Journ

alof

Cell

Scie

nce

Myosin isoform switching during assembly of theDrosophila flight muscle thick filament lattice

Zacharias Orfanos* and John C. Sparrow`

Department of Biology, University of York, York YO10 5DD, UK

*Present address: Institute for Cell Biology, Department of Molecular Cell Biology, University of Bonn, Ulrich-Haberland-Str. 61a, 53121 Bonn, Germany`Author for correspondence (john.sparrow@york.ac.uk)

Accepted 23 October 2012Journal of Cell Science 126, 139–148� 2013. Published by The Company of Biologists Ltddoi: 10.1242/jcs.110361

SummaryDuring muscle development myosin molecules form symmetrical thick filaments, which integrate with the thin filaments to produce theregular sarcomeric lattice. In Drosophila indirect flight muscles (IFMs) the details of this process can be studied using genetic

approaches. The weeP26 transgenic line has a GFP-encoding exon inserted into the single Drosophila muscle myosin heavy chain gene,Mhc. The weeP26 IFM sarcomeres have a unique MHC-GFP-labelling pattern restricted to the sarcomere core, explained by non-translation of the GFP exon following alternative splicing. Characterisation of wild-type IFM MHC mRNA confirmed the presence of analternately spliced isoform, expressed earlier than the major IFM-specific isoform. The two wild-type IFM-specific MHC isoforms differ

by the presence of a C-terminal ‘tailpiece’ in the minor isoform. The sequential expression and assembly of these two MHCs intodeveloping thick filaments suggest a role for the tailpiece in initiating A-band formation. The restriction of the MHC-GFP sarcomericpattern in weeP26 is lifted when the IFM lack the IFM-specific myosin binding protein flightin, suggesting that it limits myosin

dissociation from thick filaments. Studies of flightin binding to developing thick filaments reveal a progressive binding at the growingthick filament tips and in a retrograde direction to earlier assembled, proximal filament regions. We propose that this flightin bindingrestricts myosin molecule incorporation/dissociation during thick filament assembly and explains the location of the early MHC isoform

pattern in the IFM A-band.

Key words: Sarcomere, Tailpiece, Flightin

IntroductionEach muscle sarcomere is a macromolecular complex containing a

large number of structural proteins that are essential for its function

(reviewed in Clark et al., 2002). Even though there are differences

in sarcomeric structure between organisms and muscle types, the

basic architecture of striated muscle sarcomeres is universal. A

fundamental question in myogenesis is how the multitude of

proteins is assembled to produce the very regular final sarcomeric

structure and different models have been proposed to explain it

(reviewed in Sanger et al., 2005). The most widely accepted of

these is the premyofibril model (Rhee et al., 1994) which

postulates a progressive process of maturation of sarcomeres

within a myofibril from early, less complex structures called

premyofibrils, by the sequential addition of sarcomeric proteins.

Other models propose that the various sarcomeric sub-parts, such

as early Z-disc and thin filament complexes called I-Z-I brushes,

and thick filament A-band precursors, assemble individually and

separately before they come together to form the final structure

(Furst et al., 1989; Schultheiss et al., 1990; Lu et al., 1992; Holtzer

et al., 1997).

The Drosophila indirect flight muscles (IFM) are an established

model genetic system for the study of muscle development

(Fernandes et al., 1991; Vigoreaux, 2001). Many of the IFM

sarcomeric proteins are present as IFM-specific isoforms, which

often permit their genetic knockdown without compromising adult

viability. The ultrastructural details of insect IFM sarcomere

assembly have been described in detail in two dipteran species,

Calliphora erythrocephala (Auber, 1969) and Drosophila

melanogaster (Reedy and Beall, 1993). In both species

sarcomere assembly begins with the establishment of nascent

myofibrils, which mature synchronously throughout the fibre, in

Drosophila without the later addition of extra sarcomeres (Reedy

and Beall, 1993). This means that any given developmental time-

point represents a stage in assembly for all the sarcomeres in the

fibre. In Drosophila IFM sarcomere assembly takes around 3 days,

permitting ready sampling at distinct time-points for the detailed

study of gene expression and protein localisation.

Sarcomeric myosin is a hexamer, consisting of two myosin

heavy chains, two essential light chains and two regulatory light

chains. The N-terminal region of the heavy chain polypeptide

forms the myosin head with its ATP-dependent motor domain,

whereas the C-terminal region forms the rod. Extensive a-helical

domains of the latter region self-dimerise to form coiled-coil rods,

which further associate with each-other to form thick filaments.

Most, if not all, animals express multiple sarcomeric myosin heavy

chain isoforms to produce muscles with different physiological

properties (Schiaffino and Reggiani, 1996; Weiss and Leinwand,

1996; Reggiani et al., 2000). In Drosophila, the different isoforms

arise from the single myosin heavy chain (Mhc) gene (Bernstein

et al., 1983) by alternative transcript splicing of multiple

alternative exons at five positions within the final mRNA, and

the inclusion or exclusion of exon 18 (George et al., 1989).

Myosin assembly into thick filaments involves three processes.

First, myosin heavy chain monomers dimerise via their a-helical

Research Article 139

Journ

alof

Cell

Scie

nce

coiled regions (Cohen and Parry, 1998); second, fully formeddimeric myosin molecules associate in an anti-parallel fashion,

through a sequence of charged amino-acids called the assemblycompetent domain, to form a thick filament nucleating centre(Sohn et al., 1997). Finally, further myosin molecules are added tothe ends of the nucleating centre, elongating the nascent thick

filament. In the sarcomeric context, it remains unclear how andwhere the process of assembling individual thick filaments, thenorganising them into the superstructure of the A-band takes place

and how this is regulated in vivo. A-band substructures may formalone and become incorporated into the sarcomere later, or allthree sequential processes of myosin assembly into thick filaments

might take place within the developing sarcomere. The differentsarcomeric assembly models proposed so far (reviewed in Sangeret al., 2005) allow for any of these possibilities.

In our search for genetic tools to investigate A-band assembly,

we obtained a transgenic line expressing a GFP-tagged version ofthe Mhc gene, called weeP26. This line was generated in a ‘proteintrap’ screen, in which a small P-element (weeP) containing a GFP

exon was mobilised to obtain random insertions into the genome(Clyne et al., 2003). Early in our characterization of this transgenicline, we observed unusual differences in the pattern of myosin–

GFP localisation in the sarcomeric A-bands of the IFMs comparedto other muscles in the fly. We report here that these differencesreveal the presence of a second myosin heavy chain (MHC)

isoform in addition to the major IFM-specific myosin isoformpreviously described (Hastings and Emerson, 1991) during IFMsarcomere development. The differential expression andlocalisation of the two MHC isoforms shows that IFM A-bands

assemble progressively, by the addition (and subsequentelongation) of new thick filaments around an initially establishedthick filament core. Furthermore, we show that the IFM-specific

protein flightin assists in regulating this assembly process byreducing myosin exchange/turnover once the latter has beenassembled into thick filaments.

ResultsThe weeP26 transgenic line contains a transposon encoding aGFP exon inserted in the Mhc gene between exons 18 and 19

(Clyne et al., 2003), the last two exons of the gene; we haveconfirmed this independently by sequencing of weeP26 genomicDNA. Alternative splicing of Mhc transcripts produces variants

that either include or exclude exon 18, with translationterminating either in exon 18 or 19, respectively, as both exonscontain a stop codon (Fig. 1A). The large number of MHC

isoforms can therefore be classified as either MHC-18 or MHC-19. Due to the location of the GFP exon, in the weeP26 line onlythe MHC-19 isoforms will include the GFP, as in MHC-18isoforms translation termination happens upstream of the GFP

exon (Fig. 1A). It was expected therefore that all embryonic/larval muscle isoforms, which are MHC-19, (Zhang andBernstein, 2001), would be GFP-tagged in weeP26 muscles; the

IFMs, which specifically express an exon-18-containing isoform(Hastings and Emerson, 1991) were not expected to have anyGFP-tagged MHC. Confocal microscopy of weeP26 muscles

showed that the GFP-tagged myosin (MHC-GFP) localises in theA-band region of the embryonic larval wall muscles (Fig. 1B)and the adult jump muscle (Fig. 1C), known as the tergal

depressor of trochanter (TDT) or tergotrochanter (TTM) muscle.The unexpected appearance of MHC-GFP in IFM sarcomeres(Fig. 1D) also showed an unusual sarcomeric localisation pattern.

While the GFP signal was found throughout the A-band region in

TDT and larval muscle, in the IFM it was limited to the core

region of the A-band. This was shown better by staining for the

IFM-specific thick filament protein flightin, which was clearly

localised in a much wider area than MHC-GFP (Fig. 1E). Fig. 1F

is a schematic of the localisation of MHC-GFP in the core of the

Fig. 1. The weeP26 line expresses GFP-tagged MHC. (A) Mhc transcripts

either contain or lack exon 18, with translation terminating in exon 18 or 19,

respectively. In the case of the weeP26 line, the inserted GFP exon will only

be translated in the isoforms excluding exon 18. (B–D) Localisation of MHC-

GFP (green) in different muscles of the weeP26 line; Z-disks are stained for a

Z-disc epitope of sallimus (red): (B) larval muscle; (C) jump muscle;

(D) IFM. (E) Staining weeP26 IFM for A-band protein flightin (red) shows

that MHC-GFP in the IFM is confined to two foci in the sarcomeric core.

(F) Staining for M-line protein obscurin (red) shows that the foci flank the M-

line. (G) Schematic of the localisation of MHC-GFP in weeP26 IFM

sarcomeres, relative to the entire A-band. Scale bar: 5 mm.

Journal of Cell Science 126 (1)140

Journ

alof

Cell

Scie

nce

IFM sarcomere, in two foci flanking the M-line. Overall this

result showed that there are two different populations of myosin

molecules in the weeP26 IFMs, bearing or lacking the GFP tag,

with the tagged molecules localised in the sarcomeric core. Since

only MHC-19 variants are expected to be GFP- tagged in weeP26

flies, this suggests that an MHC-19 variant is present in the IFMs,

but with a restricted sarcomeric location.

The GFP tag in weeP26 IFM could affect MHC properties and

thick filament assembly. However, the normal Z-disk appearance

in the confocal images above (Fig. 1A) suggests that sarcomere

assembly in weeP26 homozygotes is unaffected. Electron

micrographs of homozygous adult weeP26 IFMs show that the

ultrastructure of the sarcomeres is indistinguishable from those of

wild type (Fig. 2) including sarcomere length at 3.3636

0.136 mm (n530), confirming that myosin-containing thick

filaments occur in regions outside the MHC-GFP signal, and

that the GFP tag does not affect sarcomere assembly. Finally,

flight-testing to assess IFM function showed that 3-day-old

weeP26 homozygotes fly as well as the wild type [Student’s t-

test, t(18)51.364, P,0.001]. Therefore the GFP tag in weeP26

IFMs has no negative effects on sarcomere assembly or function.

The restricted pattern of MHC-GFP localisation in the adult

IFMs could be explained if the protein was expressed and

assembled into the early developing sarcomere, and not later, on

the assumption that IFM A-bands grow by the addition of thick

filaments around an early thick filament core. To study this, the

localisation of MHC-GFP was followed in developing weeP26

IFM sarcomeres. WeeP26 IFMs were dissected out of early

(48 hrs after puparium formation, APF) and mid-development

(72 hrs APF) pupae, and immunostained for obscurin, a protein

that in Drosophila IFM localises to the M-line from the earliest

stages of sarcomere assembly (Katzemich et al., 2012) (Fig. 3).

At 48 hrs APF, MHC-GFP is present throughout the early, narrow

A-band core (including the region of the developing M-line). At

72 hrs APF, despite the growth of the sarcomere in length (along

the myofibrillar axis) but also in width (orthogonal to the

myofibrillar axis), as shown by the lateral extension of the

obscurin-stained M-line, the MHC-GFP pattern remains largely

unchanged. It is confined to the core, and mostly absent from

the rest of the growing A-band. An apparent reduction in the signal

intensity at the centres of the fluorescence corresponds to the M-

line region. The GFP pattern in the adult IFM sarcomere is almost

identical, except that the M-line fluorescence gap is slightly wider.

These observations suggest that in weeP26 IFM the early A-band

is assembled using the GFP-tagged MHC, which is expected to be

an MHC-19 isoform (henceforth designated MHC-IFM19).

Subsequently, thick filaments increase in length outwards from

the core using the non-tagged MHC, the previously reported IFM

MHC-18 isoform (henceforth designated MHC-IFM18), leaving

MHC-IFM19 in the core. This not only confirms that the IFM A-

band grows from the core outwards by the addition of thick

filaments laterally, but also that the thick filaments grow at their tips,

otherwise the GFP foci would progressively move away from each

other.

To eliminate the possibility that the change in MHC isoform in

weeP26 during development is due to the presence of the GFP-

exon, Mhc expression during wild-type IFM development was

characterised. mRNA was isolated from developing wild-type

IFM at 36, 48 and 72 hrs APF. RT-PCR was performed using

primers on exons 17 and 19, flanking exon 18, to test for the

inclusion or exclusion of exon 18, thereby differentiating

between Mhc-IFM18 and Mhc-IFM19 transcripts (Fig. 4A). At

36 hrs APF, only expression of Mhc-IFM19 was detected

(Fig. 4B–C). At 48 hrs expression of Mhc-IFM19 was reduced,

while Mhc-IFM18 was first detected. At 72 hrs APF, Mhc-

IFM19 signal was no longer detectable, but Mhc-IFM18 was

strongly expressed. The newly eclosed adult IFMs still strongly

expressed the Mhc-IFM18 mRNA. The Mhc-IFM19 transcript

was also detectable at very low levels in the adult IFMs, though

this could also be due to a small contamination from other

thoracic muscles. The results were confirmed by multiple mRNA

isolation replicates, and PCR using different conditions (not

shown). There is therefore clear evidence from fluorescence

microscopy and expression data for a transition from expression

of MHC-IFM19 to that of MHC-IFM18, around 48 hrs APF.

Adult IFM is reported to express only one MHC-IFM18

isoform, the alternative exon profile/composition of which is

already known (Hastings and Emerson, 1991). In order to

examine the exon profile of the earlier MHC-IFM19, the

alternative Mhc exons (numbers 3, 7, 9, 11 and 15) were

amplified from IFM cDNA isolated at 36 hrs APF and

sequenced. According to the RT-PCR results above this should

Fig. 2. weeP26 IFM sarcomere ultrastructure as seen by TEM is

indistinguishable from the wild-type. Scale bars: 1 mm (white), 2 mm (black).

Fig. 3. MHC-GFP remains in the sarcomeric core

throughout IFM myofibrillogenesis. Obscurin staining

marks the M-line position. At 48 hrs APF the GFP-tagged

isoform occurs throughout the nascent A-band, including the

M-line region. At later ages, as the myofibrils grow laterally

(as seen by the growth of the M-line in the obscurin channel),

MHC-GFP remains in the sarcomeric core, while a gap

appears in the M-line region. Scale bar: 5 mm.

Switching Drosophila muscle myosin 141

Journ

alof

Cell

Scie

nce

only contain the Mhc-IFM19 mRNA. The amplification wasperformed using primers on the constitutive exons, flanking the

alternative exons, in order to detect all possible isoforms. For

each reaction, sequencing produced a single clean sequence,

showing that only one specific Mhc-IFM19 isoform is expressed

at 36 hrs APF. The sequence was compared to the knownsequence of the alternative exons. The comparison showed that

the translation of Mhc-IFM19 uses exons 3b, 7d, 9a, 11e and 15a,

the same profile as the adult Mhc-IFM18 isoform. Therefore the

only difference between the early Mhc-IFM19 and late Mhc-

IFM18 is in the choice to include, or not, exon 18, whichdetermines the C-terminal sequence.

All Drosophila Mhc isoforms are of virtually identical size. Asall MHC-19 isoforms in weeP26 are expected to be GFP-tagged,

there is sufficient size difference to differentiate between the

early MHC-IFM19-GFP and the untagged adult MHC-IFM18.

The accumulation of the two isoforms at different developmental

stages of homozygous weeP26 IFM was followed by western blot

(Fig. 5). However, even at 48 hrs APF, when MHC-IFM19 is

solely expressed, only a portion of the total MHC migrated to the

GFP-tagged band size on the gel, with the untagged MHC being

the major band. A western blot of larval muscles, which are

known to only express MHC-19 isoforms (Zhang and Bernstein,

2001), similarly showed that only a portion of MHC was tagged.

This can be explained by skipping of the GFP exon during

transcript splicing, which has been shown before for other weeP

lines (Clyne et al., 2003), or by proteolytic degradation of the

GFP-tagged C-terminal region of MHC-IFM19-GFP.

The IFM-specific MHC-associated protein flightin has been

implicated in A-band stability, as in its absence, thick filament

lengths are misregulated, and sarcomeres break down as a result of

contraction forces (Reedy et al., 2000). To examine whether MHC-

IFM19-GFP in weeP26 IFMs might be differently localised in the

absence of flightin, we crossed weeP26 to a flightin null mutant

stock (fln0). For these experiments, we isolated adult IFMs

immediately after eclosion, as flightin-null sarcomeres are known

to become damaged following contractions in the newly emerged

young adult. In flies with only one copy of flightin, the MHC-

IFM19-GFP pattern was very mildly affected. However, in the flies

lacking all flightin, MHC-IFM19-GFP was relocalised to the

entirety of the A-band (Fig. 6A). As MHC-IFM19-GFP is only

expressed during the early stages when the A-band core is formed,

this localisation suggests that in the absence of flightin the protein

diffuses freely within the A-band during development, rather than

remain confined to the foci in the sarcomeric core. This suggests

that flightin restricts MHC monomer exchange/diffusion in the

A-band.

Another possible explanation for the distribution of the GFP

signal in the weep26; fln0 sarcomere could be a cleavage of the

MHC-IFM19-GFP and re-binding of the GFP moiety throughout

the A-band. To ensure this was not the case, we probed western

blots of 72 hr AFP IFM with anti-GFP antibody and detected no

free GFP (not shown). Additionally expression of GFP in IFM of

Dmef2-GAL4 .UAS-eGFP flies showed no association of the GFP

with the sarcomeres. Furthermore, we explored the possibility that

the fln0 mutation affects the Mhc isoform switch using PCR, as a

very extended expression of the Mhc-IFM19-GFP mRNA could

Fig. 5. Only part of MHC is GFP-tagged in weeP26 muscles, as seen by

western blots stained for myosin. (A) IFM samples from different

developmental ages. Even at the earliest time-point of 48 hrs APF, when only

MHC-IFM19 is expressed, only a small fraction of the total MHC migrates to

the GFP-tagged size. In the later ages (n.e.5newly eclosed, 3 d53 day old),

the amount of GFP-tagged MHC is barely visible compared with untagged

MHC. (B) Samples from larval muscles, wild type, weeP26 and one lane of

50:50 mixed wild type:weeP26. Larval muscles solely express MHC-19

isoforms but in weeP26 larvae only a fraction of the MHC is GFP-tagged.

Fig. 4. Terminal exon splicing of IFM Mhc shifts mid-development,

giving rise to a different isoform. (A) RT-PCR scheme detecting the

presence or absence of exon 18 in Mhc cDNA derived from wild-type IFM

transcripts, by product size. (B,C) RT-PCR results according to scheme in

A show that in early sarcomeric assembly (36 hrs APF) only exon 19 is

detectable, whereas later (72 hrs) only exon 18 is detectable. The isoform

change begins around 48 hrs APF, where the expression of exon 19

diminishes, while that of exon 18 begins. Traces of exon 19 are also

detectable in the young adult IFM. Quantification of PCR bands (C) was done

with normalization against ribosomal protein 49 (rp49) as an endogenous

reference.

Journal of Cell Science 126 (1)142

Journ

alof

Cell

Scie

nce

also give rise to the observed pattern, irrespective of the function offlightin. The data (supplementary material Fig. S1) show that thechange in isoform expression in fln0 IFM is indeed delayed, but

only by 24 hrs to around 72 hrs APF. However, this shift does notsubstantially affect our conclusions. Our unpublished work (inagreement with the work of Reedy and Beall, 1993) shows that the72 hr timepoint is approximately half-way through sarcomere

assembly. The 24 hr delay in expression could cause the MHC-IFM19-GFP localisation at the sarcomeric core to be wider, but notto extend throughout the A-band as we have described here.

In order for flightin to restrict the MHC-IFM19-GFPdistribution to the sarcomeric core it would have to be expressedat least as late as the start of sarcomere widening, after 48–56 hrs

APF. Flightin is known to begin accumulating half-way throughpupation (Vigoreaux et al., 1993). However, the precise time of itsfirst localisation in the developing A-band has not been previously

reported. We therefore studied flightin localisation in thedeveloping IFM in an Sls-GFP genetic background, whichexpresses a GFP-tagged version of the Z-disk protein sallimus asa Z-disk marker. Flightin could be detected as early as 48 hrs APF,

localising at foci flanking the Z-disk (Fig. 6B). Since the IFM I-band is relatively narrow, and flightin is a myosin binding protein,this localisation would correspond to the edge of the nascent A-

band, at the region of the putative A-I junction. This is confirmedin weeP26 IFMs of the same age, where flightin can be clearly seenlocalising at the edge of the nascent A-band (Fig. 6C). During

intermediate developmental stages (56 and 72 hrs APF; Fig. 6B)flightin was also found in the A-I junction of the growingsarcomere, and since A-band thick filaments grow from their tips

(see earlier), this argues that the filaments are being ‘decorated’ byflightin as they grow. However, the pattern had also expandedtowards the M-line, with the latter expansion being more advancedat the sarcomeric core, than at the periphery. This shows that

flightin, which by the end of sarcomere development is found inalmost the entire A-band, for any given thick filament binds MHCin a progressive and possibly regulated manner, beginning at the

A-I junction, and from there extending towards the M-line. Ithowever appears to be excluded from the M-line itself, even in thefully developed adult samples.

To determine whether flightin binds both MHC-18 and MHC-19 isoforms indiscriminately, IFMs from a stock expressing onlyembryonic myosin (Wells et al., 1996), an MHC-19 isoform,

were stained for flightin (Fig. 6D). Despite the absence of MHC-IFM18 in these muscles, flightin was found localised throughout

the embryonic myosin A-bands. Flightin binding is therefore notrestricted to MHC-IFM18, but can occur with the embryonic

MHC isoform, which differs at all alternative Mhc exons fromboth adult IFM isoforms.

We have argued that flightin diminishes myosin motility within

the A-band. Such an effect should be demonstrable in weeP26

IFM, in the relative localisation of flightin and MHC19-IFM-GFP.

In the time following the switch from the fluorescent to the non-fluorescent myosin isoform, the portions of the A-band in which

flightin is already present should retain their fluorescence.Conversely, in the areas lacking flightin, the signal should

progressively weaken by turnover/exchange with the non-fluorescent myosin. For optimal comparison, average images of

the two localisation patterns were generated, and intensity plotswere drawn (Fig. 7). In the early stages (48 hrs APF) MHC-

IFM19-GFP fluorescence in the putative A-band is most intense inthe M-line region. This can be explained by new myosin molecules

being added laterally there to form new thick filament nuclei. Atthat time-point, flightin largely colocalises with a portion of the

fluorescence distal to the M-line. At 72 hrs APF, both localisationpatterns have expanded, reflecting the growth of the A-band bothin length and width, but the flightin pattern extends around that of

MHC19-IFM-GFP. This is due to the MHC isoform change thattakes place between 48 and 72 hrs APF, after which the A-band

extends (as seen by the flightin pattern) without a fluorescentmyosin. Besides its expansion in the growing part of the A-band,

the flightin pattern also expands towards the M-line, in the alreadyestablished part of the thick filaments, presumably by the addition

of new flightin molecules there. The MHC19-IFM-GFP signal,however, progressively weakens in the M-line region and its

surroundings (as seen by the intensity plots), where flightin is stillabsent. In young adults no GFP fluorescence is visible in the M-

line region, but the two MHC19-IFM-GFP foci flanking it remain.Even though by that time flightin has reached the area immediately

adjacent to the M-line, it is not early enough to rescue the GFPfluorescence there (for a schematic description of these events, see

Fig. 8). Overall, these observations show that the MHC19-IFM-GFP fluorescence appears unaltered in the sarcomeric regions

where flightin was already present at the time of the MHC isoformchange. We attribute this effect to flightin, which prevents

Fig. 6. Flightin localisation in the IFM, and its requirement for

the unique MHC-IFM19-GFP pattern of weeP26. (A) In the

absence of flightin, MHC-IFM19-GFP is not confined to the

sarcomeric core of IFM sarcomeres, as shown in weeP26

homozygote fln0 flightin null homozygote flies (right panel). In the

presence of one copy of flightin (middle panel), the GFP pattern is

only mildly disrupted. (B) Flightin localisation pattern shown in IFM

from the Sls-GFP line, which have GFP-tagged Z-disks. (C) Flightin

and MHC-IFM19-GFP colocalise at the edge of the weeP26 IFM

nascent A-band at 48 hrs APF. (D) Flightin is present throughout the

A-bands of embryonic-like sarcomeres ectopically generated in the

IFM of a fly expressing only ‘embryonic’ MHC; flightin can

therefore bind to both MHC-18 and -19 isoforms. The image is the

same size as B, was taken after eclosion, and shows multiple

sarcomeres laterally connected (as is typical of that muscle). Scale

bars: 5 mm (white), 1 mm (yellow).

Switching Drosophila muscle myosin 143

Journ

alof

Cell

Scie

nce

MHC19-IFM-GFP turnover and replacement by the non-tagged

MHC. We propose that one stabilising effect of flightin on the

thick filaments is a result of it reducing myosin monomer

exchange/turnover within the A-band.

DiscussionThe unique localisation pattern of fluorescent MHC in the IFM of

weeP26 flies argued for an unexpected alternate splicing pattern

of the inserted GFP exon, and the likely presence of an early IFM

MHC isoform (MHC-IFM19). We have confirmed that a novel

Mhc mRNA is produced in early IFM myogenesis, which

contains, except for exon 18, all of the alternate exons of the

previously well-described mRNA (Hastings and Emerson, 1991)

that encodes the major IFM MHC isoform (MHC-IFM18). This

agrees with an observation made by Suggs et al. (Suggs et al.,

2007), who previously detected an Mhc transcript lacking exon

18 in wild-type IFM. In weeP26, the inclusion of the GFP exon in

the MHC-IFM19 splice variant would generate the fluorescent

MHC-GFP signal in the IFM.

The MHC-GFP localisation pattern in weeP26 IFM could arise

either by a targeted localisation of the GFP-tagged isoform in the

sarcomere, or due to differences in timing of MHC isoform

expression and assembly during development. We have shown

here that in the wild-type expression of MHC-IFM19 mRNA

precedes that of the major isoform message (MHC-IFM18),

which itself appears as MHC-IFM19 mRNA is in decline. The

mRNAs for these isoforms are expressed almost mutually

exclusively. This suggests that at least part of the explanation

of the IFM MHC-GFP sarcomeric pattern in weeP26 flies is the

timing of expression of these MHC isoforms. The localisation of

MHC-GFP in the sarcomere leads to two general conclusions

about IFM A-band assembly. Firstly, the A-band assembles from

the core outwards. Once the initial thick filament core with a

defined nascent M-line centre is formed, further lattice growth

takes place by the sequential addition of thick filaments radially

around it. Secondly, once established, thick filaments elongate by

addition of myosin monomers to their tips, otherwise the GFP

foci in weeP26 IFM would be seen to progressively move away

from the M-line, or become irregular.

Transitions in myosin isoforms during development, such as

from embryonic and neonatal to adult myosin isoforms, have

been demonstrated in various vertebrate striated muscles, such as

rat (Whalen et al., 1981; Lyons et al., 1983, Weydert et al., 1987;

Lyons et al., 1990; LaFramboise et al., 1991; Hughes et al., 1993)

and chicken pectoral muscle (Taylor and Bandman, 1989). In the

latter case, individual thick filaments containing both neonatal

and adult isoforms were documented. However, such transitions

in vertebrates most likely represent remodelling rather than

functional isoform changes during de novo assembly of

individual sarcomeres, as each myosin isoform is capable of

making thick filaments alone. A different mechanism is found

during the myogenesis of Caenorhabditis elegans body wall

muscles, in which two myosin isoforms are found. These are

encoded by different genes, myosin A (myo-3) and myosin B

(unc-54) (Miller et al., 1983; Mackenzie et al., 1978). Both

isoforms are found in every thick filament in those muscles, with

the minor myosin A isoform restricted to the region of the bare

zone, and the major myosin B isoform present in the flanking

regions (Epstein et al., 1982; Miller et al., 1983). Epstein et al.

(Epstein et al., 1985) proposed that during thick filament

formation myosin A, along with other accessory proteins, forms

a nucleation core. Paramyosin then assembles on that core,

recruiting myosin B. This mechanism suggests that myosins A

and B have differing functions, with the former required for thick

filament nucleation, which is supported by the myosin A mutant

phenotype (Waterston, 1989). This is different, however, from

the case of IFM sarcomere assembly; as shown in the weeP26

IFM sarcomeres, there are regions where thick filaments contain

one or both MHC isoforms, so the advantage, if any, of using two

MHC isoforms in the assembly of individual thick filaments is

Fig. 7. Comparison of localisation pattern averages of MHC-IFM19-GFP and flightin (by antibody) at three different developmental ages. Average

images were generated by overlaying .50 individual confocal images. Intensity graphs compare the patterns between the two proteins, or of the same protein at

different developmental ages (intensities of the images or graphs do not represent absolute values due to the substantial differences in intensity between the

sampled ages, due to increasing protein accumulation). (a) After 72 hrs APF the MHC-IFM19-GFP pattern retains its position while in the M-line region the

fluorescence intensity progressively diminishes from the early to the late time-point. (b) The flightin pattern extends distally to the M-line with the growing thick

filament tips, while at the same time proximally towards the M-line on the already-established thick filaments, but never covers the M-line completely. (c,d,e) The

overlap of the MHC-IFM19-GFP and flightin patterns throughout the time-points (yellow shaded area on plots on the right) appears to define the area of the

characteristic GFP foci remaining in the adult weeP26 IFM. Scale bar: 2 mm.

Journal of Cell Science 126 (1)144

Journ

alof

Cell

Scie

nce

not clear, but may be required for normal A-band initiation and

assembly.

Our evidence is that IFM A-band establishment takes place

using an MHC isoform encoded by an mRNA that is identical to

the major IFM-specific MHC mRNA except for the exclusion of

exon 18. This makes exon 19 the terminally translated exon in the

early IFM isoform. Therefore, the early and late MHC isoforms

differ only in their C-termini, which are translated from either

exons 18 or 19. This suggests that the C-terminal polypeptide

sequence encoded by exon 19 is either essential for early

sarcomere assembly, or unable to sustain the specific function of

the adult IFM. Translation of exon 18 adds only a single residue

before the stop codon, whereas that of exon 19 produces a peptide

tail of 27 residues; the difference between the two isoforms can

be reduced to the inclusion (MHC-IFM19) or exclusion (MHC-

IFM18) of the peptide tail. In most members of the myosin II

protein family, the majority of the rod is a-helical with the

exception of the C-terminus, which is a random coil and is

frequently referred to as the ‘non-helical’ C-terminal tailpiece. In

Drosophila MHC the predicted helical region of the rod stops

within the first few amino-acids encoded by exon 19. Therefore,the non-helical tailpiece of the fly MHC is coded by exon 19, so

that MHC-19 molecules contain the non-helical tailpiece, butMHC-18 molecules lack it.

Even though regions in the myosin rod upstream of the tailpiece(light-meromyosin region and assembly-competent domain) have

been implicated in MHC dimerisation and thick filament formation(Sohn et al., 1997; Cohen and Parry, 1998), little is known aboutthe function of the tailpiece itself. So far, most of our knowledge

of it comes from non-muscle and smooth muscle myosins.Paracrystals of the two naturally occurring vertebrate smoothmyosin isoforms (SM1 and SM2), which have tailpieces of

differing sizes, show differences in thick filament packing (Rovneret al., 2002), suggesting that the tailpiece is involved in thickfilament polymerisation. In non-muscle myosin the tailpiece canpromote filament assembly (Hodge et al., 1992; Ronen and Ravid,

2009), while its removal affects the stability of in vitro rodassemblies either positively or negatively, depending on theisoform (Ronen et al., 2010). Conversely, some studies claim that

the tailpiece is not directly important for thick filament assemblyitself (Ikebe et al., 2001, Hoppe et al., 2003), but might be requiredfor stable positioning of the filaments in the sarcomere (Hoppe

et al., 2003).

Since the Mhc exon 18 is used only in some muscles [IFM, TDTand leg muscles; summarised in (Zhang and Bernstein, 2001)] theMHC expressed in most fly muscles will contain the exon 19

encoded tailpiece. The appearance of MHC-GFP throughout the A-band of weeP26 TDT (Fig. 1C) suggests that MHC-19 isoformsare also expressed in that muscle. However, the absence of the

tailpiece in the major IFM MHC isoform and its inclusion in anearly, relative minor MHC localised specifically only in the IFMA-band core argues that it may have a specific function. We cannot

exclude a modified proposal that initiation of thick filamentassembly during the earliest stages of IFM sarcomerogenesisrequires the presence of MHC with a tailpiece, but the assembly of

further thick filaments does not.

Wells et al. (Wells et al., 1996) ectopically expressed a wildtype embryonic Mhc transgene containing exon-19 in the IFMs ofan Mhc null strain (Mhc1) and showed that muscles assemble

normally, but progressively degenerate with use. This shows thatthe tailpiece does not prevent this myosin assembling into thickfilaments in the periphery of IFM sarcomeres. Swank et al.

(Swank et al., 2000) specifically addressed the importance of theembryonic versus adult myosin rod (Mhc exons 19 versus 18) inthe IFM, by expressing in Mhc null flies a transgenic construct

based on an embryonic Mhc cDNA, but containing genomicDNA (including introns) for exons 17-18-19. Splicing of thetransgene transcripts occurred in the IFMs to produce an exon 18containing message. This improved the IFM phenotype of the

embryonic (exon-19) Mhc construct seen by Wells et al. (Wellset al., 1996), by increasing stability and reducing degeneration inthe adult stages. Swank et al. (Swank et al., 2000) concluded that

the exon 18 terminus is important for the stability of the adultIFM sarcomeres. This might indeed suggest that the exon-19tailpiece might have a deleterious effect in the function of this

specialised muscle, so that it is absent from the later, major MHCisoform. Unfortunately whether the construct by Swank et al. alsoexpressed MHC containing exon 19 in the IFMs was not

determined, so the question as to whether an MHC with atailpiece is required for the initiation of A-filament assembly inthe IFM remains unresolved. Further transgenic experiments with

Fig. 8. Model schematic describing the proposed interaction of flightin

with the two myosin isoforms, based on the localisation of the proteins

during weeP26 IFM sarcomere development. Diagrams represent

transverse sections through the centres of sarcomeres at three developmental

timepoints. The two myosin isoforms are represented as blocks of different

colour, with green for MHC-IFM19-GFP and grey for MHC-IFM18. As thick

filaments grow, flightin is added in the proximity of the tips, while being

excluded from the very end of the tips by Sls (yellow lines), as suggested by

Ferguson et al. (Ferguson et al., 1994). At the same time, continuing from

regions of the thick filaments that already contain flightin, more flightin

molecules are added sequentially towards the M-line. During development, as

myosin isoform expression changes from MHC-IFM19-GFP (green) to MHC-

IFM18 (grey), all new thick filaments, as well as the growing portions of the

old ones, will contain the new isoform (grey). However, in the thick filament

portions that lack flightin (sarcomere middle in 72 hrs APF diagram), MHC-

IFM19-GFP is slowly replaced by MHC-IFM18. We propose that flightin

stabilises the portions of the thick filaments where it is bound, by inhibiting

this form of myosin molecule exchange. Representations are not

stoichiometrically accurate.

Switching Drosophila muscle myosin 145

Journ

alof

Cell

Scie

nce

an Mhc cDNA construct lacking exon 19 were beyond the scopeof the present study.

The MHC tailpiece could also affect myosin activity. The tail of

smooth muscle myosin can modulate contractility through itsbinding to the light-meromyosin region of adjacent myosins withina thick filament (Cai et al., 1995) and phosphorylation of residues

in the tailpiece of molluscan MHC reduces myosin ATPaseactivity (Kuznicki et al., 1985; Collins et al., 1982a; Collins et al.,1982b; Castellani and Cohen, 1987). It may be important to restrict

contractility during early sarcomere assembly.

In addition to the switch of MHC isoforms between 48 and72 hrs APF in IFM development shown here, other sarcomeric

proteins including troponin I, troponin T (Nongthomba et al.,2007) and sallimus (Burkart et al., 2007) each show an isoformswitch during a similar period of IFM myogenesis. All of theseswitches result from changes in alternate splicing patterns.

Sallimus (also known as Drosophila titin), an Ig-domain-containing elastic protein that links the Z-discs to the A-filamentends (Lakey et al., 1990; Kulke et al., 2001), has two IFM isoforms

localized differently within each sarcomere, with the shorter kettinfound throughout the Z-disc and the longer Sls(700) found only inthe Z-disk centre (Burkart et al., 2007). The latter isoform would

then be co-axial with the central MHC-IFM19 containing A-filaments, although there is no evidence linking the binding ofSls(700) to the MHC tailpiece. The isoform changes in sallimus,and the other proteins mentioned above, suggest a coordinated

regulation of alternate splicing after 40 hrs APF. It must reflecteither changes required for sarcomere assembly, changes in musclefunction during muscle development, as has been described in

vertebrates, or as a consequence of the evolutionary changes thatled to the specific muscle gene regulation programme of thesehighly specialised muscles.

The flightin localisation pattern during IFM sarcomereassembly has not previously been reported. Flightin is observedin the developing sarcomere as early as 48 hrs APF, beginning at

the A/I junction of the nascent A-band. The flightin pattern thenprogresses inwards towards the M-line. This localisation patternsuggests two independent processes by which flightin ‘decorates’thick filaments. Our evidence is that it first binds close to the A/I

junction, where thick filaments appear to be decorated as theygrow from their tips. The second process takes place beginningbehind the already decorated thick filament tips, and progresses

by the sequential addition of flightin to previously assembledregions of the thick filaments towards the M-line. This explainsthe concave shape of the flightin pattern across the myofibril

diameter at mid-development (see Figs 7, 8) as this processbegins earlier for the thick filaments in the core, and therefore themigration towards the M-line is more advanced there. Thisprocess may be due to a ‘domino’ effect of already-bound

flightin facilitating further flightin binding to more proximalneighbouring regions of the same thick filament. Flightinphosphorylation is not the enabling mechanism in this

progressive binding as phosphorylation occurs entirely post-eclosion (Vigoreaux et al., 1993). Note however that a visible gapremains in the M-line region, suggesting that flightin is excluded

from the bare zone. This agrees with immuno-EM studies of theflightin homologue (zeelin-2) in the IFMs of the water bugLethocerus indicus, where the protein was shown to be absent

from the bare zone (Ferguson et al., 1994; Reedy et al., 2000; Qiuet al., 2005). These authors also showed that flightin was absentfrom the very tips of the thick filaments of the A/I junction,

presumably due to the presence of the connecting filaments(consisting of sallimus and projectin) in that region (Ferguson et al.,

1994), though this is not resolvable in our work due to limitationsof confocal microscopy. The possible presence of the connectingfilaments in that region might argue for an interaction betweenthem and flightin, assisting the decoration of the thick filaments

with flightin as they grow. However, in the sarcomeric actin nullAct88FKM88, which lacks Z-disks and organised connectingfilaments, the scattered thick filaments are decorated with

flightin throughout (Reedy et al., 2000), suggesting that flightindecoration does not require interactions with the connectingfilaments.

In weeP26 flies homozygous for the flightin null mutant fln0,MHC-IFM19-GFP is found throughout the A-band rather thanbeing restricted to the core. In this situation the GFP-labelling ofthe A-filaments is much less intense than that observed in the

presence of flightin, which we interpret as indicating that theMHC-IFM19-GFP is mixed with the untagged MHC throughoutthe A-band, including regions normally assembled after MHC-

IFM19 expression has ceased. The simplest explanation is that inwild-type flies flightin binding restricts MHC to the locationwhere it is initially incorporated into a thick filament; in its

absence myosin molecules show ‘diffusion’, probably byundergoing rounds of incorporation/dissociation while thickfilament assembly continues. This is reflected in the fact thatthe MHC-IFM19-GFP pattern in weeP26 IFM appears to be

prevented from diffusing only in the areas where it co-localiseswith flightin (Fig. 7). Flightin is known to have a role in thestructural integrity of IFM sarcomeres since in fln0 null mutants

sarcomeres break during their earliest use (Reedy et al., 2000).Furthermore flightin appears to affect A-band assemblydynamics, as in its absence developing IFM sarcomeres are

thinner and longer (Reedy et al., 2000) and in newly eclosed fln0

null flies contain thick filaments with more variable and overallgreater lengths than wild type (Contompasis et al., 2010). We

propose that flightin has a role in IFM assembly, where it reducesboth thick filament association and dissociation rates of myosinmolecules, thereby regulating thick filament assembly kinetics.Such an effect would lead to an overall greater stability of the

IFM thick filaments, agreeing with previous proposals for flightinin enhancing thick filament stability, while regulating their length(Contompasis et al., 2010).

The results are consistent with the premyofibril model ofsarcomere assembly, insofar as myofibrils develop without anyformation of large pre-assembly complexes that are subsequently

stitched into the complete structure. However, there are a numberof fundamental differences between the IFMs and vertebratesarcomere assembly. Firstly, IFM sarcomeres grow individuallyand synchronously from the nascent myofibril stage all the way

to adulthood (Reedy and Beall, 1993). Secondly, Drosophila titinalso referred to as sallimus, is not long enough and lacksextensive homologous C-terminal domains to act as a half

sarcomere ruler protein such as proposed for vertebrate titin(reviewed in Trinick, 1996). Thirdly, the Drosophila genomedoes not include homologues to cytoplasmic intermediate

filament proteins (Goldstein and Gunawardena, 2000) so suchstructures and proteins cannot play a part in myogenesis. Finally,important processes such as lateral fusion of nascent myofibrils

to form more mature myofibrils and Z-disk splitting to introducenew sarcomeres, observed in vertebrate muscles and cells inculture (reviewed in Sanger et al., 2005) are not seen in the IFM

Journal of Cell Science 126 (1)146

Journ

alof

Cell

Scie

nce

(Reedy and Beall, 1993). The isoform transitions of MHC-IFM19

to MHC-IFM18 and of other proteins such as sallimus, highlight

the establishment of the sarcomeric core and its subsequentgrowth as two different steps – core assembly and peripheral

growth. We propose that these transitions reflect different

requirements between early nascent myofibril establishment

and later adult function of this specialist muscle.

Materials and MethodsFly strains/genes/culture conditions

The WeeP26 MHC-GFP stock (w1118; P[weeP 26]) was generated in the screen ofClyne et al. (Clyne et al., 2003). The transposon insertion location was confirmedby genomic sequencing using primers Plac1 (CACCCAAGGCTCTGCTCCCA-CAAT) and Pry4 (CAATCATATCGCTGTCTCACTCA) in conjunction with Mhc

exon 17 and 19 primers (described below). The flightin null stock fln0 (w; +; e fln0)was kindly provided by Dr Jim Vigoreaux (Reedy et al., 2000). The weeP26/fln0

stock was generated by crossing the weeP26 and fln0 stocks via a double balancer(w; CyO/If; MKRS/TM6,Tb), to yield double homozygotes (w; weeP26; e fln0).The Sls-GFP stock (w; +; P{PTT-un1}slsZCL2144; line G53 – Flytrap #ZCL2144;Morin et al., 2001) which has GFP-labelled Z-discs was used for the flightinlocalisation study. The Oregon-R wild-type strain (Bloomington Stock Center) wasused as wild-type control. For developmental staging, white pre-pupae witheverted spiracles (Bainbridge and Bownes, 1981) were removed into fresh vials at25 C (time 0 hrs after puparium formation – APF) and harvested at required time-points. Adult flies were selected as ‘newly eclosed’ between 0 and 8 hrspost-eclosion.

Immunostaining

Newly eclosed adult IFMs were dissected from bisected half thoraces in 4%paraformaldehyde (PF), incubated for 15 minutes, then washed with relaxingsolution (6 mM MgCl2, 5 mM EGTA, 5 mM ATP, 90 mM potassium propionate,20 mM NaPi, pH 7.0). For early IFM preparations, timed pupae were removedfrom their puparia and pinned by the head on dry Sylgard (Dow Corning), dorsalside down, and then submerged in 4% PF in PBS. After dissection along theventral midline unattached material was flushed gently away using a syringe toexpose the IFMs. These were detached and incubated in fixative for a further15 minutes, then transferred back to relaxing solution. The IFMs from bothdissections were permeabilised overnight in Triton-X/glycerol solution (50% v/vglycerol, 0.5% Triton X-100, 20 mM NaPi, 2 mM MgCl2, 1 mM EGTA, 5 mMDTT, pH 7.0) at 4 C, and then washed twice with relaxing solution. Primaryantibodies [anti-flightin rabbit polyclonal, (Reedy et al., 2000); anti-obscurin,rabbit polyclonal (Burkart et al., 2007); anti-kettin, MAC155, rat monoclonal(Lakey et al., 1990)] were applied overnight at 4 C. Muscles were washed twice,secondary antibodies were applied for 3 hrs, then the muscles were rinsed twiceagain. Image averages of the flightin localisation patterns in the IFM weregenerated in ImageJ (http://rsbweb.nih.gov/ij/), by cropping, exporting andmanually aligning single sarcomere images of identical size. Images werecompiled into a stack and their average was calculated using the Z-project tools.Intensity profiles were calculated using the ‘Plot Profile’ function, the valuesplotted in Microsoft Excel and further processed in CorelDraw.

Electron microscopy

The EM protocol largely followed that described by O’Donnell and Bernstein(O’Donnell and Bernstein, 1988). Adult half-thoraces were dissected in EMdissection buffer (100 mM sucrose, 10 mM sodium phosphate buffer, 2 mM EGTA,pH 7.2) and fixed overnight at 4 C in 3% paraformaldehyde, 2% glutaraldehyde inmodified (100 mM sodium phosphate) dissection buffer. Specimens were washed(63) in 100 mM sodium phosphate buffer pH 7.2, fixed for 45 minutes in 1%100 mM OsO4 on ice and washed (63) in phosphate buffer. Samples weredehydrated in an alcohol series, washed (63) in 100% ethanol and then inepoxypropane (62). Samples were infiltrated with mixtures of araldite resin andepoxypropane 25% (30 minutes) then 50% (overnight), before transfer to 100% andresin for 2 hrs at 37 C, followed by polymerisation for 48 hrs at 60 C. Samples weresectioned and post-stained with lead citrate before being examined, and images wererecorded in a FEI Tecnai 12 Bio Twin electron microscope.

RNA isolation and PCR

Muscles were dissected as described above in PBS containing protease inhibitors(Complete Mini EDTA-free, Roche, No. 04693159001) and mRNA was extracted(Qiagen RNeasy Mini kit, animal tissue protocol). For 36, 48, 72 hrs APF pupaeand newly eclosed flies, 40, 40, 20 and 10 sets of muscles were dissected,respectively (for further confirmation replicates were made separately). cDNAsynthesis was performed using the Stratagene First Strand cDNA Synthesis kit.RT-PCR was performed using primers GACGAACTCCTGAACGAAGC (exon 17forward) and TCAGGAGCAAGGTCGAATCT (Exon 19 reverse), multiplexed

with primers for the endogenous reference ribosomal protein 49 (forwardTCCTACCAGCTTCAAGATGAC, reverse GTGTATTCCGACCACGTTACA).Reactions were carried out using the Qiagen PCR Multiplex kit (No. 206143),using the program 95 C for 15 minutes, 30 or 34 cycles of 94 C for 30 seconds,57 C for 90 seconds and 72 C for 120 seconds, and final extension 72 C for5 minutes. PCR products were separated on 1.2% agarose gel and band intensitieswere calculated using GeneTools v 4.01 (Syngene). Relative band intensities werecalculated by dividing the intensity value of the Mhc bands with that of theendogenous reference. The exon profile of the early (36 hr APF) IFM MHCisoform was determined by sequencing the alternative exons of the 36 hr cDNAusing the following primers for the flanking constitutive exons; Exon 3 (MhcEx2F:CCAGTCGCAAATCAGGAG; MhcEx4R: CAGAGATGGCGAAAATATGG),Exon 7 (MhcEx5F: GGCTGGTGCTGATATTGAGA; MhcEx8R: TTGTACAGC-TCGGCGGTATCG), Exon 9 (MhcEx8F: CGATACCGCCGAGCTGTACAA;MhcEx10R: TCGAACGCAGAGTGGTCAT), Exon 11 (MhcEx10F: ATGACC-ACTCTGCGTTCGA; MhcEx12R: GATCTTGCCCAGACCCTCATC), Exon 15(MhcEx14F: CTCAAGCTCACCCAGGAGGCT; MhcEx16R: GGTCTCATCCA-GTTTCGACTG).

Western blotting

Adult and pupal IFM samples were dissected as above. Tissues were immediatelyplaced in loading buffer (312.5 mM Tris-HCl pH 6.8, 10% SDS, 0.5%bromophenol blue, 50% glycerol, 6 M urea) and denatured for 3 minutes at95 C. Samples were run on ‘loose’ agarose-reinforced acrylamide SDS gels(Tatsumi and Hattori, 1995), but with an acrylamide concentration of 3%. Proteinswere transferred for 3 hrs at 50 V. Membranes were stained for MHC (MAC147,rat monoclonal; Qiu et al., 2005).

AcknowledgementsWe would like to thank Sean Sweeney for his support and theweeP26 line, and Belinda Bullard, Kevin Leonard, Peter O’Toole,Meg Stark, Betsy Pownall and Adam Middleton for their suggestionsand help. Also, Dieter Furst, Jorg Hohfeld, Riga Tawo and Jan Daerrfor their support during the revision of this manuscript, and FarinazAfsari for help with western blots.

FundingThis work was partly funded by the EU FP6 network ‘MYORES’.

Supplementary material available online at

http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.110361/-/DC1

ReferencesAuber, J. (1969). La myofibrillogenese de muscle strie.1. Insectes. J. Microsc. 8, 197-

232.

Bainbridge, S. P. and Bownes, M. (1981). Staging the metamorphosis of Drosophila

melanogaster. J. Embryol. Exp. Morphol. 66, 57-80.

Bernstein, S. I., Mogami, K., Donady, J. J. and Emerson, C. P., Jr (1983).

Drosophila muscle myosin heavy chain encoded by a single gene in a cluster of

muscle mutations. Nature 302, 393-397.

Burkart, C., Qiu, F., Brendel, S., Benes, V., Haag, P., Labeit, S., Leonard, K. and

Bullard, B. (2007). Modular proteins from the Drosophila sallimus (sls) gene and

their expression in muscles with different extensibility. J. Mol. Biol. 367, 953-969.

Cai, S., Ferguson, D. G., Martin, A. F. and Paul, R. J. (1995). Smooth muscle

contractility is modulated by myosin tail-S2-LMM hinge region interaction. Am. J.

Physiol. 269, C1126-C1132.

Castellani, L. and Cohen, C. (1987). Myosin rod phosphorylation and the catch state of

molluscan muscles. Science 235, 334-337.

Clark, K. A., McElhinny, A. S., Beckerle, M. C. and Gregorio, C. C. (2002). Striated

muscle cytoarchitecture: an intricate web of form and function. Annu. Rev. Cell Dev.

Biol. 18, 637-706.

Clyne, P. J., Brotman, J. S., Sweeney, S. T. and Davis, G. (2003). Green fluorescent

protein tagging Drosophila proteins at their native genomic loci with small P

elements. Genetics 165, 1433-1441.

Cohen, C. and Parry, D. A. D. (1998). A conserved C-terminal assembly region in

paramyosin and myosin rods. J. Struct. Biol. 122, 180-187.

Collins, J. H., Cote, G. P. and Korn, E. D. (1982a). Localization of the three

phosphorylation sites on each heavy chain of Acanthamoeba myosin II to a segment at

the end of the tail. J. Biol. Chem. 257, 4529-4534.

Collins, J. H., Kuznicki, J., Bowers, B. and Korn, E. D. (1982b). Comparison of the actin

binding and filament formation properties of phosphorylated and dephosphorylated

Acanthamoeba myosin II. Biochemistry 21, 6910-6915.

Contompasis, J. L., Nyland, L. R., Maughan, D. W. and Vigoreaux, J. O. (2010).

Flightin is necessary for length determination, structural integrity, and large bending

stiffness of insect flight muscle thick filaments. J. Mol. Biol. 395, 340-348.

Switching Drosophila muscle myosin 147

Journ

alof

Cell

Scie

nce

Epstein, H. F., Berman, S. A. and Miller, D. M., III (1982). Myosin synthesis andassembly in nematode body wall muscle. In Muscle Development: Molecular and

Cellular Control. pp. 419-428. New York, NY: Cold Spring Harbor Laboratory Press.Epstein, H. F., Miller, D. M., 3rd, Ortiz, I. and Berliner, G. C. (1985). Myosin and

paramyosin are organized about a newly identified core structure. J. Cell Biol. 100,904-915.

Ferguson, C., Lakey, A., Hutchings, A., Butcher, G. W., Leonard, K. R. and

Bullard, B. (1994). Cytoskeletal proteins of insect muscle: location of zeelins inLethocerus flight and leg muscle. J. Cell Sci. 107, 1115-1129.

Fernandes, J., Bate, M. and Vijayraghavan, K. (1991). Development of the indirectflight muscles of Drosophila. Development 113, 67-77.

Furst, D. O., Osborn, M. and Weber, K. (1989). Myogenesis in the mouse embryo:differential onset of expression of myogenic proteins and the involvement of titin inmyofibril assembly. J. Cell Biol. 109, 517-527.

George, E. L., Ober, M. B. and Emerson, C. P., Jr (1989). Functional domains of theDrosophila melanogaster muscle myosin heavy-chain gene are encoded byalternatively spliced exons. Mol. Cell. Biol. 9, 2957-2974.

Goldstein, L. S. B. and Gunawardena, S. (2000). Flying through the drosophila

cytoskeletal genome. J. Cell Biol. 150, F63-F68.Hastings, G. A. and Emerson, C. P., Jr (1991). Myosin functional domains encoded by

alternative exons are expressed in specific thoracic muscles of Drosophila. J. Cell

Biol. 114, 263-276.Hodge, T. P., Cross, R. and Kendrick-Jones, J. (1992). Role of the COOH-terminal

nonhelical tailpiece in the assembly of a vertebrate nonmuscle myosin rod. J. Cell

Biol. 118, 1085-1095.Holtzer, H., Hijikata, T., Lin, Z. X., Zhang, Z. Q., Holtzer, S., Protasi, F., Franzini-

Armstrong, C. and Sweeney, H. L. (1997). Independent assembly of 1.6 micronslong bipolar MHC filaments and I-Z-I bodies. Cell Struct. Funct. 22, 83-93.

Hoppe, P. E., Andrews, R. C. and Parikh, P. D. (2003). Differential requirement forthe nonhelical tailpiece and the C terminus of the myosin rod in Caenorhabditis

elegans muscle. Mol. Biol. Cell 14, 1677-1690.Hughes, S. M., Cho, M., Karsch-Mizrachi, I., Travis, M., Silberstein, L., Leinwand,

L. A. and Blau, H. M. (1993). Three slow myosin heavy chains sequentiallyexpressed in developing mammalian skeletal muscle. Dev. Biol. 158, 183-199.

Ikebe, M., Komatsu, S., Woodhead, J. L., Mabuchi, K., Ikebe, R., Saito, J., Craig,R. and Higashihara, M. (2001). The tip of the coiled-coil rod determines thefilament formation of smooth muscle and nonmuscle myosin. J. Biol. Chem. 276,30293-30300.

Katzemich, A., Kreiskother, N., Alexandrovich, A., Elliott, C., Schock, F., Leonard,

K., Sparrow, J. and Bullard, B. (2012). The function of the M-line protein obscurinin controlling the symmetry of the sarcomere in the flight muscle of Drosophila.J. Cell Sci. 125, 3367-3379.

Kulke, M., Neagoe, C., Kolmerer, B., Minajeva, A., Hinssen, H., Bullard, B. and

Linke, W. A. (2001). Kettin, a major source of myofibrillar stiffness in Drosophilaindirect flight muscle. J. Cell Biol. 154, 1045-1057.

Kuznicki, J., Cote, G. P., Bowers, B. and Korn, E. D. (1985). Filament formation andactin-activated ATPase activity are abolished by proteolytic removal of a smallpeptide from the tip of the tail of the heavy chain of Acanthamoeba myosin II. J. Biol.

Chem. 260, 1967-1972.LaFramboise, W. A., Daood, M. J., Guthrie, R. D., Schiaffino, S., Moretti, P.,

Brozanski, B., Ontell, M. P., Butler-Browne, G. S., Whalen, R. G. and Ontell, M.

(1991). Emergence of the mature myosin phenotype in the rat diaphragm muscle.Dev. Biol. 144, 1-15.

Lakey, A., Ferguson, C., Labeit, S., Reedy, M., Larkins, A., Butcher, G., Leonard,K. and Bullard, B. (1990). Identification and localization of high molecular weightproteins in insect flight and leg muscle. EMBO J. 9, 3459-3467.

Lu, M. H., DiLullo, C., Schultheiss, T., Holtzer, S., Murray, J. M., Choi, J.,

Fischman, D. A. and Holtzer, H. (1992). The vinculin/sarcomeric-alpha-actinin/alpha-actin nexus in cultured cardiac myocytes. J. Cell Biol. 117, 1007-1022.

Lyons, G. E., Haselgrove, J., Kelly, A. M. and Rubinstein, N. A. (1984). Myosintransitions in developing fast and slow muscles of the rat hindlimb. Differentiation 25,168-175.

Lyons, G. E., Schiaffino, S., Sassoon, D., Barton, P. and Buckingham, M. (1990).Developmental regulation of myosin gene expression in mouse cardiac muscle. J. Cell

Biol. 111, 2427-2436.Mackenzie, J. M., Jr, Schachat, F. and Epstein, H. F. (1978). Immunocytochemical

localization of two myosins within the same muslce cells in Caenorhabditis elegans.Cell 15, 413-419.

Miller, D. M., 3rd, Ortiz, I., Berliner, G. C. and Epstein, H. F. (1983). Differentiallocalization of two myosins within nematode thick filaments. Cell 34, 477-490.

Morin, X., Daneman, R., Zavortink, M. and Chia, W. (2001). A protein trap strategyto detect GFP-tagged proteins expressed from their endogenous loci in Drosophila.

Proc. Natl. Acad. Sci. USA 98, 15050-15055.Nongthomba, U., Clark, S., Cummins, M., Ansari, M., Stark, M. and Sparrow, J. C.

(2004). Troponin I is required for myofibrillogenesis and sarcomere formation inDrosophila flight muscle. J. Cell Sci. 117, 1795-1805.

Nongthomba, U., Ansari, M., Thimmaiya, D., Stark, M. and Sparrow, J. (2007).

Aberrant splicing of an alternative exon in the Drosophila troponin-T gene affectsflight muscle development. Genetics 177, 295-306.

O’Donnell, P. T. and Bernstein, S. I. (1988). Molecular and ultrastructural defects in a

Drosophila myosin heavy chain mutant: differential effects on muscle functionproduced by similar thick filament abnormalities. J. Cell Biol. 107, 2601-2612.

Qiu, F., Brendel, S., Cunha, P. M. F., Astola, N., Song, B., Furlong, E. E. M.,

Leonard, K. R. and Bullard, B. (2005). Myofilin, a protein in the thick filaments of

insect muscle. J. Cell Sci. 118, 1527-1536.

Reedy, M. C. and Beall, C. (1993). Ultrastructure of developing flight muscle inDrosophila. I. Assembly of myofibrils. Dev. Biol. 160, 443-465.

Reedy, M. C., Bullard, B. and Vigoreaux, J. O. (2000). Flightin is essential for thickfilament assembly and sarcomere stability in Drosophila flight muscles. J. Cell Biol.

151, 1483-1500.

Reggiani, C., Bottinelli, R. and Stienen, G. J. M. (2000). Sarcomeric myosin isoforms:Fine tuning of a molecular motor. News Physiol. Sci. 15, 26-33.

Rhee, D., Sanger, J. M. and Sanger, J. W. (1994). The premyofibril: evidence for its

role in myofibrillogenesis. Cell Motil. Cytoskeleton 28, 1-24.

Ronen, D. and Ravid, S. (2009). Myosin II tailpiece determines its paracrystal structure,

filament assembly properties, and cellular localization. J. Biol. Chem. 284, 24948-24957.

Ronen, D., Rosenberg, M. M., Shalev, D. E., Rosenberg, M., Rotem, S., Friedler,

A. and Ravid, S. (2010). The positively charged region of the myosin IIC non-helicaltailpiece promotes filament assembly. J. Biol. Chem. 285, 7079-7086.

Rovner, A. S., Fagnant, P. M., Lowey, S. and Trybus, K. M. (2002). The carboxyl-terminal isoforms of smooth muscle myosin heavy chain determine thick filament

assembly properties. J. Cell Biol. 156, 113-124.

Sanger, J. W., Kang, S., Siebrands, C. C., Freeman, N., Du, A., Wang, J., Stout,

A. L. and Sanger, J. M. (2005). How to build a myofibril. J. Muscle Res. Cell Motil.

26, 343-354.

Schiaffino, S. and Reggiani, C. (1996). Molecular diversity of myofibrillar proteins:

gene regulation and functional significance. Physiol. Rev. 76, 371-423.

Schultheiss, T., Lin, Z. X., Lu, M. H., Murray, J., Fischman, D. A., Weber, K.,

Masaki, T., Imamura, M. and Holtzer, H. (1990). Differential distribution of

subsets of myofibrillar proteins in cardiac nonstriated and striated myofibrils. J. Cell

Biol. 110, 1159-1172.

Sohn, R. L., Vikstrom, K. L., Strauss, M., Cohen, C., Szent-Gyorgyi, A. G. and

Leinwand, L. A. (1997). A 29 residue region of the sarcomeric myosin rod isnecessary for filament formation. J. Mol. Biol. 266, 317-330.

Suggs, J. A., Cammarato, A., Kronert, W. A., Nikkhoy, M., Dambacher, C. M.,

Megighian, A. and Bernstein, S. I. (2007). Alternative S2 hinge regions of the

myosin rod differentially affect muscle function, myofibril dimensions and myosin

tail length. J. Mol. Biol. 367, 1312-1329.

Swank, D. M., Wells, L., Kronert, W. A., Morrill, G. E. and Bernstein, S. I. (2000).

Determining structure/function relationships for sarcomeric myosin heavy chain bygenetic and transgenic manipulation of Drosophila. Microsc. Res. Tech. 50, 430-442.

Tatsumi, R. and Hattori, A. (1995). Detection of giant myofibrillar proteins connectin

and nebulin by electrophoresis in 2% polyacrylamide slab gels strengthened withagarose. Anal. Biochem. 224, 28-31.

Taylor, L. D. and Bandman, E. (1989). Distribution of fast myosin heavy chainisoforms in thick filaments of developing chicken pectoral muscle. J. Cell Biol. 108,

533-542.

Trinick, J. (1996). Titin as a scaffold and spring. Cytoskeleton. Curr. Biol. 6, 258-260.

Vigoreaux, J. O. (2001). Genetics of the Drosophila flight muscle myofibril: a window

into the biology of complex systems. Bioessays 23, 1047-1063.

Vigoreaux, J. O., Saide, J. D., Valgeirsdottir, K. and Pardue, M. L. (1993). Flightin,a novel myofibrillar protein of Drosophila stretch-activated muscles. J. Cell Biol. 121,

587-598.

Waterston, R. H. (1989). The minor myosin heavy chain, mhcA, of Caenorhabditis

elegans is necessary for the initiation of thick filament assembly. EMBO J. 8, 3429-

3436.

Weiss, A. and Leinwand, L. A. (1996). The mammalian myosin heavy chain gene

family. Annu. Rev. Cell Dev. Biol. 12, 417-439.

Wells, L., Edwards, K. A. and Bernstein, S. I. (1996). Myosin heavy chain isoforms

regulate muscle function but not myofibril assembly. EMBO J. 15, 4454-4459.

Weydert, A., Barton, P., Harris, A. J., Pinset, C. and Buckingham, M. (1987).Developmental pattern of mouse skeletal myosin heavy chain gene transcripts in vivo

and in vitro. Cell 49, 121-129.

Whalen, R. G., Sell, S. M., Butler-Browne, G. S., Schwartz, K., Bouveret, P. and

Pinset-Harstom, I. (1981). Three myosin heavy-chain isozymes appear sequentially

in rat muscle development. Nature 292, 805-809.

Zhang, S. X. and Bernstein, S. I. (2001). Spatially and temporally regulated expression

of myosin heavy chain alternative exons during Drosophila embryogenesis. Mech.

Dev. 101, 35-45.

Journal of Cell Science 126 (1)148