Oligonucleotide - peptide complexes: phase control by hybridization:Supporting Information

Jeffrey R. Vieregg Michael Lueckheide Amanda B. Marciel Lorraine LeonAlex J. Bologna Josean Reyes Rivera Matthew V. Tirrell

ContentsS1 SI Materials and Methods S1

S1.1 Nucleic acid sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S1S1.2 Peptide Synthesis and Characterization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S2S1.3 Microscopy Image Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S2S1.4 Fluorescence Recovery after Photobleaching . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S2S1.5 Ultraviolet and Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S3S1.6 Salt melting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S3S1.7 Temperature studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S3S1.8 Post-complex behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S3S1.9 Partially-hybridized structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S4S1.10Complexation with polyamines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S4

S2 SI Results S4S2.1 Polymer length, stoichiometry, and concentration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S4S2.2 Infrared Spectroscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S10S2.3 Salt studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S12S2.4 Temperature studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S14S2.5 Post-complexation behavior . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S14S2.6 Polyelectrolyte determinants of complex phase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . S16

S3 Sequence dependence S20

S1 SI Materials and Methods

S1.1 Nucleic acid sequencesThe 22-nt DNA sequence complementary to human microRNA-21 (AMO-21) was used as a base sequence for testing, as thismicroRNA is a common antisense target for therapeutic delivery. Table S1 shows this sequence, as well as related sequencesused to test the effect of DNA length. The extensions were designed using the NUPACK software package1 to minimizesecondary structure formation and self-dimerization. Lyophilized oligonucleotides were resuspended in nuclease-free 0.5XPBS + 5 mM EDTA at a molecular concentration of 2 mM based on absorbance measurements provided by the manufacturers.Immediately prior to use, oligonucleotide solutions were further diluted to 10 mM charge concentration with water.

In order to check whether the complexation behavior observed with the AMO-21 sequence was unique to that sequence,we next generated 22, 44, and 66 nt sequences from nucleotides 23 – 88 of the 88 nt oligonucleotide (i.e. all but the AMO-21portion of that sequence). We repeated the polymer length experiments with these sequences and found, in all cases, identicalresults for the phase of the complexes. These ‘revised’ sequences are listed in Table S2.

The partially-hybridized oligonucleotide structures (Figure S17) were constructed in two ways. Partial duplexes wereconstructed by annealing the 88 nt DNA sequence to the reverse complements of shorter oligonucleotides (10 – 66 nt). Hairpinstructures containing a paired stem and an unpaired apical loop were designed using NUPACK; their sequences are shown inTable S3. The total length was fixed at 44 nt while the number of complementary nucleotides was increased from 6 – 20 nt.

Additional sequences were designed to test for sequence-dependence of the complexes’ behaviors; these are tabulated withthe results of those studies in Section S3.

S1

Length (nt) Sequence (5’ - 3’)22 (AMO-21) TCAACATCAGTCTGATAAGCTA

10 TCAACATCAG44 TCAACATCAGTCTGATAAGCTATGGATACTCGTCTGGACTACTT66 TCAACATCAGTCTGATAAGCTATGGATACTCGTCTGGACTACTT

ACTCACTCATTCATCACTATCT88 TCAACATCAGTCTGATAAGCTATGGATACTCGTCTGGACTACTT

ACTCACTCATTCATCACTATCTACCGTCGCATTCAGCATTCATG

Table S1: Base oligonucleotide sequences. These sequences, with their reverse-complements, are used for the DNA lengthstudies shown in Figures 1 and 2.

Length (nt) Sequence (5’ - 3’)22 rev CTACCGTCGCATTCAGCATTCA44 rev ACTCACTCATTCATCACTATCTACCGTCGCATTCAGCATTCATG66 rev TGGATACTCGTCTGGACTACTTACTCACTCATTCATCACTATCT

ACCGTCGCATTCAGCATTCATG

Table S2: Revised oligonucleotide sequences, generated from DNA 88 sequence

S1.2 Peptide Synthesis and CharacterizationThe (KG)15 and (KGG)10 peptides were synthesized using standard FMOC (9-fluorenylmethyloxycarbonyl) - based solid phasesynthesis on a PS3 automated peptide synthesizer and FMOC-protected amino acids from Protein Technologies Inc.2. Rinkamide resin was used as a solid support, HBTU (2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphatewas used as the coupling agent, activated by N-methylmorpholine. Deprotection of the FMOC group after coupling wasachieved using 20% piperidine in dimethylformamide. After cleavage from the resin with trifluoroacetic acid and precipitationin cold ether, the peptides were characterized by MALDI-TOF ((KG)15 MW 2806.9, calculated 2795.4; (KGG)10 MW 2468.6,calculated (+1 Na+) 2461.8) and by GPC as described below. The peptides were resuspended in 100 mM NaCl and dialyzedextensively against water to produce the chloride salt (verified by 19F NMR), which was then lyophilized, resuspended andneutralized identically to the commercial peptides.

Peptide polydispersity and molecular weight were assessed via gel-permeation chromatography using three 7.8 x 300 mmcolumns (Waters Ultrahydrogel 120, 250, 500) in series and a flow rate of 1 mL/min over 40 min at RT. The eluents were aqueoussolutions containing acetonitrile (5 wt% for (KG)15, 40% for (KGG)10), plus either 3% NaH2PO4 [(KG)15] or 0.1% TFA[(KGG)10], as well as 0.02% NaN3. Refractive index data were collected using an Optilab T-rEX detector (Wyatt Technology)and peptide weight distributions were computed by comparison to a ReadyCal 200 – 1.2x106 D PEG/PEO analytical standard(Fluka). The peptide polydispersity indices (weight-averaged MW / number-averaged MW) were measured to be 1.07 for(KG)15 and 1.15 for (KGG)10, indicating a largely homogeneous population.

S1.3 Microscopy Image AnalysisBright-field micrographs of coacervate droplets were analyzed to determine trends in droplet size vs polymer length and/orcharge ratio using ImageJ 64 software and the following procedure. Background was subtracted using a rolling ball algorithmwith radius optimized for each image (typically 5–6 pixels), then the image was thresholded and inverted to insure that adjacentdroplets were separated (see Figure S4B for an example). Droplet area was then calculated using the Analyze Particles macrowith default settings.

S1.4 Fluorescence Recovery after PhotobleachingFor the FRAP measurements shown in Figure S1, the AMO-21 22 nt oligonucleotide was purchased from IDT with a 5’-fluorescein (FAM) fluorophore label and mixed with unlabeled oligonucleotide at a 10% ratio. Complexes were formed asdescribed in the main text and imaged using a spinning disk confocal microscope (Nikon) equipped with a CCD camera (Zyla;Andor) and a 60x water-immersion objective (Zeiss). An oxygen scavenging system (0.5% v/v 2-mercaptoethanol, 4.5 mg/mLglucose, 2.7 mg/mL glucose oxidase (Calbiochem), 1700 U/mL catalase (Sigma)) was added to minimize photobleachingduring imaging. Selective photobleaching was performed using a 405 nm laser and a micromirror array (MOSAIC; Andor).Recovery was imaged at 3 second intervals for the coacervate droplets and 10 second intervals for the precipitates. To estimatethe recovery time for the coacervates, the average pixel intensity was measured for the bleached portion of the droplet of interest

S2

Stem Loop Sequence (5’ - 3’)6 bp 32 nt TCAACATCAGTCTGATAAGCTACTCCACCTACCTACCCTGTTGA

10 bp 24 nt TCAACATCAGTCTGATAAGCTATGATAAACCGTTCTGATGTTGA15 bp 14 nt TCAACATCAGTCTGATAAGCTACACGACCTCAGACTGATGTTGA20 bp 4 nt TCAACATCAGTCTGATAAGCTATGGCTTATCAGACTGATGTTGA

Table S3: Hairpin oligonucleotide sequences used for partial hybridization measurements (Figure S17B).

and fit to a single exponential as shown in Figure S1B. Background signal was removed by subtracting the mean intensity for adroplet-free area, and the intensity was normalized for photobleaching during imaging by comparison to an unbleached droplet;neither of these corrections affect the fitted recovery time.

S1.5 Ultraviolet and Infrared SpectroscopyUV melt curves and circular dichroism spectra were measured using a Jasco J-815 CD spectropolarimeter. Melt curves wereobtained with oligonucleotide concentrations of 22 µM in 0.2X PBS buffer, pH 7.4. The temperature was ramped at a rate of0.5 C / min with a dwell time of 2–10 s at each data point. In all cases, transitions were observed at identical temperatures forthe upward and downward temperature ramp. CD data presented are an average of five scans collected at 50 nm/min at RT in a1 mm path length cuvette.

FTIR spectra of DNA, poly(L)lysine, and polyelectrolyte complexes were measured using a PerkinElmer Frontier spec-trometer. Complexes were prepared in D2O or H2O at 100 mM NaCl at various N/P ratios (DNA nucleotide concentration fixedat 17 mM) and centrifuged at 17000 rpm for 15 minutes prior to loading. Samples were directly loaded onto a ZnSe plate andmeasured using attenuated total reflectance (ATR) geometry at RT. 128 scans (scanning speed of 0.2 cm/s) from 4000 – 500cm−1 were averaged with a resolution of 2 cm−1. D2O and H2O background subtraction was deemed satisfactory by a flatbaseline at 1900 cm−1 and signals were normalized by the backbone DNA PO2

– symmetric stretch (1086 cm−1).

S1.6 Salt meltingPrecipitate complexes were prepared identically as for the other measurements, at a NaCl concentration of 500 mM and chargeratio of 1.0, in a volume of 100 µL. 2 minutes after plating, precipitate complexes were clearly observed on the bottom ofthe microplate well (Figure S10A). At this point, 6.6 µL of 5 M NaCl solution was applied to the liquid surface (final NaClconcentration 800 mM) and allowed to mix by diffusion while the complexes’ behavior was monitored by phase-contrastmicroscopy.

S1.7 Temperature studiesDouble-stranded complexes were prepared at the specified temperatures and loaded into pre-equilibrated hydrophobic wellplates. The samples were observed using an Olympus IX81 inverted widefield microscope equipped with a Bioptech Stable Zwarming system.

S1.8 Post-complex behaviorFor the fluorescence experiments shown in Figure 3, movies Non-complementary fluor and Complementary fluor,and Supporting Figure S12, oligonucleotides were purchased from IDT with 5’-amine labels (6 carbon linker) and conjugatedwith NHS esters of fluorescein (FAM) and tetramethylrhodamine (TAMRA) using standard reaction conditions. Fluorescentoligonucleotides were mixed with unlabeled oligonucleotides at a 10% ratio (FAM) and 1% ratio (TAMRA) and complexeswere formed as described in the main text. The fluorophores were excited with 490/20 and 565/25 bandpass filters and emissionlight was collected with 528/38 and 620/60 nm filters for fluorescein and TAMRA, respectively. FRET images were collectedusing fluorescein excitation and TAMRA emission filters; spectral bleed-through was corrected using the PixFRET plug-in forImageJ.

The experiments in which additional DNA was added to pre-formed coacervate complexes (Figure S13) were performedby preparing coacervate complexes with 22-nt DNA and 50 aa pLys as for the other measurements ([DNA phosphate] = 2.5mM) but with additional pLys ([pLys amine] = 4.3 mM), resulting in a fractional positive charge ratio of 0.63. After theseequilibrated, additional DNA (either complementary or non-complementary) was added in the same quantity as originally used,resulting in a final charge ratio of 0.44. Evolution of the complexes was then followed by optical microscopy for one hour.

S3

S1.9 Partially-hybridized structuresPartial duplexes were formed by annealing 88-nt DNA with the complements of 10-, 22-, 44-, and 66-nt DNA (Table S1) inthe same way as for the double-stranded experiments. The hairpin oligonucleotides were annealed using the same procedure toensure proper folding.

S1.10 Complexation with polyaminesSpermine (Alfa Aesar) and putrescine (Sigma-Aldrich) were purchased as hydrochloride salts, and spermidine (Alfa Aesar) asa free base, which was neutralized analogously to the peptides before use. Sheared salmon sperm DNA (average length 2000bp) was purchased from Fisher and used without further purification.

S2 SI Results

S2.1 Polymer length, stoichiometry, and concentrationFigure 1 in the main text shows typical micrographs of complexes formed by single- and double-stranded 22 nt DNA and 50aa pLys. We prepared combinations of all polymer lengths (10, 22, 44, 66, 88 nt DNA, both single- and double-stranded,and 10, 30, 50, 100 aa pLys) at charge ratios ([amine]/[phosphate], N/P ) from 0.1–9. In all cases, complexes containingsingle-stranded DNA were observed to form coacervate droplets while complexes containing double-stranded DNA formedprecipitates. We performed fluorescence recovery after photobleaching (FRAP) measurements (Figure S1) to verify the phaseof the complexes. The droplets containing single-stranded DNA showed fluorescence recovery from strong bleaching on thescale of several minutes (Panel A), while the double-stranded DNA precipitates did not exhibit significant recovery, consistentwith formation of liquid and solid phases, respectively.

Micrographs for representative complexes are shown in Figures S2 and S3, along with histograms of droplet size for thecoacervates. A sample binary image intermediate is shown in Figure S4, along with a plot of droplet size vs polymer length andrepresentative plots of droplet size vs charge ratio and NaCl concentration. With the exception of the complex formed between10 nt DNA and 10 aa pLys, droplet size was observed to be largely independent of the length of either polymer. The largestdroplets were observed near bulk charge neutrality (N/P = 1, f+ = 0.5) , which is consistent with the soluble DNA resultsshowing neutral complex formation; since the total amount of charged groups is held constant in these series, the most materialis available for complexation when the bulk stoichiometry is also neutral.

Figure S5 shows micrographs of complexes mixed at varying concentrations, from 0.1 to 10 mM total charge ([DNAphosphate] + [pLys amine]). While the size of the droplets / precipitates varies roughly with concentration, we observe nochange in the phase of the complexes over the range that we could assess by light microscopy. As the concentration decreased,longer times were required before complexes aggregated to a size sufficient for them to be seen in our microscope. Dynamiclight scattering measurements indicate that complexes form at concentrations at least as low as 2.5 µM but this technique doesnot allow determination of their phase.

S4

A Coacervate droplets: 22 nt ssDNA, 30 aa pLyst = 46.7 sec t = 113.6 secBefore bleach Bleached (t=0)

t = 113.6 sec t = 116.7 sec t = 131.8 sec

Dropletcoalescence

C Precipitates: 22 nt dsDNA, 30 aa pLyst = 20 minutesBefore bleach Bleached (t=0)

Mea

n In

tens

ity (A

U)

Time (sec)

BCoalescence

Recovery time (fit): 350 sec

Figure S1: Fluorescence recovery after photobleaching measurements of 22 nt/bp DNA, 30 aa pLys complexes. A) Fluorescencerecovery of coacervate droplets. The lower half of a droplet was selectively bleached, and recovered over several minutes’ time.At t ≈ 115 seconds, a small droplet (barely visible in the lower left corner of the previous frame) merges with the bleacheddroplet, leading to a local increase in fluorescence that then diffuses. B) Quantification of average fluorescence in the bleachedarea (approximate ROI shown in green) shows drop upon bleaching followed by recovery. Fitting to a single exponential givesa characteristic recovery time of 350 seconds. Intensity is normalized for photobleaching during imaging by comparison tounbleached droplets. C) Precipitate complexes containing double-stranded DNA do not show appreciable fluorescence recoveryover a time scale at least 10 times longer than the coacervate droplets.

S5

ss10

/p(L

)K30

N/P = 0.1 N/P = 1.5 N/P = 9

ss44

/p(L

)K10

0ss

88/p

(L)K

50

30µm scale bar

Figure S2: Phase contrast optical micrographs of single-stranded DNA/pLys coacervates at different fractional positive chargesover a range of polymer length combinations, with droplet size distributions (note that the micrographs shown are representativeportions of larger images, cf full-size image in Figure S4A).

S6

N/P = 0.1

22bp

/ pL

ys10

66

bp /

pLys

3088

bp /

pLys

100

N/P = 1.5 N/P = 9

30µm

30µm

30µm30µm30µm

30µm30µm

30µm30µm

Figure S3: Phase contrast optical micrographs of double-stranded DNA/pLys precipitates at different fractional positive chargesover a range of polymer length combinations. The quantity of precipitates formed appears larger near charge neutrality andsmaller when farther away.

S7

10080604020Poly-(L)-Lysine Length

A B C

D E F

G H I

Figure S4: Coacervate droplet image analysis. A) Raw microscope image (note scale bar). B) Same image after backgroundsubtraction, thresholding, and inversion. C) Mean droplet size vs polymer length at bulk neutrality (N/P = 1, f+ = 0.5).D–F) Mean droplet size vs fractional charge ratio (f+ = [amine]/([amine] + [phosphate])) for D) 22 nt DNA - 50 aa pLys,E) 10 nt DNA - 10 aa pLys, F) 88 nt DNA - 100 aa pLys complexes. G–I) Mean droplet size vs salt concentration for samelength combinations as D–F. Maximum droplet size is observed near 500 mM NaCl for most length combinations (10 nt - 10aa complexes are soluble at this concentration).

S8

22 bp dsDNA +100 aa pLys

0.125 mM 0.25 mM 0.5 mM

1 mM 2.5 mM 5 mM 10 mM

22 nt ssDNA +100 aa pLys

0.125 mM 0.25 mM 0.5 mM

1 mM 2.5 mM 5 mM 10 mM

Figure S5: Phase contrast optical micrographs of single- and double-stranded DNA/pLys complexes prepared at different totalcharge concentrations ([DNA phosphate + pLys amine], 5 mM is same concentration as main text figures). Liquid droplets areobserved for single-stranded DNA complexes and precipitates are observed for double-stranded complexes at all concentrations.

S9

S2.2 Infrared SpectroscopyIn order to characterize the complexes at the molecular level, we measured the infrared absorption spectrum of the pLys/DNAcomplexes, as well as that of the DNA and pLys polymers on their own. Figures S6 and S7 show the FTIR spectra of com-plexes formed between single-stranded (ss) and double-stranded (ds) DNA and pLys at wavelengths containing characteristicDNA absorption bands3,4. The phosphate symmetric stretch absorption band at 1086 cm−1 is relatively insensitive to DNAconfiguration and is used as an internal standard to normalize the spectral intensities3. pLys has a largely flat absorption spec-trum at these wavelengths, so any spectral changes should reflect complexation of the DNA. Figure S6 shows the effect ofcomplexation of single-stranded DNA at various charge ratios. As the amount of lysine increases (increasing N/P ratio), strongincreases in absorption are seen for the asymmetric phosphate stretch (1223 cm−1) and several sugar vibration bands (970,1012, 1055 cm−1), consistent with DNA complexation. Redshifts also are observed for the 1223 cm−1 asymmetric stretch and970 cm−1 backbone band. Both features indicate strong interactions between the positively-charged pLys and the anionic DNAbackbone and are consistent with previous observations of DNA complexation by polypeptides and proteins5,6.

Figure S7 compares the spectra of complexes formed by single-stranded and double-stranded DNA. Similar increasesand shifts are seen in the asymmetric phosphate stretch and sugar vibration absorption bands, consistent with the commonelectrostatic character of the pLys-DNA interaction. The double-stranded DNA also displays several unique features (mostnotably the nucleobase in-plane stretch peak at 1714 cm−1 (S3) and the lower ratio of 1055 to 1086 cm−1 peak heights) thatare preserved after complexation, indicating minimal distortion of the B-form duplex.

Symmetric stretchof PO2

-

Phosphodiester or C-Odeoxyribose stretch

Deoxyribosevibration

Deoxyribose C-Cstretch

Deoxyribosering vibration

S-type sugar vibration

dTS-type

Wavenumber (cm-1)

Abso

rban

ce (a

.u.)

1.0

1.6

0.8

1.6

0.6

1.6

0.4

0.4

08009001000110012001300

Asymmetric stretchof PO2

-

ss88/pLys N/P 10ss88/pLys N/P 5ss88/pLys N/P 1ss88/pLys N/P 0.5ss88 DNA

Figure S6: FTIR absorption spectra of 88 nt ssDNA and ssDNA - pLys (100 aa) complexes at different charge ratios, normalizedto the phosphate symmetric stretch band at 1086 cm−1. Upon complexation, increased absorption is seen in a variety ofbackbone modes, and two prominent backbone bands are shifted to lower frequencies: 1223 to 1215 and 970 to 965 cm−1.Both changes increase in magnitude as more pLys is added to the system.

S10

Wavenumber (cm-1)

Abso

rban

ce (a

.u.)

Base double bondin-plane stretch

N-type sugar vibration

ds88 / pLysss88 / pLys

ds88 DNAss88 DNA

Figure S7: FTIR absorption spectra of ss and dsDNA before and after complexation by 100 aa pLys atN/P = 1. Complexationof single- and double-stranded DNA shows many of the same spectral changes, indicative of a common mode of interaction.Several markers of hybridization are observed in the dsDNA spectrum, including the nucleobase stretch peak at 1714 cm−1

and weaker absorption at 1055 cm−1 and 1223 cm−1 compared to the ssDNA spectrum. These features are preserved in thecomplexes, consistent with minimal distortion of the B-form DNA duplex structure.

S11

S2.3 Salt studiesFigure 2 in the main text shows micrographs of 66 nt/bp DNA - 50 aa pLys complexes at selected NaCl concentrations. Asshown in panels C and D of that figure, we measured complex behavior from 0 – 1 M NaCl for every polymer length combina-tion, and up to 1.4 M for complexes that had not dissolved by 1 M NaCl. Figures S8 and S9 show additional micrographs, aswell as droplet size distributions for single-stranded complexes. Although stability increases with polymer length, qualitativetrends are similar for all the single-stranded complexes: very small droplets at low salt, micron-sized droplets at intermediatesalt concentrations, followed by shrinkage and dissolution at higher concentration. The precipitates also follow a commonpattern: rough-edged conglomerates that become more rounded at an intermediate concentration and then either dissolve (toprow of Figure S9) or melt into liquid droplets. As shown in Figure 2C, the latter behavior is observed for complexes formedfrom longer polymers, and the former for shorter polymers. Given the granularity of our data, we cannot rule out the possibilitythat the short-polymer complexes also melt at some NaCl concentration. However, the melting concentration (500–700 mMNaCl) appears to depend only weakly on polymer length and many of the short-polymer complexes are completely dissolvedat concentrations lower than this, suggesting a direct transition from solid to soluble.

22nt

/ pL

ys50

0 mM NaCl 100 mM NaCl

66nt

/ pL

ys30

900 mM NaCl

NaCl 0 mM

88nt

/ pL

ys10

800 mM NaCl

700 mM NaCl

100 mM NaCl

100 mM NaCl

0 mM NaCl

0 mM NaCl

800 mM NaCl

700 mM NaCl

Scale bar: 30 μM

Figure S8: Phase contrast optical micrographs of representative single-stranded DNA/pLys coacervates prepared at differentNaCl concentrations. Droplet size distributions were obtained with the same methodology as for the charge ratio experiments.

As mentioned in the main text, the above images are for complexes prepared at the specified salt concentrations. In order toexamine the kinetics of the precipitate – coacervate transition, we added salt to pre-formed precipitate complexes. We observedrapid melting of the complexes; the precipitates appear to ‘round up’ and soften, then split into droplets, roughly mirroringthe morphologies observed for complexes prepared at increasing NaCl concentrations. Figure S10 shows still images from atypical transition, and a time-lapse movie (NaCl melting movie.avi) shows the course of the reaction: liquid dropletsare clearly observed at the bottom of the well as soon as 3 minutes after salt is added.

S12

10bp

/ pL

ys10

0 mM NaCl 100 mM 400 mM44

bp /

pLys

50

0 mM 300 mM 600 mM 900 mM

0 mM 100 mM 1000 mM 1400 mM

88bp

/ pL

ys10

0

30µm scale barfor all images

Figure S9: Phase contrast optical micrographs of representative double-stranded DNA/pLys complexes prepared at differentNaCl concentrations.

66 bp dsDNA / 100 aa pLys complexes

30 µm

500 mM NaCl30 µm

800 mM NaCl

Figure S10: Melting of precipitate complexes upon addition of salt. Left panel shows complexes prepared at 500 mM NaCl,below the transition concentration for this length combination. Right panel shows the same field of view 7 hours after additionof concentrated salt solution. As seen in the accompanying movie, melting occurs rapidly, but time is required for the dropletsto settle down to the bottom of the well and coalesce.

S13

S2.4 Temperature studiesFigure 2E shows a precipitate-coacervate transition for the 10 bp DNA duplex at ∼ 50◦C and 300 mM NaCl. In order tounderstand this, we calculated and measured the melting temperatures for the DNA duplexes (Table S4). Our experimentalapparatus allowed access to temperatures up to ∼ 55◦C, which is less than the melting temperature for the longer duplexes.

Length Predicted Tm (◦C) Measured Tm (◦C)10 bp 46.0± 1.4 50± 122 bp 69.1± 1.4 72± 144 bp 79.4± 1.4 82± 166 bp 81.7± 1.4 83± 188 bp 83.6± 1.4 85± 1

Table S4: Predicted (IDT OligoAnalyzer) and measured melting temperatures for the DNA duplexes at 300 mM NaCl

S2.5 Post-complexation behaviorFigure 3 shows the results of mixing pre-formed coacervate complexes doped with fluorophore-labeled DNA: droplets contain-ing non-complementary DNA oligonucleotides merge and undergo rapid hydrodynamic relaxation to apparently homogeneousspheres, while droplets containing complementary oligonucleotides appear to stick on contact, forming irregularly-shaped struc-tures that become more homogeneous in color over time. Movies of both mixing reactions are included (Non-complementaryfluor movie.avi and Complementary fluor.avi). Pipette agitation of the complementary-coacervate reaction(Figure S11) produces large precipitates similar to those observed when the DNA is annealed prior to addition of the polyca-tions.

Pre-mixed Post-agitation TAMRA-DNA 22 / pLys50 + FAM-rcDNA 22/pLys50

Figure S11: Fluorescence optical micrographs of precipitates formed from the same materials as in main text Figure 3. Left:Precipitates formed after agitating coacervates containing complementary single strands of DNA. Right: Precipitates formedfrom mixing double-stranded DNA directly with pLys.

The fluorescein-TAMRA fluorophore pair can participate in resonance energy transfer (FRET) if the labels are close enoughtogether, and this scheme is often used to monitor hybridization of complementary oligonucleotides. Figure S12 shows theresults of mixing pre-formed complexes in this manner, with the process followed in the FRET channel (excite fluorescein,collect TAMRA emission, see main text methods). Interestingly, we observe a distinct FRET signal for both the complementaryand non-complementary complexes, presumably reflecting the high density of polymers in the coacervate phase.

S14

T = 20 min

T = 21 min T = 90 minT = 40.5 min

T = 75 min T = 90 min(a)

(b)

T = 0 min

T = 0 min

30µm scale bar

TAM

RA

-DN

A 22

/ pL

ys50

+

FAM

-DN

A 22

/ pL

ys50

TAM

RA

-DN

A 22

/ pL

ys50

+

FAM

-DN

A 22

rc /

pLys

50

Figure S12: FRET optical micrographs of coacervate mixing, under the same conditions as main text Figure 3). A) Mixing ofcomplexes containing non-complementary DNA. B) Complexes containing complementary DNA. FRET signal is observed inboth channels, but as in Figure 3, irregularly-shaped solid complexes form when complementary DNA complexes are mixed.

Before addition Non-complementary, 1 hr Complementary, 1 hr

30 μm 30 μm 30 μm

Figure S13: Addition of free DNA to pre-formed complexes. Left: Single-strand coacervate complexes before addition. Center:Adding non-complementary DNA results in somewhat larger liquid droplets. Right: Adding complementary DNA producesrapid formation of a precipitate.

S15

S2.6 Polyelectrolyte determinants of complex phaseIn previous work, we had observed precipitate formation upon mixing of homochiral anionic and cationic peptides7, likely dueto hydrogen bonding and formation of a β-sheet structure. Poly(lysine) and DNA are not thought to form ordered structuresof this sort, but we prepared complexes from opposite-chirality pLys to check. As shown in Figure S14, phase behaviorwas identical to the L enantiomer: single-stranded DNA formed coacervate droplets and double-stranded DNA formed solidprecipitates.

dsDNA / p(D)LysssDNA / p(D)Lys

30µm scale bar

Figure S14: Phase contrast optical micrographs of complexes formed from 22 nt/bp DNA mixed with 100 aa poly(D)lysine.As with the (L) enantiomer, complexes with single-stranded DNA form liquid droplets while complexes with double-strandedDNA form solid precipitates.

We synthesized peptides with reduced charge density to check whether the total charge density of the complexes affectedtheir phase, as well as to provide a more realistic comparison with naturally-occurring proteins such as the RNA-bindingproteins found in membrane-less organelles. Figure S15 shows the results of mixing single- and double-stranded DNA withpeptides built from lysine-glycine and lysine-glycine-glycine repeats (50% and 33% of pLys charge density, respectively). Thecomplexes exhibit reduced stability vs NaCl but show the same phase difference as the more highly-charged pLys: single-stranded DNA makes coacervates and double-stranded DNA makes precipitates.

As discussed in the main text, classical studies of DNA condensation often use long double-stranded DNA, with thepolyamines spermidine (charge +3, linear formula NH2(CH2)3NH(CH2)4NH2) and spermine (charge +4, NH2(CH2)3NH(CH2)4NH(CH2)3NH2)as cations. The charge on these molecules is carried on their backbone rather than on side chains as for pLys, and we werecurious whether this would affect the complexes’ phase. Figure S16 shows the results of mixing single- and double-strandedDNA of various lengths with spermidine and spermine. Compared to pLys, spermidine is somewhat less effective at formingcomplexes, with only the longer oligonucleotides forming aggregates large enough to observe by optical microscopy. Spermineforms complexes with all the oligonucleotides we tested, and both polyamines form abundant complexes with long double-stranded DNA, as expected. Crucially, though, whenever complexes are observed, they have the same phase characteristics aswhen pLys (or (KG)15 or (KGG)10) is used as the polycation: single-stranded DNA forms coacervates while double-strandedDNA forms precipitates.

Figure S17 shows the results of mixing partially-hybridized DNA with pLys. Coacervate droplets are observed when theDNA is mostly single-stranded, while precipitates are observed for mostly hybridized structures. Both hairpin and partialduplexes show a coacervate - precipitate transition located somewhere between 27–40% of bases paired.

Main text Figure 4 shows the effect of methylphosphonate substitution for DNA phosphodiester linkages on complexation:double-stranded DNA is observed to form coacervates rather than precipitates when both strands have reduced charges. Inorder to verify that this difference is due to reduced charge density rather than failure to hybridize, we performed UV meltingmeasurements on the DNA-DNA, mDNA-DNA, and mDNA-mDNA duplexes. The results are shown in Figure S18: all threeshow clear melting transitions at least 20 ◦C above room temperature, indicating stable hybridization under the experimentalconditions.

S16

Sing

le-s

trand

ed /

(KG

) 15Si

ngle

-stra

nded

/ (K

GG

) 10

NaCl 0 mM NaCl 100 mM NaCl 200 mM

NaCl 0 mM NaCl 50 mM NaCl 100 mM

30 µm

30 µm

30 µm

30 µm

30 µm

30 µm

Dou

ble-

stra

nded

/ (K

G) 15

NaCl 25 mM NaCl 150 mM NaCl 400 mM

NaCl 0 mM NaCl 100 mM NaCl 200 mM

Dou

ble-

stra

nded

/ (K

GG

) 10

30 µm

30 µm

30 µm

30 µm

30 µm

30 µm

A

B

C

D

Figure S15: Complexes with reduced charge density peptides. A) Single-stranded 22 nt oligonucleotide (22 rev, Table S2)+ (KG)15 peptide at same charge concentrations used in other measurements. B) Same oligonucleotide + (KGG)10 peptide.Liquid droplets are formed with both peptides, but stability vs salt decreases with peptide charge density (right column, cfmain text Figure 2). C) Double-stranded 22 nt oligonucleotide (22 rev annealed to complement) + (KG)15 peptide. B) Sameoligonucleotides + (KGG)10 peptide. Solid precipitates are formed with both peptides.

S17

Spermidine (3+)

Spermine (4+)

Single-stranded DNA

Double-stranded DNA

10 nt 22 nt 66 nt 88 nt

10 bp 22 bp 44 bp 88 bp 2 kb

Spermidine (3+)

Spermine (4+)

Figure S16: Phase contrast optical micrographs of complexes formed by single- and double-stranded DNA (charge concen-tration 2.5 mM) with the polyamines spermidine and spermine (charge concentration 100 mM). With single-stranded DNA,spermidine forms very small complexes with 66 nt DNA and liquid droplets with 88 nt DNA; no complexes are observed foroligonucleotides of 44 nt or below. Spermine forms liquid droplet complexes with all oligonucleotides studied. Spermidineforms precipitate complexes with 44–88 bp double-stranded oligonucleotides, as well as sheared salmon sperm DNA with av-erage length 2 kb. Precipitates are observed with spermine and all double-stranded oligonucleotides tested, as well as salmonsperm DNA.

S18

m = 6

n = 10 20% dsDNA

m = 10 45% dsDNA

m = 15 68% dsDNA

m = 20

n = 2240% dsDNA

n = 4467% dsDNA

n = 6686% dsDNA

27% dsDNA 91% dsDNA

Scale bar 30 µm

B Hairpin DNA(44 nt total)

Loop: 44 - 2m

Stem length(bp): 2m

Duplex DNAA

88 nt

n nt

ssDNA (nt): 88 - ndsDNA (bp): 2n

Figure S17: Phase contrast optical micrographs of partially hybridized DNA complexed with 100 aa pLys. A) Partial duplexes:20% double-stranded DNA forms coacervate droplets, while increased percentages of dsDNA form solid precipitates. B)Hairpins: coacervate droplets are observed at 27% double-stranded DNA and precipitates are observed at higher fractions.

Temperature (deg C)

Rel

. Abs

orba

nce

mDNA-mDNADNA-mDNAdsDNA

Figure S18: UV melting curves for double-stranded DNA (blue), DNA - mDNA (orange), and mDNA - mDNA (green) du-plexes. Absorbance is normalized so each curve has a range of 0 to 1 over the indicated temperature range. Stability againstthermal denaturation decreases with methyl phosphonate substitution, but melting transitions are observed for all three duplexesat temperatures substantially above room temperature, indicating duplex formation.

S19

S3 Sequence dependenceAs described in Section S1.1, identical results were obtained with the microRNA-21 derived sequence and the computer-designed revised 22 nt sequence shown in Table S2. Interestingly, the reverse complements to these sequences (“rc”) showedsomewhat different behavior: rcDNA 22 formed rounded-over solids (similar in appearance to those formed at salt concentra-tions near the precipitate-coacervation transition discussed in Section S2.3) with 100 aa pLys (liquid complexes were observedwith shorter pLys) and rc 22 rev formed similar-looking solids with pLys of all lengths. In order to investigate the generalityof the phase behavior with respect to oligonucleotide sequence, we followed two approaches. First, we designed 10 more 22-ntsequences and measured the phase of the complexes formed by mixing them with 100 aa pLys. Table S5 shows the sequencesand results. 9 of the 10 exhibited identical phase behavior to the DNA 22 and rev 22 sequences (11/14 total, 79%): liquidcoacervates from single-stranded DNA and solid precipitates from double-stranded DNA. We also investigated the behaviorof the rc DNA 22 and rc rev 22 oligonucleotides in more detail to determine the reason for solid formation. These results aredescribed below: in both cases, our conclusion is that these sequences likely form folded structures when complexed with pLys,leading to the observed ’soft solids’.

Sequence (5’ - 3’) Phase1 TCAACTGCGATCTGGTAAGTCA Liquid2 TGACTTACCAGATCGCAGTTGA Solid3 TGGATACTCGTCTGGACTACTT Liquid4 AAGTAGTCCAGACGAGTATCCA Liquid5 ACTCACTCATTCATCACTATCT Liquid6 AGATAGTGATGAATGAGTGAGT Liquid7 CTGAGGTCGCATTCAGCATTCA Liquid8 TGAATGCTGAATGCGACCTCAG Liquid9 ACTGCGTCTGCTAAGGTCAATC Liquid

10 GATTGACCTTAGCAGACGCAGT Liquid

Table S5: Additional 22 nt oligonucleotide sequences. Nine of ten form liquid complexes when mixed with 100 aa pLys. Allwere designed using NUPACK to minimize structure and self-complementarity.

The rc DNA 22 sequence is the DNA version of microRNA 21, and is partially self-complementary, as shown in Figure S19.In fact, NUPACK predicts that 76% of rc DNA 22 oligonucleotides (vs 42% for DNA 22) are dimerized at the 2.5 mM chargeconcentration used in most of the experiments described in the main text (at 22 ◦C and 100 mM NaCl, other options set todefault). We tested subsets of the rc DNA 22 sequence to see whether the predicted dimer structure forms and whether thiscorrelates with the observed phase behavior. Table S6 shows these sequences and the phase of the complexes observed whenthey are mixed with 100 aa pLys; all but one of the oligonucleotides containing the predicted self-complementary nucleotidesform solid complexes, and all of them show clear melting transitions when heated on their own (Figure S20), a clear sign ofstructure formation. By contrast, a 10 nt sequence from the 3’ end that does not contain one of the complementary regionsshows no melting transition and forms liquid complexes.

Oligonucleotide Sequence (5’ - 3’) Phaserc DNA 22 TAGCTTATCAGACTGATGTTGA Solidrc DNA 10 CTGATGTTGA Liquidrc 3prime ATCAGACTGATGTTGA Solidrc mid 16 CTTATCAGACTGATGT Liquidrc mid 11 ATCAGACTGAT Solidrc 5prime TAGCTTATCAGACTGAT Solid

Table S6: Sub-sequences of the partially self-complementary rc DNA 22 oligonucleotide and phase of complexes formed with100 aa pLys. Bases predicted to take part in dimerization (Figure S19) are highlighted in blue.

In contrast to the microRNA-21 derived sequences, the rev 22 sequence and its complement were designed to be structure-free, and neither show melting transitions when heated. The solid-forming rc rev 22 sequence does however contain an elevatedfraction of purine nucleotides (64% A and G bases), which can form folded structures stabilized by non Watson-Crick interac-tions under certain conditions, including when mixed with polycations8,9. In particular, G-A mismatches are only marginallyunstable under normal conditions and may in fact become stabilizing under conditions where the backbone electrostatic repul-sion is decreased (i.e. by a high concentration of polycations). We constructed several modified versions and subsequencesof the rc rev 22 oligonucleotide (Table S7) to determine whether non-canonical purine interactions might play a role in the

S20

Figure S19: Self-dimer structure of rc DNA 22, as predicted by NUPACK1; 10 of the central 11 nt form a complementaryduplex. Arrowheads denote the 3’ end of the sequence.

observed phase behavior. Oligonucleotide 8 (Table S5) was originally designed as a more sequence-balanced variant of rc rev22, with 2 fewer purines and one T to C substitution. Interestingly, this 3-nt change is sufficient to convert the phase of thecomplexes from solid to liquid. In order to see whether the 3’ end of the oligonucleotide takes part in a specific structuralinteraction, two shorter versions (16-1 and 16-2) were constructed. Both form solid complexes, disfavoring the specific struc-ture hypothesis. We next looked at the twin GAA tracts near the 5’ end of the sequence; mutating either two of the A bases(rrc A-T) or three G bases (rrc G-C) from this part of the sequence resulted in liquid-forming complexes, as did a completereplacement of G by C in the sequence (purine depletion). Substituting adenine for all of the cytosines (purine enrichment),by contrast, resulted in solid complexes. Comparing all these sequences (Table S7, columns 3 and 4) shows a clear trend:oligonucleotides with large fractions of purine bases formed solids, while balanced and low-purine sequences formed liquidcomplexes. Some types of purine-purine interactions (e.g. G-quartets, parallel duplexes) show specific features in their circulardichroism spectra10,11, but we did not observe these for any of the oligonucleotides studied (Figure S21), consistent with theidea that the structures may only be stable in the context of complexes with pLys. As a result, we cannot definitively identify thestructures formed by rev 22 rc, but the extreme sensitivity to sequence mutation coupled with the dependence on purine fractionstrongly suggests the formation of non Watson-Crick structures, likely aided by the electrostatic neutralization provided by thepolycations.

Oligonucleotide Sequence (5’ - 3’) % Purine Phaserc rev 22 TGAATGCTGAATGCGACGGTAG 64 SolidOligo 8 TGAATGCTGAATGCGACCTCAG 55 Liquidrrc 16-1 TGAATGCTGAATGCGA 63 Solidrrc 16-2 ATGCTGAATGCGACGG 63 Solidrrc A-T TGTATGCTGTATGCGACGGTAG 55 Liquidrrc G-C TCAATGCTCAATGCCACGGTAG 50 Liquidrrc no G TCAATCCTCAATCCCACCCTAC 27 Liquidrrc no C TGAATGATGAATGAGAAGGAAG 82 Solid

Table S7: Variations of the rc rev 22 oligonucleotide sequence, fraction of purine bases, and phase of complexes formed with100 aa pLys. Nucleotide alterations highlighted in red.

S21

1.0

0.8

0.6

0.4

0.2

0.0

Rel

ativ

e Ab

sorb

ance

605040302010Temperature (°C)

rc mid 11 rc mid 16 rc 5prime rc 3prime rc DNA 10

Figure S20: UV melting data for rc DNA 22 sequence variants. All 4 sequences containing the self-complementary subse-quence show clear melt transitions, indicating formation of Watson-Crick duplexes. The rc mid 16 sequence has an estimatedmelting temperature below room temperature, which may explain the liquid complexes observed with this oligonucleotide. Bycontrast, the rc DNA 10 sequence, which is not self-complementary and forms liquid complexes, shows no melting transition.Absorbances are normalized for a range of 0 to 1 over the displayed temperature, with the exception of rc DNA 10 which isnormalized by the same scaling factor as rc mid 11.

30

25

20

15

10

5

0

-5

-10

Mol

ar R

esid

ue E

lliptic

ity •

10^-

3

320300280260240220200180Wavelength (nm)

DNA 22 (Liquid) rc DNA 22 (Solid) Oligo 7 (Liquid) Oligo 8 (Liquid) rev 22 (Liquid) rc rev 22 (Solid)

Figure S21: Circular dichroism spectra for DNA 22, rev 22, Oligo 8, and their complements. Peak magnitudes vary consistentwith the nucleotide compositions, but no unique peaks are observed for the solid-forming sequences (e.g. a 260 nm peak forG-quartet formation).

S22

References[1] Zadeh, J. N.; Steenberg, C. D.; Bois, J. S.; Wolfe, B. R.; Pierce, M. B.; Khan, A. R.; Dirks, R. M.; Pierce, N. A. Journal

of computational chemistry 2010, 32, 170–173.

[2] Fields, G. B.; Noble, R. L. International Journal of Peptide and Protein Research 2009, 35, 161–214.

[3] Banyay, M.; Sarkar, M.; Graslund, A. Biophysical Chemistry 2003, 104, 477–488.

[4] Taillandier, E.; Liquier, J. Methods in Enzymology 1992, 211, 307–335.

[5] Mady, M. M. International Journal of the Physical Sciences 2011, 6, 1–7.

[6] Choosakoonkriang, S.; Lobo, B. A.; Koe, G. S.; Koe, J. G.; Middaugh, C. R. Journal of pharmaceutical sciences 2003,92, 1710–1722.

[7] Perry, S. L.; Leon, L.; Hoffmann, K. Q.; Kade, M. J.; Priftis, D.; Black, K. A.; Wong, D.; Klein, R. A.; Pierce, C. F.;Margossian, K. O.; Whitmer, J. K.; Qin, J.; de Pablo, J. J.; Tirrell, M. Nature Communications 2015, 6, 1–8.

[8] Maruyama, A.; Katoh, M.; Ishihara, T.; Akaike, T. Bioconjugate chemistry 1997, 8, 3–6.

[9] Chou, S.-H.; Chin, K.-H.; Wang, A. H.-J. Nucleic Acids Research 2003, 31, 2461–2474.

[10] Kandimalla, E. R.; Agrawal, S. Biochemistry 1996, 35, 15332–15339.

[11] Vorlıckova, M.; Kejnovska, I.; Sagi, J.; Renciuk, D.; Bednarova, K.; Motlova, J.; Kypr, J. Methods (San Diego, Calif)2012, 57, 64–75.

S23