Proc. Nat. Acad. Sci. USA 70 (1973)

Correction. In the article "Human Phosphoribosylpyro-phosphate Synthetase: Increased Enzyme Specific Ac-tivity in a Family with Gout and Excessive Purine Syn-thesis," by Becker, M. A., Kostel, P. J., Meyer, L. J. &Seegmiller, J. E., which appeared in the October 1973 issueof the Proc. Nat. Acad. Sci. USA 70, 2749-2752, Fig. 1, p.2750, was reproduced improperly by the printer. The figureand its accompanying legend are reprinted here. The inves-tigation described in the article, was supported by grantsAM 05646, AM 13622, and GM 17702 from the NationalInstitutes of Health.

FIG. 1. Immunoprecipitation analysis of the reaction betweenpurified human erythrocyte PP-ribose-P synthetase and rabbitserum. Center well contained 25 Al of 5000-fold purified normalPP-ribose-P synthetase (460 Mg/ml). Numbered wells containedthe following: wells 1 and 6, serum from immunized rabbits; wells2 and 5, serum from unimmunized rabbits; wells 3 and 4, IgGfractions from unimmunized and immunized rabbits, respectively.Double diffusion was done for 24 hr at 4°. Single precipitin bandsare noted only where outer wells contained immunoglobulin fromrabbits immunized with the purified enzyme.

Correction. In the article "Neutron Diffraction Structureof Melampodin: Its Role in the Reclassification of theGermacranolides," by Watkins, S. F., Fischer, N. H. &Bernal, I., which appeared in the August 1973 issue ofProc. Nat. Acad. Sci. USA 70, 2434-2438, the footnote atthe bottom of page 2437 should be deleted.

Correction. In the article "Nucleotide Modification In Vitroof the Precursor of Transfer RNATYr of Escherichia coli,"by Schaefer, K. P., Altman, S., and S611, D., which appearedin Part I of the December 1973 issue of Proc. Nat. Acad. Sci.USA 70, 3626-3630, the following correction should be made.On p. 3628, the top line of the second column should read,"...found next to the anticodon (U40). In mature tRNA (18),in addition.... "

FIG. 3. Peroxidase test on 129 morulae (magnification:X800). (a) Preimmunization serum 1:800; (b) antiserum againstF9, 1:800.

Correction. In the article "Surface Antigens Common toMouse Cleavage Embryos and Primitive TeratocarcinomaCells in Culture," by Artzt, K., Dubois, P., Bennett, D.,Condamine, H., Babinet, C. & Jacob, F., which appearedin the October 1973 issue of the Proc. Nat. Acad. Sci. USA70, 2988-2992, Fig. 3, p. 2991, was reproduced improperlyby the printer. It and its accompanying legend are re-

printed here.

On page 2990 (first sentence of text, right-hand column) ofthe same paper, the sentence, "Absorptions were performed at40 for 30 min with 1 volume of C' :2 volumes of cells to dilutedserum," should read, "Absorption8 were performed at 40 for30 min with 1 volume of packed cells to 2 volumes of dilutedserum."

Correction. In the article "Regulation of AcetylcholineReceptors in Relation to Acetylcholinesterase in Neuro-blastoma Cells," by Simantov, R. and Sachs, L., whichappeared in the October 1973 issue of Proc. Nat. Acad. Sci.USA 70, 2902-2905, on page 2902 the beginning of line 10 inthe second paragraph in Materials and Methods should read500 Ci/mol instead of 500 Ci/mmole. On p. 2905, the left handordinate of Fig. 6 should read "No. of acetylcholine receptors/cell (X 10-)" instead of (X 10-7).

b

3932 Corrections:

a

Vo.k"..'' 11

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Dow

nloa

ded

by g

uest

on

Mar

ch 2

7, 2

021

Proc. Nat. Acad. Sci. USA 70 (1973)

Correction. In the article "Human Phosphoribosylpyro-phosphate Synthetase: Increased Enzyme Specific Ac-tivity in a Family with Gout and Excessive Purine Syn-thesis," by Becker, M. A., Kostel, P. J., Meyer, L. J. &Seegmiller, J. E., which appeared in the October 1973 issueof the Proc. Nat. Acad. Sci. USA 70, 2749-2752, Fig. 1, p.2750, was reproduced improperly by the printer. The figureand its accompanying legend are reprinted here. The inves-tigation described in the article, was supported by grantsAM 05646, AM 13622, and GM 17702 from the NationalInstitutes of Health.

FIG. 1. Immunoprecipitation analysis of the reaction betweenpurified human erythrocyte PP-ribose-P synthetase and rabbitserum. Center well contained 25 Al of 5000-fold purified normalPP-ribose-P synthetase (460 Mg/ml). Numbered wells containedthe following: wells 1 and 6, serum from immunized rabbits; wells2 and 5, serum from unimmunized rabbits; wells 3 and 4, IgGfractions from unimmunized and immunized rabbits, respectively.Double diffusion was done for 24 hr at 4°. Single precipitin bandsare noted only where outer wells contained immunoglobulin fromrabbits immunized with the purified enzyme.

Correction. In the article "Neutron Diffraction Structureof Melampodin: Its Role in the Reclassification of theGermacranolides," by Watkins, S. F., Fischer, N. H. &Bernal, I., which appeared in the August 1973 issue ofProc. Nat. Acad. Sci. USA 70, 2434-2438, the footnote atthe bottom of page 2437 should be deleted.

Correction. In the article "Nucleotide Modification In Vitroof the Precursor of Transfer RNATYr of Escherichia coli,"by Schaefer, K. P., Altman, S., and S611, D., which appearedin Part I of the December 1973 issue of Proc. Nat. Acad. Sci.USA 70, 3626-3630, the following correction should be made.On p. 3628, the top line of the second column should read,"...found next to the anticodon (U40). In mature tRNA (18),in addition.... "

FIG. 3. Peroxidase test on 129 morulae (magnification:X800). (a) Preimmunization serum 1:800; (b) antiserum againstF9, 1:800.

Correction. In the article "Surface Antigens Common toMouse Cleavage Embryos and Primitive TeratocarcinomaCells in Culture," by Artzt, K., Dubois, P., Bennett, D.,Condamine, H., Babinet, C. & Jacob, F., which appearedin the October 1973 issue of the Proc. Nat. Acad. Sci. USA70, 2988-2992, Fig. 3, p. 2991, was reproduced improperlyby the printer. It and its accompanying legend are re-

printed here.

On page 2990 (first sentence of text, right-hand column) ofthe same paper, the sentence, "Absorptions were performed at40 for 30 min with 1 volume of C' :2 volumes of cells to dilutedserum," should read, "Absorption8 were performed at 40 for30 min with 1 volume of packed cells to 2 volumes of dilutedserum."

Correction. In the article "Regulation of AcetylcholineReceptors in Relation to Acetylcholinesterase in Neuro-blastoma Cells," by Simantov, R. and Sachs, L., whichappeared in the October 1973 issue of Proc. Nat. Acad. Sci.USA 70, 2902-2905, on page 2902 the beginning of line 10 inthe second paragraph in Materials and Methods should read500 Ci/mol instead of 500 Ci/mmole. On p. 2905, the left handordinate of Fig. 6 should read "No. of acetylcholine receptors/cell (X 10-)" instead of (X 10-7).

b

3932 Corrections:

a

Vo.k"..'' 11

Proc. Nat. Acad. Sci. USAVol. 70, No. 12, Part I, pp. 3626-3630, December 1973

Nucleotide Modification In Vitro of the Precursor of Transfer RNATYrof Escherichia coli

(ribothymidine, pseudouridine biosynthesis/cleaved precursor substrate)

K. P. SCHAEFER*, S. ALTMANt, AND D. SOLLt

Kline Biology Tower, Yale University, New Haven, Connecticut 06520

Communicated by J. G. Gall, August 20, 1973

ABSTRACT Certain nucleotides in precursor RNAof tRNATYr of Escherichia coli were modified in vitro with apreparation of partially purified E. coli enzyme containingribothymidine- and pseudouridine-forming activity. Theonly nucleotides modified in vitro are the same as thosefound modified in mature tRNA. The best substrate forthese modifying enzymes is the RNase P cleavage productof the precursor RNA, which contains the mature tRNAsequence. Of the two pseudouridines found in maturetRNA, one (in the T4(C sequence) can be formed in intactprecursor RNA. The other (in the anticodon stem) canonly be formed in the cleaved precursor RNA. The presenceof modified nucleotides in the precursor RNA does notenhance its rate of cleavage by RNase P.

Among cellular RNAs, transfer RNA (tRNA) is unique in itshigh content of various modified nucleotides (1). Isopentenyla-denosine (iPA) in tUNA may affect the interaction of tRNAwith ribosomes (2, 3), and certain methylated bases in tRNAmarkedly increase the rate of aminoacylation (4). Somepseudouridines (4) in tRNA play a role in the regulation ofthe synthesis of amino-acid biosynthetic enzymes (5).

Transcription of tRNA genes is followed by specific cleavageof a larger precursor (6-10). We have used the precursor mole-cule to a tRNATYr of Escherichia coli (7, 8), in which somenucleotide modifications are absent and some present in lowamounts, the in vitro RNase P product derived from it (8, 11),and the mature tRNATYr,T to study in vitro the biosynthesisof ribothymidine, pseudouridine, and (methylthio)isopen-tenyladenosine. We also investigated the relationship betweenmodification and cleavage of precursor tRNA by RNase P.

MATERIALS AND METHODS

Bacterial Strains. E. coli MRE 600 (RNase I-) was thesource of all enzymes. E. coli BF 266 (12) was the host for in-fection by bacteriophage t80 psu3+ A25 (13) used in prepara-tion of tRNATYr precursor.

Abbreviations: T, ribothymidine; P, pseudouridine; iPA, N8(A2-isopentenyl)adenosine; Gm, 2'-O-methylguanosine; S4U, 4-thiouridine; Np, 3'-phosphomonoester of the nucleoside N.* Present address: Labor fuer Genetik, Universitaet Konstanz,BRD-7750 Konstanz, West Germany.t To whom reprint requests may be addressed.t Precursor RNA is an RNA molecule 128 nucleotides long con-

taining, internally, the primary sequence of E. coli tRNATYrSU3 + mutant A25 (8). Cleaved precursor RNA is the RNAmolecule 87 nucleotides long derived from precursor by cleavagewith RNase P. The 5'-end of the product of this reaction beginswith the tRNATYr su3+ mutant A25 sequence. Mature tRNA istRNATYr from su3 + mutant A25.

3626

Bacteriophage Strains. Mutant A25 of bacteriophage N80SU3+ has been described (13). This strain carries two mutationsin the structural gene for tyrosine tRNA and was used in thepreparation of tRNATNr precursor.

Chemicals and Reagents. S-Adenosyl i,[methyl-Cm4imethio-nine (specific activity 50 Ci/mol) and carrier-free [82p]_orthophosphate were obtained commercially. T1 and T2ribonucleases were obtained from Sankyo Co., Tokyo. Ribo-nuclease A and deoxyribonuclease (free of ribonuclease) werepurchased from Worthington. E. coli isopentenylpyrophos-phate:tRNA transferase (EC 2.5.x.x) (20) was a gift of Dr. J.Bartz.tRNA TYr SU3+ A25 and Precursor to tRNATYr SU3+ A26

were prepared as described (11) in 20- or 40-ml batches inshaking culture flasks instead of bubbler tubes, which did notaffect the yield. After the precursor was extracted from gels,precipitated, and suspended in water, it was dialyzed exten-sively against glass-distilled water or buffer [20mM Tris - HClpH 8-10 mM MgCl2] to remove salts coprecipitating inethanol. Precursor dialyzed in this manner is much less sus-ceptible to contaminating ribonuclease activity found inpreparations of modification enzyme. Mature tRNATYr andother RNAs used as mobility markers were extracted from thesame gels used to prepare precursor. Unfractionated E. colitRNA used as carrier was a gift of Dr. B. F. C. Clark.RNase P Was Prepared from 10-g quantities of frozen E.

coliMRE 600 cells and assayed as described (11).For Preparation of RNase P Cleavage Product, which lacks

the first 41 nucleotides from the 5'-end of the precursor mole-cule, dialyzed precursor was incubated with RNase P puri-fied through the DEAE-Sephadex step, as described (11). Ifa less pure ribosomal wash fraction was used as the source ofRNase P, it was dialyzed before use to prevent simultaneousmethylation of the substrate.

Preparation of an Enzyme Fraction Containing Uracil tRNATransmethylase, Other Transmethylase Activities, and Pseu-douridine-Forming Activity. The methods used were based onthose developed by Johnson et al. (14). Method A: E. coliMRE600 was grown in rich medium to stationary phase, harvested,and quickly frozen. 30 g of cells was ground with 60 g of alu-mina (all operations were done at 40). The paste was extractedwith 100 ml of 20 mM Tris HCI (pH 8)-10 mM MgC12-20mM 2-mercaptoethanol and centrifuged for 20 min at20,000 X g. The resulting supernatant was centrifuged for 2hr at 100,000 X g. The high-speed supernatant was made 1%in streptomycin sulfate, stirred for 15 min, and centrifugedfor 10 min at 27,000 X g. The resulting supernatant wasfractionated by ammonium sulfate precipitation. The 33-

Modification of Precursor tRNA 3627

47% saturation precipitate was collected by centrifugationand dissolved in 20 ml of 20 mM Tris * HC1 (pH 7.8)-i mMMgCl2-20 mM mercaptoethanol-10% (v/v) glycerol. Thissolution (about 20 ml) was dialyzed overnight against a largevolume of column buffer [10 mM Tris HC1 (pH 8.9)-5 mMMgCl2-1 mM EDTA-10% (v/v) glycerol] and then appliedto a DEAE-cellulose column (2 X 30 cm) equilibrated withthe same buffer. The column was washed with 200 ml ofcolumn buffer and then with the same volume of this buffercontaining 0.1 M NaCl. Relatively little protein was washedoff during these steps. The bulk of the protein, together withthe uracil tRNA transmethylase, was eluted by washing with300 ml of column buffer containing 0.3 M NaCl. Fractions of5 ml were collected every 5 min. The peak of enzymaticactivity lagged slightly behind the peak of protein concentra-tion. The peak fractions of enzymatic activity were pooled andsubjected to ammonium sulfate precipitation. The 40-60%saturation pellet was dissolved in 3 ml of column buffer anddialyzed extensively against 1 liter of this buffer. The enzymewas stored at -20° in 50% glycerol. The uracil-tRNAmethylase is stable under these conditions for at least 6months. This protein fraction (designated modification en-zyme) contained various modifying enzyme activities. Max-imum specific activity of enzyme preparations obtained bythis method was 30 mU/mg. One enzymatic unit transfers1 Mmole of methyl group onto unfractionated Mycoplasma sp.Kid tRNA (at 10 A260 units/ml of assay solution) per min.

Method B: This method is similar to method A but with thefollowing exceptions: (a) After alumina was removed from thecell lysate, RNase-free DNase was added to a final concentra-tion of 1 gg/ml and the mixture was incubated for 30 min at40. After centrifugation for 4 hr at 100,000 X g, the upperthree-quarters of the supernatant were taken. The subsequentstreptomycin step was omitted and ammonium sulfate frac-tionation was done as in method A. (b) An additional elutionstep with column buffer containing 0.2M NaCl was performedduring DEAE-cellulose chromatography. Most protein waseluted in this step and the levels of RNase activity was gen-erally reduced in all fractions. The specific activity of uraciltRNA transmethylase so prepared was 160 mU/mg. Fig. 1shows the elution profile of the DEAE-cellulose column.The significant difference between these two methods is

that there is little pseudouridine-forming activity in the 0.3M NaCl eluate from the DEAE-cellulose column of methodB preparations.

Uracil tRNA Transmethylase Activity Was Assayed ac-cording to Johnson et al. (14) with Mycoplasma sp. Kid tRNA(gift of Margaret Edson) as substrate and S-['4C]adenosyl-methionine as methyl donor.

Nucleotide-Sequence Analysis of Radioactive RNA. Themodified or unmodified radioactive RNAs were examined bytwo-dimensional chromatography (15,16).

Modified Nucleosides in tRNA Were Identified by two-di-mensional thin-layer chromatography of the 3'-mononucleo-tides produced by ribonuclease T2 hydrolysis of RNA (14, 17).The nucleotide content was determined quantitatively byscraping the areas containing radioactive material fromcellulose plates after two-dimensional chromatography andcounting the samples in a liquid scintillation counter. Molaryield of Tp, for example, is calculated by summing all radio-

E

E.2

0CO

0

1:0I

-VC5.a'6 0

00

4 3-I

0

. .

1 0 WashFraction number

PIG. 1. DEAE-cellulose chromatography of modificationenzymes by method B. The dialyzed 33-47% ammonium sulfatesulfate fraction in column buffer was loaded on a DEAE-cellulosecolumn (1.5 X 15 cm) and washed with the same buffer that alsocontained 0.1 M NaCl. Consecutive washing steps were per-formed; the NaCl concentration was raised first to 0.2 M and thento 0.3 M. Protein concentration in the peak fractions (A). UraciltRNA transmethylase activity (0). +± 4 indicates that the cor-responding protein peak contained ,6-forming activity; -,indicates that no activity was found. We checked RNase activity(-) by incubating about 2.5 X 104 cpm of precursor for 30 minin incubation buffer and measuring acid-insoluble radioactivity.

activity found in the Tp, Up, and 41p spots and normalizingthis number to the theoretically expected number of molesof Up, determined from the primary sequence of the substrateused. The fraction of radioactivity in the Tp spot then givesthe molar amount of all Up modified to Tp. Analyses of T2hydrolysates of intact precursor, tRNA, or cleaved precursoryielded slightly higher values for minor base content than didthe corresponding analysis of T1 oligonucleotides containingthese bases.

Modification Reactions with tRNA Precursor, Cleaved Pre-cursor Product, and tRNA were done in 0.5 ml of incubationbuffer [0.1 M Tris HCl pH 8-5 mM MgCl2-6 mM 2-mer-captoethanol plus 1.5 X 106 cpm of S-[14C]adenosylmethio-nine], containing 0.05-0.75 mg of modification enzyme proteinand variable amounts of substrate. The substrate in any re-action mixture was precursor, cleaved precursor, or maturetRNA in radiochemical quantities (104-106 cpm) with addedcarrier RNA usually present in not more than 0.5 A260 unit perreaction (an excess of carrier up to 10 A260 units/0.5 ml hadno effect on the activity of uracil tRNA transmethylase).The mixture was incubated for 2 hr at 370, and the reactionwas stopped by addition of an equal volume of redistilled,water-saturated phenol. After it was shaken, the aqueouslayer was removed and the phenol phase was extracted oncewith half the original volume of water. The combined aqueousphases were dialyzed for 5 hr at room temperature againstbuffer [0.05 M Na-citrate pH 5.3-0.2M NaCl-0.01 M MgCl2]and then overnight either against glass-distilled water or in-cubation buffer without 2-mercaptoethanol. The samples

Proc. Nat. Acad. Sci. USA 70 (1973)

3628 Biochemistry: Schaefer et al.

A UG AC AC -G CpC*G UU G A85

pppG * CAGGCCAGUAAAAGCAUUACCCG * CU * AiG * CG - CeoU *AG C

5G * C

G C

G5AG CU G A DAMum-u~~~e-u7G

C

70CC U A A

GG G ,, ..

C 60iu

AAG AG U55

T4

20 GCcc ACOG

4

30A-U C

GC A u

Ace U40-* 50C AU A- i6A35CuA

FIG. 2. Primary sequence of E. coli tRNATYr precursordrawn in a hypothetical secondary structure. Nucleotides foundmodified in the mature tRNA are indicated with their modi-fications. The uncertainty in the identity of the 3'-terminalnucleotide has been removed and is shown correctly in thisdiagram (24; J. D. Smith, personal communication).

were lyophilized and then prepared for nucleotide analysis orchromatography.

RESULTSIn vivo modification of precursor and tRNAPrecursor extracted from phage-infected cells is partiallymodified with 41, and tRNA extracted from these cells is notfully modified. The following bases are modified: (numberingis from the 5'-end of the tRNA sequence) U63 modified to T;U64 modified to 4'; A38 modified to i6A (Fig. 2). The positionof the 41 modification is the same as reported (8). No 4' is

TABLE 1. In vivo levels of modified nucleotides in precursortRNA5.,TYr A25 and tRNA.UTYr A25

Modified Molar yield

nucleotide Precursor" tRNAb

i6Ap 0.24(0.06-0.50) 0.32(0.04-0.63)Tp 0.37(0.13-0.70) 1.04 (1.0 -1.13)Op 0.67(0.24-1.07) 1.28(1.13-1.47)Gm 0 0S4U 0 Traces

Precursor and tRNA were isolated and analyzed. Molaryields of modified nucleotides were calculated from knownprimary sequences. The average value of the ratio T: 4P for 15precursor preparations was 0.57 with a standard deviation of0.14. Part of the variability in molar yields may be due to varia-tion in specific activity of individual triphosphates during thebrief labeling period in different experiments. Ranges are given inparentheses.

a Average of 15 preparations.b Average of four preparations.

found next to the anticodon (U40).Tn mature tRNA (18). Inaddition to the above modifications, U8,9 are found as s4U,G17 is found as Gm, and U40 is found as 4'. The extent of modi-fication was estimated by total enzymatic hydrolysis of theRNAs followed by two-dimensional chromatography andautoradiography. The molar yields of various nucleotides arelisted in Table 1. The precursor totally lacks Gm and s4U,but contains i6A, T, and q4 in partial molar yields, whereasmature tRNA contains significantly higher levels of i6A, T,and 4', and traces of S4U. Undermodification of the maturetRNA may be due to disruption of some tertiary structure inthe tRNA mutants studied (19), or saturation of host modifi-cation enzymes by the large amount of RNA substrate pro-duced in phage-infected cells.The amount of i6A, T, and 4' found in precursor varies

somewhat in different preparations. While the molar yieldof i6A is usually low and shows no obvious-correlation withthat of any other modified nucleotide, we find consistently a

ratio of T: 4, close to 0.60, regardless of variation in absolutemolar yields of these nucleotides. This result suggests thatmodification of these two adjacent nucleotides (U63, U64) isinterrelated in vivo. This relation between modification levelsof these two nucleotides need not be preserved in vitro.

In vitro modification

Properties of Modifying Enzyme Preparations. Before use

with tRNATYr or its precursor as substrate, the E. colimodification enzyme was characterized with respect to itsability to form T in Mycoplasma sp. Kid tRNA, since thistRNA contains no ribothymidine (14). The formation of T inthis tRNA was linear with respect to time for at least 1 hr at370 with modification enzyme made by method A or B (Fig.3A). Because the precursor is a "natural" substrate for andextremely sensitive to certain nucleases, modification enzymewas also tested for its ribonuclease activities. Contaminating

0)co0CL 1.1

00

.C- 0.1

0

m 8 0.10 o

CM,,EE O.:O-

"0 20 40 60 80 100 120-

80

0)40 2:

20 X) 4,

c10

'80

7= 60- -_

-6, 40 ^40

co20B

, 0 20 40 60 80 100 120Minutes

FIG. 3. (A) Characteristics of method B modification enzyme.Transmethylase activity (A). Degradation of precursor (0) andcleaved precursor (0). (B) Characteristics of endogenous nucleasein method A modified enzyme. Susceptibility of precursor (0),cleaved precursor (0), and tRNATYr (A) to endogenous RNaseattack was measured. Control incubation with precursor (A)showed no degradation when enzyme was omitted.

Co , ,, ,, 14(

.8

64 71l - 4

7 A

v_ Ad . A- -A --

Proc. Nat. Acad. Sci. USA 70.(1978)

C65

A

LA.

Modification of Precursor tRNA 3629

ribonucleases in modification enzyme prepared by methodA appear to be more active on precursor than on maturetRNA or cleaved precursor (Fig. 3B). This result suggeststhat the ribonuclease activity is similar to that released fromribosomes washed in 0.5 M ammonium chloride (11). WhenS-100 fraction is prepared in a manner that minimizes ribo-somal disruption and contamination (method B), ribonu-clease activity is much reduced (Fig. 3A). Despite variouslevels of ribonuclease activity in different preparations ofmodification enzyme, the results of in vitro modification ex-periments were invariant (Table 2). Although modificationenzyme prepared by method A contained more nuclease activ-ity than the method B enzyme, we used it in some experimentsbecause the {/-forming activity was more active in this prepa-ration. To reduce the possibility that ribonuclease reaction endproducts (oligonucleotides or undialyzed mononucleotides)interfered with our results, the precursor, after incubationwith modification enzyme, was purified on polyacrylamide-gelelectrophoresis. The nucleotide composition of this in vitromodified, reisolated precursor was compared with that fromprecursor that had only been dialyzed after modification; nodifference was observed.Formation of Ribothymidine and Pseudouridine In Vitro.

Three substrates-precursor tRNA, the RNase P cleavageproduct of the precursor containing the tRNA primary se-quence, and mature tRNA-were used for modification invitro. After incubation with modification enzyme, the RNAswere analyzed. The results revealed in all cases an increasein Tp and V/p, compared to untreated precursor. With precur-sor as substrate, the level of Tp was raised significantly(Table 2) with any preparation of modification enzyme, butnever to more than 75% of U63. However, with either cleavedprecursor or mature tRNA as substrates, complete methyla-tion could be achieved with either method A or method Benzyme. In vitro modification with method B enzyme, whichcontains very little /-forming activity, resulted in completemethylation of U63, while modification of U64 to 4' was in-complete. This result suggests that in vitro the uracil tRNAtrans-methylase and the 164-forming activity are not underobligatory interrelated control since they are separable andcan function independently (Fig. 1).

Modification enzyme prepared by method A can form abouttwo 4' residues per molecule in cleaved precursor but only oneV/ in intact precursor (Table 2). In contrast, method B en-zyme in combination with the 0.2 M NaCl fraction can formonly one 4', even in the cleaved precursor. Nucleotide analysisof oligonucleotides, obtained by T1 RNase digestion of themodified RNAs, revealed that only A64 was formed by methodB modification enzyme when the 0.2 M NaCl fraction wasadded to it. This result suggests that there is a difference inreactivity of the two uridines in tRNATYr that can be modifiedto 4. The existence of different enzymatic activities forming 4'at different sites in tRNA has been shown in S. typhimurium(5). In our experiments the enzyme responsible for formationof !'40 was no longer present in the DEAE-cellulose eluates inmethod B. Since the precursor contains only Vc4 while themature tRNA contains both k64 and V140, it seemed plausiblethat the pseudouridine site next to the anticodon (U40) be-comes reactive only after the precursor is cleaved. To investi-gate this possibility, precursor and cleaved precursor, beforeand after treatment with modification enzyme (method A),

TABLE 2. In vitro modification of precursor tRNA..,TYrA25, cleaved precursor, and tRNA.,TYr A225

Modi-Modi- fiedfication nule- Cleavedenzyme otide Precursor tRNA Precursor

Method ATp 0.2a 0.44b 0.9a 1. 03b 0.2a.* 1.04bVtp 0.35- 0.56 1.3 - 1.81 0.35- 1.9

Method BTp O.70a 0.77b o.7a 0.98b6&p 0.80 -0.85 0.8 0.95

Precursor, tRNA, and cleaved precursor were isolated andanalyzed. Results of single representative experiments areshown. In Method A, precursor and cleaved precursor were fromthe same preparation, but tRNA was from a different prepara-tion. Molar yields of i6A were in all cases unchanged after in-cubation with modification enzyme, since no isopentenyl pyro-phosphate was added. Enzyme prepared by Method B (containingonly U63 tRNA transmethylase) was used together with the 0.2M NaCl wash from the DEAE-cellulose column to include Vt64-forming activity.

a Molar yields of modified nucleotides determined in in vivomodified RNAs (i.e., before in vitro incubation with modificationenzyme).

b Molar yields determined after in vitro incubation with modi-fication enzyme.

contain 41 (according to the sequence of mature tRNATYr)were checked for the presence of this modified nucleoside.When intact precursor was analyzed, no ,, was found next tothe anticodon (1'4o) either before or after incubation withmodification enzyme. In contrast, cleaved precursor after in-cubation with the enzyme, contained V/ both in the anticodonloop (l,40) and adjacent to T (V164) but nowhere else. Thus, theenzyme forming V/ next to the anticodon only acts after theprecursor has been cleaved at the 5'-end to mature tRNA size.The enzymatic activity converting U40 to '1'40, as assayed in anS-100 fraction of method A, decreases markedly within a weekof its preparation.No nucleotides in the first 41 nucleotides from the 5'-end

of the precursor ever get modified. This has been shown byanalysis of intact precursor and by examination of the 41 nu-cleotide fragment after treatment with modification enzyme.

Introduction of Isopentenyladenosine into tRNATYr Precursor.The precursor is already modified in vivo and contains i6A inlow molar yields (Table 1). In an attempt to isopentenylateintact precursor in vitro, the RNA was incubated with par-tially purified E. coli isopentenyl: tRNA transferase and [3H ]-isopentenylpyrophosphate. After hydrolysis and chromatog-raphy of the reaction mixture, the spot in the chromatogramcorresponding to the mobility of i6A was assayed for both 32pand 3H radioactivity. From the specific activities we calculatedthat a maximum of 0.03 mol of additional i6A per substratemolecule was formed. In addition to i6Ap, the spot isolatedfrom the thin-layer chromatogram contains the 2-methylthioderivative of i'Ap (Agris, P. F., Schaefer, K. & Armstrong, D.,unpublished). The low yield of the isopentenylation of pre-cursor in vitro, the low amounts of this nucleotide isolatedfrom preparations of precursor in vivo, and the high level of

were digested with T1 RNase. The oligonucleotides that should this modification in mature tRNA suggest that cleaved pre-

Proc. Nat. Acad. Sci. USA 70 (1973)

3630 Biochemistry: Schaefer et al.

cursor may be the most favored substrate for the isopentenyl:tRNA transferase. We have not performed the isopentenyla-tion of cleaved precursor in vitro, but the enzyme preparationused here (20, 25) and others (21) can efficiently modify i6A-deficient E. coli tRNATYr, rat-liver tRNASer (20, 25) andseveral M1ycoplasma tRNAs (20, 25).

Level of Nucleotide Modification Affects RNase P Cleavage ofPrecursor tRNA. The presence of modified nucleotides, albeitin low molar yields, in precursor isolated in vivo suggests thatthese nucleotides may play a role in tRNA biogenesis. Al-though RNase P can cleave precursor (8), we investigatedthe action of RNase P on precursor containing various levelsof modified nucleotides. We anticipated that if rare nucleo-tides facilitated this cleavage step in tRNA biogenesis itwould be observable as a rate effect in vitro.

Part of a preparation of precursor was incubated withmodification enzyme. Nucleotide analysis showed that thelevels of T and 4V in the treated substrate had increased about20%, from initial values of 0.69 and 0.8, respectively. Boththe untreated and treated precursor were then exposed toRNase P. The rate of reaction, which was linear for about 40min at 370, was measured by quantitation of the reisolatedsubstrate and products." The data (not shown) indicatedthat treated substrate is attacked at a rate about 65% of thatof untreated substrate. This result, which was reproducedwith different precursor preparations, shows that the velocityof the RNase P reaction must be several-fold greater withtotally unmodified than with the modified precursor. Bothsubstrates used in our experiments are fully susceptible toRNase P, since in longer incubation both are cleaved com-

pletely by this enzyme.

DISCUSSION

We have shown that intact precursor tRNATYr and its RNaseP cleavage product, containing the tRNA primary sequence,

can serve as substrates for enzymatic activities capable ofmodifying uridine to ribothymidine or pseudouridine andadenosine to isopentenyladenosine in vitro. These reactionsappear to be as specific in vitro as they are in vivo, since onlythose nucleotides found modified in the mature tRNA are

modified in vitro. We were unable to demonstrate formation of2'-O-methylguanosine in vitro. Tertiary structure of the RNAmight be important in determining enzyme specificity for thismodification (19).

Precursor tRNA contains within it the primary sequence ofthe cleaved precursor and the mature tRNA. Since the rate ofreaction of our modifying enzyme preparation with these twosubstrates is very different, it appears that secondary or

tertiary structure is an important factor in determining theserates. In particular, stoichiometric yields of ribothymidineand both pseudouridines are found only with the cleavedprecursor as substrate. Like mature tRNA, this RNA is alsomuch more resistant to a contaminating nuclease found in our

partially purified preparations of modifying enzyme.

Since cleaved precursor appears to be the best, but not theonly, substrate for these nucleotide modifications, we propose

that the low levels of modified bases in intact precursor are

simply a reflection of the different reaction equilibria of modi-fication enzymes with intact or cleaved precursor as substrates.The equilibria for each substrate must vary for different modi-fications such that Gm, for example, is found not at all inintact precursor, whereas k64 is found in molar yields some-

times as high as 1.0. Similarly I'40 can be produced in vitro

only in cleaved precursor, by. an enzymatic activity that ap-pears to be quite distinct from the one responsible for the t64modification. Since high levels of nucleotide modification in-terfere with the RNase P reaction, we conclude that cleavageof precursor is a very early event in tRNA biogenesis and thatthe rare nucleotides, as suggested (8), serve no prerequisiterole in specific cleavage of precursor tRNA.Many different functions for modified nucleotides in tRNA

have been proposed (2-4). In a mutant of S. typhimu-rium (5, 22), the loss of two pseudouridines in the anticodonregion of tRNAHiS and tRNALeU led to derepression of the cor-responding aminoacid-synthesizing enzymes. However, nototal loss of function of tRNA in protein biosynthesis has beenshown with any undermodified tRNA and, in fact, E. colimutants lacking ribothymidine in all tRNA species (23) areviable. It appears, therefore, that the absence of any one ofthe modified nucleotides in tRNA may only marginally re-duce the capacity of tRNA to function in translation duringprotein biosynthesis.

We thank Ms. Virginia Warner for expert technical assistance.K.P.S. was a Postdoctoral Fellow of the Deutsche Forschungs-gemeinschaft. This work was supported by Grants GM-15401and GM-19422 from the United States Public Health Service,GB-36009X from the National Science Foundation, E-626 fromthe American Cancer Society, and an American Cancer Societygrant to Yale University.

1. S611, D. (1971) Science 173, 293-299.2. Fittler, F. & Hall, R. H. (1966) Biochem. Biophys. Res.

Commun. 25, 441-446.3. Gefter, M. L. & Russell, R. L. (1969) J. Mol. Biol. 39, 145-

157.4. Roe, B., Michael, M. & Dudock, B. (1973) Nature, in press.5. Singer, C. E., Smith, G. R., Cortese, R. & Ames, B. N.

(1972) Nature New Biol. 238, 72-74.6. Burdon, R. H. (1971) Progr. Nucl. Acid Res. Mol. Biol.

11,33-79.7. Altman, S. (1971) Nature 229, 19-20.8. Altman, S. & Smith, J. D. (1971) Nature New Biol. 233,

35-39.9. McClain, W. H., Guthrie, C. & Barrell, B. (1972) Proc.

Nat. Acad. Sci. USA 69, 3703-3707.10. Wilson, H. J., Kim, J. S. & Abelson, J. N. (1972) J. Mol.

Biol. 71, 547-556.11. Robertson, H. D., Altman, S. & Smith, J. D. (1972) J. Biol.

Chem. 247, 5243-5251.12. Primakoff, P. & Berg, P. (1970) Cold Spring Harbor Symp.

Quant. Biol. 35, 391-396.13. Smith, J. D., Barnett, L., Brenner, S. & Russell, R. C.

(1970) J. Mol. Biol. 54, 1-14.14. Johnson, L., Hayashi, H. & S6ll, D. (1970) Biochemistry 9,

2823-2831.15. Sanger, F. & Brownlee, G. G. (1967) in Methods in Enzy-

mology, eds. Colowick, S. P. & Kaplan, N. 0. (AcademicPress, New York), Vol. 12A, pp. 361-381.

16. Barrell, B. G. (1971) in Proc. Nucl. Acid Res., eds. Cantoni,G. L. & Davis, D. R. (Harper and Row, New York), Vol. 2,pp. 751-779.

17. Nishimura, S. (1972) Prog. Nucl. Acid Res. Mol. Biol. 12,50-86.

18. Goodman, H. M., Abelson, J. N., Landy, A., Zadrazil, S. &Smith, J. D. (1970) Eur. J. Biochem. 13, 461-483.

19. Anderson, K. W. & Smith, J. D. (1972) J. Mol. Biol. 69,349-356.

20. Bartz, J. & Soll, D. (1972) Biochimie 54, 31-39.21. Rosenbaum, N. & Gefter, M. L. (1972) J. Biol. Chem. 247,

5675-5680.22. Allaudeen, H. S., Yang, S. K. & S611, D. (1972) FEBS Lett.

28, 205-208.23. Bjork, G. R. & Isaksson, L. A. (1970) J. Mol. Biol. 51,

83-100.24. Loewen, P. C. & Khorana, H. G. (1973) J. Biol. Chem., 248,

3489-3499.25. Bartz, J. (1973) Ph.D. thesis, Yale University.

Proc. Nat. Acad. Sci. USA 70 (1978)