of the expected size (142 bp) at all

three treatment stages tested (Figure 1).

PCR product sequencing and analysis

Sequencing and BLAST analysis from selected EnV-

positive sewage samples revealed high sequence homology

with a variety of EnV strains listed in the NCBI database,

as is to be expected when using a primer set broadly

reactive for all enterovirus types. PCR sequencing results

will be examined in greater detail in the following

chapters.

  41  

Figure 1. Agarose gel depicting enterovirus detection from urban sewage. Amplified with primer set EQ-1/EQ-2. Detection from 100 mL of raw influent, post-primary clarification/pre-UV disinfection, and post-disinfection/effluent treatment stages. M = 50bp DNA ladder. (-) = no template control.

  42  

DISCUSSION

Reported here is the development of a rapid, user-

friendly method for the effective concentration and

detection of enteroviruses from Hawaiian environmental

waters. As previously discussed, because reliance on

bacterial indicators fails to reflect the presence of

potentially problematic viral pathogens, a need for

alternative monitoring parameters exists. EnV has already

been discussed as a potential alternative indicator of

microbial water quality; the highly optimized detection

protocol established and validated here is a substantial

step toward making this goal a reality.

By using urban wastewater as our nucleic acid source

for protocol optimization, as opposed to a single clinical

sample, primer efficacy was optimized for a broad genotypic

range of all human enteroviruses. As enteric viruses are

known to exhibit resistance to common wastewater treatment

practices, it was no surprise that EnV was detected at all

three treatment stages tested, including the effluent that

is discharged into the open ocean.

By comparing detection efficiencies of presently

available primer sets in a side-by-side manner, we were

able to establish EQ-1/EQ-2 to be a fine-tuned, and highly

sensitive protocol for the effective detection of human

  43  

enteroviruses. Under the described conditions, this

optimized protocol is 103- to 107-fold more sensitive than

all other protocols tested, suggesting its suitability to

detect viral pathogens present in water environments at low

concentrations.

The establishment of a highly sensitive EnV detection

reported here represents an extremely useful tool for

environmental virologists and is an important stepping-

stone leading toward the concrete establishment of

alternative model systems for water quality monitoring.

  44  

REFERENCES

Abbaszadegan M, Huber MS, Gerba CP, Pepper IL (1993) Detection of enteroviruses in groundwater with the polymerase chain reaction. Appl Environ Microbiol 59: 1318-1324 Bessaud M, Jegouic S, Joffret ML, Barge C, Balanant J et al (2008) Characterization of the genome of human enteroviruses: Design of generic primers for amplification and sequencing of different regions of the viral genome. J Virol Methods 149: 277-284 Chung H, Jaykus L, Sobsey MD (1996) Detection of human enteric viruses in oysters by in vivo and in vitro amplification of nucleic acids. Appl Environ Microbiol 62: 3772-3778 Dierssen U, Rehren F, Henke-Gendo C, Harste G, Heim A (1998) Rapid routine detection of enterovirus RNA in cerebrospinal fluid by a one-step real-time RT-PCR assay. J Clin Virol 42: 58-64 Fuhrman JA, Liang X, Noble RT (2005) Rapid detection of enteroviruses in small volumes of natural waters by real-time quantitative reverse transcriptase PCR. Appl Environ Microbiol 71: 4523-4530 Gomara MI, Megson B, Gray J (2006) Molecular detection and characterization of human enteroviruses directly from clinical samples using RT-PCR and DNA sequencing. J Med Virol 78: 243-253 Hot D, Legeay O, Jacques J, Gantzer C, Caudrelier, Y et al (2003) Detection of somatic phages, infectious enteroviruses and enterovirus genomes as indicators of human enteric viral pollution in surface water. Water Res 37: 4703-710 Hymas WC, Aldous WK, Taggart EW, Stevenson JB, Hillyard DR (2008) Description and validation of a novel real-time RT-PCR enterovirus assay. Clin Chem 54: 406-413 Jofre J and Blanch AR (2010) Feasibility of methods based on nucleic acid amplification techniques to fulfill the requirements for microbiological analysis of water quality. J of Appl Microbiol 109: 1853-1867

  45  

Jothikumar N, Sobsey MD, Cromeans TL (2010) Development of an RNA extraction protocol for detection of waterborne viruses by reverse transcriptase quantitative PCR (RT-qPCR). J Virol Methods 169: 8-12 Kreader CA (1996) Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Micriobiol 62:1102-1106 Lees DN, Henshilwood K, Dore WL (1994) Development of a method for detection of enteroviruses in shellfish by PCR with poliovirus as a model. Appl Environ Microbiol 60: 2999-3005 Pond, Kathy (2005) Water recreation and disease - Plausibility of associated infections: acute effects, sequelae and mortality. World Health Organization Puig M, Jofre J, Lucena F, Allard A, Wadell G et al (1994) Detection of adenoviruses and enteroviruses in polluted waters by nested PCR amplification. Appl Environ Microbiol 60: 2963-2970 Reynolds KA, Roll K, Fujioka RS, Gerba CP, Pepper IL (1998) Incidence of enteroviruses in Mamala Bay, Hawaii using cell culture and direct polymerase chain reaction methodologies. Can J Microbiol 44: 598-604 Tan EL, Chow VTK, Kumarasinghe G, Lin RTP, MacKay IM et al (2006) Specific detection of enterovirus 71 directly from clinical specimens using real-time RT-PCR hybridization probe assay. Mol Cell Probe 20: 135-140 Tong H, Lu Y (2011) Effective detection of human adenovirus in Hawaiian waters using enhanced PCR methods. Virol J 8: 57 Tong H, Connell C, Boehm AB, Lu Y (2011) Effective detection of human noroviruses in Hawaiian waters using enhanced RT-PCR methods. Water Research 45(18):5837-5848 U.S. Environmental Protection Agency (2007) EPA’s tentative decision on the renewal of CWA 301(h) variance for the Sand Island Wastewater Treatment Plant. Tentative Decision Document: Fact Sheet.

  46  

Zhang C, Wang X, Liu, Y, Peng D (2010) Simultaneous detection of enteroviruses from surface waters by real-time RT-PCR with universal primers. J Environ Sci 22: 1261-1266 Zoll GJ, Melchers JG, Kopecka H, Jambroes G, Van Der Poel HJ et al (1991) General primer-mediated polymerase chain reaction for detection of enteroviruses: application for diagnostic routine and persistent infections. J Clin Virol 30: 160-165

  47  

CHAPTER 3

HUMAN ENTEROVIRUS OCCURRENCE IN HAWAIIAN ENVIRONMENTAL WATERS

INTRODUCTION

In tropical regions such as Hawaii, human enteric

viruses, especially enteroviruses, are isolated throughout

the year (Fong and Lipp 2005). This is of significant

concern in a state where residents and tourists alike enjoy

year-round recreational activities in the local coastal

waters. Once a highly optimized assay for enhanced EnV

detection had been developed and validated (Chapter 2), it

was applied to an environmental surveillance study aimed at

evaluating the occurrence of EnV in Hawaiian waters. 22

recreational bodies of water were selected as sampling

sites. Coastal and freshwater sites were included in the

study, all of which receive, to varying degrees,

considerable human activity, including swimming,

snorkeling, diving, surfing, kayaking, canoeing, boating,

and fishing.

Because a diversity of viral strains are known to

exist in environmental samples (Loisy 2004), DNA sequencing

of PCR-positive EnV amplicons from several sampling

locations was conducted.

  48  

MATERIALS AND METHODS

Environmental water sample collection

Between June 2010 and October 2011, twenty-two surface

water samples were collected from various marine and

freshwater sites around the island of Oahu (Figure 2).

Marine sites include Sand Island State Recreational Area,

Kailua Bay, Waikiki Beach, Pokai Bay, Maunalua Bay, Kualoa

Regional Park, West Loch Community Shoreline Park, Kahala

Beach, and the beach parks of Ala Moana, Diamond Head,

Maili, Waialae, Kaiaka Bay, Kahana Bay, Ko Olina (Lagoons 3

and 4), Bellows Field, and Punalu’u. Freshwater sites

include Wahiawa Reservoir, Manoa Stream, and Kaelepulu

Stream. The sample collected from Ala Wai Canal was

brackish. 2-L samples were collected in sterile,

polypropylene containers and transported on ice to the

laboratory for immediate processing. A 2-L field blank

consisting of double-distilled H2O was prepared as a

negative control. A positive control was prepared by

spiking 2-L of seawater from Diamond Head Beach Park with

100 ml EnV-positive wastewater influent.

  49  

Figure 2. Geographic locations of environmental water sampling sites on Oahu, HI.

  50  

Sample concentration, nucleic acid extraction, and RT-PCR

Environmental samples were processed using the

filtration-based method described previously in Chapter 2.

Prior to filtration, MgCl2 solution was mixed into

freshwater samples to reach a final concentration of 25 mM.

2 L of environmental water samples were filtered through

0.45-µM pore size, type HA membranes (Millipore Corporation,

MA) on a filtration manifold under vacuum. For three water

samples with high sediment content, collected from Bellows

Field Beach Park, West Loch Community Shoreline Park, and

Kaelepulu Stream, filters became clogged before 2 L were

able to pass; therefore, smaller volumes of 0.80 L, 0.80 L,

and 0.50 L were passed, respectively. Nucleic acids were

extracted from the recovered membranes using the PowerWater

RNA Isolation Kit, supplied by MoBio Laboratories, CA,

according to a modified protocol designed for separate

extraction of both RNA and DNA. The DNase I digestion step

in the original protocol (steps 21-23) was skipped, and a

60 µL eluent containing both DNA and RNA was obtained. 15 µL

of the eluent mixture was aliquot to serve as the DNA

template for subsequent PCR. The remaining 45 µL eluent was

combined with 5 µL of 10X DNase I buffer (MoBio

laboratories, CA) and 3 µL of DNase I (MoBio laboratories,

CA) and incubated at room temperature for 20 min. DNase I

  51  

was heat-inactivated by incubating the reaction at 75°C for

5 min yielding pure RNA. The nucleic acid samples were

stored at -80°C until future usage.

Seven microliters of RNA extracted from each sample

was used as template for RT-PCR, performed with the DyNAmo

cDNA synthesis kit (New England Biolabs, NEB, MA) according

to the manufacturer’s instructions. Random hexamers were

used as primers.

Molecular amplification via PCR

Primer set EQ-1/EQ-2, selected as the optimal

candidate for surveillance of EnV presence in the

environment, was used to test the twenty-two environmental

water samples for EnV contamination. PCR was performed as

described in Chapter 2, using the newly-optimized PCR

conditions specified in Table 3. Results were visualized

via gel electrophoresis as previously described.

E. coli amplification as internal control

It is well known that environmental water samples

contain inhibitory compounds such as minerals, organic

matter, humic and fulvic acids, tannins, and biomass (Jofre

and Blanch 2010). If inefficiently removed during sampling

processing, the presence of these compounds can negatively

  52  

affect downstream molecular analysis (Shieh 1995,

Parshionikar 2004). In order to assess nucleic acid

extraction efficiency and inhibitor removal during sample

processing, DNA extracted from water samples was tested for

the presence of E. coli, which is known to grow naturally

in the Hawaiian environment and is expected to be readily

detectable in all samples (Byappanahalli 2004). In each 25

µL reaction, 3 µL sample DNA were added to 22 µL PCR mixture

containing 1X Taq (Mg2+ free) reaction buffer, 2.5 mM MgCl2

solution, 200 nM dNTP mixture, 0.1 μg/μL BSA, 400 nM of each

primer (URL301: TGTTACGTCCTGTAGAAAGCCC, URR-432:

AAAACTGCCTGGCACAGCAATT) (Bej 2001), and 2 units of Taq

polymerase. The amplification cycle consisted of an initial

5 min. denaturation at 94°C, followed by 35 cycles of 30

sec. denaturation at 94°C, 30 sec. annealing at 60°C, and 30

sec. extension at 72°C, completed by a final 5 min.

extension at 72°C. Results were visualized via gel

electrophoresis, performed as previously described.

PCR product sequencing and analysis

In order to confirm true EnV detection and identify

enteroviral strains present in the Hawaiian environment,

selected positive DNA fragments amplified by primer set EQ-

1/EQ-2 from environmental water samples were subjected to

  53  

DNA sequencing. DNA bands were excised, recovered, and

cloned into pCR®2.1-TOPO® vectors as described for EnV

amplicons detected in sewage (Chapter 2). 5 environmental

clones from 5 positive sampling sites (Manoa Stream, Pokai

Bay, Kaiaka Beach Park, Waikiki Beach, and Wahiawa

Reservoir) were submitted to ASGPB for DNA sequencing.

Resulting genomic sequences were aligned and compared with

available EnV sequences listed in the NCBI databank using

BLAST.

  54  

RESULTS

Enterovirus detection in environmental water samples

Environmental screening indicated that eleven of the

twenty-two sample sites contained EnV contamination,

including Diamond Head Beach Park, Pokai Bay, Kailua Bay,

Waikiki Beach, Kaiaka Bay Beach Park, Wahiawa Reservoir,

Manoa Stream, Ala Moana Beach Park, Ko Olina Beach Park

Lagoon 3, Kahala Beach, and Punalu’u Beach Park (Table 4).

  55  

Table 4. Enterovirus detection in Hawaiian environmental waters

 Map#a Site Condition EnV detection

1 Kaiaka Bay Beach Park Seawater +

2 Punalu’u Beach Park Seawater +

3 Wahiawa Reservoir Freshwater +

4 Kahana Bay Beach Park Seawater −

5 Kualoa Regional Park Seawater -

6 Kailua Bay Seawater +

7 Kaelepulu Stream Freshwater −

8 Bellows Field Beach Park Seawater −

9 Maunalua Bay Seawater −

10 Waialae Beach Park Seawater −

11 Kahala Beach Seawater +

12 Diamond Head Beach Park Seawater +

13 Manoa Stream Freshwater +

14 Ala Wai Canal Brackish −

15 Waikiki Beach Seawater +

16 Ala Moana Beach Park Seawater +

17 Sand Island State Recreational Area Seawater −

18 West Loch Shoreline Park Seawater −

19 Ko Olina Beach Park Lagoon 4 Seawater −

20 Ko Olina Beach Park Lagoon 3 Seawater +

21 Maili Beach Park Seawater −

22 Pokai Bay Seawater +

Field Blank ddH2O −

Spike control Seawater + sewage +

aSee Figure 2

  56  

E. coli detection as internal control

E. coli was detected in all water samples tested,

indicating efficient nucleic acid extraction and inhibitor

removal during sample processing. This finding supports the

notion that negative detection of EnV at several sample

sites is truly negative, as opposed to being due to

unsatisfactory nucleic extraction and/or inhibitor effects.

PCR product sequencing and analysis

Sequencing and BLAST analysis from selected EnV-

positive water samples revealed high sequence homology with

a variety of EnV strains listed in the NCBI database, as

expected when using a primer set broadly reactive for all

enterovirus types. Of the 13 sequenced EnV PCR products

(including amplicons from sewage and environmental

samples), 9 were identified as human coxsackie A/B viruses

(including human enterovirus 90), causative agents of

herpangina, meningitis, fever, respiratory disease, hand-

foot-and-mouth disease, myocarditis, heart anomalies,

thrush, pleurodynia, and diabetes (Bosch 1998). Also

detected were human enterovirus 68, associated with

respiratory illness (Oberste 2004) and 2 human echoviruses,

linked to meningitis, fever, respiratory disease, thrush,

gastroenteritis, and severe neonatal infections (Piraino

  57  

1982). EnV sequence alignment and BLAST analysis may be

further examined in Figure 3.

Figure 3. Nucleotide sequence analysis of EnV isolated from wastewater (multiple clones) and environmental water samples. (A) Sequence alignment of 142bp fragments amplified by primer set EQ-1/EQ-2. Dots indicate homology with sewage isolate #1. (B) Closest BLAST match (including E value and percentage identity) of sequenced PCR products with EnV strains listed in the NCBI database.

 

1 ACATGGTGTG AAGAGTCTAT TGAGCTAATT GGTAGTCCTC CGGCCCCTGA ATGCGGCTAA TCCTAACTGC 70 Sewage #1

.......... .......... .......C.. .AG....... .......... .......... .......CA. Sewage #2 .......... .......... .......... ....A..... .......... .......... .......... Sewage #3 .......... .......... .......CC. .AG....... .......... .......... ...C...CAC Sewage #4 .......... .......... .......G.. A......... .......... .......... .......... Sewage #5 .......... .......... .......CA. AAGA...... .......... .......... ...C...CAT Sewage #6 .......... .......... .......CC. .AG....... .......... .......... ...C...CA. Sewage #7 .......AGA .......... .......... .A..A..... .......... ........-. .......... Sewage #8 .......... .......... .......G.. A......... .......... .......... .......... H2O: Manoa Stream .......... .......... .......CAA .AG....... .......... .......... .......... H2O: Pokai Bay .......... .......... .......CA. AAG....... .......... .......... ...C...CAT H2O: Kaiaka Bay .......... .......... .......G.. .......... .......... .......... ...C...CAT H2O: Waikiki Beach .......... .......... .......G.. .......... .......... .......... .......... H2O: Wahiawa Reservoir

71 AGAGCGCGTA CCCTCAACCC AGGGGGCGGC GCGTCGTAAT GGGTAACTCT GCAGCGGAAC CGACTACTTT GG 142 Sewage #1 G....AG..G .T.A...A.. ..T...T... TT.......C .C.C..G... .TG....... .......... .. Sewage #2 G....ACAC. ...A..CA.. .......A.T .T.......C ...C...... .......... .......... .. Sewage #3 G....AA..G .T.A...A.. ..T...TA.. TT.......C .C.C..G... .TG....... .......... .. Sewage #4 .......... .......... .......... .......... .......... .......... .......... .. Sewage #5 G....AA..G A..A...T.. ..T..TTCT. TT.......C .C.C..G..C .TG....... .......... .. Sewage #6 G....AA..G .T.A...A.. ..T...TA.. TT.......C .C.C..G... .TG....... .......... .. Sewage #7 G....AGA.. ...A..CA.. ..T....A.T CT........ ...C...... .......... .......... .. Sewage #8 G......... .......... .......... .......... .......... .......... .......... .. H2O: Manoa Stream G....AGA.. ...A..CA.. ..T....A.T CT........ ...C...... .......... .......... .. H2O: Pokai Bay G....AA..G A.TA...T.. ..T..TTCT. TT.......C .C.C..G..C .TG....... .......... .. H2O: Kaiaka Bay G....AA..G A..A...T.. ..T..TTCT. TT.......C .C.C..G..C .TG....... .......... .. H2O: Waikiki Beach G....AGA.. ..TA.G.G.. ..T....A.T CT.......C ...C...... .......... .......... .. H2O: Wahiawa Reservoir

Sample Closest BLAST match (Accession #, Name) E value Max ident Sewage #1 GU236101.1 Human coxsackievirus A16 isolate 00.143.2668 5e-59 96% Sewage #2 DQ995634.1 Human coxsackievirus A11 strain BAN01-10589 1e-60 97% Sewage #3 GQ126860.1 Human coxsackievirus B5 1e-60 97% Sewage #4 AB192877.1 Human enterovirus 90 5e-59 96% Sewage #5 HQ423141.1 Human coxsackievirus A16 strain KMM/08 1e-60 97% Sewage #6 AF465511.1 Human coxsackievirus A13 strain Flores 5e-54 94% Sewage #7 AB192877.1 Human enterovirus 90 5e-59 96% Sewage #8 GU236215.1 Human echovirus 11 isolate 39351.82 8e-57 95% H2O: Manoa Stream HQ423141.1 Human coxsackievirus A16 strain KMM/08 2e-62 97% H2O: Pokai Bay AJ579633.1 Human echovirus 11 isolate JP-979/89 5e-59 96% H2O: Kaiaka Bay AF465511.1 Human coxsackievirus A13 strain Flores 2e-52 93% H2O: Waikiki Beach AY062274.1 Human enterovirus 68 strain VR-561 2e-47 91% H2O: Wahiawa Reservoir GU236263.1 Human echovirus 24 isolate 23927 2e-62 97%

A

B

  58  

DISCUSSION

Establishment of highly sensitive EnV-detection assay

allowed a survey study of 22 recreational water sites

around the island of Oahu, 11 of which tested positive for

enterovirus, indicating fecal pollution in a significant

portion of Hawaii’s surface water. It is worthy to note

that this is the first report of using an effective

molecular detection method to demonstrate a relatively high

occurrence of enterovirus in Hawaiian recreational waters.

The utilization of this optimized protocol to rapidly and

reliably screen multiple water samples from across the

island of Oahu represents a powerful research tool of

important public health significance.

It should be noted that public health implications are

limited based solely on PCR-positive results (Choi 2005,

Fout 2003). While molecular detection assays can be useful

for indicating fecal contamination in an area, they do not

distinguish between the presence of truncated genomic

fragments or complete, viable, and infectious virus

particles (Boehm 2003, Rodriguez 2009). Therefore,

infectivity assays based on the observance of viral-induced

CPE in cell culture are important in order to make valid

determinations of health risks (Fong 2005). Current

research in this laboratory is directed at assessing the

  59  

infectivity (defined as of the ability of a virus to enter

a host cell and utilize its resources to produce infectious

virus particles, Rodriguez 2009) of the enteric viruses for

which permissive cell lines are available (AdV + EnV).

Nevertheless, whether or not the viruses are infectious,

their positive molecular detection is a useful indicator of

fecal contamination in Hawaii’s waters. Even if the viruses

themselves are non-infectious, they indicate a current or

recent source of fecal pollution that has potential to

introduce other pathogens of concern into local

recreational waters.

Of notable practical significance is that comparable

optimization studies in our laboratory have produced

similar protocols for the efficient environmental detection

of other human enteric viruses, including adenovirus (Tong

and Lu 2011), norovirus genogroups I and II (Tong et al

2011), and F-specific RNA coliphage (Tong 2011). When

combined with the EnV detection protocol established here,

these procedures comprise a powerful array for monitoring

and comparing fecal pollution levels. The ability to

reliably screen environmental waters for the presence of

multiple strains of enteric viruses is a highly desirable

research tool, facilitating a thorough investigation of

potentially contaminated recreational waters. The

  60  

relatively simple protocols using well-established,

conventional RT-PCR procedures are adoptable by a broad

range of environmental health agencies, for which more

advanced equipment and techniques (e.g. real-time PCR) may

be unavailable.

Although the described methods are powerful

supplements to aid microbial water quality monitoring,

public health implications are limited without conclusive

infectivity data. Risk assessment at any particular

recreational site cannot be based solely on PCR-detected

EnV presence or absence from a single sample collection.

Additionally, the present study is limited to the detection

of EnV strains present in Hawaii, which may not be a

complete representation of the EnV composition present

elsewhere. For serious consideration as a valid and

established alternative monitoring system, broader large-

scale trials, including additional sampling sites and

replicate samples from each site, will be necessary. Also,

comparisons with standardized bacterial surveillance

systems will contribute to a more thorough understanding of

water quality assessment.

  61  

REFERENCES

Bej AK, DiCesare JL, Haff L, Atlas RM (2001) Detection of Escherichia coli and Shigella spp. in water by using the polymerase chain reaction and gene probes for uid. Appl Environ Microbiol 57: 1013-1017 Boehm AB, Fuhrman JA, Mrse RD, Grant SB (2003) Tiered approach for identification of a human fecal pollution source at a recreational beach: Case study at Avalon Bay, Catalina Island, California. Environ Sci Technol 37: 673-680 Bosch A, Guix S, Sano D, Pinto RM (1998) New tools for the study and direct surveillance of viral pathogens in water. Curr Opin Biotechnol 19: 295-301 Byappanahalli M, Fujioka R (2004) Indigenous soil bacteria and low moisture may limit but allow faecal bacteria to multiply and become a minor population in tropical soils. Water Sci Technol 50: 27-32 Choi S, Jiang SC (2005) Real-time PCR quantification of human adenoviruses in urban rivers indicates genome prevalence but low infectivity. Appl Environ Microbiol 71: 7426-7433 Fong T, Lipp EK (2005) Enteric viruses of humans and animals in aquatic environments: health risks, detection, and potential water quality assessment tools. Microbiol Mol Bio. Rev 69: 357-371 Fout GS, Martinson BC, Moyer MWN, Dahling DR (2003) A multiplex reverse transcription-PCR method for detection of human enteric viruses in groundwater. Appl Environ Microbi 69: 3158-3164 Jofre J and Blanch AR (2010) Feasibility of methods based on nucleic acid amplification techniques to fulfill the requirements for microbiological analysis of water quality. J of Appl Microbiol 109: 1853-1867 Loisy F, Atmar RL, Guillon P, Cann PL, Pommepuy M, Le Guyader FS (2004) Real-time RT-PCR for norovirus screening in shellfish. J Virological Methods 123:1-7 Oberste MS, Maher K, Schnurr D, Flemister MR, Lovchik JC et al (2004) Enterovirus 68 is associated with respiratory

  62  

illness and shares biological features with both the enteroviruses and the rhinoviruses. J Gen Virol 85: 2577-2584 Parshionikar SU, Cashdollar J, Fout GS (2004) Development of homologous viral internal controls for use in RT-PCR assays of waterborne enteric viruses. J Virol Methods: 121:39-48 Piraino FF, Sedmak G, Raab K (1982) Echovirus 11 infections of newborns with mortality during the 1979 enterovirus season in Milwaukee, Wis. Public Health Rep 97: 346-353 Rodriguez RA, Pepper IL, Gerba CP (2009) Applicaton of PCR-based methods to assess the infectivity of enteric viruses in environmental samples. Appl Environ Microbiol 75: 297-307 Shieh YSC, Wait D, Tai L, Sobsey MD (1995) Methods to remove inhibitors in sewage and other fecal wastes for enterovirus detection by the polymerase chain reaction. J Virol Methods: 54:51-66 Tong H (2011) Development of effective detection of human enteric viruses in Hawaiian recreation waters. MS thesis, University of Hawaii at Manoa, Honolulu. 85 p. Tong H, Connell C, Boehm AB, Lu Y (2011) Effective detection of human noroviruses in Hawaiian waters using enhanced RT-PCR methods. Water Res 45: 5837-5848 Tong H, Lu Y (2011) Effective detection of human adenovirus in Hawaiian waters using enhanced PCR methods. Virol J 8: 57

  63  

CHAPTER 4

SHELLFISH-MEDIATED BIOACCUMULATION OF HUMAN ENTERIC VIRUSES IN OAHU’S MARINE ENVIRONMENT

INTRODUCTION

As addressed previously, the low concentration of

enteric viruses in environmental water samples can present

a major barrier to their effective utilization as

alternative water quality indicators. In addition to highly

optimized molecular detection assays (discussed in previous

chapters), efficient viral concentration techniques can

also help overcome this obstacle. The natural

bioconcentration phenomenon of marine bivalve shellfish

endemic to Oahu is explored here as a novel means of

assessing microbial water quality.

Bivalve molluscs are shellfish that have two shell

halves hinged together (Lees 2000). These stationary

animals obtain food by filter-feeding, meaning that they

process large volumes of water daily in order to capture

algae and other particulate matter for food (Hernroth 2002,

Karamoko 2005, Vilarino 2009, Bosch 2010). Research has

documented that the filter-feeding behavior of shellfish

can be affected by various environmental factors, including

turbidity, particulate chemical composition, pH,

temperature, and salinity (Asahina 2009). Other factors are

  64  

shellfish size and species, as larger animals are capable

of filtering more water and are thus potentially exposed to

greater numbers of pathogens in polluted waters (Nappier

2008).

As a result of filter-feeding, microbes present in

surrounding water will bioaccumulate within the internal

digestive tissues of the shellfish to a level higher than

that in the surrounding water (Kingsley 2001, Formiga-Cruz

2003, Jamieson 2005, Schultz 2007, Umesha 2008, Asahina

2009). According to Goblick et al, shellfish are able to

concentrate enteric viruses to levels up to 100-fold

greater than what exists in the nearby water (Goblick

2011). Following a contamination event, shellfish will

typically bioaccumulate viruses to detectable levels within

24-48 hours. In a study conducted by Asahina et al,

shellfish were placed into a tank containing seawater

seeded with a 10-6 dilution of a clinically positive

norovirus stool sample. Even at this high dilution, the

shellfish were capable of bioaccumulating the virus to a

readily detectable level (Asahina 2009). Additionally,

marine sediments, which are known to harbor enteric

viruses, may increase viral accumulation rates in shellfish

by acting as contamination sources in addition to the

overlying water (Landry 1983).

  65  

Shellfish are known to retain viruses longer than they

retain bacterial indicators commonly used for water quality

assessment (Dore 1995, Kingsley 2011, Goblick 2011).

Depuration, a natural process utilized by filter-feeders,

acts to expel substances that are inessential to the

animals. Enteric viruses are purged more slowly than most

bacteria, and research has shown that depuration is an

ineffective method for the removal of viruses from

shellfish tissue (Richards 2010). In fact, viral retention

mechanisms may exist (Le Guyader 2006, Hansman 2007). In a

study conducted by Asahina et al, enterovirus was detected

in shellfish tissue via RT-PCR 12 days after a seeded tank

exposure event (Asahina 2009). Similarly, Nappier et al

allowed oysters exposed to various enteric viruses to

depurate and found that viruses persisted even after 29

days (Nappier 2008). Also, it has been suggested that

phagocytic processes in shellfish hemocytes, involving

lysosomal enzymes, toxic oxygen intermediates, and

antimicrobial peptides, are utilized to kill bacteria.

However, these processes have not been shown to affect

viruses; enteric viruses have actually been shown to

persist within phagocytic hemocytes of live bivalves

(Richards 2010, Kingsley 2010).

  66  

As a result of this natural concentration phenomenon,

bivalve shellfish may act as bioindicators of microbial

contamination in the waters they inhabit (Manso 2010). In

this way, these animals represent “a snapshot” of water

quality over the past days to weeks (Miller 2005).

Shellfish have been used for decades as bioindicators of

heavy metals, pesticides, and other toxins in the aquatic

environment, and they have been recognized in recent years

as potential bioindicators of bacteria, viruses, and

parasites of fecal origin (Miller 2005, Ismail 2006,

Sombrito 2007, Connell et al 2012). By subjecting nucleic

acids extracted from shellfish internal tissue to optimized

PCR assays developed by our laboratory, greatly

enhancedenteric virus detection efficiency has been

achieved. This novel shellfish-mediated bioaccumulation

phenomenon shows promising potential to aid in effective

surveillance of Hawaiian environmental waters.

Commonly found inhabiting Hawaii’s ocean environment

is the marine bivalve Isognomon spp. Ranging in size from

40-55 x 15-30 mm, this mollusk is usually found 1-2 meters

below the ocean surface, living underneath rocks and in

reef crevices of intertidal and subtidal habitats.

Isognomon spp. are typically short-lived (2 years or less)

and reach sexual maturity within their first year. They

  67  

have no commercial value and have received little attention

in the literature (Harper 1994, Asahina 2009).

For this study, Isognomon spp. are collected from

various beaches around the island of Oahu and nucleic acids

are extracted from internal digestive tissues. Highly

optimized RT-PCR/PCR protocols are then applied to test for

the presence of enterovirus, norovirus genogroups I and II,

adenovirus, and F-specific RNA coliphage. Resulting

information regarding the occurrence of various enteric

viruses in local marine waters is an extremely useful

resource to enhance water quality surveillance measures.

  68  

MATERIALS AND METHODS

Sample collection

Between July and December 2011, marine bivalves

Isognomon spp. were collected from reef crevices and from

underneath rocks at twelve various beaches around the

island of Oahu (Figure 4). Sampling site selections were

based on shellfish availability, recreational activity

levels, and potential sources of fecal pollution (including

both point and non-point sources). Several other sampling

sites were visited, including Kuilima Cove, Hukilau Beach

Park, Swanzy Beach Park, Ka’a’awa Beach Park, and various

sites along the Waianae coastline; however, either no

shellfish were found, or sampling conditions were too rough

at these locations. Whenever possible, samples were

harvested from a wide collection area in order to ensure

assessment of overall water quality at each particular site

(as opposed to collecting all samples from underneath a

single rock or ledge). Between 15 and 55 specimens were

collected from each site, depending on size and

availability.

  69  

Figure 4. Geographic locations of twelve sample collection sites included in shellfish-mediated bioaccumulation study.

  70  

Shellfish dissection + nucleic acid extraction

Following transport to the laboratory on ice,

shellfish were counted, measured, weighed, and shucked

using sterile No. 4 scalpels + No. 20 blades. Internal

digestive tissues were removed using sterile forceps and

separated into 1.0 – 2.0 g aliquots, from which nucleic

acids were extracted using the MoBio PowerSoil RNA

Isolation Kit + DNA Elution Accessory Kit (MoBio

Laboratories, CA), according to the manufacturer’s

instructions. This kit, designed for the isolation of

nucleic acids from soil samples, was selected for its

powerful removal of inhibitory substances, yielding high

quality, biologically intact, RT-PCR amplifiable RNA (MoBio

Laboratories, PowerSoil instruction manual). Extracted RNA

was subject to DNase treatment using the RTS DNase Kit

(MoBio Laboratories, CA), according to the manufacturer’s

instructions. DNA and DNase-treated RNA were stored at -80°C

until future usage. Also, during animal dissection, 0.5 –

1.0 g of tissue from each animal was aliquoted into 1.5 ml

Eppendorf tubes and stored at -80°C to be utilized in future

infectivity studies.

  71  

Simultaneous water sample processing

At each of the 12 sites where shellfish were

collected, a 2 L water sample was also collected in order

to compare the sensitivity between these two viral

detection methods. Water samples were collected and

processed using the same membrane filtration and nucleic

acid extraction methods described in previous chapters. The

entire volume of 2 liters was filtered from each sample

site. Extracted nucleic acids were stored at -80°C until

future usage.

RT-PCR/PCR

In order to generate cDNA to test for the presence of

RNA viruses EnV, NoVI, NoVII, and F+, RT-PCR was performed

(as described in previous chapters) using RNA extracted

from shellfish and corresponding water samples as template.

To test for the presence of AdV (DNA virus), extracted DNA

was utilized directly as the PCR template. PCR for all five

enteric virus subsets was performed according to their

individual optimized conditions (Tables 5 and 6). Details

of the primer sets employed may be found in Table 7.

Results were visualized by performing gel electrophoresis

as previously described.

  72  

Table 5. Optimized PCR reaction components for enteric virus detection

 

Virus Primer [Mg] (mM)

[Primer] (µM)

BSA (0.01 µg/µL)

AdV ADV-F

ADV-R 1.5 0.6 +

NoV GI QNIF4

NV1LCR 2.0 0.4 +

NoV GII COG2F

COG2R 2.0 0.8 +

EnV EQ-1

EQ-2 1.5 0.6 +

F+ OgorzalyIII F

OgorzalyIII R 2.0 0.8 +

 

  73  

Table 6. Optimized PCR cycle conditions for enteric virus detection

 

Step Temperature

Time

Initial denaturation 94°C 5 min

Denaturation 94°C 30 sec

Anneal 54°C (AdV)

58°C (EnV, NoV, F+) 30 sec

Extension 72°C 30 sec

GO TO: 2 40 cycles ---

Final extension 72°C 10 min

Hold 4°C ---

 

  74  

Table 7. Primer sets employed in bioaccumulation study

Virus Primer Sequence (5' -> 3') Size

NoV GI QNIF4 CGCTGGATGCGNTTCCAT 86 bp

NV1LCR CCTTAGACGCCATCATCATTTAC

NoV GII COG2F CARGARBCNATGTTYAGRTGGATGAG 97 bp

COG2R TCGACGCCATCTTCATTCACA

EnV EQ-1 ACATGGTGTGAAGAGTCTATTGAGCT 142 bp

EQ-2 CCAAAGTAGTCGGTTCCGC

F+ Ogorzaly III F CCGCGTGGGGTAAATCC 115 bp

Ogorzaly III R TTCTTACGATTCCGAGAAGGCT

AdV ADV-F GCCACGGTGGGGTTTCTAAACTT 131 bp

ADV-R GCCCCAGTGGTCTTACATGCACATC

  75  

E. coli amplification as internal control

As mentioned previously, it is well known that

environmental samples contain high levels of inhibitory

compounds. Shellfish are no exception; in fact, the

inhibitors present in shellfish tissue are often especially

problematic due to humic substances, glycogen, and other

properties of shellfish extracts (Lees 1994, Atmar 1995,

Schwab 2001, Loisy 2004, Kingsley 2011). In order to

efficiently detect viruses via PCR, nucleic acids must be

as pure as possible. This is especially important when

dealing with RNA viruses, as the additional reverse

transcriptase step often a major limiting factor due to the

enzyme’s susceptibility to interfering and inhibitory

substances (Arnal 1999). Therefore, just as E. coli was

used as an internal amplification control for the

environmental samples discussed in Chapter 3, DNA extracted

from shellfish tissue was also tested for the presence E.

coli. PCR conditions and gel electrophoresis were performed

as described in the previous chapter.

PCR product sequencing and analysis

In order to confirm true enteric virus detection and

identify specific strains present in the Hawaiian

environment, selected positive amplicons detected from

  76  

shellfish and corresponding water samples were subjected to

DNA sequencing. DNA bands were excised, recovered, and

submitted to ASGPB, as described previously, for direct DNA

sequencing. Resulting genomic sequences were compared with

available enteric virus sequences listed in the NCBI

databank using BLAST.

  77  

RESULTS

Enteric virus detection in shellfish and corresponding

water samples

Detection results of this bioaccumulation study are

summarized in Tables 8 (shellfish), 9 (corresponding

coastal water samples), and 10 (correlation between EnV

detection in shellfish and water samples). The most

commonly detected virus in shellfish was human norovirus

genogroup I, for which 8 of 12 beach sites and 33 of 64

total sample groups (51.6%). Human enterovirus was also

quite prevalent, detected in shellfish from 8 beach sites

and in 30 of the 64 total sample groups (46.9%).

Contamination levels of the remaining three viruses were

lower but still quite significant. Adenovirus was detected

in shellfish from 7 beach sites and in 21 of the total

sample groups (32.8%). Norovirus II was detected in

shellfish from 4 beach sites and in 15 of the total sample

groups (16.3%). F-specific RNA coliphage was detected at 6

beach sites and in 11 of the total sample groups (17.2%).

Based on detection results from the twelve

corresponding water samples, NoVI was most prevalent

(positive detection at 7 of 12 sites). EnV was detected at

4 of 12 sites, followed by AdV and NoVII (3 and 2 positive

  78  

sites, respectively). F+ was not detected in any of the

twelve water samples.

E. coli as internal control

All sample groups tested positive for E. coli,

indicating efficient nucleic acid extraction and inhibitor

removal.

PCR product sequencing

A variety of enteric virus strains were detected from

both shellfish and coastal water samples. See Table 11 for

details.

  79  

Table 8. Enteric virus detection in shellfish

Site # Collected

# Sample Groups

# (+) Groups

AdV EnV NoVI NoVII F+

Ala Moana 15 3 3 3 3 - -

Kahala 30 5 - 3 2 2 1

Kahana Bay 40 4 - - 4 2 -

Kawaikui 21 4 1 - 4 - 1

Ko Olina Lagoon 3 18 5 3 5 5 3 2

Ko Olina Lagoon 4 48 4 - - 4 - -

Kualoa Park 55 5 3 4 5 - 1

Magic Island 28 7 - 3 - - 4

Punalu’u 48 6 5 5 - - 2

Sand Island 26 6 1 - 6 - -

Waialae (Resort) 36 9 - 2 - 8 -

Waialae Beach Park 20 6 5 5 - - -

TOTAL 385 64 21 30 33 15 11

  80  

Table 9. Enteric virus detection in corresponding water samples

Site AdV EnV NoVI NoVII F+

Ala Moana + - + - -

Kahala - + - - -

Kahana Bay - - + + -

Kawaikui - - + - -

Ko Olina Lagoon 3 + + + + -

Ko Olina Lagoon 4 - - + - -

Kualoa Park - - + - -

Magic Island - + - - -

Punalu’u - + - - -

Sand Island - - + - -

Waialae (Resort) - - - - -

Waialae Beach Park + - - - -

12 SITES TOTAL 3 4 7 2 0

  81  

Table 10. Enterovirus detection correlation between shellfish and water samples

Site EnV detection

Water Shellfish

# (+) of Total # Tested

Ala Moana Beach Park - 15 of 15

Kahala Beach + 18 of 30

Kahana Bay Beach Park − 0 of 40

Kawaikui Beach Park - 0 of 21

Ko Olina Beach Park Lagoon 3 + 18 of 18

Ko Olina Beach Park Lagoon 4 − 0 of 48

Kualoa Regional Park - 44 of 55

Magic Island + 12 of 28

Punalu’u Beach Park + 40 of 48

Sand Island State Recreational Area - 0 of 26

Waialae (Resort) - 8 of 36

Waialae Beach Park − 17 of 20

  82  

Selected gel images are displayed below (Figures 5-8).

Figure 5. Agarose gel depicting adenovirus detection from shellfish collected at Kualoa Park. Amplified with primer set ADV-F/ADV-R. (+) = TOPO plasmid containing fragment of interest confirmed via DNA sequencing. (-) = no template control.

   

Figure 6. Agarose gel depicting enterovirus detection from samples collected at Ko Olina Lagoon 3. Amplified with primer set EQ-1/EQ-2. (+) = TOPO plasmid containing fragment of interest confirmed via DNA sequencing. (-) = no template control.

  83  

Figure 7. Agarose gel depicting norovirus genogroup I detection from samples collected at Ko Olina Lagoon 3. Amplified with primer set QNIF4/NV1LCR. (+) = TOPO plasmid containing fragment of interest confirmed via DNA sequencing. (-) = no template control.

   

Figure 8. Agarose gel depicting enterovirus detection from samples collected at Kahala Beach. Amplified with primer set EQ-1/EQ-2. (+) = TOPO plasmid containing fragment of interest confirmed via DNA sequencing. (-) = no template control.

  84  

Table 11. Enteric virus strains detected in Hawaiian marine environment

a) Enterovirus

 Strain Site of Detection

(if from H2O: italics)

Human coxsachievirus A16 Kahala Resort

Ko Olina Lagoon 3

Human coxsachievirus A22

Punalu’u

Kualoa

Kahala Beach

Kahala Beach

Human echovirus 11 Magic Island

Human echovirus 30 Ko Olina Lagoon 3

Human enterovirus C Kahala Beach

Human enterovirus 71 Ko Olina Lagoon 3

   b) Norovirus genogroup I    

 Strain Site of Detection

(if from H2O: italics)

Human norovirus Saitama Ko Olina Lagoon 4

Norovirus Hu/GI/2005/8338/Chelyabinsk Kahana Bay

Norovirus genogroup 1 strain 1336 Kahana Bay

Norovirus Hu/GI.1/P7587/2007/Stromstad Sand Island

Norovirus Hu/GI.1/P7-587 Kualoa

Norovirus Hu/GI/Guangxi/DL131-2/2010 Kualoa Ko Olina Lagoon 4

Norovirus Hu/GI.3/C13/Bonaberi/2009 Ko Olina Lagoon 3

   

 

  85  

c) Norovirus genogroup II

 Strain Site of Detection

(if from H2O: italics)

Norovirus Hu/GII/Maizuru/7734/2007/JPN Kahala Beach

Norovirus Hu/GII/Beijing/589/2008 Ko Olina Lagoon 3 Ko Olina Lagoon 3

   

   

 d) F-specific RNA coliphage    

Strain Site of Detection (if from H2O: italics)

Enterobacteria phage Qbeta

Magic Island Kualoa Park Kahala Beach

Ko Olina Lagoon 3

e) Adenovirus

Strain Site of Detection (if from H2O: italics)

Human adenovirus 41

Punalu’u

Sand Island

Kualoa

Ko Olina Lagoon 3

Ko Olina Lagoon 3

Human adenovirus B isolate DA0630 Ala Moana

  86  

DISCUSSION

The novel enteric virus detection method employed here

has interesting implications for enhanced environmental

surveillance. The substantial number and wide variety of

enteric viruses detected in shellfish collected from Oahu’s

coastal waters suggests that these animals are indeed

useful biosentinels of microbial water quality.

Shellfish dissection, nucleic acid extraction, and

subsequent PCR analysis revealed positive detection of at

least one enteric virus subset at every beach site tested,

suggesting fecal pollution in a significant portion of

Hawaii’s marine environment. It is interesting to note that

NoVI was the most commonly detected enteric virus in

shellfish, followed by EnV and AdV. Corresponding water

samples revealed a similar hierarchy of enteric virus

prevalence in the Hawaiian marine environment. These

results suggest widespread occurrence of these two enteric

virus subtypes in our local waters. NoVII was detected at a

lesser extent, due perhaps to lower general occurrence in

the state of Hawaii, or decreased environmental persistence

as compared to other enteric viruses. It is also possible

that, compared to other types of enteric virus, NoVII is

not preferentially bioaccumulated within shellfish tissue.

F+ was also detected at a low level, most likely due to the

  87  

fact that this virus is thought to restrictively indicate

point source contamination (direct sewage), but not other

various non-point sources. Another possibility is that,

despite precise PCR condition optimization for individual

primer sets, certain detection protocols are simply more or

less sensitive than others.

Due to the bioconcentration phenomenon of shellfish,

it is expected that the utilization of these filter-feeders

proves to be a more sensitive method for viral detection

than testing water samples directly. Findings from this

study confirm this expectation. Whenever a coastal water

sample tested positive for a particular virus, shellfish

collected from the same location also tested positive.

Conversely, not all viruses detected in shellfish were

detected in water samples tested directly from the same

site. In fact, for each of the 5 of the viruses included in

this study, the number of contaminated sites determined

through shellfish processing exceeds that of direct water

sampling.

To compare enteric virus detection in shellfish versus

corresponding water samples more deeply, detection

correlation results are compared site-by-site for EnV

specifically, as shown in Table 10. Shellfish dissection,

nucleic acid extraction, and subsequent PCR analysis

  88  

revealed positive EnV detection in specimens from eight of

twelve coastal locations. From the four sites where EnV was

not detected in shellfish, corresponding water samples also

tested negative; this correlation suggests that these sites

are free of EnV contamination. Four of the eight sites

where EnV was detected in shellfish, including Kahala

Beach, Magic Island, Ko Olina Lagoon 3, and Punalu’u Beach

Park, were also shown to contain EnV through membrane

filtration of water samples. This positive correlation

strongly suggests fecal pollution at these four beaches. It

is interesting to note that from the remaining four sites,

where shellfish were shown to contain EnV (Ala Moana Beach

Park, Kualoa Regional Park, Waialae-Resort, and Waialae

Beach Park), water tested EnV-negative. Detection analysis

for all other viral types included in the study yields

similar correlation results. These findings strongly

contribute to the notion that using shellfish as sentinels

of water quality is a more sensitive monitoring method than

testing water directly.

However, although using shellfish as sentinels of

water quality yields enhanced detection sensitivity, this

method does require additional processing time and effort.

Prior to nucleic acid extraction, an adequate number of

shellfish must be acquired and dissected, which is a much

  89  

lengthier process than the simple membrane filtration

procedure utilized when testing direct water samples.

Therefore, shellfish processing may be suitable for more

in-depth water quality studies, while the ease and

simplicity of direct water sample collection may be more

practical for routine recreational water monitoring.

PCR product sequencing is a useful research component

for effective water quality monitoring, as it provides

valuable insight into the various enteric viral strains

that contaminate our local waters. The diverse composition

of strains identified here confirms that our optimized

primer sets are broad enough to include a wide range of

members within each viral subset. Similar viral strains

were detected from shellfish and direct water samples,

indicating shellfish-mediated uptake of whichever viral

strains are present in the surrounding water. A wide

variety of EnV and NoVI were detected from multiple sites

around the island of Oahu. The most commonly detected AdV

was adenovirus 41, a critical etiological agent of viral

gastroenteritis in children (Xagoraraki 2007). The

seemingly lower prevalence of NoVII and F+ in Hawaiian

waters is reflected in corresponding DNA sequencing

results.

  90  

An additional research area of interest is the

identification of the origins of fecal matter in

recreational waters. It is known that major pollution

sources of concern include sewage discharge, storm water

runoff from streams and storm drains, and contamination

from bathers themselves (Pond 2005). All swimmers release

fecal organisms upon entering the water in a process called

bather shedding. Fecal accidents and diaper-aged children

are also of concern (Devine 2011). It has been demonstrated

that bathers particularly impact water quality in confined

waters with limited flow (Fattal 1991). High levels of

bacterial indicators have been shown to correlate with a

high number of visitors during periods of high recreational

use, such as weekends and the summertime (McDonald 2008).

Other potential contamination sources include input from

groundwater discharge, beach sand, and boats (Bosch 2010,

Viau 2011). Marinas are usually located in sheltered areas

with reduced water circulation, resulting in the

accumulation of boating waste. Also, boats in use may

dispose of waste improperly into recreational waters

(Devine 2011). In developed countries, because most point

sources of wastewater are well regulated, non-point sources

such as urban runoff during storms become main contributors

to surface water pollution (Viau 2011). In fact, the most

  91  

common route of fecal contamination in recreational waters

is following heavy rainfall, when increased runoff and

overflow exacerbate pre-existing causes of recreational

water pollution (Bosch 2010). 96% of Hawaii’s beach

advisories in 2010 were due to “brown water advisories”, or

rain (Dorfman 2011). Also, flooding over saturated soils

can result in larger sediment flow, resulting in increased

microbial counts in recreational waters (Devine 2011).

In the waters of Hawaii specifically, pollution source

tracking is a difficult task. Because water flow is

unidirectional in streams, fecal contamination will most

likely originate upstream. However, in the marine

environment, source tracking is more difficult due to the

continuous mixing of water (Miller 2005). Also, several

recreational bodies of water receive multiple inputs from

land sources, making accurate source targeting a

challenging task. For instance, Kailua Bay, receives inputs

from the Mokapu wastewater outfall, Kawainui Canal, and

Ka’elepulu Stream, all of which are potential sources of

contamination (Krock 1993). Several sites routinely test

positive for various fecal contaminants, yet the sources of

pollution remain unknown and ambiguous (Hunt, USGS).

Coastal waters receiving discharge from streams are

particularly susceptible to fecal contamination (Viau

  92  

2011), and numerous recreational beach sites in Hawaii

receive freshwater runoff. It is estimated that Kahana Bay,

located on the windward side of Oahu, receives 30 million

gallons of freshwater runoff per day (C&C of Honolulu).

Septic wastewater is suspected as another major influence,

but convincing data is currently unavailable.

Malfunctioning septic systems at just a few near-shore

properties can result in beachwater contamination

significant enough to require beach closures, and pathogens

from faulty inland septic systems may enter streams that

flow into recreational waters (Devine 2011). In 2007,

Kualoa Beach Park was closed for several months due to

bacterial levels seven times the acceptable standard, an

event most likely attributable to leaching from the park

restrooms (Hunt, USGS). Another likely contamination source

is open defecation of homeless populations inhabiting areas

around environmental waters. In a 2011 study conducted by

Viau et al, four streams with large homeless encampments

nearby tested positive for several types of enteric

viruses, including adenovirus, enterovirus, norovirus I,

and norovirus II (Viau 2011). The identification of fecal

pollution sources is important if preventative action is to

be taken in hopes of minimizing future contamination events

in our precious tropical waters.

  93  

It was originally hypothesized that the degree of

viral contamination at various Hawaiian beaches (as

detected by the bioaccumulation study) may be correlated

with various impact factors, such as nearby wastewater

effluent discharge, recreational activity levels, or

freshwater input. This categorical approach was aimed at

beginning to understand the sources of fecal pollution in

the Hawaiian environment. However, because many marine

sites are exposed to a combination of impact factors (e.g.

high recreational activity + freshwater input), it is

difficult at this point to accurately pinpoint direct

sources of fecal contamination. Despite the lack of

particularly clear-cut correlations, results of the

bioaccumulation study do provide an opportunity to explore

various possibilities regarding enteric virus distribution

in the marine environment. Such suppositions are discussed

below.

Ala Moana Beach Park (including the Magic Island

sampling site) is an extremely popular bathing beach with

exceptionally high recreational activity levels. In 1994,

this beach accommodated an estimated 1.5 million people

(Paul 1997). Therefore, bather shedding may be largely

responsible for the fact that 4 of the 5 enteric virus

subgroups included in the study were detected in this

  94  

region. The reef-protected waters of Ala Moana Beach Park

remain quite calm throughout the year, resulting in

decreased water circulation and, therefore, increased viral

persistence. Input from the nearby Ala Wai Canal may also

contribute to pollution levels, particularly during storm

events, as this body of water receives a significant

fraction of urban runoff (Connolly 1999). There has been

concern that migrating effluent from the Sand Island

Wastewater Treatment Plant outfall deteriorates water

quality at shoreline beaches such as Ala Moana; however,

findings of Paul et al suggest that the offshore outfall is

not a major contaminating influence (Paul 1997). Waste

discharge from boats an adjacent harbor is yet another

potential source of contamination at Ala Moana Beach Park.

At the Sand Island State Recreational Area, all

shellfish tested positive for NoVI, and a very small number

of samples contained AdV. It was originally thought that

this area may be more heavily polluted due to effluent

drifting back to shore from the Mamala Bay wastewater

output. However, although enteric viruses are frequently

detected near the output itself, it is believed that they

do not commonly return to nearshore waters (Paul 1997).

Also, wave action was very high during the period of sample

collection; this dramatic mixing of water probably had a

  95  

major dilution effect on any enteric viruses that may have

present in the surrounding water.

The beaches of Kahala, Kawaikui, and Waialae may be

grouped similarly in that all receive moderate levels of

recreational activity and non-point source input. Pipes

connected to storm drainage systems may release runoff into

these waters following periods of heavy rainfall.

Additionally, Waialae Beach is impacted by discharge from

Kapakahi Stream (Vijayavel 2010). The detection of several

types of enteric viruses in shellfish from these locations

may be attributable to these reasons. Also, the waters of

Waialae and Kawaikui were especially turbid during the time

of sample collection. Because enteric virus survival is

enhanced through association with particles within the

water column (as previously discussed), this may have been

another contributing factor to their positive detection.

Kahana Bay and Punalu’u Beach Park receive discharge

from Kahana Stream and Punalu’u Stream, respectively. Both

sites receive low to moderate recreational activity. AdV,

EnV, and F+ were detected at Punalu’u. At Kahana Bay, NoVI

and NoVII were detected. Often observed near these two

areas are a number of homeless individuals, whose open

defecation may be discharged into the ocean. It should be

noted that, due to extremely high turbidity in the main

  96  

section of the bay, shellfish tested from Kahana Bay were

collected from a relatively small sampling quadrant quite

remote from the rivermouth. The highly diluted nature of

the water in this region may explain why norovirus was the

only virus detected.

At Kualoa Park, all viruses except NoVII were

detected. As previously mentioned, the park’s faulty septic

system has been a major pollution problem in the past. The

beach park restrooms are now closed with caution tape.

However, camping is quite popular at Kualoa Park, and

campers may either attempt to use the restrooms anyway, or

choose to defecate freely on park grounds. Both

possibilities will clearly negatively impact the water

quality at Kualoa. Additionally, shellfish were collected

from a calm region protected from the open ocean by cement

barricades; decreased wave action and circulation in this

area may boost viral persistence.

Findings from Isognomon spp. inhabiting the lagoons of

Ko Olina are particularly interesting. While shellfish from

Lagoon 3 tested positive for all 5 viral subtypes,

shellfish from Lagoon 4 were only shown to contain NoVI.

Conditions at these two man-made lagoons are extremely

similar; both are extremely well protected by rock

barricades and very popular bathing beaches. While the

  97  

differences in enteric virus prevalence at these sites may

seem contradictory, two possible explanations are

hypothesized. First is the difference in sampling periods.

Because these lagoons are part of a resort, tourists are

the major beachgoers. Lagoon 3 was sampled during the

summertime, the peak vacation season for tourist and

swimmer activity. In contrast, Lagoon 4 was sampled in

October, a less popular month for recreational water

activity at Ko Olina. This may partially explain the

opposing results of the bioaccumulation study in this

region. Another contributing factor may be the precise

sampling location. Shellfish from Lagoon 3 were collected

in the shallow waters nearest the beach, where bathers tend

to congregate and where circulation is lowest. In contrast,

shellfish from Lagoon 4 were harvested from the offshore

region opening out past the protective rock barrier, where

few swimmers travel and where the diluting effect of wave

action is stronger than within the cove. It might be

expected that shellfish inhabiting this area would

bioconcentrate enteric viruses to a lesser extent than

their counterparts closer to the shore. Because of these

interesting factors and because Isognomon spp. are

extremely prevalent and easily harvestable at Ko Olina,

this site is ideal for future exploratory studies aimed at

  98  

deciphering the complex dynamics of shellfish-mediated

bioaccumulation of viral pathogens.

Although the high presence of enteric viruses reported

in Hawaii’s marine environment may be alarming, caution

should be made when interpreting results. PCR detects both

infectious and damaged viruses, so without correlating

infectivity data, public health risks are difficult to

assess. However, regardless of their infectivity, enteric

viruses may be used as indices of human fecal pollution.

Their positive detection indicates the potential presence

of other human pathogens of concern in aquatic

environments.

This pilot study utilizing indigenous Hawaiian

mollusks as competent bioindicators of water quality is an

innovative approach to screening environmental waters for

fecal pollution. Because enteric viruses often persist in

environmental waters at such low concentrations, their

effective detection is greatly aided by the natural

bioconcentration phenomenon of shellfish. Research findings

using the novel protocol suggest a high prevalence of viral

pathogens in Hawaiian recreational waters. Future research,

including infectivity assays and laboratory-controlled

spike studies to more directly measure bioaccumulation and

inhibition levels, will further investigate the practical

  99  

feasibility of using shellfish as natural bioindicators of

microbial water quality.

  100  

REFERENCES

Arnal C, Ferre-Aubineau V, Besse B, Mignotte B, Schwartzbrod L, Billaudel S (1998) Comparison of seven RNA extraction methods on stool and shellfish samples prior to hepatitis A virus amplification. J Virological Methods 77: 17-26 Asahina AY, Lu Y, Wu C, Fujioka RS, Loh PC (2009) Potential biosentinels of human waste in marine coastal waters: bioaccumulation of human noroviruses and enteroviruses from sewage-polluted waters by indigenous mollusks. J Virol Methods 158: 46-50 Atmar RL, Neill FH, Romalde JL, Le Guyader F, Woodley CM, Metcalf TG, Estes MK (1995) Detection of Norwalk virus and hepatitis A virus in shellfish tissues with the PCR. Appl Environ Microbiol 61: 3014-3018 Bosch A and Le Guyader SF (2010) Introduction: Viruses in shellfish. Food Environ Microbiol 2: 115-116 City & County of Honolulu. Hawaii’s implementation plan for polluted runoff control, Appendix F: Detailed descriptions of Hawaii’s 18 water quality limited segments Connell C, Tong H, Wang Z, Allmann E, Lu Y (2012) New approaches for enhanced detection of enteroviruses from Hawaiian environmental waters. PLoS ONE (in production) Connolly JP, Blumberg AF, Quadrini JD (1999) Modeling fate of pathogenic organisms in coastal waters of Oahu, Hawaii. J Environ Engineering 398-406 Devine J (2011) Sources of beachwater pollution. Natural Resources Defense Council Dore WJ, Lees DN (1995) Behavior of Escherichia coli and male-specific bacteriophage in environmentall contaminated bivalve molluscs before and after depuration. Appl and Environ Microbiol 61: 2830-2834 Dorfman M and Rosselot KS (2011) Testing the waters: A guide to water quality at vacation beaches. Twenty-first annual report. Natural Resources Defense Council Fattal B, Olevsky E, Cabelli VJ (1991) Bathers as a possible source of contamination for swimming associated

  101  

illness at marine bathing beaches. Int J Environ Health Res 1: 204–214 Formiga-Cruz M, Allard AK, Conden-Hansson AC, Henshilwood K, Hernroth B E et al (2003) Evaluation of potential indicators of viral contamination in shellfish and their applicability to diverse geographical areas. Appl Environ Microbi 69: 1556-1563 Goblick GN, Anbarchian JM, Woods J, Burkhardt W, Calci K (2011) Evaluating the dilution of wastewater treatment plant effluent and viral impacts on shellfish growing areas in Mobile Bay, Alabama. J of Shellfish Research 30: 979-987 Hansman GS, Oka T, Okamoto R, Nishida T, Toda S, Noda M, Sano D et al (2007) Human sapovirus in clams, Japan. Emerg Infect Dis 13: 620-622 Harper E and Morton B (1994) The biology of Isognomon legume (bivalvia: pterioida) at Cape D’Aguilar, Hong Kong, with special reference to predation by muricids. The Malacofauna of Hong Kong and Southern China III: Proceedings of the Third International Workshop on the Malacofauna of Hong Kong and Southern China, Hong Kong 13 April – 1 May 1992. Hong Kong: Hong Kong University Press Hernroth BE, Conden-Hansson ACC, Rehnstam-Holm AS, Girones R, Allard AK (2002) Environmental factors influencing human viral pathogens and their potential indicator organisms in the blue mussel, Mytilus edulis: the first Scandinavian report. Appl Environ Microbiol 68: 4523-4533 Hunt C, USGS. Wastewater and nutrient source tracking – results of reconnaissance chemical mapping at Kualoa and Kahana, Oahu. HI DOH/USGS Cooperative Program, Pacific Islands Water Science Center Ismail A (2006) The use of intertidal molluscs in the monitoring of heavy metals and organotin compounds in the west coast of Peninsular Malaysia. Coastal Marine Science 30: 401-406 Jamieson RC, Joy DM, Lee H, Kostaschuk R, Gordon RJ (2005) Resuspension of sediment-associated Escherichia coli in a natural stream. J Environ Qual 34: 581-589 Karamoko Y, Ibenyassine K, Aitmhand R, Idaomar M, Ennaji M M (2005) Adenovirus detection in shellfish and urban sewage

  102  

in Morocco (Casablanca region) by the polymerase chain reaction. J Virological Methods 126:135-137 Kingsley DH, Richards GP (2001) Rapid and efficient extraction method for reverse transcription-PCR detection of hepatitis A and Norwalk-like viruses in shellfish. Appl Environ Microbiol 67: 4152-4157 Kingsley D, Provost K (2010) A potential mechanism of virus persistence within bivalve shellfish [abstract]. American Society of Virology. Bozeman, Montana, p. 1 Krock HJ, Rujioka RS (1993) Kailua Bay bacteriological water quality and circulation assessment report (KB-6) Water Resources Research Center, University of Hawaii at Manoa, Honolulu, HI Landry EF, Vaughn JM, Vicale TJ, Mann R (1983) Accumulation of sediment-associated viruses in shellfish. Appl Environ Microbiol 45: 238-247 Le Guyader FS, Loisy F, Atmar RL, Hutson AM, Estes MK, Ruvoen-Clouet N, Pommepuy M et al (2006) Norwalk virus-specific binding to oyster digestive tissues. Emerg Infect Dis 12: 931-936 Lees DN, Henshilwood K, Dore WL (1994) Development of a method for detection of enteroviruses in shellfish by PCR with poliovirus as a model. Appl Environ Microbiol 60: 2999-3005 Lees D (2000) Viruses and bivalve shellfish. International J Food Microbiol 59: 81-116 Loisy F, Atmar RL, Guillon P, Cann PL, Pommepuy M, Le Guyader FS (2004) Real-time RT-PCR for norovirus screening in shellfish. J Virological Methods 123:1-7 Manso C F, Polo D, Vilarino M L, Romalde J L (2010) Genotyping of hepatitis A virus detected in bivalve shellfish in Falicia (NW Spain). Water Sci Tech 61:15-24 McDonald AT, Chapman PJ, Fukasawa K (2008) The microbial status of natural waters in a protected wilderness area. J Environ Management 87: 600-608 Miller WA, Atwill ER, Gardner IA, Miller MA, Fritz HM, Hedrick RP, Melli AC, Barnes NM, Conrad PA (2005) Clams

  103  

(Corbicula fluminea) as bioindicators of fecal contamination with Cryptosporidium and Giardia spp. in reshwater ecosystems in California. International J Parasitology 35: 673-684 Nappier SP, Graczyk TK, Schwab KJ (2008) Bioaccumulation, retention, and depuration of enteric viruses by Crassostrea virginica and Crassostrea ariakensis oysters. Appl Environ Microbiol 74: 6825-6831 Paul JH, Rose JB, Jiang SC, London P, Xhou X, Kellogg C (1997) Coliphage and indigenous phage in Mamala Bay, Oahu, Hawaii. Appl Environ Microbiol 63: 133-138 Pond, Kathy (2005) Water recreation and disease - Plausibility of associated infections: acute effects, sequelae and mortality. World Health Organization Richards GP, McLeod C, Le Guyader FS (2010) Processing strategies to inactivate enteric viruses in shellfish. Food Environ Virology 2: 183-193 RNA PowerSoil Total RNA Isolation Kit Instruction Manual. Version 02162010. MoBio Laboratories, Inc. Schultz AC, Saadbye P, Hoorfar J, Norrung B (2007) Comparison of methods for detection of norovirus in oysters. International J of Food Microbiol 114: 352-356 Schwab KJ, Neill FH, Le Guyader F, Estes MK, Atmar RL (2001) Development of a reverse transcription-PCR-DNA enzyme immunoassay for detection of Norwalk-like viruses and hepatitis A virus in stool and shellfish. Appl Environ Microbiol 67:742-749 Sombrito EZ, Honrado MCV, de Vera A, Tabbada RS, Ranada ML, Relox J, Tangonan MC (2007) Use of Perna viridis as a bioindicator of paralytic shellfish toxins at low Pyrodinium bahamense var compressum density using a radioreceptor assay. Environmental Bioindicators 2: 264-272 Umesha KR, Bhavani NC, Venugopal MN, Karunasagar I, Krohne G, Karunasagar I (2008) Prevalence of human pathogenic enteric viruses in bivalve molluscan shellfish and cultured shrimp in south west coast of India. International J Food Microbiology 122: 279-286

  104  

Viau EJ, Lee D, Boehm AB (2011) Swimmer risk of gastrointestinal illness from exposure to tropical coastal waters impacted by terrestrial dry-weather runoff. Environmental Sci Technol 45: 7158-7165 Vijayavel K, Rujioka R, Ebdon J, Taylor H (2010) Isolation and characterization of Bacteroides host strain HB-73 used to detect sewage specific phages in Hawaii. Water Research 44: 3714-3724 Vilarino ML, Le Guyader SL, Polo D, Schaeffer J, Krol J, Romalde JL (2009) Assessment of human enteric viruses in cultured and wild bivalve molluscs. International Microbiology 12: 145-151 Xagoraraki I, Kuo DHW, Wong K, Wong M, Rose JB (2007) Occurrence of human adenoviruses at two recreational beaches of the Great Lakes. Appl Environ Microbiol 73: 7874-7881

  105  

CHAPTER 5

CONCLUSIONS

 Described here are the development and application of

novel protocols for the effective detection of human

enteric viruses in Hawaiian environmental waters. First, a

highly optimized and sensitive protocol for enterovirus

detection was established. Once confirmed through testing

urban wastewater, this protocol was utilized in a

surveillance study of 22 recreational bodies of water

located on Oahu, 11 of which tested enterovirus-positive.

Next, an innovative approach to increased enteric

virus detection sensitivity was explored, utilizing the

bioconcentration phenomenon of filter-feeding shellfish.

Specimens were collected from 12 marine sites and tested

for the presence of an array of important viruses,

including adenovirus, enterovirus, norovirus genogroups I

and II, and F-specific RNA coliphage. Multiple virus types

were detected in sampling groups from all around the

island, indicating fecal contamination in a significant

portion of Oahu’s costal waters. Enteric virus detection

from corresponding water samples revealed that the

utilization of Isognomon spp. dramatically enhances

detection sensitivity.

  106  

The conveyed methods provide practical means of

utilizing enteric viruses as alternative indicators, with

potential to enhance accurate assessment of microbial water

quality and minimize risks associated with polluted

recreational waters. Reliable microbial water quality

monitoring is vital to ensure the safety of swimmers,

surfers, divers, and other recreational users of waters in

Hawaii and worldwide. Research findings provide meaningful

insight into the degree of fecal contamination here in the

Hawaiian environment. The revealed polluted regions are

sites of potential health risk and should instigate

additional investigation of our beloved recreational

waters.