Original Article Low frequency electromagnetic field (LFMF ... · NPCs group compared with BM-NPCs group at day 30. RT-PCR showed that in LFMF+BM-NPCs group, mRNA expres - sions of

Int J Clin Exp Med 2019;12(7):8136-8148www.ijcem.com /ISSN:1940-5901/IJCEM0093982

Original ArticleLow frequency electromagnetic field (LFMF) promotes bone marrow derived neural progenitor cells (BM-NPCs) differentiation and nerve repair in traumatic brain injury rats

Chong Zhang1,2,3, Ming-Sheng Zhang2,4

1Southern Medical University, Guangzhou 510000, Guangdong Province, China; 2Guangdong Provincial People’s Hospital, (Guangdong Academy of Medical Sciences), Guangzhou 510080, Guangdong Province, China; 3The First Affiliated Hospital of Guangxi Traditional Chinese Medical University, Nanning 53002, Guangxi Province, China; 4Southern Medical University Affiliated Hospital, Guangzhou 510030, Guangdong Province, China

Received March 17, 2019; Accepted May 13, 2019; Epub July 15, 2019; Published July 30, 2019

Abstract: Objective: The current study was carried out to investigate whether LFMF treated BM-NPCs could exert favorable repair function in brain injury in rats. Methods: BM-NPCs were isolated from 3-week old SD rats, and induced into NSC-like cells. The TBI model was established using modified Feeney weight-drop method. Cells were transplanted into the lesioned area followed by treating with 50 HZ LFMF for 60 consecutive days. The Wayne Clark score and grooming score were recorded for neurobehavioral evaluation. H&E staining was performed to observe the pathological changes at day 1, 7 and 30. Immunofluorescence was performed to detect the locations and ex-pressions of the GFAP, NeuN and β-III tubulin. RT-PCR was carried out to examine the mRNA expressions of nestin, PSA-NCAM, β-III tubulin and neurotransmitters ACHE, 5-HT, GABA. Results: Wayne Clark scores were significantly lower and grooming scores were markedly higher in LFMF+BM-NPCs group than other groups. H&E staining showed that at day 7 and 30, LFMF+BM-NPCs group had the slightest edema, least cystic cavities and inflammatory cells. Immunofluorescence demonstrated that NeuN and β-III tubulin positive cells were significantly higher in LFMF+BM-NPCs group compared with BM-NPCs group at day 30. RT-PCR showed that in LFMF+BM-NPCs group, mRNA expres-sions of neural markers nestin, PSA-NCAM, β-III tubulin and neurotransmitters ACHE, 5-HT, GABA are significantly higher compared with other groups. Conclusion: Transplantation of BM-NPCs in addition with intervention of 50 HZ LFMF can improve the neurologic functional recovery of TBI rats through up-regulation of the expression of β-III tubulin and NeuN genes.

Keywords: Low frequency magnetic fields, brain injury, cell transplantation

Introduction

Traumatic brain injury (TBI) is one of the lead- ing causes of death and disability in young adults of industrialized countries [1, 2]. TBI is reported as a highly complex disorder, involving a primary injury, which leads to neuronal death and a secondary injury cascade [3, 4]. In addi-tion to the financial burden on families and society, TBI could also lead to grave long-term impairments for the survivors [5]. The second-ary injury could extend past the initially dam-aged tissue and results in further neurological de- terioration for months after the primary injury [5]. Although a series of works have been de-

voted to TBI, pathogenesis of brain injury is complex and still remains poorly understood, associated with cell death, spreading inflamma-tion, infection and neural dysfunction [6, 7]. Therefore, it is urgent to search for an effective therapy to reduce TBI-related disabilities.

In recent years, neural progenitor or neural stem cell (NSC) transplantation has been con-sidered as a novel treatment in various neuro-logical diseases. Evidence has demonstrated that NSC transplantation could repair the dam-age and recover motor and cognitive function in neurological diseases including Parkinson disease, Alzheimer’s disease and ischemic st-

http://www.ijcem.com

LFMF promotes BM-MPCs differentiation and TBI recovery

8137 Int J Clin Exp Med 2019;12(7):8136-8148

roke [8-10]. It has also been shown that trans-planted NSCs can survive, differentiate into neurons and/or glia, and attenuate motor dys-function after TBI [11]. Among all the stem cells, bone marrow derived neural progenitor cells (BMNPCs) are favorable potential cells that could differentiate into NSC-like cells in that BM-NPCs are easily obtained with less ethical restriction [12].

Although stem cell therapies are likely to help functional recovery from brain injury, the effect appears to be limited [13]. Mashkouri [13] sug-gested that unitary treatment of stem cells may not be optimal for brain repair, and addition of other methods may enhance the therapeutic outcomes. Therefore, comprehensive therapy based on stem cells transplantation to improve the recovery process is needed.

Over the past years, low frequency electromag-netic field (LFMF) has been proved as a novel and non-invasive method in various clinical use and experimental studies. Several studies con-firmed that low frequency LFMF affects prolif-eration or differentiation of BMSCs [14, 15]. In our previous studies, LFMF at 50 HZ can pro-mote differentiation of various stem cells and perform various effects [16-18]. LFMF has also been shown to guide NSC differentiation and attenuates nerve injury. One recent study showed a significantly enhanced proliferation in a human neuroblastoma after exposure to a continuous magnetic field (50 Hz, 1 mT) [19]. Moreover, continuous exposure to LFMFs (50 Hz, 1 mT) promoted neuronal differentiation of postnatal NSCs in vitro [20] and adult neuro-genesis in vivo [21]. Interestingly, Duong sug-gested that non-invasive treatment with LFMF may be useful to protect microglial cells from death [22]. The above evidences implied that LFMF exposure has the potential effect on the NSC differentiation. However, there have been no studies available about the effects of 50 Hz LFMF exposure on the activity and property of BM-NPCs transplants in a TBI model. There- fore, we hypothesized that LFMF exposure after BM-NPCs transplantation was important for improving the recovery process following brain injury.

Materials and methods

Cell culture and preparation of NSC-like cells

BMSCs derived from marrow stroma collected from the femur and tibiae of ten 8-week-old

Sprague-Dawley rats (male and female, 80~ 120 g) and were maintained as monolayer cul-tures and expanded using Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Grand Is- land, NY) containing 10% fetal bovine serum (FBS, Invitrogen), penicillin (100 U/ml; Sigma-Aldrich, St. Louis, MO), streptomycin (100 mg/ml; Sigma-Aldrich), and amphotericin B (0.25 mg/ml; Sigma-Aldrich). Non adherent cells were removed by changing the medium after 24 h. The culture medium was changed twice a week thereafter. For subculture, when cells grew to 80~90% confluence, cells were detached with 0.25% trypsin/0.02% EDTA (Gibco, Grand Is- land, NY) and passaged at a ratio of 1:3 plat- es. Cells from the 3rd to the 7th passage were used for experimental purpose.

In order to induce BM-NPCs differentiation into NSC-like cells, BM-NPCs were seeded at a den-sity of 5.0×103 cells/cm2. When cells grew to 30~40% confluence, the cells were cultured with neuronal differentiation medium (Gibco, Grand Island, NY) composed of DMEM/F12 with KCl (5 mM), valproic acid (2 M), forskolin (10 μM), hydrocortisone (1 μM), and insulin (5 g/ml).

Immunofluorescent assay

After neuronal induction for 3 days in vitro, the formation of floating neurospheres were col-lected on the glass slides and perfused with 4% paraformaldehyde. And those neurospheres were treated with the use of standard proto-cols for immunofluorescent assay according to the previous study [23]. Anti-rabbit nestin (1:500; Chemicon, Rolling Meadows, IL), β-III tubulin (1:2,000; United Chemicon, Inc., Rolling Meadows, IL), and glial fibrillary acidic protein (GFAP, 1:200; United Chemi-con, Inc.) monoclo-nal antibodies were used. After staining pro-cess, all slides were observed and images were taken under a microscope (RX50; Ningbo Sunny Instruments Co., Ltd, Yuyao, China).

Patch-clamp recordings and electrophysiologi-cal measurements

Voltage-clamp recordings were performed using the whole-cell configuration of the patch-clamp technique [24]. For electrophysiological recordings, the growth medium was replaced with a bath solution containing 140 mM NaCl, 5 mM KCl, 2 mM CaCl2, 1 mM MgCl2, 10 mM HEPES, and 10 mM glucose, which was adjust-


8138 Int J Clin Exp Med 2019;12(7):8136-8148

ed to pH 7.3 with Tris alkaline buffer (~320 mOsm/kg). Micropipettes (2-5 MΩ resistance) were fabricated from 1.5-mm (o.d.) borosilica- te glass capillary tubes (Hilgenberg, Malsfeld, Germany). The pipette solution contained 125 mM KCl, 1 mM CaCl2, 2 mM MgCl2, 2 mM Mg-ATP, 2 mM Na2ATP, 10 mM HEPES, 10 mM EGTA and was adjusted to pH 7.2 with KOH (~283 mOsm/kg). All recordings were carried out at room temperature using a computer- controlled patch-clamp amplifier (EPC-10; HE- KA Electronics, Lambrecht, Germany) and Pa- tchmaster software (HEKA Electronics). Action potentials were recorded under current clamp conditions in which the cells were stimulated with 50-300 pA current injection for 2,000 ms. Data were analyzed off-line with Fitmaster v2x69 software (HEKA Electronics).

Grouping of animals

All protocols involving the use of animals were in compliance with the National Institutes of Health Guide for the Care and Use of Labora- tory Animals, and were approved by the Animal Care and Use Committee, Southern Medical University, Guang Zhou, China. Female Spra- gue-Dawley (SD) rats weighing about 200 ± 20 g were used in the study. They were randomly assigned to four groups: a control group (rats subjected to TBI, and receiving saline injections instead of cultured cells); a LFMF group (rats subjected to TBI and receiving saline treatment with LFMF); a BM-NPCs group (rats subjected to TBI and receiving BM-NPCs transplantation); a BM-NPCs+LFMF group (rats subjected to TBI and receiving BM-NPCs transplantation with LFMF intervention);

TBI model

In our study, the TBI model was established according to the revised Feeney method [25]. All rats were anesthetized by intraperitoneal (i.p.) injection of 3.6% chloral hydrate (1 mL/ 100 g; Sigma-Aldrich, St. Louis, MO, USA) and then their heads were fixed in a stereotaxic frame. The right parietal bone was exposed. A bore was drilled into the skull 2.5 mm away from the sagittal suture and 1.5 mm away from the arcuate suture, not touching the dura mater. The skull was removed until the diame-ter of the “bone window” was enlarged to 5.0 mm. The cerebral cortex was exposed and subjected to an impact from a 20 cm high posi-tion along the guide bar by a 50 g hammer, which resulted in a predominantly focal injury

of the right cerebral cortex. Then, the exposed dura was covered with bone wax and the scalp sutured. Rats were given food and water ad libi-tum and received injections of penicillin to pre-vent infection.

Cell transplantation marked with CM-Dil

The cells from the third passage were trypsin-ized (0.125% trypsin, 5 min), and gently titrated into serum containing medium to inactivate the trypsin, then washed three times by gently pel-leting the cells, followed by a low-speed cen-trifugation (900 g). They were resuspended in DMEM/F-12 to yield/reach a final concentra-tion of 1×107 cells/mL. The suspension was kept on ice and gently triturated before each injection to keep the suspension dispersed and free of cell clumps. NSCs were labeled CM-Dil, and then engrafted into tissues around the injury site through the microinjection needle of a stereotaxic instrument. Four injections were made, each containing 5.0 μL of suspended cells, delivered at 1 μL/min. The control group received only saline injections. All transplant recipients received 10 mL of cyclosporine each, administered intraperitoneally, beginning 3 days before transplantation and continuing for 1 week.

LFMF exposure system

The rats were housed in individual cages under controlled environmental conditions (tempera-ture, 23 ± 1°C; humidity, 50% ± 5%; lights on from 08:00 to 20:00 h) before LFMF treatment. The magnetic intensity at the center of coils was measured with a gaussmeter-probe (Tin- Dun Industry Co., Ltd, Shanghai, China). The wave shape and frequency were visualized by an oscilloscope (RIGOL, Beijing, China). The fre-quency and intensity were monitored using a sensor that was connected to a digital multime-ter. All rats were placed in the exposure device and were exposed to LFMF (50 Hz) at 1 mT for 60 min per day. Briefly, the rats in each four group were placed in a rounded acryl cage con-taining four divisions for the simultaneous exposure of four rats without restraint, and the cage was placed inside the coil during expo-sure. The LFMF generated by the coils was clas-sified as a vertical field, since the field lines were perpendicular to the bottom plane of the cage. Therefore, the LFMF was applied in a dor-sal-ventral direction relative to each the rat’s body.


8139 Int J Clin Exp Med 2019;12(7):8136-8148

Assessment of neurologic function impairment and behavior change

The Wayne Clark neurologic deficit score was recorded to evaluate the neurologic function impairment [26]. The Wayne Clark neurobehav-ioral score ranges from 0 to 28 points, the high-er the score, the more serious the damage: 6~12 points indicate mild brain injury, 12~18 for medium brain injury, and 18 or more points implicating severe brain damage hurt [26]. Results were read by two blind experienced neurologists, and the Kappa value was calcu-lated to examine the consistency. The Wayne Clark score was recorded from all the four groups at day 1, day 3, day 7 day 30 and day 60 after intervention. Grooming score was also recorded to evaluate motor function [27]. The rat grooming assessment tool was made as a 40 cm high and 20 cm diameter hollow cylin-der. Scores were recorded by two blind experi-enced animal operators.

The forelimb motor function on the experimen-tal side was evaluated. A 5-minute video was recorded and saved for analysis by the video capture system. Grooming score was defined as below: 0 point-no signs of recovery; 1 point-the forepaw of could touch the mouth. 2 points: the forepaw could touch between the mouth and the eye; 3 points: the forepaw could touch the eye; 4 points: the forepaw could touch the anterior part of the ear; 5 points: the forepaw could touch the posterior part of the ear.

Histological examination

The brains were removed from two rats from each of the four groups after the animals had been deeply anesthetized with sodium pento-barbital; the brains were then fixed with 10% formalin. The fixed brains were dehydrated using a graded series of ethanol, cleared with xylene, and embedded in paraffin. Brain paraf-fin sections were cut at a thickness of 7 μm using a microtome and were mounted on 3- aminopropyltriethoxysilane-coated glass slides. Each section was stained with hematoxylin and eosin (H&E) for histological examination.

Immunofluorescence histochemistry

The brains of rats were removed and fixed in phosphate buffered 4% paraformaldehyde (pH 7.4). Then, the fixed samples were sectioned in the lesioned area at 40 µm thickness using a

cryomicrotome (Leica, Wetzlar, Germany). The obtained sections were incubated with 0.01 M sodium citrate buffer (pH 6.0) for 30 min at 90°C and then washed with Tris buffered saline with Tween (TBST). Next, the sections were blocked in 10% goat serum for 1 h and then incubated with anti-βIII tubulin (1:100) (Che- micon, Rolling Meadows, IL), anti-NeuN (1:500) (Chemicon, Rolling Meadows, IL), anti-GFAP (1: 100) (Chemicon, Rolling Meadows, IL) over- night at 4°C. The fluorescence isothiocyanate (FITC)-labeled goat-anti rabbit secondary anti-body (Santa Cruz) and tetramethylrhodamine isothiocyanate (TRITC)-labeled secondary anti-body (Santa Cruz) were incubated with the samples. 100 μl 4’, 6-diamidino-2-phenylindole (DAPI) was added to each section followed by washing three times. For each marker, four sec-tions of the brain from an individual animal were randomly selected and analyzed by the same observer, who was unware of animal assignments.

Real time-PCR

Total RNA was extracted from brain tissue and the neurospheres after EMF exposure for 30 d. The total RNA was reverse transcribed for cDNA using the TaKaRa PrimeScript RT Reagent kit (Takara Biotechnology Co., Dalian, China), fol-lowing the manufacturer’s instruction. PCR con-ditions were set as follows: 2 min at 95°C fol-lowed by 39 cycles of 20 s at 95°C, 20 s at 60°C, and 30 s at 72°C, and a final extension at 72°C (5 min). The primers used in the RT-PCR are listed in Table 1. For each PCR product, a single narrow peak was obtained by melting curve analysis at the specific melting curve temperature, indicating specific amplification. Samples were tested in triplicate, and the aver-age values were used for quantification. For each sample, the ratio between the relative expression values of β-catenin and β-actin was calculated to compensate for variations in quantity or quality of starting mRNA, as well as for differences in the efficiency of the reverse transcription process. The relative amount of each gene was determined using the 2--ΔΔCt method.

Statistical analysis

The software Graphpad Prism 6.0 was used to perform statistical analysis. All data were expressed as mean ± standard deviation (SD).


8140 Int J Clin Exp Med 2019;12(7):8136-8148

Statistical difference was analyzed by one-way analysis of variance among different groups. Tukey test was performed for post-hoc analy-sis. The collecting dates of neurologic function scores at different times were analyzed by repeated measurement analysis of variance. P value less than 0.05 was considered to be sta-tistically significant.

Results

BM-NPCs morphology and identification

A morphological study of the BM-NPCs that were cultured was performed at different days after neural induction. BM-NPCs were cultured

and differentiated (Figure 1A-C). After 2 to 3 days of culture, cells began to form neurospheres and became larger by at 5 days (Figure 1D-F). The cells stained with nestin (an NSC marker), with β-III tubulin (a neuronal marker) and GFAP (an astrocyte marker) negative (Fi- gure 2B) were regarded as BM-NPCs (Figure 2A). First, the identification of the BM-NPCs was carried out. The new isolated single cells were cultured in proliferation medium. Cells dif-ferentiated into neurons with glia cells died, whereas BM-NPCs formed neurospheres as shown in Figure 1E and 1F. For cell differentia-tion, neurospheres were cultured in differentia-tion medium. Neurospheres were positive for β-III tubulin (Figure 2D) and GFAP (Figure 2E)

Table 1. Primer sequence listGene Forward Primer Reverse Primer Length (bp)Nestin GGACTCAGAACAAGTGAATGGG CTGTCCCTGTAATAGGAGTTCTTG 106PSA-NCAM CAAGTCCCTAGACTGGAACGC CCTTGGATTTTCCTTGCTGGT 71β-IIItubulin GCATCTCCGAGCAGTTTACG TCCTCGTCGTCATCTTCATACAT 190ACHE CACCGTGCCTCCACATTGACT CTGTGCGGGCAAAATTGGTC 1665-HT ATAGCTGATATGCTGCTGGGTT AAAGAGCACATCCAGGTAAATCC 123GABA CCATTGTCCTCTTCTCCCTCTC TTTGCCTCCACTTCTACAGACC 121β-actin CACCCAGCACAATGAAGATCAAGAT CCAGTTTTTAAATCCTGAGTCAAGC 317

Figure 1. Morphological changes of BM-NPCs differentiation to neurons at different times. A. Neural differentiation Day 3 (×100). B. Neural differentiation Day 10 (×100). C. Neural differentiation Day 14 (×100). D. Cell suspension after 24 hour culture (×100). E. Cultured cells began to form neurospheres at day 3 (×100). F. Single neurosphere formation at 14 week (×400).


8141 Int J Clin Exp Med 2019;12(7):8136-8148

and nestin negative (Figure 2C) by Immu- nofluorescence test as shown in Figure 2D and 2E. Lastly, we performed neurophysiological tests, the intracellular spontaneous postsynap-tic current was recorded with 60 mV amplitude and 200 ± 30 pA current (Figure 3). Therefore, the neurosphere-like BMNPCs preserved the ability of proliferation and differentiation.

Effect of LFMF on neurological function after cell transplantation

To investigate whether LFMF could affect the neurological function, we tested the behavior after cells were transplanted at day 1, day 3, day 7, day 30 and day 60, respectively, by eval-uating Wayne Clark score and grooming score

Figure 2. Expressions of neural cell related markers. A. Positive expression of Nestin of BM-NPCS before neural induction (×400). B. Negative expressions of β-III tubu-lin and GFAP in BM-NPCs (×400). C. Negative expression of Nestin after neural induction (×100). D. Positive expression of β-III tubulin after neural induction. E. Positive expression of GFAP after neural in-duction (×100).

Figure 3. Neurophysiologi-cal testing by patch-clamp.


8142 Int J Clin Exp Med 2019;12(7):8136-8148

in each group. Wayne Clark scores decreased in all the four groups over time (Figure 4A), whereas grooming scores increased in all the four groups over time (Figure 4B). However, the LFMF+BM-NPCs group exhibits the best trend of functional recovery compared with other groups, according to the time-dependent curve. We next found that at day 30 and day 60 the Wayne Clark score in LFMF+BM-NPCs group was significantly lower than BM-NPCs, LFMF and control group (P<0.05) (Figure 4C), where as grooming score LFMF+BM-NPCs group was significantly higher than BM-NPCs, LFMF and control group (Figure 4D). Interestingly, we also found LFMF group also had better function recovery compared with controls. These results indicate that BM-NPCs transplantation adding LFMF has better neurological function than BM-NPCs transplantation only. LFMF stimula-tion can accelerate the brain function recovery.

Histological findings after cell transplantation

We next performed microscopic observation of the damaged brain following cell transplanta-tion at each time-point using hematoxylin and eosin staining. At the beginning of cell trans-plantation (7 days after TBI model), tissues

around the lesioned area became fragmented with reduced blood flow and compressed blood vessels in all four groups. On the 7th day after transplantation, edema was present around the injury area in both control group and LFMF group, with large cystic cavity, infiltration of inflammatory cells and obvious reduction of nerve cells. Conversely, The edema is slighter in the BM-NPCs group and LFMF+BM-NPCs group, with limited range of cystic cavity and presence of astrocytes. On the 30th day after transplantation, the cystic cavities became less in LFMF group, BM-NPCs group, LFMF+ BM-NPCs group compared with control group. Edema in the BM-NPCs group and LFMF+BM-NPC group gradually disappeared. Cells in the LFMF+BM-NPCs group were neatly arranged around the lesions with inflammatory cells dis-appearing (Figure 5).

Expression of neural marker proteins by im-munofluorescence assay

The growth and percentage of neurons (NeuN and β-III tubulin positive cells) and astrocytes (GFAP positive cells) were detected by immuno-fluorescence assay at day 30 in each group. GFAP positive cells were largely present in the lesioned area in all the four groups. Percentage

Figure 4. Wayne Clark and grooming deficit score of the TBI rats in each group at different time points. A. Wayne Clark scores decrease in all the four groups in the process of time. B. Grooming scores increase in all the four groups in the process of time. C. Comparison of Wayne Clark scores at different time among four groups. D. Comparison of grooming scores at different time among four groups (*P<0.05 vs control group, #P<0.05 vs BM-NPCs group, &P<0.05 vs LFMF group).


8143 Int J Clin Exp Med 2019;12(7):8136-8148

of GFAP positive cells were slightly higher in control group compared with BM-NPCs group and LFMF+BM-NPCs group at day 30 after cell transplantation (Figure 6). However, CM-Dil marked NeuN and β-III tubulin positive cells were present in the BM-NPCs group and LFMF+BM-NPCs group, which were absent in the control and LFMF group. The NeuN and β-III tubulin positive cells grown and merged with surrounding tissues in both the BM-NPCs and LFMF+BM-NPCs group. The fusion with sur-rounding tissues of NeuN and β-III tubulin posi-tive cells were tighter in LFMF+BM-NPCs group compared with the BM-NPCs group (Figure 6).

These results indicated that LFMF could pro-mote the regeneration and formation of nerve tissues

RT-PCR

To address the molecular mechanism for LFMF on cell transplantation in TBI model, the expres-sions of related genes Nestin, PSA-NCAM and β-III tubulin and neurotransmitters ACHE, 5-HT, GABA were detected in the brain of rats sub-jected to TBI at day 30. The expressions of Nestin, PSA-NCAM and β-III tubulin as well as ACHE, 5-HT mRNA were significantly higher in

Figure 5. Microscopic observation of the pathological changes following cell transplantation at each time-point us-ing hematoxylin and eosin staining. Blue: nucleus was stained with hematoxylin; Red: cytoplasm was stained with eosin (×100).


8144 Int J Clin Exp Med 2019;12(7):8136-8148

the LFMF+BM-NPCs group than in BM-NPCs group (P<0.05~P<0.01) and LFMF and control group (P<0.01), the expressions of Nestin, PSA-NCAM and β-III tubulin as well as ACHE, 5-HT mRNA were significantly higher in the BM-NPCs group than in the control group. (Figure 7A-D, **P < 0.01; *P < 0.05).

Discussion

In the current study, we explored the role of 50 HZ LFMF in promoting the differentiation of BM-NPCs into neurons in vivo and investigated the effects of 50 HZ LFMF on the recovery of motor function in rats with brain injury. We con-firmed that 1 mT 50 HZ LFMF intervention in combination with BM-NPCs transplantation reduced brain edema and improved neurological scores in a rat TBI model. Our data showed th-

at exposure to 50 Hz LFMF combination with BM-NPCs caused the up-regulation of neural marker nestin, PSA-NCAM, β-III tubulin and neurotransmitter ACHE, 5-HT, GABA mRNA lev-els. In addition, the percentages of NeuN and β-III tubulin positive cells in the LFMF+BM-NPCs group were significantly higher compared with control groups at day 30. H&E staining showed that inflammation cells and edema dis-appeared in the LFMF+BM-NPCs group. All these findings indicated that LFMF may serve as a favorable adjunctive therapy for TBI.

Previous studies have found that high intensity magnetic stimulation of brain cells is able to produce action potentials (AP) and can also lead to changes of AP on cell membranes [28]. However, whether high intensity magnetic stim-ulation is beneficial for the recovery of dam-

Figure 6. Expressions of GFAP, NeuN and β-III tubulin in different groups at Day 30 after TBI model establishment; DAPI labeled nucleus were stained with blue Fluorescence; GFAP, NeuN and β-III tubulin proteins were stained with green fluorescence; CM-Dil labeled cells were stained with red fluorescence (×100).


8145 Int J Clin Exp Med 2019;12(7):8136-8148

aged nerve cells has not yet reached a consis-tent conclusion. Compared with high intensity magnetic stimulation, Mil-Tesla magnetic stim-ulation does not cause side effects including phototoxicity and thermal toxicity, which ren-ders magnetic stimulation relatively safe. Th- erefore, it is necessary to make further inten-sive study to explore the micro-and macro-effects of LFMF on damaged nerve cells and tissues, illustrating the potential effect and mechanism that LFMF can influence the cen-tral and peripheral nervous system.

However, changes in cell morphology and be- havioral assessment could not be verified in a long-term dependent manner, in that second-ary injury was also an important process in TBI. Our research found that improvement of motor function and change of pathological structure are still recovering after one month. Suggested choice of time window for the recovery of neu-rological function in TBI patients is within 24 hours after brain damage [29], long-term treat-ment using LFMF still remains effective on the recovery of nerve function.

NSCs or NPCs maintenance is of great impor-tance in maintaining stem cell pool for giving rise to diverse types of neurons and glia during brain development. NSCs or NPCs must under-go diverse processes, such as self-renewal, cell differentiation, cell apoptosis, and the develop-

ment of neurites. One previous study found that NSCs or NPC proliferation and differentia-tion were enhanced after LFMF exposure in vitro [30]. Our study observed that LFMF could also promote NSCs or NPCs differentiation in vivo.

We also found the LFMF+BM-NPCs group had higher mRNA expressions of nestin, PSA-NCAM, β-III tubulin and NeuN. In addition, immunofluo-rescence tests identified the location of β-III tubulin and NeuN, and we observed that fusion with surrounding tissues of NeuN and β-III tubu-lin positive cells were tighter in the LFMF+BM-NPCs group compared with BM-NPCs group. PSA-NCAM is the polysialylated form of neural cell adhesion molecule (NCAM). In the adult brain, PSA-NCAM is expressed on the cell sur-face of newly generated daughter cells, on neu-rites during outgrowth and path finding, and at the synapse of mature neurons [31]. PSA-NCAM serves to regulate nerve cell-cell and nerve cell-ECM interactions during times of plasticity [32]. β-III tubulin is the major constituent of microtubules, involved in a wide variety of func-tions, including mitosis, transport of various organelles, maintenance of cellular morpholo-gy, and axonal transport in neurons [33]. β-III tubulin is also known as neuron-specific β-III tubulin, is expressed specifically in neurons [34]. Neuronal nuclei (NeuN) is a well-recog-nized marker that is detected exclusively in

Figure 7. mRNA expressions of neuronal marker by RT-PCR in different four groups at day 30. A. mRNA Expression of NeuN. B. mRNA Expression of PSA-NCAM. C. mRNA Expression of β-III tubulin. D. mRNA Expression of ACHE. E. mRNA Expression of 5-HT. F. mRNA Expression of GABA. Each sample was repeated for three times (*P<0.05,**P<0.01).


8146 Int J Clin Exp Med 2019;12(7):8136-8148

post-mitotic neurons and has been considered to be a reliable marker of mature neurons [35]. These findings indicated that LFMF could pro-mote the BM-NPCs differentiation and upregu-late the mRNA expressions of neural related genes and neurotransmitters.

The inflammatory response from activated mi- croglia as well as recruited neutrophils and macrophages, and reactive oxygen species (ROS) from blood metabolites contribute to brain damage and subsequently causes progressive damage [36]. Oxidative stress and inflammato-ry reaction are recognized as important me- chanisms of TBI-caused injury [37]. Therefore, improving antioxidant response and reducing inflammation would alleviate TBI-induced brain damage [38]. In our study, we found LFMF could alleviate edema, modulate inflammation reac-tion, accelerate the necrotic tissue absorbing, and promote nerve regeneration. There is gr- owing evidence of the potential role of EMFs in biological modulation of autoimmunity, immune functions and oxidative stress. One study on mouse macrophages after short-term exposure to 50 Hz LFMF at 1.0 mT showed a significant uptake of carboxylated latex beads in macro-phages, indicating EMFs stimulate the phago-cytic activity of their macrophages [39]. LFMF seems to have an antioxidant and neuroprotec-tive effect [40] and could induce the antioxi-dant pathway Nrf2, which is closely associated with its protective effect against neurotoxicity induced by 3-nitropropionic acid (3-NP) [41]. LFMF has been shown to perform direct anti-inflammatory effects both in vitro and vivo [42]. LFMF exposure interferes with many cellular processes including the modulation NF-κB ac- tivation and inhibition of many pro-inflammato-ry cytokines such as tumor necrosis factor-α and IL-1β, chemokines [43].

In summary, we found that LFMF modulated the differentiation of BM-NPCs isolated from both embryonic and ischemic adult hippocam-pus in vitro. Our results suggested that LFMF may serve as an effective method for promot-ing functional recovery of TBI.

Acknowledgements

This research was supported by the National Natural Science Foundation of China (8187- 1842).

Disclosure of conflict of interest

None.

Address correspondence to: Ming-Sheng Zhang, Southern Medical University Affiliated Hospital, Guangzhou 510630, Guangdong Province, China. E-mail: [email protected]

References

[1] Abou El Fadl MH and O’Phelan KH. Manage-ment of traumatic brain injury: an update. Neu-rosurg Clin N Am 2018; 29: 213-221.

[2] Iorio-Morin C, Fortin D and Blanchard J. TBI prognosis calculator: a mobile application to estimate mortality and morbidity following traumatic brain injury. Clin Neurol Neurosurg 2016; 142: 48-53.

[3] Vella MA, Crandall ML and Patel MB. Acute management of traumatic brain injury. Surg Clin North Am 2017; 97: 1015-1030.

[4] Lozano D, Gonzales-Portillo GS, Acosta S, de la Pena I, Tajiri N, Kaneko Y and Borlongan CV. Neuroinflammatory responses to traumatic brain injury: etiology, clinical consequences, and therapeutic opportunities. Neuropsychiatr Dis Treat 2015; 11: 97-106.

[5] Maas AI, Stocchetti N and Bullock R. Moderate and severe traumatic brain injury in adults. Lancet Neurol 2008; 7: 728-741.

[6] Zhao Z, Zhou Y, Tian Y, Li M, Dong JF and Zhang J. Cellular microparticles and pathophysiology of traumatic brain injury. Protein Cell 2017; 8: 801-810.

[7] Dixon KJ. Pathophysiology of traumatic brain injury. Phys Med Rehabil Clin N Am 2017; 28: 215-225.

[8] Zhang Q, Chen W, Tan S and Lin T. Stem cells for modeling and therapy of parkinson’s dis-ease. Hum Gene Ther 2017; 28: 85-98.

[9] Kang JM, Yeon BK, Cho SJ and Suh YH. Stem cell therapy for alzheimer’s disease: a review of recent clinical trials. J Alzheimers Dis 2016; 54: 879-889.

[10] Bernstock JD, Peruzzotti-Jametti L, Ye D, Gessler FA, Maric D, Vicario N, Lee YJ, Pluchino S and Hallenbeck JM. Neural stem cell trans-plantation in ischemic stroke: a role for precon-ditioning and cellular engineering. J Cereb Blood Flow Metab 2017; 37: 2314-2319.

[11] Ma H, Yu B, Kong L, Zhang Y and Shi Y. Trans-plantation of neural stem cells enhances ex-pression of synaptic protein and promotes functional recovery in a rat model of traumatic brain injury. Mol Med Rep 2011; 4: 849-856.

[12] Tang Y, Cui YC, Wang XJ, Wu AL, Hu GF, Luo FL, Sun JK, Sun J and Wu LK. Neural progenitor cells derived from adult bone marrow mesen-

mailto:[email protected]


8147 Int J Clin Exp Med 2019;12(7):8136-8148

chymal stem cells promote neuronal regenera-tion. Life Sci 2012; 91: 951-958.

[13] Mashkouri S, Crowley MG, Liska MG, Corey S and Borlongan CV. Utilizing pharmacotherapy and mesenchymal stem cell therapy to reduce inflammation following traumatic brain injury. Neural Regen Res 2016; 11: 1379-1384.

[14] Ross CL, Siriwardane M, Almeida-Porada G, Porada CD, Brink P, Christ GJ and Harrison BS. The effect of low-frequency electromagnetic field on human bone marrow stem/progenitor cell differentiation. Stem Cell Res 2015; 15: 96-108.

[15] Seo N, Lee SH, Ju KW, Woo J, Kim B, Kim S, Jahng JW and Lee JH. Low-frequency pulsed electromagnetic field pretreated bone marrow-derived mesenchymal stem cells promote the regeneration of crush-injured rat mental nerve. Neural Regen Res 2018; 13: 145-153.

[16] Bai WF, Xu WC, Zhu HX, Huang H, Wu B and Zhang MS. Efficacy of 50 Hz electromagnetic fields on human epidermal stem cell trans-plantation seeded in collagen sponge scaf-folds for wound healing in a murine model. Bioelectromagnetics 2017; 38: 204-212.

[17] Bai WF, Xu WC, Feng Y, Huang H, Li XP, Deng CY and Zhang MS. Fifty-hertz electromagnetic fields facilitate the induction of rat bone mes-enchymal stromal cells to differentiate into functional neurons. Cytotherapy 2013; 15: 961-970.

[18] Bai WF, Zhang MS, Huang H, Zhu HX and Xu WC. Effects of 50 Hz electromagnetic fields on human epidermal stem cells cultured on col-lagen sponge scaffolds. Int J Radiat Biol 2012; 88: 523-530.

[19] Grassi C, D’Ascenzo M, Torsello A, Martinotti G, Wolf F, Cittadini A and Azzena GB. Effects of 50 Hz electromagnetic fields on voltage-gated Ca2+ channels and their role in modulation of neuroendocrine cell proliferation and death. Cell Calcium 2004; 35: 307-315.

[20] Piacentini R, Ripoli C, Mezzogori D, Azzena GB and Grassi C. Extremely low-frequency electro-magnetic fields promote in vitro neurogenesis via upregulation of Ca(v)1-channel activity. J Cell Physiol 2008; 215: 129-139.

[21] Cuccurazzu B, Leone L, Podda MV, Piacentini R, Riccardi E, Ripoli C, Azzena GB and Grassi C. Exposure to extremely low-frequency (50 Hz) electromagnetic fields enhances adult hippo-campal neurogenesis in C57BL/6 mice. Exp Neurol 2010; 226: 173-182.

[22] Duong CN and Kim JY. Exposure to electromag-netic field attenuates oxygen-glucose depriva-tion-induced microglial cell death by reducing intracellular Ca(2+) and ROS. Int J Radiat Biol 2016; 92: 195-201.

[23] Ma Q, Deng P, Zhu G, Liu C, Zhang L, Zhou Z, Luo X, Li M, Zhong M, Yu Z, Chen C and Zhang

Y. Extremely low-frequency electromagnetic fields affect transcript levels of neuronal differ-entiation-related genes in embryonic neural stem cells. PLoS One 2014; 9: e90041.

[24] Hamill OP, Marty A, Neher E, Sakmann B and Sigworth FJ. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 1981; 391: 85-100.

[25] Feeney DM, Boyeson MG, Linn RT, Murray HM and Dail WG. Responses to cortical injury: I. Methodology and local effects of contusions in the rat. Brain Res 1981; 211: 67-77.

[26] Finnie J. Animal models of traumatic brain in-jury: a review. Aust Vet J 2001; 79: 628-633.

[27] Salas M, Pulido S, Torrero C and Escobar C. Neonatal undernutrition and self-grooming de-velopment in the rat: long-term effects. Physiol Behav 1991; 50: 567-572.

[28] Kaneko K, Kawai S, Fuchigami Y, Shiraishi G and Ito T. Effect of stimulus intensity and vol-untary contraction on corticospinal potentials following transcranial magnetic stimulation. J Neurol Sci 1996; 139: 131-136.

[29] Heath DL and Vink R. Improved motor outcome in response to magnesium therapy received up to 24 hours after traumatic diffuse axonal brain injury in rats. J Neurosurg 1999; 90: 504-509.

[30] Ma Q, Chen C, Deng P, Zhu G, Lin M, Zhang L, Xu S, He M, Lu Y, Duan W, Pi H, Cao Z, Pei L, Li M, Liu C, Zhang Y, Zhong M, Zhou Z and Yu Z. Extremely low-frequency electromagnetic fields promote in vitro neuronal differentiation and neurite outgrowth of embryonic neural stem cells via up-regulating TRPC1. PLoS One 2016; 11: e0150923.

[31] Gascon E, Vutskits L and Kiss JZ. The role of PSA-NCAM in adult neurogenesis. Adv Exp Med Biol 2010; 663: 127-136.

[32] Wainwright SR and Galea LA. The neural plas-ticity theory of depression: assessing the roles of adult neurogenesis and PSA-NCAM within the hippocampus. Neural Plast 2013; 2013: 805497.

[33] Romero-Aleman MM, Monzon-Mayor M, San-tos E and Yanes C. Expression of neuronal markers, synaptic proteins, and glutamine syn-thetase in the control and regenerating lizard visual system. J Comp Neurol 2010; 518: 4067-4087.

[34] Romero-Aleman MM, Monzon-Mayor M, San-tos E, Lang DM and Yanes C. Neuronal and gli-al differentiation during lizard (gallotia galloti) visual system ontogeny. J Comp Neurol 2012; 520: 2163-2184.

[35] Duan W, Zhang YP, Hou Z, Huang C, Zhu H, Zhang CQ and Yin Q. Novel insights into NeuN: from neuronal marker to splicing regulator. Mol Neurobiol 2016; 53: 1637-1647.


8148 Int J Clin Exp Med 2019;12(7):8136-8148

[36] Ziebell JM and Morganti-Kossmann MC. In-volvement of pro- and anti-inflammatory cyto-kines and chemokines in the pathophysiology of traumatic brain injury. Neurotherapeutics 2010; 7: 22-30.

[37] Corrigan JD, Selassie AW and Orman JA. The epidemiology of traumatic brain injury. J Head Trauma Rehabil 2010; 25: 72-80.

[38] Cheng T, Wang W, Li Q, Han X, Xing J, Qi C, Lan X, Wan J, Potts A, Guan F and Wang J. Cerebro-protection of flavanol (-)-epicatechin after trau-matic brain injury via Nrf2-dependent and -in-dependent pathways. Free Radic Biol Med 2016; 92: 15-28.

[39] Frahm J, Lantow M, Lupke M, Weiss DG and Simko M. Alteration in cellular functions in mouse macrophages after exposure to 50 Hz magnetic fields. J Cell Biochem 2006; 99: 168-177.

[40] Medina FJ and Tunez I. Huntingtons disease: the value of transcranial meganetic stimula-tion. Curr Med Chem 2010; 17: 2482-2491.

[41] Tunez I, Drucker-Colin R, Jimena I, Medina FJ, Munoz Mdel C, Pena J and Montilla P. Tran-scranial magnetic stimulation attenuates cell loss and oxidative damage in the striatum in-duced in the 3-nitropropionic model of Hun-tington’s disease. J Neurochem 2006; 97: 619-630.

[42] Rosado MM, Simko M, Mattsson MO and Pioli C. Immune-modulating perspectives for low frequency electromagnetic fields in innate im-munity. Front Public Health 2018; 6: 85.

[43] Vianale G, Reale M, Amerio P, Stefanachi M, Di Luzio S and Muraro R. Extremely low frequency electromagnetic field enhances human kerati-nocyte cell growth and decreases proinflam-matory chemokine production. Br J Dermatol 2008; 158: 1189-1196.

Documents

Original Article Low frequency electromagnetic field (LFMF ... · NPCs group compared with BM-NPCs group at day 30. RT-PCR showed that in LFMF+BM-NPCs group, mRNA expres - sions of