Nup124p Is a Nuclear Pore Factor of Schizosaccharomyces pombe That Is Important for Nuclear

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/99/$04.0010

Aug. 1999, p. 5768–5784 Vol. 19, No. 8

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Nup124p Is a Nuclear Pore Factor of Schizosaccharomyces pombeThat Is Important for Nuclear Import and

Activity of Retrotransposon Tf1DAVID BALASUNDARAM,1 MICHAEL J. BENEDIK,2 MARY MORPHEW,3 VAN-DINH DANG,1

AND HENRY L. LEVIN1*

Laboratory of Eukaryotic Gene Regulation, National Institute of Child Health and Human Development, NationalInstitutes of Health, Bethesda, Maryland,1 Biochemical and Biophysical Sciences, University of Houston,

Houston, Texas,2 and Department of Molecular, Cellular, and Developmental Biology,University of Colorado, Boulder, Colorado3

Received 12 February 1999/Returned for modification 25 March 1999/Accepted 27 April 1999

The long terminal repeat (LTR)-containing retrotransposon Tf1 propagates within the fission yeast Schizo-saccharomyces pombe as the result of several mechanisms that are typical of both retrotransposons andretroviruses. To identify host factors that contribute to the transposition process, we mutagenized cultures ofS. pombe and screened them for strains that were unable to support Tf1 transposition. One such straincontained a mutation in a gene we named nup124. The product of this gene contains 11 FXFG repeats and isa component of the nuclear pore complex. In addition to the reduced levels of Tf1 transposition, the nup124-1allele caused a significant reduction in the nuclear localization of Tf1 Gag. Surprisingly, the mutation innup124-1 did not cause any reduction in the growth rate, the nuclear localization of specific nuclear localizationsignal-containing proteins, or the cytoplasmic localization of poly(A) mRNA. A two-hybrid analysis and an invitro precipitation assay both identified an interaction between Tf1 Gag and the N terminus of Nup124p. Theseresults provide evidence for an unusual mechanism of nuclear import that relies on a direct interactionbetween a nuclear pore factor and Tf1 Gag.

Retroviruses and long terminal repeat (LTR)-containingretrotransposons possess similar methods of propagation thatinclude the conversion of their mRNA into cDNA by reversetranscriptase (RT) and the insertion of this double-strandedDNA into the host genome by integrase (IN). Because reversetranscription occurs in the cytoplasm, the preintegration com-plexes (PIC) of cDNA and IN must be transported into thenucleus for integration to occur. Nuclear pore complexes(NPC) are assemblies of more than 50 proteins that providethe means for selective passage of proteins and nucleic acidsbetween the cytoplasm and the nucleus (55, 58). Althoughsignificant progress has been made describing the families oftransport factors that deliver nuclear localization sequence(NLS)-containing proteins to the nucleus (13, 21, 51, 53, 65),the current models of nuclear import do not directly addresshow macromolecules as large as virus complexes pass throughthe nuclear pore.

The length and diameter of the transport channel have beenmeasured by testing nucleoplasmin-coated gold particles ofvarious sizes for the ability to pass through the nuclear pore.The maximum diameter of the channel was found to be 20 to25 nm, and this passage extends approximately 50 nm acrossthe nuclear envelope (15, 46). Large macromolecular sub-strates that must in some form pass through the NPCs in intactnuclear envelopes include the 50-nm virus particles of simianvirus 40 (SV40) (24, 49, 70), the 90-nm particles of adenovirus(24, 60), and the 160S PIC of human immunodeficiency virus(HIV). Although the adenovirus particles attach to the NPCand disassemble before the transport of the DNA-protein VII

complex, SV40 appears to pass through the NPC as virionparticles (25, 49, 70). The nuclear import of the HIV PICreflects not only the presence of NLS activity in matrix and INbut also the unusual b-karyopherin-like properties of Vpr (8,17, 18, 28, 30, 54, 61, 62). Recent evidence suggests that theimport of the HIV PIC in nondividing cells relies on an inter-action between Vpr and specific nuclear pore factors that con-tain FXFG motifs (16, 61).

It is interesting that the passage of retroviruses through theNPCs is not thought to be important in dividing cells, becauseretroviruses may readily access the host genome after break-down of the nuclear envelope. Nevertheless, the IN of aviansarcoma virus possesses efficient NLS activity that contributesto virus replication (34, 35). In addition, the retrotransposonsof Saccharomyces cerevisiae and Schizosaccharomyces pombemust travel through NPCs to access the nucleus because thenuclear envelopes of these organisms do not breakdown duringmitosis.

Although these examples of large transport substrates indi-cate that multiple mechanisms may exist to allow their import,little is known about the principal activities required for thesemechanisms. Because LTR-containing retrotransposons pro-duce large virus-like particles (VLPs) and because these trans-posons propagate in yeast, the genetic analysis of transpositionmay reveal whether specialized host activities are required forthe nuclear import of large transposon complexes. In addition,the extensive similarity between retroviruses and LTR-contain-ing retrotransposons suggests that any information relevant tothe import of transposon complexes may lead to a better un-derstanding of retrovirus import. Recent studies of Ty1 trans-position in S. cerevisiae revealed that IN contains a bipartiteNLS that is required for Ty1 transposition (33, 47). Althoughthese results constitute important first steps in the understand-ing of the nuclear transport of retrotransposon proteins, little

* Corresponding author. Mailing address: Laboratory of EukaryoticGene Regulation, National Institute of Child Health and Human De-velopment, NIH, Bethesda, MD 20892. Phone: (301) 402-4281. Fax:(301) 496-8576. E-mail: [email protected].

5768

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

is known about what components of the NPC contribute to Ty1import.

The fission yeast S. pombe contains Tf1, an active LTR-retrotransposon that expresses functional copies of Gag, pro-tease (PR), reverse transcriptase (RT), and integrase (IN)proteins (39, 41). The transposition activity of a neo-markedcopy of Tf1 can be monitored in vivo, and as many as 4% of thecells induced for transposition receive Tf1 insertions (40). Al-though Tf1 possesses an unusual self-priming mechanism forthe initiation of reverse transcription (36–38), the other aspectsof its reverse transcription and integration appear to model thegeneral properties of LTR retroelements (2, 3, 39–41). Theresults of sucrose gradient fractionation and blotting tech-niques indicate that extracts of S. pombe cells induced fortransposition contain large Tf1 particles composed of Gag, RT,IN, Tf1 mRNA, and Tf1 cDNA (3, 37, 40).

To search for host factors that contribute to Tf1 function, wemutagenized cultures of S. pombe and screened for strains thatwere unable to support Tf1 transposition. We identified amutation in a host gene that lowered Tf1 transposition by12-fold without reducing the levels of reverse transcription.Immunofluorescence microscopy indicated that this mutationalso caused a significant reduction in the nuclear localization ofTf1 Gag. We named this host gene nup124 (nuclear pore factorof 124 kDa) because this protein localized to the nuclear en-velope and because the hypothetical coding sequence included11 copies of the FXFG repeat that is present in a large familyof nuclear pore factors. The mutant allele of nup124 caused noalterations in growth rates or in the nuclear localization ofother proteins examined. The results of two-hybrid analysesand glutathione S-transferase (GST) precipitation assays de-tected an interaction between Tf1 Gag and Nup124p. This

evidence indicates that Nup124p possesses a specialized activ-ity required for the nuclear import of Tf1 complexes.

MATERIALS AND METHODS

Media and growth of S. pombe strains. The S. pombe minimal liquid and platemedia were composed of EMM (2). For growth rate determinations, overnightcultures in EMM complete plus vitamin B1 were diluted to an optical density at600 nm (OD600) of 0.05 in fresh medium (50 ml). Growth of all S. pombe strainswas conducted at 32°C unless otherwise stated. To examine temperature sensi-tivity, strains were grown on plates incubated at 16, 20, 25, 37, and 42°C. Theyeast strains used in this study are listed in Table 1.

Plasmid constructions. Many DNA fragments used to create plasmids for thisstudy were generated by PCR. To avoid complications due to the inadvertentcreation of mutations by the polymerases, we used the high-fidelity enzymesTurbo Pfu (Stratagene) and Deep Vent (New England Biolabs). In addition, theplasmids that were generated with PCR products were created in duplicate fromindependent PCRs and the properties of each plasmid were studied in parallel.

The HA-tagged allele of nup124 included a double copy of the HA epitopethat was inserted into a BclI site introduced at the N terminus of the codingsequence in plasmid pHL1587-18. To create a FLAG-tagged version of Gag, thesequence encoding 10 amino acids of Tf1 Gag in pHL1258 was replaced bycreating a NaeI restriction site near the sequence encoding the C terminus ofGag. The NaeI site was created within a product of fusion PCR by using oligo-nucleotides HL211 and HL212 for the NaeI site. Using two complementaryoligonucleotides, HL220 and HL221, a 24-bp DNA fragment encoding theFLAG epitope was cloned into the newly created NaeI site to generate pHL1276.

A mutation in Xenopus nucleoplasmin within the bipartite NLS amino acidswas created by fusion in the context of the green fluorescent protein (GFP)-nucleoplasmin fusion protein. A 1.3-kb BamHI-MscI fragment encoding thewild-type nucleoplasmin NLS, KKAGQAKKKK (pREP-GFP-Nucleoplasmin,[Table 2]), was replaced by a similar fragment containing the mutated NLSKKAGQANNKK to create pHL1769 (Table 2). The 1.3-kb region generated byPCR containing the mutation was confirmed by sequence analysis. This mutatedversion of the nucleoplasmin NLS has been previously reported to inhibit nuclearimport (57).

A mutation from cytosine to thymine in the wild-type nup124 sequence wascreated by fusion PCR to re-create the nup124-1 allele. A 2.6-kb AvrII-NcoIfragment containing the wild-type nup124 in pHL1338-3 (Table 2) was replaced

TABLE 1. Yeast strains

Strain Genotype Strain/Plasmid Source or reference

461 h1 ade6-210 hist3-1D ura42 D 18 leu1-32 Parent/no plasmid 52912 h2 ura4-294 leu1-32 Parent/no plasmid J. Boeke 21X52965 h2 ura4-294 leu1-32 912/pSP1 This study972 h2 ura4-294 leu1-32 912/pSp2 411282 h2 ura4-294 leu1-32 912/pHL449-1 371836 h2 ura4-294 leu1-32 912/pHL490-80 31858 h1 ura4-D18 leu1-32 ade6-m210 1605/pHL449-1 This study1554 h2 ura4-294 leu1-32 912/pHL476-3 374990 h2 ura4-294 leu1-32 1836/pSP1 This study4992 h2 ura4-294 leu1-32 1554/pSP1 This study5533 h2 ura4-294 leu1-32 1282/pSP1 This study5750 h2 ura4-294 leu1-32 nup124-1 Parent/no plasmid This study5754 h2 ura4-294 leu1-32 nup124-1 5750/pHL449-1 This study5895 h2 ura4-294 leu1-32 912/pHL1276 This study6061 h2 ura4-294 leu1-32 nup124-1 5754/pSP1 This study6106 h2 ura4-294 leu1-32 nup124-1 5754/pHL1338-3 This study6110 h2 ura4-294 leu1-32 nup124-1 5754/pHL1288 This study6136 h2 ura4-294 leu1-32 pHL1342:leu1 nup124-1 Stable leu1 integrant of pHL1342 in 5750 This study6404 h2 ura4-294 leu1-32 1282/pHL1343-1 This study6405 h2 ura4-294 leu1-32 1282/pHL1344-1 This study6406 h2 ura4-294 leu1-32 nup124-1 5754/pHL1343-1 This study6407 h2 ura4-294 leu1-32 nup124-1 5754/pHL1344-1 This study6569 h2 ura4-294 leu1-32 nup124-1 5750/pHL1276 This study6565 h2 ura4-294 leu1-32 nup124-1 5750/pFL20 This study6566 h2 ura4-294 leu1-32 912/pFL20 This study6576 h2 ura4-294 leu1-32 912/1587-18 This study6577 h2 ura4-294 leu1-32 912/1587-18 (independent transformant of 6576) This study6620 h2 ura4-294 leu1-32 nup124-1 6136/pHL449-1 This study6876 h1 ade6-210 his3-1 D ura4-D18 leu1-321

nup124::pk1(3) GFP SV40 poly(A) ura41Integration of the pk1(3) GFP SV40 poly(A) ura41

tag at the C-terminal end of Nup124 in strain 461This study

EGY48 Mata ura3 his3 trp1 3LexAop-leu2 S. cerevisiae strain used as a two-hybrid host 20

VOL. 19, 1999 THE NUCLEAR IMPORT OF A RETROTRANSPOSON 5769

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

by a fusion PCR fragment containing the mutated nup124-1 recreated sequenceto form pHL1678 (Table 2). The sequence generated by fusion PCR containingthe mutation was confirmed.

Integration of GFP into the C terminal of the nup1241 product by homologousintegration gene tagging. A construct designed to contain the 39 end of thenup124 open reading frame (ORF), pK1 antigen (three repeats), GFP gene,SV40 poly(A) signal and ura41 marker followed by sequence after the nup124stop codon was generated by PCR with HL613 and HL614 (Table 3) as primersand pCS2pkSu (Table 2) as template. The PCR-generated fragment was used totransform S. pombe 461 (Table 3). Stable ura41 transformants were microscop-ically examined for GFP fluorescence. Integration of the nup124-3pk1-GFP-ura41 construct into the nup locus in single copy was verified by Southern blotanalysis. Strains carrying the genomically tagged nup124 were then processed forimmunoelectron microscopy.

Immunoelectron microscopy. Cells were prepared for electron microscopy byfreeze-substitution fixation after rapid freezing by previously published methods(12). The anti-GFP antibodies (the kind gift of Jason Kahana and Pam Silver)were diluted 200-fold in blocking buffer, and sections mounted on grids werefloated overnight on a 20-ml drop of this solution (12, 67). The grids were thenrinsed in buffered saline and treated with goat anti-rabbit immunoglobulin la-beled with 10-nm-diameter colloidal gold (12, 67).

Molecular and genetic techniques. Strains to be tested for transposition andcDNA recombination were treated as previously described (2, 11).

The levels of Tf1 cDNA and protein in cells induced for transposition weremeasured by DNA blot analysis and Western analysis, respectively (2).

Mutagenesis of S. pombe YHL1858. The parent strain YHL1858 was subjectedto mutagenesis with ethyl methanesulfonate (EMS) as described by Moreno etal. (48). The mutagenized culture exhibited 16% viability compared to the cellsnot treated with EMS. The same preparation of cells was plated on EMM 2 uramedium to generate colonies of cells that contained the Tf1-neoAI plasmid. Wescreened 2,500 of these colonies for reduced transposition activity by the Tf1patch assay.

Construction of an S. pombe genomic library. Genomic DNA was isolatedfrom the wild-type strain 972 in 500 ml of YES medium. The DNA was subjectedto partial digestion with Sau3A after having established the optimal conditionsfor the fractionation of a population corresponding to 4 to 6 kb. Sau3A created39 overhang ends that were partially filled in with dATP and dGTP by usingKlenow enzyme. The resulting DNA was inserted into the vector pHL1288.

The polylinker and the nmt1 sequence of the multicopy plasmid pREP3 (45)were excised with PstI and SacI and replaced with a 48-base polylinker fragmentcomposed of HL199 and HL200, GCAACTAGTTCAGATCTTAGTCGACCGATGTATAAGGATCCCTGAGCT, containing the restriction sites PstI, SpeI,BglII, SalI, BamHI, and SacI. pHL1288 was linearized with SalI followed bypartial filling-in of the first two nucleotides with dCTP and dTTP by usingKlenow. The genomic DNA digested with Sau3A was ligated into pHL1288overnight at 16°C.

TABLE 2. Plasmids

Plasmid Description Source or reference

pAF1 Contains the S. pombe his3 gene 52pSP1 S. pombe ars1 vector with the S. cerevisiae LEU2 10pSP2 S. pombe ars1 vector with the S. cerevisiae URA3 10pREP3 leu-1 selectable multicopy plasmid 45pFL20 S. pombe vector with ARS and stabilization fragment 44pGH54 Used to make a neo probe 31pJK148 Integrating vector containing complete sequence of the leu1 gene of S. pombe 32pHL449-1 neoAI-marked version of Tf1 in a ura4 selectable plasmid 37pHL476-3 Tf1-neoAI with frameshift in IN 37pHL481 Integration vector This reportpHL490-80 Tf1-neoAI with frameshift in PR 3pHL1258 449-1 with a unique NgoMI site in Gag used to insert the FLAG epitope This reportpHL1276 pHL1258 with a FLAG sequence inserted into the NgoMI site This reportpHL1288 Genomic library plasmid This reportpHL1335 Genomic library DNA insert in pHL1288 suppressing the nup124-1 defect This reportpHL1336 Genomic library DNA insert in pHL1288 suppressing the nup124-1 defect This reportpHL1337 Genomic library DNA insert in pHL1288 suppressing the nup124-1 defect This reportpHL1338-3 Genomic library DNA insert in pHL1288 suppressing the nup124-1 defect This reportpHL1339-2 Genomic library DNA insert in pHL1288 suppressing the nup124-1 defect This reportpHL1342 pHL481containing a 4.4-kb SpeI-BamHI nup124 fragment from pHL1335 This reportpHL1343-1 pHL 1338-3 with a framshift mutation of nup124 This reportpHL1344-1 pHL1338-3 with a 3.97-kb deletion in nup124 This reportpHL1346 pHL1338-3 with a 4.22-kb deletion in nup124 This reportpHL1469-2 PCR-generated BclI site at the ATG of nup124 ORF in pHL1339-2 This reportpHL1470-6 PCR-generated BaclI site at the ATG of nup124 ORF in pHL1339-2 This reportpHL1471-2 pHL1469-2 amplified in a dam bacterial strain, DM1 This reportpHL1472-6 pHL1470-6 amplified in a dam bacterial strain, DM1 This reportpHL1572 pHL1472-6 containing a his3 gene in the place of the nup124 ORF This reportpHL1587-18 HA epitope inserted into the nup124 coding sequence in pHL1471-2 This reportpGEX-6P-1 GST fusion expression plasmid PharmaciapHL1613-4 pGEX-6P-1 containing full-length Gag This reportpHL1623-1 pGEX-6P-1 containing N-terminal portion of nup124 This reportpHL1622-1 pGEX-6P-1 containing C-terminal portion of nup124 This reportpHL1678 PCR-generated nup124-1 mutation, cytosine to thymine in pHL1338-3 This reportpREP-GFP-

NucleoplasminLeu2 selectable marker, nmt1 promoter drives transcription of GFP fusion to

Xenopus nucleoplasmin which contains a bipartite NLS sequenceKKAGQAKKKK

4

pHL1769 Nucleoplasmin NLS, KKAGQAKKKK in pREP-GFP-Nucleoplasmin, was re-placed by a similar fragment containing the mutated NLS KKAGQANNKK

This report

pSGP502-SV40 Leu1 selectable marker, nmt1 promoter drives transcription of GFP fused to lacZ;contains SV40 large T antigen NLS sequence MAPKKKRKV

S. G. Pasion and S. Forsburg

pSGP502-SV40mut pSGP502-SV40 in which the SV40 large T antigen NLS sequence MAPKKKRKVwas mutated to MAPKEKDKV

S. G. Pasion and S. Forsburg

pCS2-KSu Contains pk1(3) GFP SV40 poly(A) ura4 used as template to generate by PCR anintegration tag nup124::pk1(3) GFP SV40 poly(A) ura41

C. Troxell and J. R. McIntosh

5770 BALASUNDARAM ET AL. MOL. CELL. BIOL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

TABLE 3. Oligonucleotides

Oligonucleotide Sequence (59-39) Use

HL446 atgtgtaggttaagtgatcaaggcgtaatcaggcacatcatatgggtaggcgtaatcaggcacatcatatgggtacatcaatacaaactcatcgacaactac

PCR with HA epitope

HL211 tgaaacatttgttttctttgggccggcaaacttattgtttttccaattg Bottom-strand oligonucleotide creates a unique NgoMI restrictionsite in gag in pHL1258

HL212 caattggaaaaacaataagtttgccggcccaaagaaaacaaatgtttca Top strand oligonucleotide creates a unit NgoMI restriction site ingag in pHL1258

HL220 gactacaaggacgacgatgacaag To generate a 24-bp DNA fragment encoding the FLAG epitopeof pHL1276

HL221 cttgtcatcgtcgtccttgtagtc To generate a 24-bp DNA fragment encoding the FLAG epitopein pHL1276

HL199 gcaactagttcagatcttagtcgaccgatgcataaggatccctgagct 59-flanking oligonucleotide of polylinker sequence in library vectorpHL1288

HL200 cagggatccttatgcatcggtcgactaagatctgaactagttgctgca 39-flanking oligonucleotide of polylinker sequence in library vectorpHL1288

HL417 ctgcagcaactagttcagatcttagtcgaccgatgtataaggatccctgagctc 59-flanking oligonucleotide in nup124 mutating ATG to a BclI siteHL340 gtcgatgagtttgtattgatcactcctgtttcaaaaaatac 39-flanking fusion oligonucleotide for overlapping the pair HL417-

HL418 with BclI mutationHL418 ctagattcctaacctcgaggtataatcttgcttttgctttggc 39-flanking oligonucleotide in nup124 mutating ATG to a BclI siteHL420 gtattttttgaaacaggagtgatcaatacaaactcatcgac 59-flanking oligonucleotide for overlapping the pair HL417-HL418

with BclI mutationHL447 catcgtaaggatccatttgtcttccaccaatttttgaatt PCR generation of the 39 flank of S. pombe his3 gene with

pHL1570 as templateHL440 gtatatacggccgtctatgcaaagctaacgaatct PCR generation of the 59 flank of S. pombe his3 gene with

pHL1570 as templateHL495 tttggcagatctctttcaacgttt PCR oligonucleotide 59 flank for generation of Gag in GST vectorHL496 gctttaatcagaggatccatgaaaaactcatcacagaaaagaatt PCR oligonucleotide 39 flank for generation of Gag in GST vectorHL520 agttagcacaaggataccctcgagtcaataacgtcttttcttgtattttgta PCR oligonucleotide 59 flank for generation of an N-terminal por-

tion of Nup124p in GST vectorHL5103 catgctttaatcagaggatccagaattattcgcgttagtaatcggagccat PCR oligonucleotide 39 flank for generation of an N-terminal por-

tion of Nup124p in GST vectorHL521 agttagcacaaggataccgtcgactcacaaacgattagtttgcacatcagc PCR oligonucleotide 59 flank for generation of C-terminal section

of Nup124p in GST vectorHL501 catgctttaatcagaggatccaaggagaatgagcccaagccaacg PCR oligonucleotide 39 flank for generation of C-terminal section

of Nup124p in GST vectorHL339 gaattcatgcctcctgtttcaaaaaatac 59 flank for 779–1073 nucleotide synthesis of nup124 segment 1 to

generate LexA fusionsHL340 ctcgaggtataacttgcttttgctttgg 39 flank for 779–1073 nucleotide synthesis of nup124 segment 1 to

generate LexA fusionsHL341 gaattcagaattattcgcgttagtaatcgg 59 flank for 1073–1718 nucleotide synthesis of nup124 segment 2

to generate LexA fusionsHL342 ctcgagtcatgcattgactaatacaggcttc 39 flank for 1073–1718 nucleotide synthesis of nup124 segment 2

to generate LexA fusionsHL343 gaattcgaagttcagacagattccaacc 59 flank for 1718–2363 nucleotide synthesis of nup124 segment 3

to generate LexA fusionsHL344 ctcgagtcacaaacgattagtttgcacaatca 39 flank for 1718–2363 nucleotide synthesis of nup124 segment 3

to generate LexA fusionsHL345 gaattcaaggagaatgagcccaagcc 59 flank for 2363–3008 nucleotide synthesis of nup124 segment 4

to generate LexA fusionsHL346 ctcgagtcacttggtaaaattaaatgaaaactg 39 flank for 2363–3008 nucleotide synthesis of nup124 segment 4

to generate LexA fusionsHL347 gaattcccaaatacggatgccaaaacc 59 flank for 3008–3653 nucleotide synthesis of nup124 segment 5

to generate LexA fusionsHL348 ctcgagtcaggtagtctttgaagttgcagac 39 flank for 3008–3653 nucleotide synthesis of nup124 segment 5

to generate LexA fusionsHL349 gaattctctgaaggaaccgctccagc 59 flank for 3653–4306 nucleotide synthesis of nup124 segment 6

to generate LexA fusionsHL350 ctcgagttaacgttttcttcgacttcgg 39 flank 3653–4306 nucleotide synthesis of nup124 segment 6 to

generate LexA fusionsHL414 gaattcatgaaaaaactcatcacagaaaaggattcgaatggaaatgg 59 flank for Gag to generate B42 activation domain fusionsHL355 ctcgagtcaataacgtcttttcttgtattttg 39 flank for Gag to generate B42 activation domain fusionsHL613 ggtattcaattcaatttgggctcttcta

actcacaaacaaatgcgcccccgggccgtaaaattgctgtgccccgaagtcgaagaaaacgttccggaggaggtggaggagagctcatgggtattcctaac

59-flanking PCR oligonucleotide for generating nup124::pk1(3)GFP SV40 poly(A) ura41 integration tag

HL614 taaaagcgtccgtatgtgtaaacaaaaatgtaataattattccttagcaattaatttaaaggacaaagtctatctaaactatcatatgagaaagtctttgctgatatgcctt

39-flanking PCR oligonucleotide for generating nup124::pk1(3)GFP SV40 poly(A) ura41 integration tag


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

Strain YHL5754 (nup124-1) was transformed by treatment with lithium ace-tate and library DNA in amounts optimized to yield 600 to 800 colonies/plate(48). The colonies were then put through the cDNA recombination assay toidentify clones able to rescue the recombination defect of the strain withnup124-1. A total of 54,155 colonies tested in the screen yielded five plasmidsthat complemented both the transposition and recombination defects ofYHL5754. Plasmid DNA was isolated by extraction from the strains that sup-pressed the nup124-1 defect (2).

Deletion of the nup124 sequence in the suppressor plasmid and creation of aframe shift. A deletion in the nup124 sequence of the suppressor plasmidpHL1338-3 was created by digestion with SnaBI and SmaI followed by ligation.A frameshift mutation was created 375 bases downstream from the start oftranslation of nup124 in the suppressor plasmid by linearizing pHL1338-3 withAvrII. The 59 overhangs were filled with Klenow, and the resulting blunt endswere ligated to create pHL1343.

To insert a suppressing fragment of nup124 back into the genome, an inte-gration vector, pHL481, was created by removing the 742-nucleotide ClaI frag-ment from pJK148 (32). This plasmid, contained a multicloning site and thecomplete sequence of the leu1 gene of S. pombe. A 4.4-kb SpeI-BamHI fragmentfrom pHL1338-3 with nup124 was inserted into pHL481 digested with XbaI andBamHI to produce pHL1342. To integrate this plasmid, pHL1342 was digestedwith AgeI and transformed into the wild-type strain YHL912 and the nup124-1mutant strain YHL5750. Stable Leu1 transformants were selected, and stableintegrants were identified. DNA blot analysis of YHL6136 indicated that theintegration of pHL1342 occurred at the genomic location of nup124.

Construction of a strain with nup124 deleted. To delete the entire ORF ofnup124 and replace it with his3, we used strains and plasmid DNA as describedby Ohi et al. (52). A BglII-NaeI fragment with the his3 gene of S. pombe wasgenerated by PCR with oligonucleotides HL447 and HL440 with pAf1 as tem-plate. DNA from pHL1472-6 was digested with BclI and SmaI to remove the3.47-kb nup124 ORF, and the remaining DNA was ligated to the BglII-NaeIfragment of the his3 sequence to create pHL1572. The 3.6-kb BglII-Ecl136IIfragment was used to transform a homozygous wild-type his3 diploid. Strainswere identified by DNA blot hybridization in which the nup124-1 allele had beenreplaced by the integration of a Dnup124::HIS3-disrupted copy.

Immunofluorescence microscopy. FLAG-tagged Gag was localized by incu-bating mutant and wild-type cells induced to overexpress the FLAG-tagged Gagby the absence of vitamin B1. A total of 5 OD600 units of stationary-phase cells(OD600 5 10 to 11) were harvested and processed essentially as describedpreviously (5). The cells were reacted with a 1:1,000 dilution of primary antibody,anti-FLAG M2 monoclonal antibody (no. IB13025; Eastman Kodak, New Ha-ven, Conn.), at room temperature in a humidified chamber overnight. After fivewashes, these cells were incubated with a secondary antibody consisting of Or-egon Green 488 goat anti-mouse immunoglobulin G (Molecular Probes, Eugene,Oreg.) at a 1:500 dilution for 2 h in the dark. Cells were mounted prior tovisualization with 1 mg of p-phenylenediamine (Sigma P-1519) per ml, 1 mg of49,6-diamidino-2-phenylindole (DAPI) per ml in 50% glycerol was added, andthe coverslips were sealed with clear nail polish.

The localization of HA-tagged Nup124p was determined by the same methodused to visualize the FLAG-Gag protein. A total of 5 OD600 units of cells grownin EMM 2 leu dropout medium were harvested at an OD600 of 0.25. They werefixed for 75 min and treated with Zymolyase 100T (Seikagaku Corp.) for 1 h. Theprimary antibody was a 1:5,000 dilution of the monoclonal antibody HA.11(MMS-101P; BAbCO), and the secondary antibody was a 1:1,000 dilution ofOregon Green 488 goat anti-mouse immunoglobulin G.

To localize the SV40 NLS-GFP-LacZ protein, nup124-1 and wild-type strainswere transformed with pSGP502-SV40 and pSGP502-SV40mut plasmids (kindlysupplied by Sally G. Pasion, Salk Institute, San Diego, Calif.) (Table 2). Toinduce the overexpression of the GFP-LacZ fusion proteins, the strains weregrown in the absence of vitamin B1. A total of 5 OD600 units of log-phase cells(OD600, 0.6 to 0.8) were harvested and fixed for 2 min in 2% (vol/vol) formal-dehyde–0.05% (vol/vol) glutaraldehyde (G5882; Sigma) in phosphate-bufferedsaline. After two washes with phosphate-buffered saline, the cells were allowed toadhere for 40 min at room temperature to slides coated with 1.0% polyethyleni-mine. The slides were rinsed in distilled water and air dried. The cells were nextmounted with a solution containing p-phenylenediamine (1 mg/ml) and DAPI (1mg/ml) in 50% glycerol before the coverslips were sealed with clear nail polish.

To study the localization of the GFP-nucleoplasmin protein, nup124-1 andwild-type strains were transformed with the pREP-GFP-Nucleoplasmin plasmid(kindly supplied by Tokio Tani and Yasumi Ohshima, Kyushu University,Kyushu, Japan) and pHL1769 (Table 2). After the cells were induced for Tf1expression, 5 OD600 units of log-phase cells (OD600 of 0.6 to 0.8) were harvestedand directly incubated for 40 min in the dark at room temperature in Hoechst33342 (bis-benzimidine; B2261 [Sigma] at 25 mg/ml in 50% glycerol while ad-hering to slides coated with 1.0% polyethylenimine. The slides were then rinsedin distilled water and air dried. The cells were mounted with 12.5 mg of Hoechst33342 per ml in 50% glycerol before the coverslips were sealed with clear nailpolish.

The in situ hybridization assay to detect poly(A) mRNA was conducted aspreviously published (27).

Cells were observed and photographed with a Zeiss Axiophot fluorescence

microscope equipped with a 1003 objective. Unless otherwise mentioned, KodakEktachrome P1600 film was used to capture the images.

Two-hybrid analysis. To screen for the interactions between Tf1 Gag and theNup124 protein, the yeast interaction trap two-hybrid system was used (20, 26).DNA segments encoding full-length Gag as well as six segments of Nup124p (seeFig. 8) were amplified by PCR and cloned into activation domain (AD) andbinding-domain (BD) plasmid vectors. To clone these fragments into the two-hybrid vectors, primers for each PCR product were designed to create EcoRI andXhoI restriction sites at the 59 and 39 ends, respectively. Duplicates of each PCRproduct were cloned into the DNA binding-domain plasmid, pEG202, and acti-vation domain plasmid, pJG4-5 (20). The various combinations of plasmids weretransformed into yeast strain EGY48 (20), which has the upstream activatingsequences of the chromosomal LEU2 gene replaced with by LexA operators.Potential interactions were scored by printing patches from galactose platescontaining leucine to galactose plates lacking leucine. The plates were monitoredon a daily basis for up to 5 days. The growth of test interaction patches wascompared to that demonstrated by a known interaction consisting of p53 fused toLexA and SV40 large T antigen fused to B42.

GST precipitation. The Gag of Tf1 and the two halves of Nup124p wereexpressed as C-terminal GST fusions in the BLR (Novagen) strain of bacteria. APCR product encoding Gag was generated with oligonucleotides that produceda BamHI site (HL495) at the beginning of the Gag gene and a XhoI site (HL496)at the predicted end of the Gag gene. This product was inserted into the BamHIand XhoI sites of pGEX-6P-1 (Pharmacia Biotech) to produce pHL1613-4. APCR product encoding an N-terminal portion of Nup124p that corresponded tosections 2 and 3 in Fig. 8 was created with a BamHI site at its beginning (HL520)and a SalI site (HL5103) at its 39 end. This product was inserted into the BamHIand SalI sites of pGEX-6P-1 to create pHL1623-1. Similarly, a PCR productencoding the C-terminal section of Nup124p (see Fig. 8, sections 4, 5, and 6) wascreated with a BamHI site (HL521) at the 59 end and a XhoI site (HL501) at the39 end. Insertion of this product into the BamHI and XhoI sites of pGEX-6P-1produced pHL1622-1. The GST-Nup124p proteins were cleaved with PreScissionprotease (Pharmacia Biotech) and eluted from the glutathione-Sepharose 4Bbeads whereas the GST-Gag proteins were purified on the glutathione-Sepha-rose 4B beads and used directly in precipitation experiments.

The pull-down experiments were performed, as described by Rexach andBlobel (56), in binding buffer that contained 20 mM HEPES (pH 6.8), 150 mMpotassium acetate, 2 mM magnesium acetate, 2 mM dithiothreitol, 0.1 mMTween 20, and 0.1% Casamino Acids. After the beads with GST-Gag werewashed in binding buffer and the Nup124p proteins were dialyzed in bindingbuffer, approximately 1 mg of the Nup124p proteins was added in 15 ml to 15 mlof resin bed with 1 mg of GST-Gag. The sample was rotated end over end atroom temperature for 45 min, and after three washes with 250 ml of bindingbuffer, the beads and the supernatant fractions were combined with sampleloading buffer and loaded onto a sodium dodecyl sulfate–10% polyacrylaminegel.

RESULTS

To identify genes in S. pombe that contribute to the functionof Tf1, we mutagenized cultures with EMS and screened thestrains for reduced levels of transposition. Tf1 activity in indi-vidual colonies was monitored by a previously described assaythat detected the insertion of neo-marked Tf1 elements intothe genome of S. pombe (40). To measure transposition, aplasmid-encoded copy of Tf1 that included a bacterial neomy-cin resistance gene (Tf1-neoAI) was induced for transpositionby activating Tf1 transcription. After first selecting against cellsthat retained the Tf1-neoAI plasmid, we identified cells withgenomic inserts of Tf1-neo by virtue of the resistance to G418provided by the neo gene. Figure 1 contains the results of atransposition assay and shows that a patch of cells that initiallycontained wild-type Tf1-neoAI produced confluent growth on aplate that contained G418 whereas a similar patch of cells thatcontained Tf1-neoAI with a frameshift in IN showed signifi-cantly less transposition.

The strains that appeared to have significantly lower trans-position activity were examined for several trivial causes ofreduced growth on the plates that contained G418. Each can-didate suspected of possessing transposition defects was testedfor reduced function of the nmt1 promoter as fused to lacZ.We also retransformed each candidate with a fresh copy of theTf1-neoAI plasmid to identify which strains were defective fortransposition simply due to mutations in the assay plasmid. Inaddition, we tested strains with a version of Tf1 that contained


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

arg3 as a transposition marker. In this way, we could excludecandidates that showed low growth on the G418/5-fluoro-orotic acid (FOA) plates due to alterations specific to themetabolism of G418. One strain that exhibited a genuine re-duction in transposition was crossed with a wild-type strain.The spores of 14 tetrads exhibited a 2:2 segregation of thetransposition defect, which indicated that the reduced Tf1 ac-tivity was due to a mutation in a single gene. For reasonsdescribed below, we named this gene nup124.

The transposition activity of cells that contained thenup124-1 mutation is shown in Fig. 1. To measure the magni-tude of this defect we subjected strains to a quantitative-trans-position assay that was developed previously (2, 43). The re-sults of the quantitative-transposition assay showed that thestrain with the nup124 mutation produced 12-fold-fewer trans-position events than did the wild-type strain (described in Ma-terials and Methods).

After the mutagenized strains were tested for defects intransposition activity, they were screened by a previously de-scribed assay that detected homologous recombination be-tween Tf1 plasmid sequences and copies of Tf1 cDNA. Theoccurrence of wild-type levels of this recombination indicatesthat normal levels of Tf1 cDNA are present in the nucleus (2).The homologous-recombination assay was performed with thesame Tf1-neoAI plasmid that was used for the transpositionassays. The presence of an artificial intron (AI) disrupted theneo reading frame, and because the intron orientation wasinverted relative to neo, the intron could not be spliced fromthe neo transcript. However, strains induced for Tf1 expressionbecome resistant to G418 because the intron was in the appro-priate orientation to be spliced from the Tf1 mRNA. We foundthat if colonies induced for Tf1 expression were replica printeddirectly to plates that contained G418, significant levels ofG418 resistance occurred that could be attributed to twoequally efficient processes (2). The reverse transcripts of thespliced Tf1 mRNA, if present in the nucleus, could homolo-gously recombine with the Tf1-neoAI plasmid and generate aG418-resistant version of the plasmid. The cDNA also was ableto serve as the substrate for conventional transposition events.Although these processes occurred with about equal propor-tions in wild-type strains, we could use this method to measure

the levels of homologous cDNA recombination in strains thatwere known to be defective for transposition (2). The featureof the transposition assay that masks the detection of cDNArecombination was growth on a medium that selects against theTf1-neoAI plasmid.

The recombination assay in Fig. 1 shows that a wild-typecopy of the Tf1-neoAI plasmid produced confluent growth onagar medium that contained G418. The confluent growth pro-duced by a version of Tf1-neoAI that lacked IN due to aframeshift mutation and the lack of G418 resistance due to aframeshift just upstream of RT (PR fs) are demonstrationsused to indicate that the homologous-recombination assay de-tects products of reverse transcription even in the absence ofIN activity (2). Figure 1 also shows that the mutation in nup124that was responsible for low transposition activity caused adramatic reduction in the homologous recombination of Tf1cDNA. The magnitude of the recombination defect was deter-mined by subjecting the strains to a quantitative version of thehomologous-recombination assay (2). The strain with thenup124-1 mutation produced 40-fold-lower levels of cDNArecombination than did the wild-type strain (see Materials andMethods).

The results of the recombination assays suggested either thatthe levels of Tf1 reverse transcripts were reduced by thenup124-1 mutation or that normal levels of cDNA were pro-duced but did not accumulate in the nucleus. We used a pre-viously published technique to measure directly the accumu-lated levels of Tf1 cDNA in cells (2, 38). Liquid cultures of cellsinduced for Tf1 expression were extracted for total DNA,which was then digested with BstXI and subjected to DNA blotanalysis. DNA was extracted from cultures that were in log-phase growth as well as from cells that had reached stationaryphase. The results showed that the wild-type Tf1-neoAI plas-mid produced the same amount of a 2.1-kb fragment of cDNAas did the strain with the mutation in nup124-1 (Fig. 2A). A9.5-kb band resulted from the BstXI digestion of the Tf1-neoAIplasmid, and this served as an internal control for levels ofDNA loaded in each lane.

Another possibility we considered was that the nup124-1mutation indirectly caused a reduction in the level of one or allof the Tf1 proteins. An immunoblot of proteins extracted from

FIG. 1. Transposition and cDNA recombination assays of Tf1. The genetic manipulations and replica printing required for the transposition and recombinationassays are indicated in parentheses. The ability of the reverse transcripts in both assays to produce G418 resistance is shown. Although wild-type (wt) Tf1-neoAIproduced G418 resistance in both assays, a mutation that blocked integrase expression, IN fs, greatly reduced growth on the transposition plates without significantlyreducing growth on the recombination plates. PR fs is a strain with a frameshift mutation in Tf1 that blocks the expression of PR, RT, and IN. FOA- 5-fluorooroticacid.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

cultures harvested in both stationary and exponential phasesshowed that the levels of Gag and IN proteins in cells with thenup124-1 defect were indistinguishable from those in wild-typecells (Fig. 2B). Since IN is the last protein encoded by thesingle ORF of Tf1, the presence of normal levels of IN indi-cated that all Tf1 proteins were translated with wild-type effi-ciency.

Isolation and sequence of the nup124 gene. To isolate awild-type copy of the nup124 gene and determine its sequence,we transformed a genomic library of plasmids into a strain withthe nup124-1 allele and screened for complementation of thetransposition defect. The strains with high levels of transposi-tion activity were all found to contain the same fragment ofgenomic DNA. Both orientations of the insert were isolated.Furthermore, these plasmids complemented both the trans-position and cDNA recombination defects caused by thenup124-1 mutation. The sequence of the entire 5,075-bpgenomic fragment was available from the S. pombe genomeproject.

Figure 3A is a diagram of the fragment that included thesignificant ORFs and the restriction sites used to determinethat each of the complementing plasmids contained the sameinsert. The sequence began with 106 codons of the ORF thatcorresponded to the last 64% of a gene for a clathrin coatassembly protein. The end of the fragment encoded the last20% of a 754-amino-acid protein with sequence similarity toATP-dependent RNA helicases. The center of the fragmentcontains the entire gene (encoding 1,159 amino acids) for ahypothetical protein of 124 kDa. When a deletion was madefrom the SnaBI site to the SmaI site, the complete codingsequence of the central ORF was removed and the resultingplasmid no longer complemented the transposition or recom-

bination defect of the nup124-1 mutation (Fig. 3B). We alsofound that a frameshift mutation generated near the beginningof the central ORF in the AvrII site destroyed the complemen-tation activity of the plasmid (Fig. 3B). These data indicatedthat the central ORF, encoding 1,159 amino acids, was thesource of the complementation. To test whether this suppres-sor gene was allelic to nup124, we subcloned the entire frag-ment of genomic sequence shown in Figure 3A into an inte-gration vector that contained the leu1 gene of S. pombe. Theresulting plasmid was integrated at the genomic site of thecomplementing ORF in a haploid strain that contained thenup124-1 allele. The structure and position of the integratedplasmid were confirmed by DNA blot analysis. The single-copyintegrated fragment was found to retain its ability to comple-ment the nup124-1 defects in transposition and homologousrecombination (Fig. 3C). The resulting strain was mated with ahaploid that possessed a wild-type copy of nup124, and 20tetrads were dissected. All four spores of these tetrads pos-sessed wild-type transposition and cDNA recombination activ-ity. Taken together, these data indicate that the central ORFfrom the complementing fragment was allelic with nup124.

The predicted amino acid sequence encoded by nup124 wasanalyzed by TFASTA, and a low but measurable level of sim-ilarity to several nuclear pore factors was found. Further ex-amination of the alignments revealed that the nuclear porefactors all possessed FXFG motifs, and it was primarily thesesequences that aligned with nup124. The predicted amino acidsequence of the nup124 product is shown in Fig. 4 and thepositions of 11 repeats of FXFG are shown. The FXFG is onetype of the FG repeat motifs found in nuclear pore factors(65).

FIG. 2. Levels of Tf1 cDNA and proteins are not altered by the mutation in nup124-1. (A) Tf1 cDNA production in wild-type and nup124-1 cells at the logarithmicand stationary phases of growth. A DNA blot containing nucleic acid extracted from wild-type (WT) (YHL1282), PR frameshift (YHL1836), INT frameshift(YHL1554), and the nup124-1 mutant (YHL5754), is shown. Genomic DNA from the logarithmic and stationary phases of growth on medium without vitamin B1 wasdigested with BstXI and loaded onto a 0.6% agarose gel, which was transferred to a filter and probed with a 1.0-kb neo fragment. (B) Tf1 proteins in wild-type andnup124-1 cells at the logarithmic and stationary phases of growth. An immunoblot of extracts from the cells used for the Tf1 cDNA determination in panel A is shown.The filter was probed with both anti-Gag and anti-IN antisera. The arrows marked IN and Gag show the positions of the IN and Gag proteins.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

The mutation in the nup124-1 allele introduced a stop codonthat truncated the protein between the second and third FXFGrepeats. To determine the nature of the defect in the proteinexpressed by nup124-1, we used PCR to produce four overlap-

ping regions of nup124, using as the template genomic DNAfrom a strain of S. pombe that contained the nup124-1 allele.Two independent PCR products of each region were clonedand sequenced. The sequences of the cloned PCR products

FIG. 3. Isolation and sequence of the nup124 gene. (A) Restriction fragment of the genomic sequence that complemented the nup124-1 defect, with the locationsof the ORFs indicated by large arrows. The C-terminal sections of the ATP-dependent helicase and the clathrin assembly protein are shown with shaded arrows, andthe nup124 ORF is shown with a black arrow. Also shown are the positions of restriction sites including AvrII, SnaBI, and SmaI, the sites used to disrupt the nup124ORF. (B) All strains were assayed for transposition activity. The strains represented in the upper panel are as follows (from left to right); wild type (wt) (YHL5533),nup124a (YHL6106, a nup124-1 strain expressing the entire complementing fragment, nup124b (YHL6061, a strain with an empty vector, pSP1), nup124c (YHL6110,a strain with the empty library vector pHL1288); a wild-type strain containing Tf1 PR fs (YHL4990); and a wild-type strain containing Tf1 IN fs (YHL4992). The strainsin the top row of the lower panel are, from left to right, two transformants of a wild-type strain with the complementing fragment that contained the frameshift mutationat the AvrII site (YHL6404) and two transformants of a strain with the nup124-1 mutation and the plasmid with the complementing fragment and the frameshiftmutation at the AvrII site (YHL6406). The strains in the lower row of the bottom panel are two transformants of a wild-type strain with the plasmid copy of thecomplementing fragment that contained the SnaBI-SmaI deletion (YHL6405) and two transformants of a strain with the nup124-1 mutation and the plasmid thatcontained the SnaBI-SmaI deletion (YHL6407). (C) The strain with the nup124-1 allele was transformed with an integrating plasmid containing the entirecomplementing sequence. A stable transformant (YHL6136), shown to contain an integration of the suppressor sequence into the nup124-1 loci, was transformed withthe Tf1-neoAI plasmid pHL449 (YHL6620) and assayed for transposition (upper panel) and recombination (lower panel). aTwo independent transformants are shown.Also represented in both top and bottom sections are (from left to right) strains with wild-type (wt) and nup124-1 alleles (YHL1282 and YHL5754, respectively) andthe standard control strains consisting of Tf1 IN fs (YHL1554) and Tf1 PR fs (YHL1836).


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

were compared to the sequence of the wild-type nup124 iso-lated from the S. pombe library. A single-nucleotide substitu-tion was found that converted codon 722 into a terminationcodon. The result of this nonsense mutation was predicted toremove 9 of the 11 FXFG repeats (Fig. 4). To test whether thissingle-nucleotide substitution was indeed the cause of thetransposition defect, we regenerated the mutation in the con-text of the original plasmid with nup124, which complementedthe genomic nup124-1 allele. We found that the single-nucle-otide substitution did inactivate the ability of the plasmid tocomplement the transposition defect caused by nup124-1 (re-sults not shown).

Nup124p is a nuclear pore factor. To test whether Nup124pwas a component of nuclear pores, we determined its cellularlocalization by indirect-immunofluorescence microscopy. Adouble HA tag was fused to the N terminus of nup124 asexpressed from its own promoter on the same plasmid thatcomplemented the nup124-1 mutation. The addition of the HAtag did not reduce the ability of nup124 to complement thetransposition or cDNA recombination defects caused bynup124-1. Cells were fixed and prepared for visualization withan anti-HA monoclonal antibody. The fluorescence imageshowed punctate foci that encircled the position of the nucleusas visualized by DAPI staining (Fig. 5). This signal was specificfor the HA-tagged nup124 since the control strain that con-tained the vector without HA-tagged nup124 produced no flu-orescence signal. The punctate localization of HA-taggedNup124p around the edge of the nucleus is typical of thesignals produced by antibodies that recognize nuclear poreproteins.

Although the appearance of HA-Nup124p at the nuclear rimwas consistent with a localization at the NPCs, the resolutionof light microscopy did not allow us to determine whetherNup124p was specifically a component of the NPCs. For thispurpose, we examined the localization of Nup124p at highresolution by immunological electron microscopy. We con-structed a strain that expressed GFP fused to the C terminus ofNup124p. The fusion protein was expressed by the nup124promoter from its genomic location. Figure 6 shows a thinsection that was treated with the anti-GFP antibody and goat

FIG. 4. Amino acid sequence of the Nup124p (Q09904) protein as predictedwith annotation software that identified a small intron marked here with anasterisk. The 11 FXFG repeats at the C-terminal end are underlined. Themutation site of the nup124-1 allele is indicated by a short vertical line before theQ where the codon CAG coding for Q is mutated to a Stop codon, TAG.

FIG. 5. Cellular location of Nup124p. Two strains, YHL965 (bottom, vector without nup124) and YHL6576 (top, plasmid with HA-tagged nup124) were grown inEMM 2 leu dropout medium and prepared for immunofluorescence microscopy. The left two panels show the FITC signal produced by the anti-HA antibody, andthe right two panels contain images of the DAPI signals.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

anti-rabbit immunoglobulin labeled with 10-nm-diameter col-loidal gold. A significant number of the gold particles localizedto the nuclear pore structures. The positions of gold particleson 21 sections were examined. The density of gold particlesdirectly associated with nuclear pore structures was deter-mined, and the average value was found to be 24 gold particlesper mm2 of NPC surface. Compared to the density of particlesspecifically associated with nuclear pore structures (252 goldparticles; 24 particles/mm3) the gold particles were 18 times

less likely to be found in the nucleoplasm (180 particles; 1.3particles/mm3) and 40-fold less likely to be found in the cyto-plasm (169 particles; 0.6 particle/mm3). The large numbers ofgold particles associated with the nuclear pore structures indi-cated that Nup124p is a component of the NPC.

The nup124-1 mutation reduced the nuclear localization ofGag. To pursue the possibility that the mutation in nup124reduced the nuclear localization of Tf1 complexes, we surveyedTf1 Gag and IN for their tendency to localize to the nucleus of

FIG. 6. Immunoelectron microscopy demonstrating the presence of a Nup124-GFP fusion protein within nuclear pores. Strain YHL6876 expressed a single-copyallele of GFP fused to the end of Nup124p. Cells were grown in EMM and processed for immunoelectron microscopy with an antibody specific for GFP. (A) A thinsection of a cell shows a ring of reduced density that indicates the position of the nuclear envelope. The dark structures embedded in the ring are the nuclear pore.A high concentration of gold particles are associated with the nuclear pores (arrows). The square indicated the region shown at higher magnification in panel B. Bar,1.0 mm. (B) The inset from panel A was enlarged to allow inspection of the gold particles associated with two nuclear pores. Bar, 0.1 mm.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

wild-type cells grown at 32°C, the same temperature used dur-ing the transposition assays. Because levels of Gag are sub-stantially greater than those of IN, we found it much morereliable to monitor the localization of Gag. A FLAG epitopewas inserted near the C terminus of Gag, and the resultingtransposon, Tf1(FLAG)-neoAI, possessed wild-type levels oftransposition and homologous recombination activity (data notshown). Wild-type cells that were induced for the expression ofTf1(FLAG)-neoAI were grown to saturation and prepared forimmunofluorescence microscopy with the M2 anti-flag mono-clonal antibody (Kodak). We found that the majority of thewild-type cells produced a single strong focused signal (Fig. 7).The fluorescence image produced by the anti-FLAG antibodywas merged with an inverted black-and-white image of thenucleus generated by DAPI staining. The merged imageshowed that the majority of the FLAG-based signal was en-tirely overlapped by the nucleus. We found that the anti-FLAGsignals were specific for Tf1 since no signal was observed fromcells that did not include Tf1(FLAG)-neoAI (results notshown). In sharp contrast to the wild-type cells, the strain withthe mutation in nup124 showed almost no FLAG signal withinthe nucleus (Fig. 7). Table 4 contains a compilation of local-ization data that includes 99 nuclei from wild-type cells and 79nuclei from cells with the nup124-1 mutation. Only the nucleifrom cells that produced a FLAG signal were tabulated forlocalization. These data indicate that Gag in the wild-type cellslocalized to the nucleus while the mutation in nup124 reducedthe number of nuclei with nuclear localization of Gag by 7.3-

fold. Interestingly, the 7.3-fold drop was associated with a4.6-fold increase in the number of nuclei that not only lackedGag but also appeared to be directly attached to aggregates ofcytoplasmic Gag.

The nup124-1 allele does not cause a general defect in thefunction of the NPC. One fundamental question about thenuclear import of Tf1 Gag was how a mutation in a nuclearpore factor could cause a significant defect in the import of aparticular protein without resulting in a general loss of importfunction and viability. We tested whether cells with thenup124-1 allele had reduced growth. The doubling time ofthese strains at 32°C was measured in liquid cultures thatcontained EMM plus a complete mixture of supplements. Thenup124-1 mutation did not cause any reduction in growth rate(results not shown). In addition, the colony sizes of cells withthe nup124-1 mutation were tested after growth at 25, 32, and37°C. The mutant cells formed the same-sized colonies as thewild-type cells at all three temperatures (results not shown).

The wild-type growth rate of cells with the nup124-1 muta-tion suggested that the mutation did not cause a defect in thebulk import of proteins into the nucleus. To determine directlywhether nuclear import was altered, we asked whether thenup124-1 allele reduced the nuclear localization of specificproteins in cells grown at 32°C. To test whether the mutationin nup124-1 altered the nuclear import of a substrate with acanonical monopartite NLS, we monitored the cellular local-ization of a fusion protein that included the SV40 NLS, GFP,and b-galactosidase. Fluorescence micrographs showed that

FIG. 7. Immunofluorescence of Tf1 FLAG-Gag in wild-type cells. (Top) Strain YHL5895 contained a wild-type allele of nup124 and the Tf1-neoAI FLAG-Gagplasmid, pHL1276. The green signal is specific for the FLAG-Gag protein, and the blue signal is produced by DAPI and indicates the position of the nucleus. The panelon the right is a merge of the FLAG-Gag signal produced by YHL5895 with an inverted black-and-white image of its DAPI stain. The merge was generated with AdobePhotoshop 4.0 with the screen function set at 65% opacity. (Bottom) Same experiment as in the top three panels, except that strain YHL6565 (bottom) contained thenup124-1 allele.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

the GFP fusion localized to the nuclei of wild-type cells (resultsnot shown). This nuclear localization was due to the functionof the SV40 NLS, since amino acid substitutions in the NLSresulted in a cytoplasmic localization. We found that the cellswith the nup124-1 allele showed the same localization of theGFP fusion protein in the nucleus as did the wild-type cells(results not shown). The effect of the nup124-1 allele on thenuclear localization of the NLS-GFP-b-galactosidase was eval-uated for a large number of nuclei, and this tabulation (Table4) confirmed the finding that no change in nuclear localizationresulted from the nup124-1 mutation.

To evaluate the effect of the nup124-1 allele on the nuclearlocalization of a protein with a bipartite NLS, we examined thebehavior of GFP fused to nucleoplasmin, a protein of Xenopus(57). In wild-type cells, GFP-nucleoplasmin localized to thenucleus (Table 4). This nuclear localization was dependent onthe function of the nucleoplasmin NLS since amino acid sub-stitutions in this sequence resulted in cytoplasmic localization(Table 4). In addition to causing a cytoplasmic localization, thealtered nucleoplasmin NLS generated punctate fluorescencethat may have resulted from aggregation (results not shown).The localization of GFP-nucleoplasmin in cells with thenup124-1 mutation was nuclear and appeared indistinguishablefrom the pattern seen in wild-type cells (Table 4). Here, too,the nuclear localization in cells with the nup124-1 mutation wasdependent on the function of the nucleoplasmin NLS. Thesedata clearly show that the nup124-1 allele did not reduce thenuclear localization of GFP-nucleoplasmin.

In addition to alterations in the nuclear import of proteins,mutations in proteins of the NPC reduce the nuclear export ofpoly(A) mRNA. In fact, mutations in several nuclear porefactors of S. cerevisiae cause obvious defects in the export ofmRNA without noticeably lowering the import of proteins(65). We therefore tested the possibility that the nup124-1allele generated a defect in NPC function that could be ob-served as the accumulation of poly(A) mRNA in the nucleus.To visualize the localization of mRNA, cells grown at 32°Cwere fixed and treated with deoxygenin-labeled oligo(dT) andfluroescein isothiocyanate (FITC)-conjugated anti-deoxygeninantisera. Cells that contained the nup124-1 mutation did notaccumulate poly(A) mRNA in the nucleus and were indistin-guishable from wild-type cells (Table 4). As an example of cellsthat do accumulate poly(A) mRNA in the nucleus, we included

a strain with a mutation in the nuclear pore protein Rae1p.This rae1-1 allele causes a defect in the nuclear export ofpoly(A) mRNA when cells are shifted to the nonpermissivetemperature of 35°C (7, 68). Taken together, the unalteredlocalizations of poly(A) mRNA, SV40 NLS-GFP-LacZ, andGFP-nucleoplasmin in cells with the nup124-1 allele indicatedthat this mutation did not cause a general defect in the trans-port of material in and out of the nucleus.

To ask whether the defect in nup124 caused any gross alter-ation in the positioning or distribution of the NPCs within thenuclear envelope, we treated cells with the FXFG-specific an-tibody MAb414 and examined them by immunofluorescence.Cells with the nup124-1 allele showed a nuclear-rim patternthat was typical of proteins in the NPC, and this staining wasindistinguishable from the pattern observed for wild-type cells(results not shown).

nup124 is not an essential gene. To test whether nup124 isrequired for viability, we deleted just the ORF of nup124 fromone allele of a diploid strain and replaced it with the his3 gene.The structure and position of the deletion were confirmed byusing DNA blots that were probed separately with his3 andnup124 sequences. Each of 48 tetrads produced two viablespores and two dead spores (results not shown). Although thisresult suggested that nup124 was essential for viability, wetested the possibility that Nup124p protein was important onlyfor spore germination and not for vegetative growth. The dip-loid that contained a deletion in one allele of nup124 wastransformed with a plasmid that contained a wild-type copy ofnup124. Spores derived from this strain were germinated onmedium that required the presence of the plasmid for growth.Among the resulting colonies were haploid cells that containedthe chromosomal deletion of nup124 but retained the copy ofnup124 in the plasmid. Subsequent growth on rich mediumdemonstrated that cells possessed viability even after loss ofthe plasmid that carried the only remaining copy of nup124(results not shown). The absence of nup124 coding sequence inthis strain was verified by DNA blot analysis (results notshown). These results indicated that nup124 is not required forvegetative growth and, as a result, may be important for sporegermination.

Nup124p interacts directly with Tf1 Gag. The possibilityexisted that the nup124-1 allele did not directly cause thedefect in nuclear localization of Gag but instead caused a

TABLE 4. Localization of transport substrates

Transport substrate Genotype ofstrain

Transport functionstudied

No. of nuclei observed

Counteda% Exhibiting

nuclearlocalization

FLAG-tagged Gag nup1241 Import 99a 74FLAG-tagged Gag nup124-1 Import 79a 10SV40-NLS-GFP-LacZ nup1241 Import 122b 99SV40-NLS (Mut)-GFP-LacZ nup1241 Import 66b 0SV40-NLS-GFP-LacZ nup124-1 Import 117b 96SV40-NLS (Mut)-GFP-LacZ nup124-1 Import 54b 0Nucleoplasmin-NLS-GFP nup1241 Import 88b 98Nucleoplasmin-NLS (Mut)-GFP nup1241 Import 89b 0Nucleoplasmin-NLS-GFP nup124-1 Import 89b 98Nucleoplasmin-NLS (Mut)-GFP nup124-1 Import 90b 0Poly(A) mRNA nup1241 Export 123c 0.81Poly(A) mRNA nup124-1 Export 153c 1.96Poly(A) mRNA rae1-1 Export 87c 94

a Only nuclei of cells displaying a Gag-specific FITC generated immunofluorescence (a), GFP-specific fluorescence (b), or FITC-conjugated anti-deoxygenin-generated immunofluorescence (c) were tabulated.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

FIG. 8. Analysis of interactions between Gag and Nup124p. (A) Segments 1 through 6 of Nup124p correspond to the following amino acids of Nup124p: 1, 1 to91; 2, 92 to 306; 3, 307 to 521; 4, 522 to 736; 5, 737 to 951; 6, 952 to 1152. Corresponding nucleotide sequence were fused to the transcription activation domain B42.Numbers above and below the arrowheads indicate the primers used to generate the PCR products that were inserted into the two-hybrid vectors. (B) Summary oftwo-hybrid interactions between segments 1 to 6 of Nup124p expressed as fusions to the LexA binding domain and the Tf1 Gag expressed as a fusion to the B42activation domain. Potential interactions were scored as growth on SC medium containing galactose and lacking leucine. All fusions were tested for intrinsic ornonspecific activation. The AD plasmids were cotransformed with LexA fused to the Bicoid protein to test for specificity of interaction with each of the BD fusions,while all the BD plasmids were cotransformed with an empty AD to test for intrinsic activation. The BD fusion with the Gag protein resulted in significant intrinsicactivation and therefore could not be used in this study. All other fusions used did not intrinsically or nonspecifically activate expression of the LEU2 reporter.Additionally, a positive control was used in these two-hybrid experiments based on the strong interaction of murine p53 and SV40 large T antigen. Plasmids containingp53 fused to LexA and SV40 large T antigen fused to B42 (Clontech) were cotransformed into EGY48 and tested for growth on medium lacking leucine. Strainscontaining these fusion proteins showed visible growth in approximately 1 to 2 days. (C) GST precipitation analysis of interactions between purified samples of Gagand two portions of Nup124p. The N-terminal and C-terminal portions of Nup124p as well as GST and GST-Gag were purified from bacteria. The GST and GST-Gag


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

reduction in import of another protein that, in turn, was re-quired for Gag import. However, the following observationsuggested that Nup124p contributed directly to the nuclearlocalization of Gag. We noted that the nup124-1 allele causeda substantial reduction in colony size in cells that were sub-jected to multiple cycles of Tf1 induction (results not shown).A single cycle of growth on induction medium, as was typical ofthe transposition assay, did not result in a reduction in growthor viability. This genetic interaction of Tf1 expression with thedefect in Nup124p may have resulted from the overaccumula-tion of Gag and its association with Nup124p. Additional ex-periments were developed to test directly for an interactionbetween Gag and Nup124p.

We used the two-hybrid system of S. cerevisiae to identifysequences within Nup124p that may interact with Gag. Thecoding sequence of nup124 was divided into six segments thatwere individually fused to the DNA BD of LexA. The Gagprotein was fused to a transcriptional AD, B42 and tested forinteractions with each of the six segments of Nup124p (Fig.8A). Segments 2 and 3 of nup124 interacted strongly with Gag,as indicated by expression of a reporter gene that allowedgrowth on medium lacking leucine (Fig. 8B). In addition, seg-ments 5 and 6 showed weak interaction with Gag. All theinteractions observed were specific in that they required theexpression of both fusion proteins and that the fusion proteinsinclude the Nup124p and Gag sequences.

The results of the two-hybrid analysis indicated that Gagmay interact with segments of nup124. However, it was possi-ble that the interaction was mediated by additional factors. Weasked whether Gag could interact directly with regions ofnup124 by expressing the proteins in bacteria as GST fusionsand subjecting them to precipitation analysis. An N-terminaldomain (segments 2 and 3) and a C-terminal domain (seg-ments 4 to 6) of Nup124p, as well as the intact Gag, were fusedto the C terminus of GST and expressed in bacteria. All threefusion proteins were purified from bacterial extracts by usingglutathione-Sepharose, and the GST domains were cleaved offthe two segments of Nup124p. Gag bound to the Sepharosebeads was mixed separately with the N-terminal and C-termi-nal domains of Nup124p, and after an incubation of 45 min,the beads were pelleted and washed. Figure 8C shows that afraction of the N-terminal domain of Nup124p did pellet withGST-Gag but not with GST alone attached to beads. Thisdirect interaction was specific in that the C-terminal domain ofNup124p did not precipitate with the GST-Gag. The copre-cipitation of Gag with segments 2 and 3 of Nup124p coincidedwith the observation that the strongest interaction detected bytwo-hybrid analysis was between Gag and segments 2 and 3 ofNup124p.

DISCUSSION

Nup124p is a nuclear pore factor required for nuclear lo-calization of Tf1. The nup124 gene was predicted to encode aprotein of 124 kDa with 11 copies of the FXFG repeats in afamily of nuclear pore factors. BLAST-based alignments con-firmed that Nup124p was most closely related to a large classof nuclear pore factors that possess variable numbers and ar-rangements of FXFG repeats. The nuclear pore proteins with

FXFG repeats encoded in the genome of S. cerevisiae includeNup1p, Nup2p, Nsp1p, and Nup159p. Some mammalian nu-clear pore factors with FXFG repeats are Nup153p, Nup358p,Nup62, and Nup214p. The results of in vitro binding experi-ments led to the current model that the FXFG repeats of thefactors in the NPC serve as docking sites for karyopherinproteins associated with transport cargo (1, 56, 59, 71). Arelated class of nuclear pore proteins possesses repeats ofGLFG and also participates in nuclear transport. Members ofthis class of factors bind karyopherin complexes in vitro andappear to participate in nuclear export (65).

That nup124 encoded a component of the NPC was indi-cated by the nuclear-rim signal produced by the HA-Nup124pprotein in immunolocalization experiments and by the resultsof immunoelectron microscopy studies. The identification ofNup124p as a nuclear pore factor supports the evidence thatnup124-1 caused a defect in the transport of FLAG-Gag to thenucleus. The immunofluorescence of cells treated with anti-FLAG antibodies revealed that the nup124-1 allele caused a7.3-fold drop in the number of nuclei with high levels ofFLAG-Gag. The drop in the number of nuclei with significantconcentrations of FLAG-Gag correlated well with the 4.6-foldincrease in the number of cells with large aggregates of FLAG-Gag attached to the outside of the nuclear envelope.

Although we have no direct evidence that the nuclear importof Gag is required for transposition, the presence of Gag in thenucleus supports this possibility. The capsid proteins of manyviruses form complexes with viral RNA or DNA that are im-ported into the nucleus. For example, the matrix protein ofHIV is a component of the preintegration complex and pos-sesses NLS activity that may contribute to the infectivity ofnondividing cells (9, 18, 19). The behavior of Tf1 proteins insucrose gradients indicated that in cells grown to stationaryphase, the bulk of Gag and IN are coassembled into VLPs thatalso contain cDNA (40). Therefore, the results of the sucrosegradient fractionation and the immunolocalization of Gag in-dicate that these components are probably present together inthe nucleus as VLPs. Unfortunately, we have been unable, byimmunofluorescence microscopy, to detect Tf1 IN in wild-typecells that were grown to stationary phase. The level of IN instationary-phase cells is very low due to a regulated degrada-tion process that lowers the amount of IN by more than 20-fold(3). The results of the cDNA recombination assays indicatedthat the nup124-1 mutation also disrupted the nuclear importof the Tf1 reverse transcripts. If the cDNA is imported into thenucleus as a component of the preintegration complex, assuggested above, the mislocalization of this complex couldgreatly reduce the potential for homologous recombinationbetween cDNA and plasmid sequences of Tf1.

The nuclear import of Tf1 is specifically inhibited by thenup124-1 allele. Because most proteins larger than 40 kDa arethought to require active transport through the NPC beforethey can accumulate in the nucleus, we expected that a muta-tion in an individual pore factor could lead to defects in theimport of many cellular proteins. Nevertheless, the wild-typegrowth of strains with the nup124-1 allele indicated that thebulk of nuclear import was unaffected by the mutation. We alsoexamined the nuclear import of two proteins that possessedtwo different types of NLSs. We found that the nup124-1 mu-

proteins were coupled to glutathione-Sepharose and combined with either the C-terminal or N-terminal fragments of Nup124p. The samples were incubated at roomtemperature for 45 min and washed three times in binding buffer. The beads and the supernatant were combined with 23 sample-loading buffer and loaded in equalproportions onto an SDS–10% polyacrylamide gel that was stained with Coomassie blue. The brackets over S and P indicate the pairs of supernatant and pellet fractionsfrom separate binding reactions. The components of each binding reaction are indicated by plus signs above each bracket. The positions of molecular mass standardsare indicated on the left of the panel.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

tation did not reduce the nuclear localization of SV40 NLS-GFP-LacZ or GFP-nucleoplasmin. These result indicated thatthe karyopherin functions required for the transport of pro-teins with classical or bipartite NLSs were unaffected by thenup124-1 allele.

Two other properties of the NPC that were investigatedwere the ability to export poly(A) mRNA and the distributionof the NPCs within the nuclear envelope. These characteristicswere examined in cells with the nup124-1 mutation, because anumber of strains of S. cerevisiae with defects in nuclear poreproteins show increased levels of poly(A) mRNA in the nu-cleus as well as clustering of NPCs in the nuclear envelope (6,14, 22, 27, 42, 63, 64). The observation that the nup124-1mutation did not visibly alter the export of mRNA from thenucleus or the gross distribution of the NPCs in the nuclearenvelope provided further evidence that this mutation did notreduce the ability of the pore complexes to transport materialin and out of the nucleus. In addition, these results indicatethat Nup124p possesses an activity required for the nuclearimport of Tf1 that does not appear to be required for theoverall function of the NPCs.

The defect in the transport of Tf1 material might not havebeen directly due to a lack of Nup124p function but, instead,might have been caused by the mislocalization of another pro-tein that contributed to Tf1 import. The results of two-hybridanalysis revealed strong interactions between Gag and aminoacid residues 92 to 521 of Nup124p (Fig. 8). These resultscorrelated well with results of experiments that showed that,as purified proteins from bacteria, the N-terminal half ofNup124p bound and coprecipitated with Gag fused to GST.The detection of this interaction by direct binding in vitro andby two-hybrid analysis in vivo suggested that Nup124p contrib-utes directly to the nuclear import of Gag.

The mutation in the nup124-1 allele was found to be anonsense mutation that shortened the ORF by 32% and as aresult removed 9 of the 11 copies of the FXFG repeats. There-fore, the nup124-1 mutation left intact the coding sequence forthe portion of the protein that interacted with Gag in thetwo-hybrid and GST precipitation analyses. The presence ofthe interaction domain in the defective form of Nup124-1suggests that the drop in the nuclear localization of Gag due tothe mutation in nup124-1 was not the result of reduced bindingof Gag caused by an altered conformation of the binding sur-face of Nup124p. The accumulation of Gag outside the nucleusin cells with the nup124-1 allele suggests the possibility that theN-terminal domain of Nup124p was present in the NPC andbound Gag, but the absence of the C-terminal portion ofNup124p may have inhibited the release of Gag and its sub-sequent import. Alternatively, the C-terminal domain ofNup124p may contribute to the binding of Gag, and althoughthis interaction was not detected by our binding assays, it maybe important for binding in vivo. Another possibility is that thetruncation of Nup124p caused a change in the localization ofthe protein. For example, the C-terminal truncation ofNup124p may remove structures necessary for its interactionwith the NPC. As a result, Gag would not be able to completeits process of nuclear import.

If FXFG domains play an important role in docking thesubstrates of nuclear transport, why did the nup124-1 mutationblock the nuclear import of Gag but not of other proteins? Theanswer to the specificity of the import defect may lie in theinteraction between Tf1 Gag and Nup124p. This particularinteraction may play a central role in the docking of Tf1 VLPsto the NPC. The import of cellular proteins may not requireinteractions with specific nuclear pore proteins, but instead,may occur via proteins with redundant function. Evidence that

FXFG and GLFG motifs possess redundant functions existsfor Nsp1p (FXFG protein), Nup49p (GLFG protein), Nup57p(GLFG protein), and Nup145p (GLFG protein) of S. cerevi-siae. Although all four of these proteins are essential for via-bility (23, 50, 66, 69), deletion of the FXFG or GLGF repeatsin these proteins does not reduce viability (23, 29, 50, 63, 66).As a result of these observations, the essential functions thatmapped to the nonrepeat portions of the pore proteins arethought to be structural.

We propose that Tf1 evolved an import strategy that relieson a specific interaction between Gag and the N terminus ofNup124p. We predict that the interaction between Gag andNup124p is required for import of Gag. Future experimentswill be conducted to test the impact of mutations in the N-terminal domain of Nup124p on the localization of Gag in thenucleus.

Although little is known about the nuclear pore proteins thatare directly responsible for the import of large viral complexes,recent results indicate that the Vpr protein of HIV-1 plays aunique role in the nuclear import of the HIV-1 proteins (16,30, 54, 61). Although the matrix (MA) and IN proteins of HIVcarry conventional NLSs and probably use the karyopherin a/bpathway for nuclear import (17, 18), Vpr has karyophilic prop-erties that contribute significantly to the HIV infection of non-dividing cells (18, 61). Vpr localizes at the nuclear envelope ofyeast and human cells, and this behavior is thought to lead tothe import of preintegration complexes (16, 61). Evidence forthis model includes the finding that Vpr is a component of thepreintegration complex and that Vpr also interacts with FXFGrepeat nucleoporins (19, 28, 61). Recently, Vpr was found tointeract directly with Pom121, a nuclear pore factor that con-tains FXFG repeats (16). This result suggests that Vpr maycontribute to the import of HIV preintegration complex bycausing a direct interaction between the preintegration com-plex and FXFG-containing proteins in the NPC. Consistentwith this model is the finding that Vpr uses an import pathwaydistinct from classical NLS or M9 substrates (30). This special-ized role of Vpr in the nuclear import of HIV is surprisinglysimilar to the importance of nup124 for the import of Tf1 Gagand suggests that large viral complexes may require directcontacts with FXFG proteins to successfully navigate throughthe NPC. Nevertheless, our result that the nuclear import of aVLP can be inhibited without affecting the import of otherproteins suggests that the reduction of nuclear import mayprove to be an effective strategy for antiviral therapies.

ACKNOWLEDGMENTS

Portions of this work was supported by National Institutes of Healthgrant RR-0592 to J. Richard McIntosh.

Cindy Troxell and Richard McIntosh kindly provided pCS2pkSubefore publication. We thank Shelley Sazer and Susan Forsburg formany helpful suggestions. We are grateful to Ravi Dhar and WilliamWhalen for providing the strain with the rae1-1 allele and for guidancewith the analysis of poly(A) mRNA. Sally Pasion and Susan Forsburggenerously provided SV40-NLS-GFP-lacZ plasmids in advance of pub-lication. We also thank Mary Dasso for reading the manuscript andproviding helpful suggestions.

REFERENCES

1. Aitchison, J. D., G. Blobel, and M. P. Route. 1996. Kap104p: a karyopherininvolved in the nuclear transport of messenger RNA binding proteins. Sci-ence 274:624–627.

2. Atwood, A., J. Choi, and H. L. Levin. 1998. The application of a homologousrecombination assay revealed amino acid residues in a long terminal repeatretrotransposon that were critical for integration. J. Virol. 72:1324–1333.

3. Atwood, A., J. Lin, and H. Levin. 1996. The retrotransposon Tf1 assemblesvirus-like particles with excess Gag relative to integrase because of a regu-lated degradation process. Mol. Cell. Biol. 16:338–346.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

4. Azad, A. K., T. Tani, N. Shiki, S. Tsuneyoshi, S. Urushiyama, and Y. Oh-shima. 1997. Isolation and molecular characterization of mRNA transportmutants in Schizosaccharomyces pombe. Mol. Biol. Cell 8:825–841.

5. Berkower, C., D. Loayza, and S. Michaelis. 1994. Metabolic instability andconstitutive endocytosis of STE6, the a-factor transporter of Saccharomycescerevisiae. Mol. Biol. Cell 5:1185–1198.

6. Bogerd, A. M., J. A. Hoffman, D. C. Amberg, G. R. Fink, and L. I. Davis.1994. nup1 mutants exhibit pleiotropic defects in nuclear pore complexfunction. J. Cell Biol. 127:319–332.

7. Brown, J. A., A. Bharathi, A. Ghosh, W. Whalen, E. Fitzgerald, and R. Dhar.1995. A mutation in the Schizosaccharomyces pombe rae1 gene causes de-fects in poly(A)1 RNA export and in the cytoskeleton. J. Biol. Chem.270:7411–7419.

8. Bukrinsky, M. I., S. Haggerty, M. P. Demsey, N. Sharova, A. Adzhubel, L.Spitz, P. Lewis, D. Goldfarb, M. Emerman, and M. Stevenson. 1993. Anuclear localization signal within HIV-1 matrix protein that governs infec-tion of non-dividing cells. Nature 365:666–669.

9. Bukrinsky, M. I., N. Sharova, T. L. McDonald, T. Pushkarskaya, W. G.Tarpley, and M. Stevenson. 1993. Association of integrase, matrix, andreverse transcriptase antigens of human immunodeficiency virus type 1 withviral nucleic acids following acute infection. Proc. Natl. Acad. Sci. USA90:6125–6129.

10. Cottarel, G., D. Beach, and U. Deuschle. 1993. Two new multi-purposemulticopy Schizosaccharomyces pombe shuttle vectors, pSP1 and pSP2.Curr. Genet. 23:547–548.

11. Dang, V. D., M. J. Benedik, K. Ekwall, J. Choi, R. C. Allshire, and H. L.Levin. 1999. A new member of the sin3 family of corepressors is essential forcell viability and required for retroelement propagation in fission yeast. Mol.Cell. Biol. 19:2351–2365.

12. Ding, R., R. R. West, D. M. Morphew, B. R. Oakley, and J. R. McIntosh.1997. The spindle pole body of Schizosaccharomyces pombe enters and leavesthe nuclear envelope as the cell cycle proceeds. Mol. Biol. Cell 8:1461–1479.

13. Doye, V., and E. Hurt. 1997. From nucleoporins to nuclear pore complexes.Curr. Opin. Cell Biol. 9:401–411.

14. Fabre, E., W. C. Boelens, C. Wimmer, I. W. Mattaj, and E. C. Hurt. 1994.Nup145p is required for nuclear export of mRNA and binds homopolymericRNA in vitro via a novel conserved motif. Cell 78:275–289.

15. Feldherr, C. M., E. Kallenback, and N. Schulz. 1984. Movement of a karyo-philic protein through the nuclear pores of oocytes. J. Cell Biol. 99:2216–2222.

16. Fouchier, R., B. Meyer, J. Simon, U. Fischer, A. Albright, F. Gonzalez-Scarano, and M. Malim. 1998. Interaction of the human immunodeficiencyvirus type 1 Vpr protein with the nuclear pore complex. J. Virology 72:6004–6013.

17. Gallay, P., T. Hope, D. Chin, and D. Trono. 1997. HIV-1 infection ofnondividing cells through the recognition of integrase by the importin/karyo-pherin pathway. Proc. Natl. Acad. Sci. USA 94:9825–9830.

18. Gallay, P., V. Stitt, C. Mundy, M. Oettinger, and D. Trono. 1996. Role of thekaryopherin pathway in human immunodeficiency virus type 1 nuclear im-port. J. Virol. 70:1027–1032.

19. Gallay, P., S. Swingler, J. Song, F. Bushman, and D. Trono. 1995. HIVnuclear import is governed by the phosphotyrosine-mediated binding ofmatrix to the core domain of integrase. Cell 83:569–576.

20. Golemis, E., J. Gyuris, and R. Brent (ed.). 1996. Interaction trap/two-hybridsystem to identify interacting proteins. John Wiley & Sons, Inc., New York,N.Y.

21. Gorlich, D. 1997. Nuclear protein import. Curr. Opin. Cell Biol. 9:412–419.22. Gorsch, L. C., T. C. Dockendorff, and C. N. Cole. 1995. A conditional allele

of the novel repeat-containing yeast nucleoporin RAT7/NUP159 causes bothrapid cessation of mRNA export and reversible clustering of nuclear porecomplexes. J. Cell. Biol. 129:939–955.

23. Grandi, P., N. Schlaich, H. Tekotte, and E. C. Hurt. 1995. Functional inter-action of Nic96p with a core nucleoporin complex consisting of Nsp1p,Nup49p and a novel protein Nup57p. EMBO J. 14:76–87.

24. Greber, U. F., and H. Kasamatsu. 1996. Nuclear targeting of SV40 andadenovirus. Trends Cell Biol. 6:189–195.

25. Greber, U. F., M. Suomalainen, R. P. Stidwell, K. Boucke, M. W. Ebersold,and A. Helenius. 1997. The role of the nuclear pore complex in adenovirusDNA entry. EMBO J. 16:5998–6007.

26. Gyuris, J., E. Golmis, H. Chertkov, and R. Brent. 1993. Cdi1, a human G1-and S-phase protein phosphatase that associates with Cdk2. Cell 75:791–803.

27. Heath, C. V., C. S. Copeland, D. C. Amberg, V. Del Priore, M. Snyder, andC. N. Cole. 1995. Nuclear pore complex clustering and nuclear accumulationof poly(A)1 RNA associated with mutation of the Saccharomyces cerevisiaeRAT2/NUP120 gene. J. Cell Biol. 131:1677–1697.

28. Heinzinger, N. K., M. I. Bukinsky, S. A. Haggerty, A. M. Ragland, V. Kewal-ramani, M. A. Lee, H. E. Gendelman, L. Ratner, M. Stevenson, and M.Emerman. 1994. The Vpr protein of human immunodeficiency virus type 1influences nuclear localization of viral nucleic acids in nondividing host cells.Proc. Natl. Acad. Sci. USA 91:7311–7315.

29. Iovine, M. K., J. L. Watkins, and S. R. Wente. 1995. The GLFG repetitiveregion of the nucleoporin Nup116p interacts with Kap95p, an essential yeast

nuclear import factor. J. Cell Biol. 131:1699–1713.30. Jenkins, Y., M. McEntee, K. Weis, and W. C. Greene. 1998. Characterization

of HIV-1 vpr nuclear import: analysis of signals and pathways J. Cell Biol.143:875–885.

31. Joyce, C. M., and N. Grindley. 1984. Method for determining whether a geneof Escherichia coli is essential: application to the polA gene. J. Bacteriol.158:636–643.

32. Keeney, J. B, and J. D. Boeke. 1994. Efficient targeted integration at leu1-32and ura4-294 in Schizosaccharomyces pombe. Genetics 136:849–856.

33. Kenna, M. A., C. B. Brachmann, S. E. Devine, and J. D. Boeke. 1998.Invading the yeast nucleus: a nuclear localization signal at the C terminus ofTy1 integrase is required for transposition in vivo. Mol. Cell. Biol. 18:1115–1124.

34. Kukolj, G., K. S. Jones, and A. M. Skalka. 1997. Subcellular localization ofavian sarcoma virus and human immunodeficiency virus type 1 integrases.J. Virol. 71:843–847.

35. Kukolj, G., R. A. Katz, and A. M. Skalka. 1998. Characterization of thenuclear localization signal in the avian sarcoma virus integrase. Gene 223:157–163.

36. Levin, H. L. 1997. It’s prime for reverse transcriptase. Cell 88:5–8.37. Levin, H. L. 1995. A novel mechanism of self-primed reverse transcription

defines a new family of retroelements. Mol. Cell. Biol. 15:3310–3317.38. Levin, H. L. 1996. An unusual mechanism of self-primed reverse transcrip-

tion requires the RNase H domain of reverse transcriptase to cleave an RNAduplex. Mol. Cell. Biol. 16:5645–5654.

39. Levin, H. L., and J. D. Boeke. 1992. Demonstration of retrotransposition ofthe Tf1 element in fission yeast. EMBO J. 11:1145–1153.

40. Levin, H. L., D. C. Weaver, and J. D. Boeke. 1993. Novel gene expressionmechanism in a fission yeast retroelement: Tf1 proteins are derived from asingle primary translation product. EMBO J. 12:4885–4895. (Erratum, 13:1494, 1994.)

41. Levin, H. L., D. C. Weaver, and J. D. Boeke. 1990. Two related families ofretrotransposons from Schizosaccharomyces pombe. Mol. Cell. Biol. 10:6791–6798.

42. Li, O., C. V. Heath, D. C. Amberg, T. C. Dockendorff, C. S. Copeland, M.Snyder, and C. N. Cole. 1995. Mutation or deletion of the Saccharomycescerevisiae RAT3/NUP133 gene causes temperature-dependent nuclear accu-mulation of poly(A)1 RNA and constitutive clustering of nuclear pore com-plex. Mol. Biol. Cell 6:401–417.

43. Lin, J. H., and H. L. Levin. 1997. A complex structure in the mRNA of Tf1is recognized and cleaved to generate the primer of reverse transcription.Genes Dev. 11:270–285.

44. Losson, R., and F. Lacroute. 1983. Plasmids carrying the yeast OMP decar-boxylase structural and regulatory genes: transcription regulation in a foreignenvironment. Cell 32:371–377.

45. Maundrell, K. 1993. Thiamine-repressible expression vector pREP andpRIP for fission yeast. Gene 123:127–130.

46. Mehlin, H., B. Dandeholt, and U. Skoglund. 1992. Translocation of a specificpremessenger ribonucleoprotein particle through the nuclear pore studiedwith electron microscope tomography. Cell 69:605–613.

47. Moore, S. P., L. A. Rinckel, and D. J. Garfinkel. 1998. A Ty1 integrasenuclear localization signal required for retrotransposition. Mol. Cell. Biol.18:1105–1114.

48. Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fissionyeast Schizosaccharomyces pombe. Methods Enzymol. 194:795–823.

49. Nakanishi, A., J. Clever, M. Yamada, P. P. Li, and H. Kasamatsu. 1996.Association with capsid proteins promotes nuclear targeting of simian virus40 DNA. Proc. Natl. Acad. Sci. USA 93:96–100.

50. Nehrbass, U., H. Kern, A. Mutvei, H. Horstmann, B. Marshallsay, and E. C.Hurt. 1990. NSP1: a yeast nuclear envelope protein localized at the nuclearpores exerts its essential function by its carboxy-terminal domain. Cell 61:979–989.

51. Nigg, E. A. 1997. Nucleoplasmic transport: signals, mechanisms and regula-tion. Nature 386:779–787.

52. Ohi, R., A. Feoktistova, and K. L. Gould. 1996. Construction of vectors anda genomic library for use with his3-deficient strains of Schizosaccharomycespombe. Gene 174:315–318.

53. Ohno, M., M. Fornerod, and I. W. Mattaj. 1998. Nucleocytoplasmic trans-port: the last 200 nanometers. Cell 92:327–336.

54. Popov, S., M. Rexach, G. Zybarth, N. Reiling, M. A. Lee, L. Ratner, C. M.Lane, M. S. Moore, G. Blobel, and M. Burkrinsky. 1998 Viral protein Rregulates nuclear import of the HIV-1 pre-integration complex. EMBO J.17:909–917.

55. Reichelt, R., A. Holzenburg, E. L. Buhle, M. Jarnik, A. Engel, and U. Aebi.1990. Correlation between structure and mass distribution of the nuclearpore complex and of distinct pore complex components. J. Cell Biol. 110:883.

56. Rexach, M., and G. Blobel. 1995. Protein import into nuclei: association anddissociation reactions involving transport substrate, transport factors, andnucleoporins. Cell 83:683–692.

57. Robbins, J., S. M. Dilworth, R. A. Laskey, and C. Dingwall. 1991. Twointerdependent basic domains in nucleoplasmin nuclear targeting. Cell 64:615–623.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

58. Rout, M. P., and G. Blobel. 1993. Isolation of the yeast nuclear pore complex.J. Cell Biol. 123:771–783.

59. Rout, M. P., G. Blobel, and J. D. Aitchison. 1997. A distinct nuclear importpathway used in ribosomal proteins. Cell 89:715–725.

60. Stevenson, M. 1996. Portals of entry: uncovering HIV transport pathways.Trends Cell Biol. 6:9–15.

61. Vodicka, M. A., D. M. Koepp, P. A. Silver, and M. Emerman. 1998. HIV-1Vpr interacts with the nuclear transport pathway to promote macrophageinfection. Genes Dev. 12:175–185.

62. von Schwedler, U., R. S. Kornbluth, and D. Trono. 1994. The nuclear local-ization signal of the matrix protein of human immunodeficiency virus type 1allows the establishment of infection in macrophages and quiescent T lym-phocytes. Proc. Natl. Acad. Sci. USA 91:6992–6996.

63. Wente, S. R., and G. Blobel. 1994. NUP145 encodes a novel yeast glycine-leucine-phenylalanine-glycine (GLFG) nucleoporin required for nuclear en-velope structure. J. Cell Biol. 125:955–969.

64. Wente, S. R., and G. Blobel. 1993. A temperature-sensitive NUP116 nullmutant forms a nuclear envelope seal over the yeast nuclear pore complexthereby blocking nucleocytoplasmic traffic. J. Cell Biol. 123:275–284.

65. Wente, S. R., S. M. Gasser, and A. J. Caplan. 1997. The nucleus and

nucleocytoplasmic transport in Saccharomyces cerevisiae, p. 471–546. In J.Pringle, J. Broach, and E. Jones (ed.), The molecular and cellular biology ofthe yeast Saccharomyces. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, N.Y.

66. Wente, S. R., M. P. Rout, and G. Blobel. 1992. A new family of yeast nuclearpore complex proteins. J. Cell Biol. 119:705–723.

67. West, R. R., E. V. Vaisberg, R. Ding, P. Nurse, and J. R. McIntosh. 1998.cut11(1): A gene required for cell cycle-dependent spindle pole body an-choring in the nuclear envelope and bipolar spindle formation in Schizosac-charomyces pombe. Mol. Biol. Cell 9:2839–2855.

68. Whalen, W. A., A. Bharathi, D. Danielewicz, and R. Dhar. 1997. Advance-ment through mitosis require rae1 gene function in fission yeast. Yeast 13:1167–1179.

69. Wimmer, C., V. Doye, P. Grandi, U. Nehrbass, and E. C. Hurt.1992. A newsubclass of nucleoporins that functionally interact with nuclear pore proteinNSP1. EMBO J. 11:5051–5061.

70. Yamada, M., and H. Kasamatsu. 1993. Role of nuclear pore complex insimian virus 40 nuclear targeting. J. Virol. 67:119–130.

71. Yaseen, N. R., and G. Blobel. 1997. Cloning and characterization of humankaryopherin beta3. Proc. Natl. Acad. Sci. USA 94:4451–4456.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/m

cb o

n 31

Dec

embe

r 20

21 b

y 20

2.16

3.87

.219

.

Documents

Nup124p Is a Nuclear Pore Factor of Schizosaccharomyces pombe That Is Important for Nuclear