Upload
others
View
17
Download
0
Embed Size (px)
Citation preview
Physiological and Molecular Analysis of Tolerance to
Phosphate Toxicity in Jarrah (Eucalyptus marginata)
Seedlings Inoculated with Mycorrhizal Fungi
Khalil Kariman
B.Sc. in Plant Protection: Gorgan Uni. Agric. Sci. Nat. Res., Iran
M.Sc. in Plant Pathology: Tarbiat Modarres University, Iran
This thesis is presented for the degree of Doctor of Philosophy at
the University of Western Australia
School of Earth and Environment
&
School of Plant Biology
Faculty of Natural and Agricultural Sciences
2013
As our circle of knowledge expands, so does the
circumference of darkness surrounding it
Albert Einstein
Dedicated to my father, my mother, my brothers and my
sister for their forever love and constant support during my
entire journey of education
Thesis Abstract
Jarrah (Eucalyptus marginata) is an Australian native tree with the capacity to form
arbuscular mycorrhizal (AM) and ectomycorrhizal (ECM) associations. ECM
symbioses are the main mycorrhizal type for mature eucalypts while AM symbioses are
thought to be transitory event early in eucalypt seedling growth. In previous research,
where eucalypt seedlings of several species have been exposed to isolated strains of
either AM or ECM fungi, plants in an ECM symbiosis had better P nutrition and
growth responses than those in an AM symbiosis. However, little research has been
carried out either exploring ECM and AM associations of jarrah in detail, or the effect
on plant growth and nutrition, of a dual (AM and ECM) symbiosis. In addition, jarrah
is among many Australian native plants that develop toxicity symptoms upon exposure
to high doses of phosphate (Pi). Crucial knowledge gaps exist in understanding the
molecular basis for P sensitivity of native species and how mycorrhizal symbioses
function in the deficiency-toxicity continuum. However, unpublished earlier research
has suggested a correlation between mycorrhizal status and tolerance to artificially high
levels of Pi in soil. To better understand the role of both AM and ECM symbioses in
the plant’s response to Pi and its analogues phosphite (Phi) and arsenate (AsV),
research in controlled conditions has been undertaken. Herbaceous plants in an AM
symbiosis are known to down-regulate the expression of some Pi transporter (class
PHT1) genes in roots. Therefore, I hypothesize that first, ECM fungi are better
symbiotic partners than AM in conferring growth and nutritional benefits to jarrah
plants and second, mycorrhizal associations have the potential to induce tolerance
against Pi, Phi and AsV toxicities, which could be linked with fungal ability to down-
regulate the expression of plant PHT1 genes. Therefore, this research was conducted to
i) investigate AM, ECM and dual (AM & ECM) mycorrhizal associations of jarrah and
their potential growth and P nutritional benefits, ii) clarify if mycorrhizal symbioses
can induce tolerance to jarrah plants exposed to Pi, Phi and AsV toxicity conditions and
iii) reveal any possible relationship between the expression of PHT1 genes in jarrah
roots and either P sensitivity or any mycorrhiza-mediated tolerance to Pi, Phi and AsV
toxicities.
I developed a nurse-pot system to investigate mycorrhizal colonisation of jarrah by
AM and ECM fungal species both separately and in dual AM+ECM culture (Kariman
et al., 2012, Chapter 2). The nurse-pot system was effective at initiating colonisation of
functioning AM (Scutellospora calospora) or putative ECM (Scleroderma sp.) systems.
i
The presence of S. calospora, Austroboletus occidentalis and Scleroderma sp.
individually significantly increased the shoot biomass of seedlings compared to non-
mycorrhizal (NM) controls whereas no positive response was observed with
Rhizophagus irregularis. In addition, the non-responsive AM fungus R. irregularis
suppressed the ECM symbiosis in a dual pot culture also containing Scleroderma sp.
inoculum. Also noteworthy, despite the positive growth and nutritional responses in the
A. occidentalis treatment, ECM structures were not observed in either nurse or test
seedlings. This suggested that a novel relationship existed between jarrah and A.
occidentalis that was potentially symbiotic and worthy of additional study.
A three-compartment system and 33
P-labelled Pi were used to explore the functional
mechanisms involved in the novel symbiosis observed between jarrah and A.
occidentalis (Chapter 3). The results of this additional analysis showed that the novel
symbiosis with no root colonisation was as beneficial for the host as a typical ECM
association, a finding that challenges the notion that this type of plant-fungal symbiosis
is defined by intraradical structures and an extensive network of extraradical hyphae. A
novel-plant fungus symbiosis was discovered in which i) the fungal partner does not
colonise plant roots, ii) hyphae are limited to the rhizosphere soil and vicinity and
consequently, iii) do not transfer nutrients located much beyond the rhizosphere and
presumably do not transfer nutrients directly. The transcript profile of PHT1 genes in
roots did not change in the presence of A. occidentalis, while the expression of two
genes (EmPHT1;1 and EmPHT1;2) were down-regulated in response to Scleroderma
sp., which formed classic ECM colonisation and transported 33
P to jarrah plants. This
suggests that the Pi uptake route shifts from a direct root pathway to a hyphal pathway
in the ECM plants as it does in the AM symbioses. The high concentrations of citrate
and fumarate measured in the rhizosphere soil indicated that exudation of these
substances to achieve nutrient solubilization and mobilization is a likely mechanism
involved in the proposed novel symbiosis between jarrah and A. occidentalis.
To study the role of AM, ECM and the novel symbioses in the response of jarrah to
toxic levels of P, inoculated and NM nurse plants were exposed to two potentially toxic
pulses of P as Pi (10 and 30 mg P kg-1
soil) (Chapter 4). The results revealed that jarrah
is among the most sensitive species to P fertilization, with toxicity symptoms observed
at a shoot P concentration of no more than 5.5 mg P g-1
DW. All inoculated plants had
significantly lower toxicity symptoms compared to NM controls one week after
addition of the elevated P dose.
ii
A comprehensive glasshouse experiment was then conducted to investigate the
response of jarrah to highly toxic pulses (1.5 mmol kg-1
soil) of Pi, and its analogues,
Phi and AsV (Chapter 5). The AM colonisation of jarrah plants by S. calospora
declined after 14 weeks growth, which is a common phenomenon occurring in early
stages of AM-eucalypt symbioses. However, addition of Pi and Phi reversed this
natural trend after four weeks compared to untreated AM plants. There was no root
colonisation detected for either Scleroderma sp. or A. occidentalis treatments, however
positive growth responses were detected for both treatments indicating that in this
experiment both fungi may use the novel symbiotic pathway. Four weeks after adding
the Pi pulse, only plants in the AM treatment demonstrated Pi tolerance. Results from
both toxicity experiments (Chapters 4 and 5) showed that the Pi tolerance was due to
lower shoot P concentration in both ECM and novel symbioses whereas Pi tolerance in
the AM symbioses was not always accompanied by lower shoot P concentration than
NM controls. All inoculated plants had Phi tolerance because of lower Phi uptake than
NM controls. For AsV, the most toxic analogue, all plants had died within a week after
the AsV pulse, however inoculated plants had significantly lower shoot As
concentration than NM controls. The expression of plant PHT1 genes was quantified to
see if symbiotic associations result in lower expression of plant PHT1 genes as an
indicator of hyphal P transfer and Pi tolerance. The expression pattern of jarrah PHT1
genes was not altered in response to S. calospora (AM) or either fungus (Scleroderma
sp. and A. occidentalis) that used the novel symbiotic pathway that benefitted the host
without colonisation. However, when jarrah plants were colonised by Scleroderma sp.
under low P conditions, (33
P-labelled experiment, Chapter 3), the expression of two
PHT1 genes was down-regulated. Interestingly, I detected enhanced transcript levels of
four PHT1 genes in roots of NM jarrah plants in response to Pi toxicity and three PHT1
genes in response to Phi and AsV toxicities, which could be linked with jarrah
sensitivity to these analogues.
Overall, the results in this thesis indicate that the range of beneficial fungal
interactions with jarrah is wider than the classic definition of mycorrhizal symbiosis. A
novel symbiosis clearly exists where the fungus does not penetrate the plant root but
has defined beneficial consequences to plant growth and nutrition and tolerance to Pi
and Phi. These benefits are correlated with higher carboxylate concentration in the
rhizosphere soil. Regardless of their colonisation ability, ECM performed better than
AM symbioses in improving jarrah growth and P nutrition, supporting the first
hypothesis of this thesis. However, the induced Pi and Phi tolerance in inoculated
iii
plants was not correlated with lower expression of plant PHT1 genes, disproving the
second hypothesis concerning PHT1 genes, at least for AM and novel symbioses. In
conclusion, this thesis has demonstrated that ECM and novel symbioses are more
beneficial under P-deficiency conditions while AM symbioses are superior in
protecting jarrah plants against P-toxicity conditions. This research has provided useful
insight to the P nutrition of jarrah in the context of efforts to retain its presence in
disturbed habitats.
iv
Publications arising from this thesis
Published papers:
- Kariman K, Barker SJ, Finnegan PM, Tibbett M (2012) Dual mycorrhizal
associations of jarrah (Eucalyptus marginata) in a nurse-pot system. Australian
Journal of Botany 60: 661-668
Papers to be submitted:
- Kariman K, Barker SJ, Jost R, Finnegan PM, Tibbett M. A novel plant-fungus
symbiosis benefits the host without forming mycorrhizal structures.
Target journal: Nature
- Kariman K, Barker SJ, Finnegan PM, Tibbett M. Mycorrhizal symbiosis can
induce tolerance in jarrah (Eucalyptus marginata) exposed to toxic pulses of
phosphorus.
Target Journal: Plant and Soil
- Kariman K, Barker SJ, Finnegan PM, Tibbett M. Symbiotic associations and
response of jarrah (Eucalyptus marginata) to phosphate, phosphite and arsenate
toxicities.
Target Journal: Plant Physiology
Conference presentations
- Kariman K, Barker SJ, Jost R, Finnegan PM, Tibbett M (2011). Mycorrhiza-
mediated tolerance to phosphorus toxicity in jarrah (Eucalyptus marginata). The
Rhisosphere 3 International Conference, Perth, Australia.
v
vi
Table of contents
Abstract i
Publications arising from this thesis v
Acknowledgements ix
Statement of authorship xi
Chapter 1: General Introduction and Literature Review 1
Chapter 2: Dual mycorrhizal associations of jarrah (Eucalyptus 29
marginata) in a nurse-pot system
Chapter 3: A novel plant-fungus symbiosis benefits the host 37
without forming mycorrhizal structures
Chapter 4: Mycorrhizal symbiosis can induce tolerance in jarrah 59
(Eucalyptus marginata) exposed to toxic pulses of phosphorus
Chapter 5: Symbiotic associations and response of jarrah 79
(Eucalyptus marginata) to phosphate, phosphite
and arsenate toxicities
Chapter 6: General Discussion and Conclusion 105
vii
viii
Acknowledgements
I look at my PhD as an amazing journey of my life, a journey that taught me how to
think rationally and how to work scientifically, a journey full of research experience
and a journey filled with unforgettable memories and moments with the UWA staffs
and students.
I would like to express my sincere gratitude to my coordinating supervisor Prof.
Mark Tibbett and my co-supervisors Profs Susan Barker and Patrick Finnegan for their
excellent supervision, constant support, advice and encouragement throughout my
PhD. Mark, Susan and Pat, thanks a lot indeed for teaching me the scientific
rationality, you are such awesome teachers. Susan, I also appreciate your initial
support and encouraging me to apply for international PhD scholarships at the UWA.
I acknowledge the University of Western Australia for the financial support of my
PhD studies by awarding the prestigious Scholarships for International Research Fees
(SIRF) and the University International Stipend (UIS). Financial supports from
Schools of Earth and Environment & Plant Biology are also appreciated.
I would like to thank Tim Morald, Tim Lardner and Evonne Walker in Centre for
Land Rehabilitation for their kind helps. Thanks to John Koch at the Alcoa World
Alumina for his assistance in collecting jarrah seeds from jarrah forest sites. My fellow
students Martha Orozco Aceves, Deborah Lin and Dimanthina Cheong, I really
enjoyed your company and friendship during my PhD.
Special thanks to Ricarda Jost and Hazel Gaza for their support and practical advice
on the molecular aspects of my project. Also, I greatly appreciate technical and
scientific advice from Lindsey Loweth on my 33
P experiment. Many thanks to my
great friends in Pat Finnegan’s group Bahram Mirfakhraei, Fazilah Abd Mannan,
Sandra Kerbler, Robert Pontre and Marina Borges Osorio.
Special thanks to my dear friend Basu Dev Regmi for his technical and scientific
advice throughout my studies. You are such an awesome mate with a unique spirit.
My dear friend Dr. Hossein Khabaz-Saberi, you have always been a great friend and
the person I could trust when I had serious difficulties in my life and studies.
Thanks to my school mates Mansour Ghorbanpour, Daniel Dempster, Leila
Heidarvand, He Chang (Shirely), Anjani Weerasekara, Sanjutha Shanmugam,
Zhengyao Nie, Louis Moir-Barneston, Srinivasan Samineni, John Quealy, George,
Sonja Jakob and Lalith Suriyagoda.
Michal Smirk, I am so grateful for your kind assistance with ICP analysis of my
samples. Many thanks to Gregory Cawthray for his assistance and technical advice for
ix
carboxylates and sugar analysis of my samples by HPLC. Robert Creasy and Bill
Piasini, I appreciate your positive attitudes and continuous assistance during all my
glasshouse experiments.
I have to express my deepest thanks to my parents, my sister and my brothers for
their countless supports of my education and also special thanks to my brothers for
supporting my initial migration to Australia. Heaps of thanks to my wife for all her
kindness and understanding my situation during the late stages of my PhD. My family
has always been dedicated to provide a better future for me, and my educational
achievements were unfeasible without their kindness and encouragement.
x
1
Chapter 1
General Introduction and Literature Review
General Introduction
Australian soils generally contain low levels of essential nutrients needed for plant
growth. Phosphorus (P) deficiency is considered to be the main critical factor
determining plant productivity and species diversity in Australian terrestrial ecosystems
(Thompson et al., 1983; Adams et al., 1994; Handreck, 1997; Richardson et al., 2009;
Lambers et al., 2010).
Many Australian native plants have adaptive mechanisms to extract as much P as
possible from the low P soils, in which they grow. Mycorrhizal association is an
efficient strategy for increasing P uptake and is estimated to be found in more than 80%
of land plant species (Smith and Read, 2008). There are seven types of mycorrhizal
associations defined by the way in which the plant root interacts with particular fungal
species or genera. Arbuscular mycorrhiza (AM) and ectomycorrhiza (ECM) are the
most abundant types. Arbuscular mycorrhizal associations occur in more than 336 plant
families and probably co-evolved with plant roots over the last 400 million years
(Smith and Read, 2008; Brundrett, 2009). Ectomycorrhizal associations are more
specialized, recently evolved and can form symbiotic associations with many woody
plant species from about 30 families (Wilcox, 1996; Smith and Read, 2008). Besides
the main types, unusual plant-fungus associations with unconventional structures or
without any colonisation also have been documented, which cannot be classified into
any of the already-described mycorrhizal categories (Neumann, 1959; Warcup and
McGee, 1983; Kope and Warcup, 1986; Brundrett, 2009). Generally, the association
can be considered a symbiosis that is mutually beneficial.
Some Australian native plants growing in P-impoverished soils are extremely
sensitive to P fertilization. Phosphorus sensitive species are found in the Proteaceae,
Myrtaceae, Rutaceae, Fabaceae, Mimosaceae, Haemodoraceae and generally are a
feature of heaths and other sclerophyllous plant communities (Specht and Groves,
1966; Grundon, 1972; Heddle and Specht, 1975; Specht et al., 1977; Specht, 1981a,
1981b; Dell et al., 1987; Handreck, 1997; Shane et al., 2004a, 2004b; Thomson and
Leishman, 2004; Hawkins et al., 2008). Jarrah (Eucalyptus marginata) plants are
sensitive to P fertilization presumably as a consequence of their adaptation to P-
deficient soils. Unpublished experiments have shown that jarrah becomes tolerant to P
2
following mycorrhizal colonisation (Tibbett, unpublished). There is evidence that P
responses may be linked to plant responses to root colonisation by mycorrhizal fungi
but details of this relationship are not clear. The expression of high-affinity Pi
transporter (PHT1) genes in plant roots can be reduced in response to mycorrhizal
colonisation (Karandashov and Bucher, 2005). As a consequence of the mycorrhizal
symbiosis, plant epidermal PHT1 gene expression is reduced in roots. Tolerance of
mycorrhizal jarrah plants to toxic dose of Pi might occur if the symbiotic fungi are able
to regulate the amount of Pi that they supply to the plant and the plant root epidermal Pi
uptake mechanism is reduced or not functional in the symbiotic state. The possibility
that tolerance exists in mycorrhizal jarrah plants and might be due to reduced
abundance of PHT1 gene products is an hypothesis that will be tested in this thesis.
Two phosphate (Pi) analogues phosphite (Phi) and arsenate (AsV) are of significant
importance to environmental scientists and authorities in Western Australia (WA).
Phosphite has been widely used for treatment of the Die Back disease caused by
Phytophthora cinnamomi, which is a destructive pathogen in WA forests and heathland
communities (Dell et al., 2005). Arsenate contamination of soils and underground
water occurs in WA naturally or as a result of anthropogenic activities such as mining
(Smith et al., 2003). Native plant species such as jarrah, therefore, might be exposed to
high levels of these two Pi analogues. Both Phi and AsV can enter plant roots through
the same mechanism as Pi i.e. via Pi transporters (Meharg and Macnair, 1990; Guest
and Grant, 1991; Meharg and Macnair, 1992; Marschner, 1995). Arsenate tolerance in
mycorrhizal plants can be achieved through various mechanisms such as reduction of
AsV to arsenite (AsIII) and the reduced expression of plant PHT1 genes (Sharples et
al., 2000; Gonzalez-Chavez et al., 2002).
According to our hypothesis, altered expression patterns of plant high affinity PHT1
genes are probably always associated with tolerance to Pi, Phi and AsV toxicity in
mycorrhizal plants. However, there is no literature available regarding the PHT1
sequences in jarrah, the response of PHT1 gene expression to ECM symbiosis in any
host, or the role of mycorrhizal associations in tolerance to P toxicity in woody
Australian plant species. Jarrah is an ideal model host to investigate both AM and ECM
symbioses as it has dual symbiotic capacity (Brundrett and Abbott 1991; Howard et al.,
2000) during its lifecycle.
3
Research Objectives:
1- To determine the effects of selected AM and putative ECM species on jarrah
growth and nutrient acquisition (in particular P) under P-deficient conditions
2- To investigate the symbiosis using locally isolated ECM-type fungi with which
jarrah would be associated in natural settings
3- To investigate the potential role of different fungal symbionts in inducing
tolerance to jarrah plants exposed to toxic pulses of P as Pi
4- To investigate the possibility that mycorrhizal symbioses might induce
tolerance against a toxic pulse of Pi, Phi and AsV and monitor the shoot P and
As concentration after short and long time exposure
5- To clone and sequence the root-expressed high-affinity Pi transporter genes
(PHT1 gene family) from jarrah
6- To quantify the transcript abundance of PHT1 genes in jarrah roots in order to i)
clarify the molecular mechanism behind P sensitivity in jarrah and ii) reveal the
possible correlation with P tolerance in mycorrhizal plants
4
Structure of the Thesis
Chapter 1: General Introduction and Literature Review
Chapter 2: Dual mycorrhizal associations of jarrah (Eucalyptus marginata) in a nurse-
pot system
Target Journal: Australian Journal of Botany Status: Published (2012, 60: 661-668)
Chapter 3: A novel plant-fungus symbiosis benefits the host without forming
mycorrhizal structures
Target Journal: Nature Status: To be submitted
Chapter 4: Mycorrhizal symbiosis can induce tolerance in jarrah (Eucalyptus
marginata) exposed to toxic pulses of phosphorus
Target Journal: Plant and Soil Status: To be submitted
Chapter 5: Symbiotic associations and response of jarrah (Eucalyptus marginata) to
Pi, Phi and AsV toxicities
Target Journal: Plant Physiology Status: To be submitted
Chapter 6: General Discussion and Conclusion
5
Literature Review
Australian soils and P status
Australian soils are generally known as nutrient-deficient soils and contain an
average of 300 mg P kg-1
soil, which is regarded as a low P level compared with soils
from other countries (Williams and Raupach, 1983). This is mainly because Australian
soils have derived from low P containing sedimentary rocks and also due to the long
history of geological stability in Australian landscapes (Williams and Raupach, 1983;
Handreck, 1997; Lambers et al., 2011). Some natural processes contribute to P
depletion from soil including weathering (White, 1986, 1994), leaching (Attiwill and
Leeper, 1987) and removing fine soil particles rich in P by wind and water (Beadle,
1962; Raison et al., 1985). The soil total P consists of organic P (Po) and inorganic P
pools and only less than 1% of total P is immediately available (Pi) for plants uptake
(Richardson et al., 2009). Adsorption onto soil particles and formation of AlPO4 or
FePO4 complexes are the main factors limiting the P availability for plants, particularly
in highly weathered soils (Lambers et al., 2008).
Native Australian plants and P nutrition
Many Australian native plants are well-adapted to low nutrient soils and most of them
have evolved mechanisms to capture more P from soil. Mycorrhizal associations and
cluster roots are the most important mechanisms making native plants very effective at
P uptake from low P soil (Handreck, 1997). However, many native species are now
sensitive to P fertilisation and develop phytotoxicity symptoms when exposed to over
moderate P supplies. According to Handreck (1997), an Olsen extractable P
concentration (inorganic plus organic P in the extract) of about 20 mg P kg-1
soil is
lethal to the seedlings of P-sensitive native species.
Groves and Keraitis (1976) showed that P concentrations of up to 100 mg P kg-1
soil
resulted in the mortality of seedlings of Acacia spp, Banksia spp and Eucalyptus spp.
Thomson and Leishman (2004) conducted a set of experiments to investigate the effect
of nutrient addition (various concentrations of NPK as liquid fertilizer) on the response
of some native species from low and high nutrient soils. Seedlings of both plant groups
showed a range of decline in survival after nutrient addition. However, species adapted
to high nutrient soils were less severely affected by nutrient addition. The same trend
was observed for six-month-old plants; species from high nutrient soils were more
tolerant than those adapted to low nutrient soils. Their results also suggested that
6
seedlings are more sensitive to nutrient fertilization than more mature plants, as
previously shown in other field experiments (Specht, 1963; Heddle and Specht, 1975).
Native Proteaceae species such as Banksia ericifolia and B. grandis were shown to
develop symptoms associated with P toxicity when exposed to P fertilization (Ozanne
and Specht, 1981; Parks et al., 2000; Lambers et al., 2002). P toxicity in Proteaceae is
correlated with an inability to reduce P uptake from the rhizosphere (Shane et al.,
2003). Hakea prostrata, a typical member of the Proteaceae developed P toxicity
symptoms similar to those observed in other species at application rates of more than
100 µmol P d-1
(about 3 ppm) in a hydroponic system (Shane et al., 2004a).
Some heaths and sclerophyllous species are also adversely affected by P fertilization.
The negative effects observed include reduced survival of seedlings, observable
symptoms of P toxicity such as leaf chlorosis and necrosis, hastened life cycle and early
death (Specht, 1963; Specht and Grooves, 1966; Grundon, 1972; Heddle and Specht,
1975; Specht et al., 1977). Application of small quantities of P (2 cwt superphosphate
per acre) resulted in a great reduction in the survival rate of heath seedlings (Specht,
1963). P application rates of more than 11 g m-3
as monocalcium phosphate resulted in
P toxicity symptoms in two cultivars of Caustis blakei and caused a significant
decrease in yield (Gikaara et al., 2005). However, fertilization with rock phosphate
showed no toxicity symptoms or decline in shoot dry weight in the Caustis cultivars
tested (Gikaara et al., 2005). Therefore, the occurrence of P toxicity in plants can also
depend on the type of P fertilisation as various P forms differ in their solubility and P
release into soil (van Straaten 2002).
In conclusion, many Australian native plant species show various degrees of
sensitivity when exposed to high levels of P and the toxicity symptoms and severity
might be different depending on plant species, habitat, P source and growth conditions.
However, there is no literature available on how soil biological components (in
particular, mycorrhizas) behave in native plants exposed to P toxicity conditions. The
capacity to form dual mycorrhizal associations (AM and ECM) makes jarrah an ideal
native species to investigate the function of mycorrizal symbioses under P toxicity
conditions.
Australian native plant species and tolerance to P toxicity
Soil physiochemical and biological properties can play an important role in tolerance
to P toxicity. Two varieties of Caustis blankei grown under leaching conditions showed
reduced symptoms of P toxicity compared with those grown under non-leaching
7
conditions (Gikaara et al., 2005). Status of other nutrients can also affect the P toxicity
severity. For example, increasing the levels of calcium (Ca) exacerbated the P toxicity
symptoms in Grevillea cv while addition of nitrogen N and potassium (K) reduced
toxicity (Nichols and Beardsell, 1981). Jarrah plants were more tolerant to P
fertilization when supplied with adequate levels of N (Dell et al., 1987). Adequate
supply of iron (Fe) reduced sensitivity to high levels of P in susceptible species
including Acacia spp, Banksia spp, Grevillea spp and Hakea spp (Nichols, 1988;
Goodwin, 1981; Handreck, 1991a; 1991b). Formation of insoluble P (FePO4) from
interaction of iron (Fe+3
) and P, could be a potential mechanism in this case (Brady and
Weil, 1996). The soil pH can also reduce the P availability for plants by making
insoluble complexes such as FePO4 and AlPO4 in acidic soils or CaPO4 in alkaline soils
(Lambers et al., 2008).
Jarrah plants in non-mycorrhizal growth have been shown to be very sensitive to high
levels of P, whereas AM jarrah plants develop less phytotoxicity symptoms (Tibbett,
unpublished). Mycorrhizal plants and non sensitive plants growing in high P conditions
can have reduced PHT1 gene expression and consequently their P uptake is lower,
suggesting that P tolerance in mycorrhizal plants might be correlated with lower
expression of plant PHT1 genes (Karandashov and Bucher, 2005). For example, the
PHT1 gene Mt4 was systemically down-regulated in Medicago truncatula by both P
fertilization and AM colonisation (Burleigh and Harrison, 1999). Also, two high-
affinity PHT1 genes including MtPT1 and MtPT2 were down-regulated following
colonisation of M. truncatula roots by the AM fungus Glomus versiforme (Liu et al.,
1998). In mycorrhizal tomato plants with sufficient P, the PHT1 gene LePT1 was
down-regulated in root hairs, epidermal cells and also non-colonized regions of roots
(Rosewarne et al., 1999). Colonisation of M. truncatula plants by some AM species
including G. mosseae, G. intraradices, G. versiforme, G. caledonium, G. claroideum
and Scutellospora calospora caused the down-regulation of the expression of the high-
affinity PHT1 gene MtPT2 (Burleigh, 2001). However, Gigaspora rosea failed to
reduce PHT1 gene expression in these experiments. In addition, of three AM species
tested, G. versiforme, G. mosseae and G. rosea, only G. mosseae could strongly reduce
the expression of the putative nitrate transporter AI974803. Taken together, many AM
species show the ability to reduce the expression of high-affinity PHT1 genes in order
to alter the P uptake pathway. Mycorrhizal plants take up P mainly via fungal hyphae
rather than plants roots.
8
Phosphate transporters (PHT)
Phosphorus is a macronutrient that is essential for plant growth, because it is a
structural component of nucleic acids and phospholipids, and is involved in many
cellular functions such as energy transfer and the regulation of enzyme activity.
Phosphate (Pi) is the main form of P taken up by plant roots through membrane-
embedded Pi transporter proteins.
According to the current nomenclature, Pi transporters are classified into three
families called PHT1, PHT2, PHT3 and PHT4 (Bucher et al., 2001; Mudge et al.,
2002; Rausch and Bucher, 2002). The PHT1 family include the Pi transporters involved
in P uptake from the soil solution. Most PHT1 members are induced under P-deficiency
conditions. Most members of this family have high affinity for Pi uptake, and are able
to absorb low concentrations of P (Km 1-10 µm) (Clarkson, 1984). The PHT1 members
have been identified in a variety of plant species (Table 1). Members of the PHT2
family are expected to be mainly involved in the internal Pi transport within plant
tissues (chloroplast Pi transporters) and have been shown to have a low affinity for Pi
uptake that require higher concentrations of P to function (Km 100-1000 µm) such as
Pht2:1 in Arabidopsis (Daram et al., 1999). The PHT3 members are involved in
mitochondrial Pi transport such as ARAth;Pht3;1, ARAth;Pht3;2 and ARAth;Pht3;3 in
Arabidopsis thaliana (Rausch and Bucher, 2002). PHT4 members are thought to be
organellar Pi transporters, mostly plastid-localised and expressed in both leaves and
roots (Guo et al., 2008).
9
Table. 1. List of plant species with identified PHT1 members
Plant species Reference
Arabidopsis thaliana Muchhal et al., 1996
Potato Leggewie et al., 1997; Rausch et al., 2001
Catharantus roseus Kai et al., 1997
Tomato Liu et al., 1998; Daram et al., 1998
Medicago truncatula Liu et al., 1998; Xiao et al., 2006
Barley Smith et al., 1999
Tobacco Baek et al., 2001
Lupinus albus Liu et al., 2001
Lotus Nakamori et al., 2002
Rice Paszkowski et al., 2002; Ming et al., 2005;
E. camaldulensis Koyama et al., 2006
Maize Nagy et al., 2006
Wheat Tittarelli et al., 2007
Populus trichocarpa Loth-Pereda et al., 2011
A subset of high affinity Pi transporters located in the plasmalemma of root
epidermal cells and root hair cells absorb the Pi directly from the soil solution and are
induced in response to Pi starvation. These include MtPT1 and MtPT2 in M. truncatula
(Chiou et al., 2001), StPT1 and StPT2 in potato (Rausch et al. 2001) and LePT1 in
tomato (Rosewarne et al., 1999). The expression of some of these PHT1 genes has been
shown to decrease following mycorrhizal colonisation or high Pi concentration in soil,
including MtPT2 and LePT1 (Liu et al., 1998; Burleigh and Harrison, 1999; Rosewarne
et al., 1999). The reduced expression of these PHT1 genes is due to the shift in Pi
uptake from a root pathway to a hyphal pathway in mycorrhizal plants or modification
of the Pi uptake in plants exposed to high Pi conditions.
Distinct subsets of high affinity Pi transporters are involved in the uptake of Pi
released by mycorrhizal hyphae within root cortical cells and are usually induced
following mycorrhizal colonisation. These include StPT3, StPT4 in potato (Rausch et
10
al., 2001), MtPT4 in M. truncatula (Harrison et al., 2002; Javot et al., 2007),
HORvu;Pht1;8 (AY187023) in barley, TRIae;Pht1;myc in wheat (AJ830009) and
ZEAma;Pht1;6 (AJ830010) in maize (Glassop et al., 2005), LePT4 in tomato and
StPT4 in potato (Nagy et al., 2005), ORYsa;Pht1;11 and ORYsa;Pht1;13 in rice
(Glassop et al., 2007).
Therefore, the expression of PHT1 genes may be repressed or induced by
mycorrhizal colonisation depending on their location within the plant root and also
their involvement in direct (plant) or indirect (mycorrhizal) pathways of P uptake.
Taken together, the fact that some high affinity Pi transporters (PHT1) are repressed
following mycorrhizal colonisation suggests the possible correlation between the
expression of these genes and Pi tolerance in mycorrhizal jarrah plants.
Mycorrhiza and P uptake
Mycorrhiza is a mutualistic symbiosis between plant roots and some soil borne fungi.
Seven categories of mycorrhizas have been recognized based on the morphological
structures developed and the plant-fungal species involved. These include AM, ECM,
ectendomycorrhiza, orchid mycorrhiza, ericoid mycorrhiza, arbutoid mycorrhiza and
monotropoid mycorrhiza (Smith and Read, 2008). Dark septate endophytes
(Jumpponen, 2001) and Sebacinales (Weiß et al., 2011) can colonize plant tissues and
establish beneficial associations, which are debatably referred to as mycorrhiza or
endophytes.
AM fungi are the most ubiquitous mycorrhizal fungi forming symbiotic associations
with 80% of vascular plants (Smith and Read, 2008). In AM symbiosis, fungal hyphae
penetrate roots and grow between plant epidermal and cortex cells. Some intraradical
hyphae penetrate cortex cells and form tree-like structures called arbuscules, which are
thought to be sites for exchange of metabolites between plant and fungal partners.
Storage structures are also formed within or between root cells called vesicles.
Extraradical hyphae can explore the soil more than 10 cm beyond the rhizosphere (Li et
al., 1991) and transfer mineral nutrients to plants.
ECM fungi are the second most widespread form of mycorrhiza and have an intimate
association with many plant species particularly trees and shrubs belonging to
Betulaceae, Fagaceae, Myrtaceae and Pinaceae (Wilcox, 1996). In ECM symbiosis, the
root surface is covered by fungal sheath, often making rootlets short and stumpy.
Intraradical hyphae grow deep between cortex cells (hartig net) but do not penetrate
cortex cells. ECM fungi form an extensive extraradical hyphal network of up to several
11
meters and nutrient transfer from up to 40 cm distance from root systems has been
documented (Finaly and Read, 1986).
However, plant-fungus associations with unconventional or undeveloped structures
have also been documented that cannot be classified into any of the above mycorrhizal
categories and are of ambiguous functional status (Warcup and McGee, 1983; Kope
and Warcup, 1986; Brundrett, 2009). A positive growth response has also been reported
for seedlings of E. camaldulensis inoculated with the ECM fungus Pisolithus
tinctorious without the formation of ECM structures (Neumann, 1959). The existing
literature has typically viewed the function of mycorrhizas with respect to the
specialized mycorrhizal structures and hyphal-mediated nutrient uptake, which might
not always reflect the functionally relevant factors of an association. Recent studies,
however, highlighted the role of fungi in biogenic weathering of soils in most forest
ecosystems including mineral dissolution and phosphate (Pi) solubilization, leading to
enhanced nutrient availability for ERH and ECM roots (Landeweert et al., 2001; Finlay
et al., 2009).
Some plant families including Euphorbiaceae, Myrtaceae, Pinaceae, Salicaceae,
Mimosaceae, Fagaceae and Caesalpinaceae are capable of forming symbiotic
associations with both AM and ECM fungi. Dual colonisation has been reported for
certain plant genera such as Pinus (Wagg et al., 2008), Chosenia and Salix (Hashimoto
and Higuchi, 2003), Eucalyptus (Gange et al., 2005), Acacia (Founoune et al., 2002),
Uapaca (Ramanankierana et al., 2007), Quercus (Dickie et al., 2002), Dicymbe
(McGuire et al., 2008), Kunzea (Moyersoen and Beever, 2004), and Leptospermum
(Moyersoen and Beever, 2004; Weijtmans et al., 2007). In these tripartite associations
the AM colonisation is usually replaced by ECM colonisation via several mechanisms
including mechanical barriers by the ECM sheath (Chilvers et al., 1987) and
competition for root carbohydrates (Lodge and Wentworth, 1990). However, limited
research has been carried out to clarify the details about AM/ECM interactions on the
same roots system.
Mycorrhizal symbiosis provide the host plant with several benefits such as enhancing
nutrient and water uptake (Hall et al., 1984; Allen et al., 1991; Marschner and Dell,
1994; Koske et al., 1995; Gemma et al., 1997; Koske et al., 1997), inducing resistance
against soil-inhabiting pathogens (Gianinazzi-Pearson and Gianinazzi, 1983;
Linderman, 1994; Newsham et al., 1995), tolerance against physiological stresses such
as drought and salinity (Ojala et al., 1983; Poss et al., 1985) and tolerance to heavy
12
metal toxicity (Hildebrandt et al., 2007). However, increasing the P uptake is regarded
as one of the most significant benefits conferred by both AM and ECM fungi (Koide,
1991; Tibbett and Sanders, 2002; Torres Aquino and Plassard, 2004; Smith and Read,
2008).
The positive growth responses in ECM symbiosis are not necessarily correlated with
the formation of ECM structures on the roots. Neumann (1959) observed increased
growth of E. camaldulensis seedlings inoculated with the ECM fungus Pisolithus
tinctorious without formation of mycorrhizal structures and attributed the positive
growth response to the function of fungal hyphae in the rhizosphere soil. Positive
growth responses with partial, discrete patches, or no fungal sheath have been reported
for other ECM species including Peziza whitei, Laccaria ohiensis and the
ascomyceteous WARH 24 isolate in association with certain Asteraceae (Kope and
Warcup, 1986; Warcup and McGee, 1983).
Arbuscular mycorrhizal plants take up P both directly through the Pi transporters
within plant roots and indirectly via extraradical hyphae of mycorrhizal fungi (Smith et
al., 2003). The direct pathway of P uptake can be affected by mycorrhizal colonisation
and the concentration of available P for actively absorbing roots (Smith et al., 2003).
Smith et al. (2003, 2004) showed that there had been a misevaluation of the
contribution of mycorrhizal fungi to P uptake in host plants. Indeed, mycorrhiza-
mediated P uptake could be much higher than previously presumed. Their results
demonstrated that mycorrhizal fungi made a substantial contribution to P uptake in five
plant/fungus combinations. Flax and tomato plants inoculated with G. intraradices
were shown to absorb P exclusively (100 %) through the mycorrhizal pathway. Also,
medic plants inoculated with both G. intraradices and G. caledonium absorbed more
than 60 % of their P via the mycorrhizal pathway. The contribution of the mycorrhizal
pathway to P uptake depends on the plant/fungus combination and the ability of the
fungus to cause the induction of mycorrhiza-specific genes within the host plant, which
are involved in the acquisition of P released into the root cortex by fungal hyphae
(Karandashov and Bucher, 2005). Mycorrhiza-specific plant PHT1 genes such as
OsPT11 in rice, StPT3 in potato, MtPT4 in medic and LePT4 in tomato play a
significant role in the mycorrhizal pathway of P uptake (Paszkowski et al., 2002;
Rausch et al., 2001; Liu et al., 1998; Rosewarne et al., 1999). The extent of P uptake
was demonstrated not to be correlated with the presence or absence of a growth
response in the host (Smith et al., 2003, 2004); this has been the traditional measure of
13
mycorrhizal ‘effectiveness’ and now must be re-evaluated as it does not necessarily
demonstrate a physiological response to mycorrhization.
ECM symbiosis also markedly contributes to P uptake via extraradical hyphae
exploring the soil beyond the P depletion zone caused by plant roots (Finlay and Read,
1986; Tibbett and Sanders, 2002; Torres Aquino and Plassard, 2004). However, there
has been no study focusing on the relationship between ECM colonisation and the
expression of PHT1 genes in ECM roots. That evaluation will be an important
extension of current understanding about the nutritional consequences of ECM
symbiosis to the host.
Phosphate analogues
Phosphate has several chemical analogues differing in oxidation states or the central
element including phosphite (Phi, HPO3-2
), arsenate (AsV, AsO4-3
), and vanadate (V
[V], VO4-3
) that are acquired by plants via Pi transporters (Guest and Grant, 1991;
Marschner, 1995; Finnegan and Chen 2012). Phosphite is regarded as a plant non-
metabolizable source of P and arsenate is the inorganic form of arsenic (As), both
possessing phytotoxic properties.
Phosphite chemistry and toxicity
Phosphite is a Pi analogue with the chemical formula of HPO3-2
that has been widely
used as a fungicide for controlling fungal pathogens in particular oomycetes mostly
with the generic name of fosetyl-Al or Aliette (Guest and Grant, 1991; McDonald et
al., 2001a). There are two main modes of action for antifungal activity of Phi including
inhibition of phosphorylation reactions (due to accumulation of inorganic
pyrophosphate) and disruption of the metabolic pathways regulated by Pi (Barchietto et
al., 1992; Niere et al., 1994, McDonald et al., 2001b).
From a plant perspective, Phi is generally considered to be a non-metabolizable form
of P as it cannot be assimilated into organic P compounds in plants (Guest and Grant,
1991). Therefore, application of Phi can result in development of phytotoxicity
reactions in plants (Varadarajan et al., 2002, Sukarno et al., 1993; 1996; 1998; Ticconi
et al., 2001). However, there are also reports showing positive nutritional effects of Phi
on plants (Jabahi-Hare and Kendrick, 1987; Lovatt and Mikkelsen, 2006), which are
most likely due to microbe-mediated oxidation of Phi to Pi in soil (Ohtake et al., 1996).
14
Mycorrhiza and Phi toxicity
Mycorrhizal fungi respond differently upon exposure to Phi. Howard et al., (2000)
did not observe any negative effects on ECM colonisation of Eucalyptus globulus
seedlings by Pisolithus, Scleroderma and Descolea after foliar application of Phi at a
recommended rate of 5 g L-1
. However, doubling the concentration (10 g L-1
) reduced
the ECM colonisation by Descolea. Interestingly, they also reported a four-fold
increase in AM colonisation of Agonis flexuosa after the Phi treatment. Similarly, an
increase in AM colonisation has been reported for leek (Jabahi-Hare and Kendrick,
1987) and lettuce (Clarke, 1978) after foliar application of fosetyl-Al. However, there
are some other reports showing that Phi application decreased AM colonisation in
certain plants such as maize (Seymour et al., 1994) and onion (Sukarno, 1996, 1998).
The negative effects of Phi on mycorrhizal colonisation have been attributed to
accumulation of Phi near root tips (Guest and Grant, 1991) resulting in a damage to
fine roots and consequently reduction of sites for AM and ECM formation (Howard et
al., 2000).
Similar to Pi, many Australian native plants develop toxicity symptoms upon
exposure to high doses of Phi. Barrett (2001) observed the development of toxicity in
plant species from Anarthriaceae, Epacridaceae, Myrtaceae, Papillionaceae and
Proteaceae after spraying Phi at rates from 24 to 144 kg ha-1
. The recommended rate of
5 g L-1
caused mild (less than 25%) damage to shoot of most species in jarrah forest
(Tynan et al., 2001). Howard et al. (2000) observed higher phytotoxicity rate in jarrah
than in E. globulus and A. flexuosa following foliar application of 7.5 and 10 g L-1
Phi.
However, there is not enough information about the function of mycorrhiza and their
potential role in inducing tolerance to native species including jarrah against Phi
toxicity.
Arsenate chemistry and toxicity
Arsenic (As) is a poisonous metalloid belonging to group V of the periodic table and
considered to be a hazardous environmental contaminant with a high carcinogenic
potential. The presence of As in the environment leads to remarkable loss of
biodiversity in affected ecosystems. It is also a serious direct threat to human health, as
people can intake different arsenic species by consumption of contaminated
groundwater and agricultural products (Hadi and Parveen, 2004). Particularly, it has
harmful effects on those organisms directly related to human health, such as plants,
fishes and domestic animals. Arsenic is the cause of many human diseases, such as
15
fatal cancers (lung, liver and kidney), cirrhosis, gangrene and also the cause of
arsenicosis, which is responsible for thousands of deaths each year (Hadi and Parveen,
2004).
Arsenate and arsenite (AsIII) are the most common oxidation states of As found in
nature. Contamination of groundwater and soil by As compounds is a result of natural
processes such as eruption of volcanoes and erosion of mineral deposits or
anthropogenic activities such as mining, agriculture (application of arsenical pesticides
and herbicides), forestry, drilling and so on (Smith et al., 2003). Arsenate is a Pi
analogue taken into plants via the Pi uptake system. In the cell, As (V) can severely
disrupt vital functions, including the energy production pathway by substituting for P in
the production of ATP, forming ADP-As complex that uncouples the ATP synthesis
pathway (Meharg and Hartley-Whitaker, 2002; Finnegan and Chen, 2012).
Mycorrhiza and AsV toxicity
Compared to chemical methods, biological approaches (bioremediation) are better
options for cleaning up environmental pollutants such as As in sense of both cost-
effectiveness and environmental concerns. Soil-dwelling microorganisms can function
as a key tool to avoid contamination of the food chain by various strategies such as
immobilization, transformation and volatilization of arsenic species in polluted soils.
Arsenate reduction is a widespread strategy to deal with AsV toxicity in
microorganisms such as bacteria (Cervantes et al., 1994), saprophytic fungi such as
Aspergillus and Saccharomyces (Wysocki et al., 2001; Canovas et el., 2003) and
mycorrhizal fungi (Sharples et al., 2000) in which the AsV is reduced to AsIII after
uptake, then the produced AsIII is exported back to soil (Vetterlein et al., 2007). AsIII
is more reactive and more toxic than AsV. The production of the more reactive AsIII
form from AsV means that upon export AsIII will react with soil constituents, probably
with a reduced sulfur group like a thiol, and become unavailable for further uptake. For
example, the ericoid mycorrhizal fungus Hymenoscyphus ericae was shown to reduce
AsV to AsIII inside the fungal cells and then efflux the AsIII into the rhizosphere soil
(Sharples et al., 2000).
Inoculation of Glomus aggregatum onto sunflower (Helianthus annus) alleviated As
toxicity and reduced the As concentrations in the roots and shoots of inoculated plants
(Ultra, 2006). The protective effects were attributed to improved P nutrition of plants
and the AM-mediated transformation of soil inorganic As to less toxic organic forms.
Gonzalez-Chavez et al. (2002) showed that AM symbiosis reduced the As
16
concentration in shoots of Holcus lanatus through suppression of a plant high-affinity
Pi/AsV transporter. Ahmed et al. (2006) studied the effects of Glomus mosseae on
growth and nutrition of lentil plants irrigated with As-contaminated water. The AM
symbiosis increased plant height, leaf and pod numbers, plant biomass and P content of
shoots and roots and also reduced the As content in plant tissues. Chen et al. (2007)
investigated the effects of G. mosseae on P and As acquisition by Medicago sativa.
Their results showed that mycorrhizal inoculation dramatically increased the dry
weight of plants and also substantially increased the total uptake of P and As. However,
As concentration of shoots were significantly lower than un-inoculated plants because
of dilution effects caused by increased growth of mycorrhizal plants. Taken together,
all the mentioned studies demonstrate that AM fungi could be an important biological
component in bioremediation of As contaminated soils and could reduce the As
concentration in plants tissues.
However, AM fungi were shown to increase metal uptake in some host plants and
therefore might also have a good potential for a phytoextraction strategy. Colonisation
of plants by four AM species including G. intraradices, G. mosseae, G. etunicatum and
Gigaspora gigantean increased the uptake of different heavy metals, such as As,
cadmium (Cd), zinc (Zn), lead (Pb) and selenium (Se) in certain tolerant grass species
(Giasson et al., 2006). G. intraradices showed the highest capacity for heavy metal
uptake in these experiments. The grass species used in this study were a mixture of
Festuca rubra, F. eliator, Agropyron repens and Trifolium repens, all of which are used
for re-vegetation of metal contaminated soils.
In conclusion, AM symbioses might decrease or increase the heavy metal uptake
depending on the sensitivity of the host plant. The function of mycorrhizal association
under heavy metal toxicity conditions seems to be more complicated and depends on
the types of plants being investigated, the AM isolates and the experimental conditions.
AM fungi can reduce the As concentration of plant tissues in As-sensitive plants, which
is particularly important in crop plants with nutritional values. Along with AM
activities in chemical transformation of As molecules or affecting transporter genes, the
dilution effect seems to be a common factor in AM symbiosies leading to lower As
concentration in shoot tissues. As a phytoextraction strategy, AM fungi can increase the
As uptake in plants with a relatively high level of tolerance to heavy metals (Giasson et
al., 2006).
This review of the literature concludes that mycorrhiza can play a substantial role in
plant growth and nutrition. There are unconventional ECM associations with
17
undeveloped structures where positive growth responses of the host plant are not
correlated with the extent of root colonisation. Mycorrhizas can also function in favour
of plants exposed to toxicity of Pi and its analogues. The induced tolerance could be
due to certain mechanisms such as the reduced expression of PHT1 genes in plant roots
or the dilution effect resulting from higher plant biomass in mycorrhizal plants.
Phosphate transporter genes have been identified in many plant species but there is no
literature available about the PHT1 sequences in jarrah. The outcome of this research
will contribute to better understanding of P nutrition of mycorrhizal and non-
mycorrhizal jarrah seedlings growing under P deficiency and P toxicity conditions.
There will be three hypotheses tested in this thesis regarding the Pi sensitivity and
tolerance in jarrah: i) non-mycorrhizal jarrah plants cannot reduce their Pi uptake under
Pi toxicity conditions, ii) perhaps with mycorrhizal associations jarrah plants can
tolerate high concentrations of Pi in soil and iii) the mechanisms for these traits might
involve regulated or unregulated expression of PHT1 genes.
This PhD thesis aims to i) investigate AM, ECM and dual (AM & ECM) mycorrhizal
associations of jarrah and their potential effects on jarrah growth and nutrient
acquisition under P-deficient conditions, ii) clarify the unconventional symbiotic
association between jarrah and A. occidentalis that was identified in the early stages of
this study, and investigate the underlying mechanisms that result in the host benefit of
this association , and iii) study the role of selected mycorrhizal species in inducing
tolerance against toxic pulses of Pi (PO4-3
), Phi (HPO3-2
) and AsV (AsO4-3
) in jarrah
and reveal any possible correlation with expression of jarrah PHT1 genes.
Literature Cited
Adams MA, Iser J, Keleher AD, Cheal DC (1994) Nitrogen and phosphorus availability
and the role of fire in heathlands at Wilson Promontory. Aust J Bot 42: 269-281
Ahmed FRS, Killham K, Alexander I (2006) Influences of arbuscular mycorrhizal
fungus Glomus mosseae on growth and nutrition of lentil irrigated with arsenic
contaminated water. Plant Soil 283: 33-41
Allen MF (1991) The ecology of mycorrhizae. Cambridge University Press, Cambridge
Attiwill PM, Leeper GW (1987) Forest soils and nutrient cycles. Melbourne University
Press, Melbourne
Baek SH, Chung IM, Yun SJ (2001) Molecular cloning and characterization of a
tobacco leaf cDNA encoding a phosphate transporter. Mol Cells 11: 1–6
18
Barchietto T, Saindrenan P, Bompeix G (1992) Physiological responses of
Phytophthora citrophthora to a sub-inhibitory concentration of phosphonate.
Pestic Biochem Physiol 42: 151–166
Barrett S (2001) Phytotoxic effects of phosphite on native plant communities in
southern Western Australia. PhD Thesis, Murdoch University
Beadle NCW (1962) An alternative hypothesis to account for the generally low
phosphate content of Australian soils. Aust J Agric Res 13: 434-442
Brady NC, Weil RR (1996) The nature and properties of soils. Prentice Hall
International, London
Brundrett MC, Abbott LK (1991) Roots of jarrah forest plants.1. Mycorrhizal
associations of shrubs and herbaceous plants. Aust J Bot 39: 445-457
Brundrett MC (2009) Mycorrhizal associations and other means of nutrition of vascular
plants: understanding the global diversity of host plants by resolving conflicting
information and developing reliable means of diagnosis. Plant Soil 320: 37-77
Bucher M, Rausch C, Daram P (2001) Molecular and biochemical mechanisms of
phosphorus uptake into plants. J Plant Nutr and Soil Sci 164: 209-217
Burleigh SH, Harrison MJ (1999) The down-regulation of Mt4-like genes by phosphate
fertilization occurs systemically and involves phosphate translocation to the
shoots. Plant Physiol 119: 241–248
Burleigh SH (2001) Relative quantitative RT-PCR to study the expression of plant
nutrient transporters in arbuscular mycorrhizas. Plant Sci 160: 899–904
Canovas D, Duran C, Rodriguez N, Amils R, de Lorenz V (2003) Testing the limits of
biological tolerance to arsenic in a fungus isolated from the River Tinto.
Environ Microbiol 5: 133-138
Cervantes CJiG, Ramirez JL, Silver S (1994) Resistance to arsenic compounds in
microorganisms. FEMS Microbiol Rev 15: 355-367
Chen BD, Xiao XY, Zhu YG, Smith FA, Xie ZM, Smith SE (2007) The arbuscular
mycorrhizal fungus Glomus mosseae gives contradictory effects on phosphorus
and arsenic acquisition by Medicago sativa Linn. Sci Total Environ 379: 226–
234
Chiou TJ, Liu H, Harrison MJ (2001) The spatial expression patterns of a phosphate
transporter (MtPT1) from Medicago truncatula indicate a role in phosphate
transport at the root/soil interface. Plant J 25: 281-293
Clarkson DT (1984) Ionic relations. In Wilkins MB ed Advanced Plant Physiology:
Pitman Publishing Ltd, London, UK, 319-353
Clarke CA (1978) Effects of pesticides on VA mycorrhizae. Rothamsted Experimental
Station Report for 1978, Part 1: 236-237
19
Daram P, Brunner S, Persson BL, Amrhein N, Bucher M (1998) Functional analysis
and cell-specific expression of a phosphate transporter from tomato. Planta 206:
225-233
Daram P, Brunner S, Rausch C, Steiner C, Amrhein N, Bucher M (1999) Pht2;1
encodes a low-affinity phosphate transporter from Arabidopsis. Plant Cell 11:
2153–2166
Dell B, Hardy GESJ, Vear K (2005) History of Phytophthora cinnamomi management
in Western Australia In MC Calver, H Bigler-Cole, G Bolton, J Dargavel, A
Gaynor, P Horwitz, J Mills, G Wardell-Johnson, Eds, A forest consciousness:
Proceedings of the 6th
National Conference of the Australian Forest History
Society. Millpress Science Publishers, Rotterdam, 391-406
Dell B, Jones S, Wilson SA (1987) Phosphorus nutrition of jarrah (Eucalyptus
marginata) seedlings. Plant Soil 97: 369-379
Dickie IA, Koide RT, Steiner KC (2002) Influence of established trees on mycorrhizas,
nutrition, and growth of Quercus rubra seedlings. Ecol Monographs 74: 505–
521
Feng M, Qun L, Wei W, Shanshan Z, Bin G, Daleng S (2006) Cloning, expression and
function of phosphate transporter encoded gene in Oryza sativa L. Science in
China Series C: Life Sciences, 49: 409-413
Finlay RD, Read DJ (1986) The structure and function of the vegetative mycelium of
ectomycorrhizal plants. II. The uptake and distribution of phosphorus by
mycelial strands interconnecting host plants. New Phytol 103: 157–165
Finlay RD, Wallander H, Smits M, Holmström S, van Hees PAW, Lian B, Rosling A
(2009) The role of fungi in biogenic weathering in boreal forest soil. Fungal Biol
Rev 23: 101-106.
Finnegan PM, Chen W (2012) Arsenic toxicity: the effects on plant metabolism. Front
Physiol 3: 182
Founoune H, Duponnois R, Bâ AM, Sall S, Branger I, Lorquin J, Neyra M, Chotte JL
(2002) Mycorrhiza helper bacteria stimulate ectomycorrhizal symbiosis of
Acacia holosericea with Psolithus alba. New Phytol 153: 1–9
Gange AC, Gane DRJ, Chen Y, Gong M (2005) Dual colonisation of Eucalyptus
urophylla S.T. Blake by arbuscular and ectomycorrhizal fungi affects levels of
insect herbivore attack. Agric Forest Entomol 7: 253–263
Gemma JN, Koske RE, Roberts EM, Jackson N, De Antonis K (1997) Mycorrhizal
fungi improve drought resistance in creeping bentgrass. J Turfgrass Sci 73: 15-
29
Gianinazzi-Pearson V, and Gianinazzi S (1983) The physiology of vesicular-arbuscular
mycorrhizal roots. Plant Soil 71: 197-209
20
Giasson P, Jaouich A, Cayer P, Gagné S, Moutoglis P, Massicotte L (2006) Enhanced
phytoremediation: a study of mycorrhizoremediation of heavy metal-
contaminated soil. Remediation 17: 97-110
Gikaara DM, Johnston ME, Edwards DG (2005) Phosphorus management of
Australian native plants. Acta Hort (ISHS) 683: 133-140
Glassop D, Godwin RM, Smith SE, Smith FW (2007) Rice phosphate transporters
associated with phosphate uptake in rice colonized with arbuscular mycorrhizal
fungi. Can J Bot 85: 644-651
Glassop D, Smith SE, Smith FW (2005) Cereal phosphate transporters associated with
the mycorrhizal pathway of phosphate uptake into roots. Planta 222: 688-698
Gonzalez-Chavez C, Harris PJ, Dodd J, Meharg AA (2002) Arbscular mycorrhizal
fungi confer enhanced resistance on Holcus lanatus. New Phytol 155: 163-171
Goodwin PB (1981) Nitrogen, phosphorus, potassium and iron nutrition of Australian
native plants. Unpublished Paper, Department of Agronomy and Horticultural
Science, University of Sydney
Groves RH, Keraitis K (1976) Survival of seedlings of three sclerophyll species at high
levels of phosphorus and nitrogen. Aust J Bot 24: 681-690
Grundon NJ (1972) Mineral nutrition of some Queensland heath plants. J Ecol 60: 171-
181
Guest D, Grant BR (1991) The complex action of phosphonates as antifungal agents.
Biol Rev 66: 159–187
Guo B, Irigoyen S, Fowler TB, Versaw WK (2008) Differential expression and
phylogenetic analysis suggest specialization of plastid-localized members of the
PHT4 phosphate transporter family for photosynthetic and heterotrophic tissues.
Plant Signal Behav 3: 784–790
Hadi A, Parveen R (2004) Arsenicosis in Bangladesh: prevalence and socio-economic
correlates. Pub Health 118: 559–564
Hall IR, Johnstone PD, Dolby R (1984) Interactions between endomycorrhizas and soil
nitrogen and phosphorus on the growth of ryegrass. New Phytol 97: 447-453
Handreck KA (1991a) Available phosphorus in potting media: Extractants and
interpretationof extract data. Commun Soil Sci Plant Anal 22: 529-557
Handreck KA (1991b) Interactions between iron and phosphorus in the nutrition of
Banksia ericifolia L. f. var. ericifolia (Proteaceae) in soil-less potting media.
Aust J Bot 39: 373-384
Handreck KA (1997). Phosphorous requirements of Australian native plants. Aust J
Soil Res 35: 241-289
21
Harrison MJ, Dewbre GR Liu J (2002) A phosphate transporter from Medicago
truncatula involved in the acquisition of phosphate released by arbuscular
mycorrhizal fungi. Plant Cell 14: 2413–2429
Hashimoto Y, Higuchi R (2003) Ectomycorrhizal and arbuscular mycorrhizal
colonisation of two species of floodplain willows. Mycosci 44: 339–343
Hawkins HJ, Hettasch H, Mesjasz-Przybylowicz J, Przybylowicz W, Craner MD
(2008) Phosphorus toxicity in the Proteaceae: A problem in post-agricultural
lands. Sci Hort 117: 354–365
Heddle EM Specht RL (1975) Dark Island Heath (Ninety-Mile Plain, South Australia)
VIII. The effect of fertilizers on composition and growth, 1950-1972. Aust J
Bot 23: 151-164
Hildebrandt U, Regvar M, Bothe H (2007) Arbuscular mycorrhiza and heavy metal
tolerance. Phytochem 68: 139–146
Howard K, Dell B, Hardy GE (2000) Phosphite and mycorrhizal formation in seedlings
of three Australian Myrtaceae. Aust J Bot 48: 725-729
Jabahi-Hare SH, Kendrick WB (1987) Response of an endomycorrhizal fungus in
Allium porrum L. to different concentrations of the systemic fungicides
metalaxyl (Ridomil) and fosetyl-Al (Aliette). Soil Biol Biochem 19: 95–99
Javot H, Penmetsa RV, Terzaghi N, Cook DR, Harrison MJ (2007) A Medicago
truncatula phosphate transporter indispensable for the arbuscular mycorrhizal
symbiosis. Proc Natl Acad Sci U S A 104: 1720-1725
Jumpponen A (2001) Dark septate endophytes – are they mycorrhizal? Mycorrhiza 11:
207-211.
Kai M, Masuda Y, Kikuchi Y, Osaki M, Tadano T (1997) Isolation and
characterization of a cDNA from Catharanthus roseus which is highly
homologous with phosphate transporter. Soil Sci Plant Nut 43: 227-235
Karandashov V, Bucher M (2005) Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends Plant Sci 10: 22-29
Koide RT (1991) Nutrient supply, nutrient demand and plant response to mycorrhizal
infection. New Phytol 117: 365-386
Kope HH, Warcup JH (1986) Synthesised ectomycorrhizal associations of some
Australian herbs and shrubs. New Phytol 104: 591–599
Koske RE, Gemma JN, Jackson N (1997) A preliminary survey of mycorrhizal fungi in
putting greens. J Turfgrass Sci 73: 2-8
Koske RE, Gemma JN, Jackson N (1995) Mycorrhizal fungi benefit putting greens.
USGA Green Sec Rec 33: 12-14
22
Koyama T, Kato N, Hibino T, Kawazu T, Kimura T, Sakka K (2006) Isolation and
expression analysis of phosphate transporter genes from Eucalyptus
camaldulensis. Plant Biotech 23: 215-218
Lambers H, Finnegan, PM, Laliberté E, Pearse SJ, Ryan MH, Shane MW, Veneklaas
EJ (2011) Phosphorus nutrition of Proteaceae in severely phosphorus-
impoverished soils: are there lessons to be learned for future crops? Plant
Physiol 156: 1058-1066
Lambers H, Raven JA, Shaver GR, Smith SE (2008) Plant nutrient-acquisition
strategies change with soil age. Trends Ecol Evol 23: 95–103
Lambers H, Brundrett MC, Raven JA, Hopper SD (2010) Plant mineral nutrition in
ancient landscapes: high plant species diversity on infertile soils is linked to
functional diversity for nutritional strategies. Plant Soil 334: 11–31
Lambers H, Juniper D, Cawthray GR, Veneklass EG, Martinez-Ferri E (2002) The
pattern of carboxylate exudation in Banksia grandis (Proteaceae) is affected by
the form of phosphate added to the soil. Plant Soil 238: 11-122
Landeweert R, Hofflund E, Finlay RD, van Breemen N (2001) Linking plants to rocks:
Ectomycorrhizal fungi mobilize nutrients from minerals. Trends Ecol Evol 16:
248-254.
Leggewie G, Willmitzer L, Riesmeier JW (1997) Two cDNAs from potato are able to
complement a phosphate uptake-deficient yeast mutant: Identification of
phosphate transporters from higher plants. Plant Cell 9: 381-392
Li XL, George E, Marschner H (1991) Extension of the phosphorus depletion zone in
VA-mycorrhizal white clover in calcareous soil. Plant Soil 136: 41-48
Linderman RG (1994) Role of VAM fungi in biocontrol. In: Mycorrhizae and Plant
Health. Pfleger FL, Linderman RG, cds., APS Press, St. Paul, MN, 1-26
Liu H, Trieu AT, Blaylock LA, Harrison MJ (1998) Cloning and characterization of
two phosphate transporters from Medicago truncatula roots: Regulation in
response to phosphate and to colonisation by arbuscular mycorrhizal (AM)
fungi. Mol Plant Microbe Interact 11: 14-22
Liu J, Uhde-Stone C, Li A, Vance C, Allan D (2001). A phosphate transporter with
enhanced expression on proteoid roots of white lupin (Lupinus albus L.). Plant
Soil 237: 257–266
Lodge DJ, Wentworth TR (1990) Negative associations among VA-mycorrhizal fungi
and some ectomycorrizal fungi inhabiting the same root system. Oikos 57: 347-
356
Loth-Pereda V, Orsini E, Courty PE, Lota F, Kohler A, Diss L, Blaudez D, Chalot M,
Nehls U, Bucher M, Martin F (2011). Structure and expression profile of the
phosphate Pht1 transporter gene family in mycorrhizal Populus trichocarpa.
Plant Physiol 156: 2141–2154
23
Lovatt CJ, Mikkelsen RL (2006) Phosphite fertilizers: What are they? Can you use
them? What can they do? Better Crops 90: 11-13
Lu YP, Zhen RG Rea P (1997) AtPT4: A fourth member of the Arabidopsis phosphate
transporter gene family. Plant Physiol 114: 747
Marschner H, Dell B (1994) Nutrient uptake in mycorrhizal symbiosis. Plant Soil 159:
89-102
Marschner H (1995) Mineral nutrition of higher plants, Ed 2. Academic Press, San
Diego
Meharg AA, Hartley-Whitaker J (2002) Arsenic uptake and metabolism in arsenic
resistant and non-resistant plant species. Tansley Review. New Phytol 154: 29-
43
Meharg AA, Macnair MR (1990) An altered phosphate uptake system in arsenate
tolerant Holcus lanatus. New Phytol 116: 29–35
Meharg AA, Macnair MR (1992) Suppression of the high affinity phosphate uptake
system: a mechanism of arsenate tolerance in Holcus lanatus L. J Exp Bot 43:
519–524
McDonald AE, Grant BR, Plaxton WC (2001a) Phosphite (phosphorous acid): its
relevance in the environment and agriculture and influence on plant phosphate
starvation response. J Plant Nutr 24: 1505–1519
McDonald AE, Niere JO, Plaxton WC (2001b) Phosphite disrupts the acclimation of
Saccharomyces cerevisiae to phosphate starvation. Can J Microbiol 47: 969–
978
McGuire KL, Henkel TW, De La Cerda I (2008) Dual mycorrhizal colonisation of
forest-dominating troPcal trees and the mycorrhizal status of non-dominant tree
and liana species. Mycorrhiza 18: 217-22
Ming F, Mi GH, Lu Q, Yin S, Zhang SS, Guo B, Shen DL (2005) Cloning and
characterization of cDNA for the Oryza sativa phosphate transporter. Cell Mol
Biol Lett 10: 401–411
Mitsukawa N, Okumura S, Shirano Y, Sato S, Kato T, Harashima S, Shibata D (1997)
Overexpression of an Arabidopsis thaliana high-affinity phosphate transporter
gene in tobacco cultured cells enhances cell growth under phosphate-limited
conditions. Proc Natl Acad Sci U S A 94: 7098–7102
Mosse B (1973) Plant growth responses to vesicular arbuscular mycorrhiza. IV. In soil
given additional phosphate. New Phytol 72: 127-136.
Moyersoen B, Beever RE (2004) Abundance and characteristics of Pisolithus
ectomycorrhizas in New Zealand geothermal areas. Mycolgia 96: 1225-1232
Muchhal US, Pardo JM, Raghothama KG (1996) Phosphate transporters from the
higher plant Arabidopsis thaliana. Proc Natl Acad Sci U S A 93: 10519-10523
24
Mudge SR, Rae AL, Diatloff E, Smith FW (2002) Expression analysis suggests novel
roles for members of the Pht1 family of phosphate transporters in Arabidopsis.
Plant J 31: 341-353
Nagy R, Karandashov V, Chague V, Kalinkevich K, Tamasloukht M, Xu G, Jakobsen
I, Levy AA, Amrhein N, Bucher M (2005) The characterization of novel
mycorrhiza-specific phosphate transporters from Lycopersicon esculentum and
Solanum tuberosum uncovers functional redundancy in symbiotic phosphate
transport in solanaceous species. Plant J 32: 236-250
Nagy R, Vasconcelos MJ, Zhao S, McElver J, Bruce W, Amrhein N, Raghothama KG,
Bucher M (2006) Differential regulation of five Pht1 phosphate transporters
from maize (Zea mays L.). Plant Biol 8: 186-197
Neumann R (1959) Relationships between Pisolithus tinctorius (Mich. ex. Pers) Coker
et Couch. and Eucalyptus camaldulensis Dehn. Bull. Res. Counc. Zsr. Sect. D
Bot 7: 116-120
Nichols DG, Beardsell DV (1981) Interactions of calcium, nitrogen and potassium with
phosphorus on the symptoms of toxicity in Grevillea cv. Poorinda Firebird.
Plant Soil 61: 437-445.
Niere JO, DeAngelis G, Grant BR (1994) The effect of phosphonate on the acid-soluble
phosphorus components in the genus Phytophthora. Microbiol 140:1661–1670
Newsham KK, Fitter AH, Watkinson AR (1995) Arbuscular mycorrhiza protect an
annual grass from root pathogenic fungi in the field. J Ecol 83: 991-1000
Nichols DG (1988) Nutrition and fertilizer materials. In: Potting Mixes. Australian
Institute of Horticulture, NSW Council, July, 16-30
Nakamori K, Takabatake R, Umehara Y, Kouchi H, Izui K, Hata S (2002). Cloning,
functional expression, and mutational analysis of a cDNA for Lotus japonicus
mitochondrial phosphate transporter. Plant Cell Physiol 43: 1250–1253
Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate
degradation, phosphite oxidation and polyphosphate accumulation. Res Cons
Recy 18: 125–134
Ojala JC, Jarrell WM, Menge JA, Johnson LV (1983) Influence of mycorrhizal fungi
on the mineral nutrition and yield of onion in saline soils. Agron J 75: 255–259
Okumura S, Mitsukawa N, Shirano Y, Shibata D (1998) Phosphate transporter gene
family of Arabidopsis thaliana. DNA Res 5: 261-269
Ozanne PG, Specht RL (1981) Mineral nutrition of heathlands: Phosphorus toxicity. In:
Ecosystems of the World, Vol 9A. Heathlands and related shrublands.
Descriptive studies. Ed. R. L. Specht 209-213, Elsevier, Amsterdam, The
Netherlands
25
Parks SE, Haigh AM, Creswell GC (2000) Stem tissue phosphorus as an index of the
phosphorus status of Banksia ericifolia L. Plant Soil 227: 59-65
Paszkowski U, Kroken S, Roux C, Briggs SP (2002) Rice phosphate transporters
include an evolutionarily divergent gene specifically activated in arbuscular
mycorrhizal symbiosis. Proc Natl Acad Sci U S A 99: 13324-13329
Poss, J.A., Pond, E.C., Menge J.A. and Jarell, W.M. (1985) Effect of salinity on
mycorrhizal onion and tomato in soil with and without additional phosphate.
Plant Soil 88: 307-319
Raison RJ, Khanna PK, Woods PV (1985) Transfer of elements to the atmosphere
during low-intensity prescribed fires in three Australian subalpine eucalypt
forest. Can J For Res 15: 657-664
Ramanankierana N, Ducousso M, Rakotoarimanga N, Prin Y, Thioulouse J,
Randrianjohany E, Ramaroson L, Kisa M, Galiana A, Duponnois R (2007)
Arbuscular mycorrhizas and ectomycorrhizas of Uapaca bojeri L.
(Euphorbiaceae): sporophore diversity, patterns of root colonisation, and effects
on seedling growth and soil microbial catabolic diversity. Mycorrhiza 17: 195-
208
Rausch C, Bucher M (2002) Molecular and biochemical mechanisms of phosphate
transport in plants. Planta 216: 23-37
Rausch C, Daram P, Brunner S, Jansa J, Laloi M, Leggewie G, Amrhein N, Bucher M
(2001) A phosphate transporter expressed in arbuscule-containing cells in
potato. Nature 414: 462-470
Richardson AE, Hocking PJ, Simpson RJ, George TS (2009) Plant mechanisms to
optimise access to soil phosphorus. Crop Past Sci 60: 124–143
Rosewarne G, Barker S, Smith S, Smith F, Schachtman D (1999) A Lycopersicon
esculentum phosphate transporter (LePT1) involved in phosphorus uptake from
a vesicular-arbuscular mycorrhizal fungus. New Phytol 144: 507-516
Seymour NP, Thompson JP, Fiske ML (1994) Phytotoxicity of fosetyl Al and
phosphonic acid to maize during production of vesicular-arbuscular mycorrhizal
inoculum. Plant Dis 78: 441–446
Shane MW, De Vos M, De Roock S, Cawthray GR, Lambers H (2003) Effect of
external phosphorus supply on internal phosphorus concentration and the
initiation, growth and exudation of cluster roots in Hakea prostrata R. Br. Plant
Soil 248: 209–219
Shane MW, McCully ME, Lambers H (2004a) Tissue and cellular phosphorus storage
during development of phosphorus toxicity in Hakea prostrata (Proteaceae). J
Exp Bot 55: 1033–1044
Shane MW, Szota C, Lambers H (2004b) A root trait accounting for the extreme
phosphorus sensitivity of Hakea prostrata (Proteaceae) from a biodiversity
hotspot. Plant Cell Environ 27: 991–1004
26
Sharples JM, Meharg AA, Chambers SM, Cairney JWG (2000) Mechanism of
Arsenate Resistance in the Ericoid Mycorrhizal Fungus Hymenoscyphus ericae.
Plant Physiol 124: 1327-1334
Smith FW, Ealing PM, Dong B, Delhaize E (1997) The cloning of two Arabidopsis
genes belonging to a phosphate transporter family. Plant J 11: 83-92
Smith FW, Cybinski DH, Rae AL (1999). Regulations of expression of genes encoding
phosphate transporters in barley roots. Dordrecht: Kluwer Academic Publishers.
Smith E, Smith J, Biswas T, Correll R, Naidu R (2003) Arsenic in Australian
environment: an overview. J Environ Sci Health, Part A 38:223-239
Smith SE, Smith FA, Jakobsen I (2003) Mycorrhizal fungi can dominate phosphate
supply to plants irrespective of growth responses. Plant Physiol 133: 16-20
Smith SE, Smith FA, Jakobsen I (2004). Functional diversity in arbuscular mycorrhizal
(AM) symbiosis: the contribution of the mycorrhizal P uptake pathway is not
correlated with mycorrhizal responses in growth or total P uptake. New Phytol
162: 511-524
Smith SE, Read DJ (2008) Mycorrhizal symbiosis. 3rd
ed Academic Press, London UK
Specht RL (1963) Dark island heath (Ninety-Mile Plain, South Australia) VII. The
effect of fertilizers on composition and growth, 1950-60. Aust J Bot 11: 67-94
Specht RL, Groves RH (1966) A comparison of the phosphorus nutrition of Australian
heath plants and introduced economic plants. Aust J Bot 14: 201-221
Specht RL (1975) The effects of fertilizers on sclerophyll (heath) vegetation-the
problems of revegetation after sand mining of high dunes. Search 6: 459-461
Specht RL, Connor DJ, Cliford HT (1977) The heath-savanna problem: the effect of
fertilizer on sand-heath vegetation of North Stradbroke Island, Queensland.
Aust J Ecol 2: 179-186
Specht RL (1981a) Nutrient release from decomposing leaf litter of Banksia ornata,
Dark Island heathland, South Australia. Aust J Ecol 6: 59-63
Specht RL (1981b) The water relations of heathlands: Morphological adaptions to
drought. In: Ecosystems of the World, Vol 9B. Heathlands and related
shrublands. Analytical Studies. Ed. R. L. Specht, 123-129, Elsevier Scientific,
Amsterdam, The Netherlands
Sukarno N, Smith SE, Scott ES (1993) The effect of fungicides on vesicular- arbuscular
mycorrhizal symbiosis: I. The effects on vesicular-arbuscular mycorrhizal fungi
and plant growth. New Phytol 25: 139–147
Sukarno N, Smith FA, Smith SE, Scott ES (1996) The effects of fungicides on
vesicular-arbuscular mycorrhizal symbiosis. II. The effects on area of interface
and efficiency of P uptake and transfer to plant. New Phytol 132: 583–592
27
Sukarno N, Smith FA, Scott ES, Jones GP, Smith SE (1998) The effect of fungicides
on vesicular-arbuscular mycorrhizal symbiosis. III. The influence of VA
mycorrhiza on phytotoxic effects following application of fosetyl-Al and
phosphonate. New Phytol 139: 321–330
Tibbett M, Sanders FE (2002) Ectomycorrhizal symbiosis can enhance plant nutrition
through improved access to discrete organic nutrient patches of high resource
quality. Ann Bot 89: 783-789
Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation
responses by phosphite in Arabidopsis. Plant Physiol 127: 963–972
Thompson CH, Moore AW, Northcote KH (1983) Soils and land use. In: Soils: An
Australian viewpoint. Division of Soils, CSIRO, Melbourne, pp 757-776
Thomson VP, Leishman MR (2004) Survival of native plants of Hawkesbury
Sandstone communities with additional nutrients: effect of plant age and
habitat. Aust J Bot 52: 141-147
Tittarelli A, Milla L, Vargas F, Morales A, Neupert C, Meisel LA, Salvo-G H,
Penaloza E, Munoz G, Corcuera LJ, Silva1 H (2007) Isolation and comparative
analysis of the wheat TaPT2 promoter: identification in silico of new putative
regulatory motifs conserved between monocots and dicots. J Exp Bot 58: 2573–
2582
Torres Aquino M, Plassard C (2004) Dynamics of ectomycorrhizal growth and P
transfer to the host plant in response to low and high soil P availability. FEMS
Microbiol Ecol 48: 149-156
Tynan KM, Wilkinson CJ, Holmes JM, Dell B, Colquhoun IJ, McComb JA, Hardy
GESJ (2001) The long-term ability of phosphite to control Phytophthora
cinnamomi in two native plant communities of Western Australia. Aust J Bot
49: 761-770
Ultra Jr.,VU, Tanaka S, Sakurai K, Iwasaki K (2006) Effects of arbuscular mycorrhiza
and phosphorus application on arsenic toxicity in sunflower (Helianthus annuus
L.) and on the transformation of arsenic in the rhizosphere. Plant Soil 290: 29-
41
Van Straaten P (2002) Rocks for crops: Agrominerals of sub-Saharan Africa. ICRAF,
Nairobi, Kenya, pp, 338
Vance CP, Uhde-Stone C, Allan DL (2003) Phosphorus acquisition and use: critical
adaptations by plants for securing a nonrenewable resource. New Phytol 157:
423–447
Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an
analog of phosphate, suppresses the coordinated expression of genes under
phosphate starvation. Plant Physiol 129: 1232–1240
28
Vetterlein D, Szegedi K, Ackermann J, Mattusch J, Neue HU, Tanneberg H, Jahn R
(2007) Competitive mobilization of phosphate and arsenate associated with
goethite by root activity. J Environ Qual 36: 1811-1820
Wagg C, Pautler M, Massicotte HB Peterson RL (2008) The co-occurrence of
ectomycorrhizal, arbuscular mycorrhizal, and dark septate fungi in seedlings of
four members of the Pinaceae. Mycorrhiza 18: 103–110
Warcup JH, McGee PA (1983) The mycorrhizal associations of some Australian
Asteraceae. New Phytol 95, 667-672
Weiß M, Sykorová Z, Garnica S, Riess K, Martos F, Krause C, Oberwinkler F, Bauer
R, Redecker D (2011) Sebacinales everywhere: previously overlooked ubiquitous
fungal endophytes. PLoS ONE 6: e16793
White ME (1986) The Greening of Gondwana. Reed Australia, Sydney
White ME (1994) After the greening: the browning of Australia. Kangaroo Press,
Sydney
Weijtmans K, Davis M, Clinton P, Kuyper TW, Greenfield L (2007) Occurrence of
arbuscular mycorrhiza and ectomycorrhiza on Leptospermum scoparium from
the Rakaia catchment, Canterbury. N Z J Ecol 31: 255-260
Wilcox H (1996) Mycorrhizae. In: Waisel Y, Eshel A, Kafkafi U (eds) Plant roots —
the hidden half. 2nd edition, New York, Marcel Dekker, pp 149–174
Wild A (1961) A pediological study of phosphorus in 12 soils derived from granite.
Aust J Agric Res 12: 286-299
Williams CH, Raupach M (1983) Plant nutrients in Australian soils. In: Soils: An
Australian Viewpoint. Division of Soils, CSIRO, Melbourne, pp 777-794
Wysocki R, Chery CC, Wawrzycka D, Van Hulle M, Cornelis R, Thevelein J, Tamas
MJ (2001) The glycerol channel Fps1p mediates the uptake of arsenite and
antimonite in Saccharomyces cerevisiae. Mol Microbiol 40: 1391–1401
Xiao K, Liu J, Dewbre G, Harrison M, Wang ZY (2006).Isolation and characterization
of root-specific phosphate transporter promoters from Medicago truncatula.
Plant Biol 8: 1-11
29
Chapter 2
30
31
32
33
34
35
36
37
Chapter 3
A novel plant-fungus symbiosis benefits the host without
forming mycorrhizal structures
Khalil Kariman1,2
, Susan J. Barker2,3
, Ricarda Jost2, Patrick M. Finnegan
2,3, and Mark
Tibbett1,4
1School of Earth and Environment M087, The University of Western Australia,
Crawley, WA 6009, Australia
2School of Plant Biology M084, The University of Western Australia, Crawley, WA
6009, Australia
3Institute of Agriculture M082, The University of Western Australia, Crawley, WA
6009, Australia
4Department of Environmental Science and Technology (B37), School of Applied
Sciences, Cranfield University, Cranfield, Bedfordshire, MK 43 OAL, England
Most terrestrial plants form mutually beneficial symbioses with specific soil-
borne fungi known as mycorrhiza. In a typical mycorrhizal association, fungal
hyphae (i) colonise plant roots, (ii) explore the soil beyond the rhizosphere and (iii)
provide host plants with nutrients that might be chemically or physically
inaccessible to root systems1-4
. In contrast to these common features, we report a
plant growth promoting symbiosis between the basidiomycete fungus
Austroboletus occidentalis and jarrah (Eucalyptus marginata) which has quite
different characteristics. By combining nutritional, radioisotopic (33
P) and genetic
approaches, we elucidate the nature of this novel symbiosis. We show (i) the fungal
partner does not colonise plant roots, (ii) hyphae are localised to the rhizosphere
soil (and vicinity) and consequently (iii) do not transfer nutrients located much
beyond the rhizosphere. We argue the fungus does not transfer nutrients directly
to the plant, when compared to a conventional ectomycorrhizal symbiosis
(Scleroderma sp.). Here, transcript analysis of two phosphate transporter genes
(EmPHT1;1 and EmPHT1;2) and hyphal-mediated 33
P uptake suggest that the
PO43-
uptake shifts from epidermal to hyphal pathway in ectomycorrhizal plants
similar to arbuscular mycorrhizal symbioses5 whereas A. occidentalis benefits its
plant symbiont in a more indirect fashion. High concentrations of citrate and
fumarate in rhizosphere soil indicate that nutrient solubilisation and mobilisation
38
are the likely mechanisms involved in the novel symbiosis. This rhizospheric
association between plant and fungus does not fit into currently described
paradigms of mycorrhizal symbiosis in terms of structure but appears to have
similar benefits to plants. This novel symbiosis challenges our current view of
mycorrhizal associations and rhizosphere ecology and may lead to a reassessment
of ectomycorrhizal relationships. We see this work as a starting point for further
studies on other basidiomycete-woody plant relationships, where a continuum
between heterotrophic rhizosphere fungi and fully mutualistic symbiosis is likely
to exist.
Mycorrhizal symbiosis is a strategy used by more than 80 % of land plant species
4,6
and is considered to be a critical factor in terrestrial ecosystems for sustained
productivity7, nutrient cycling
3,8 and plant soil feedback
9. At the root-fungal interface,
the heterotrophic symbiont colonises plant roots where it receives organic carbon
(mainly glucose and fructose) supplied by the phototrophic partner4. In return,
extraradical hyphae explore the soil beyond the roots for more than 10 cm in arbuscular
mycorrhizal (AM) symbioses10
and up to several meters in ECM symbioses11
, scavenge
nutrients from the soil, and assimilate and subsequently transport them to the host plant.
Seven categories of mycorrhizas have been recognized based on the morphological
structures developed and the plant-fungal species involved. These include arbuscular
mycorrhiza (AM), ectomycorrhiza (ECM), ectendomycorrhiza (ECTENDO), orchid
mycorrhiza (OM), ericoid mycorrhiza (EM), arbutoid mycorrhiza (ARBM) and
monotropoid mycorrhiza (MM)4. However, unusual plant-fungus associations with
unconventional or undeveloped structures have also been documented that cannot be
classified into any of the above mycorrhizal categories and are of ambiguous functional
status6,12,13
. Our previous work showed that A. occidentalis Watling & N.M. Greg.
substantially promoted jarrah growth and nutrient acquisition, without forming
mycorrhizal structures14
. The existing literature has typically viewed the function of
mycorrhizas with respect to the specialised mycorrhizal structures and hyphal-mediated
nutrient uptake, which might not always reflect the functionally relevant factors of an
association. Here, we used radiolabeled phosphate (33
PO43-
) and multiple compartments
to unravel the underlying functional mechanisms for the symbiosis observed between
jarrah and A. occidentalis. In the same experiment we also considered the effects of
conventional ECM formation by Scleroderma sp. on the expression of high affinity Pi
transporter genes (PHT1 gene family) in roots by quantifying the transcript abundance
of three PHT1 genes.
39
A three-compartment system was used to track 33
PO43-
uptake and hyphal
development in two different jarrah-fungus symbioses (Fig. 1a). A double polyester
mesh bag (with 40 µm pores) was used to separate the root-hyphal compartment
(RHC) from the hyphal only compartment (HC) in which we placed a radiation
compartment (RDC) containing 33
PO43-
-labelled sand. In this system plant roots were
confined to the RHC and only fungal hyphae could penetrate the mesh bag and reach
the 33
PO43-
source located 7 to 12 cm away from the root systems. The treatments were
two fungal species, A. occidentalis and Scleroderma sp. (ECM), and a non-mycorrhizal
(NM) control that received sterilized inoculum. Plants were grown in a mixture of
inoculum (peat-vermiculite substrate cultures) and double-pasteurized washed river
sand (1:10 v/v) in a controlled environment chamber for 16 weeks.
The presence of a fungal partner greatly improved jarrah growth (Fig. 1b). The
positive responses were achieved regardless of the root colonizing ability of the fungus.
There was no sign of root hyphal association or a short root morphology change for
jarrah seedlings grown with A. occidentalis, while the Scleroderma sp. treatment
achieved 77% (± 11, SE) ECM colonisation. However A. occidentalis was as effective
as Scleroderma sp. in enhancing the shoot biomass of plants (Fig. 1b). Furthermore,
jarrah plants inoculated with either fungus had larger root systems than NM controls,
with the largest root system belonging to the Scleroderma sp. treatment.
Both types of symbioses effectively increased the shoot nutrient content of plants
compared to NM controls (Table 1). Shoots of plants inoculated with A. occidentalis
had almost equal contents of P, S, Mg, Cu and even more nitrogen (N) than the
Scleroderma sp. treatment. The root colonizing fungus Scleroderma sp. seems,
however, to be more effective than A. occidentalis at facilitating uptake of the
micronutrients Fe and Zn. Inoculation with A. occidentalis enhanced the shoot P and
Mg concentration and inoculation with Scleroderma sp. enhanced the shoot
concentration of P, S, Mg, Fe and Zn compared with NM plants (Table 1).
40
Fig.1 Jarrah shoot biomass greatly enhanced by both novel (A. occidentalis) and ECM
(Scleroderma sp.) symbioses. (a) Schematic diagram showing the three-compartment
system used to study the potential functional pathways in mycorrhizal symbioses.
Jarrah roots were confined to the root hyphal compartment (RHC), while extraradical
hyphae (ERH) could pass through the polyester mesh bag (PMB) and colonize both
hyphal (HC) and radiation (RDC) compartments. (b) Shoot and root dry biomass of
jarrah plants. Bars with and are significantly different from NM controls at p <
0.05 and p < 0.10, respectively.
(a) (b)
Dry b
iom
ass
(g p
ot-1
)
ShootRoot
NM control A. occidentalis Scleroderma sp.
0
2
4
6
8
2
4
6
8
41
Table 1 Shoot nutrient status of jarrah seedlings
Content
Treatments mg pot-1
µg pot-1
P N S Mg Fe Zn Cu
NM Control
0.54
± 0.09
43.14
± 2.86
4.84
± 1.08
8.95
± 2.23
83.68
± 10.55
58.93
± 14.14
19.26
± 1.65
A. occidentalis
1.86**
± 0.56
59.95**
± 1.73
11.49**
± 1.43
21.17 **
± 3.54
165.97**
± 23.32
146.27**
± 13.52
43.52**
± 3.02
Scleroderma sp.
1.91**
± 0.22
44.46
± 0.88
12.61**
± 1.39
20.31**
± 3.41
341.48**
± 26.47
202.10**
± 19.76
48.37**
± 1.71
Concentration
mg g-1
DW
µg g-1
DW
NM Control
0.19
± 0.01
16.26
± 3.49
1.65
± 0.04
3.00
± 0.10
30.38
± 4.18
19.88
± 0.75
7.21
± 1.48
A. occidentalis
0.29*
± 0.03
10.37
± 1.45
1.93
± 0.15
3.49**
± 0.07
27.63
± 1.26
24.80
± 2.29
7.42
± 0.78
Scleroderma sp.
0.31**
± 0.03
7.52**
± 1.21
2.05**
± 0.07
3.26*
± 0.08
56.30**
± 3.92
33.19**
± 2.21
8.10
± 1.04
Data represent mean values (n=3) ± SE. Values of each nutrient followed by ** and * are
significantly different from NM controls at p < 0.05 and p < 0.10, respectively.
Accumulation of 33
P from the RDC was assessed in the shoots of the 16-week-old
plants (Fig. 2a). Scleroderma sp. transported 33
P to jarrah plants, while there was only
background radiation in shoot tissues from the A. occidentalis and NM treatments.
Non-destructive monitoring of shoot radioactivity during the growth period indicated
that the fungal-mediated 33
P uptake in the Scleroderma sp. treatment was detectable
nine weeks after planting (data not shown). Furthermore, the specific activity of
radiolabelled sand remaining after harvest in the Scleroderma sp. treatment was
significantly lower than for the NM and A. occidentalis treatments (Fig. 2a), supporting
the hypothesis that 33
P was taken up by extraradical hyphae. The plant-available P
extracted from the RHC and HC did not contain radioactivity in any of the treatments
showing 33
P did not move or leak from the RDC. Some 33
P labelled molecules were,
however, in transit from the RDC to jarrah shoots within extraradical hyphae and roots
but these organs were not considered for the present study.
Our results are consistent with two possibilities. A. occidentalis hyphae might grow
throughout the compartments, but not transfer 33
P to the RHC, or A occidentalis might
not colonise the RDC. To investigate this we quantified the hyphal length in the
42
different compartments. Hyphae of A. occidentalis were thinner (1.5 to 4 µm) than
those of Scleroderma sp. (3.5 to 14 µm). Both fungi had significantly higher hyphal
length densities in the RHC compared to the NM controls (Fig. 2b). However, the
hyphal length in both the HC and RDC did not differ significantly between A.
occidentalis and NM treatments. The Scleroderma sp. treatment had significantly
greater hyphal length in both HC and RDC than found for A. occidentalis and NM
treatments.
To ascertain the source of P exploited by plants and fungi and transferred to the
shoots of inoculated plants, we determined the concentration of plant-available P in soil
from the various compartments (Fig. 2c). The A. occidentalis treatment had the lowest
available P in the RHC of all the treatments. The available P in the HC and RDC did
not differ significantly between A. occidentalis and NM control treatments, whereas the
Scleroderma sp. treatment had lower available P in both HC and RDC compared to NM
controls. Thus, the A. occidentalis treated plants did not access P from the HC or RDC
to any greater extent than the NM control plants. Based on the results for 33
P uptake,
shoot P content, hyphal extent and the plant-available P in soil, we conclude that plants
inoculated with A. occidentalis mainly accessed P from the RHC, whereas the plants
inoculated with Scleroderma sp. obtained P from all three compartments (RHC, HC
and RDC).
The transport of PO43-
into plant cells is catalyzed by proteins encoded by members of
the PHOSPHATE TRANSPORTER1 (PHT1) multigene family. The abundance of
transcripts from various PHT1 genes typically increases under low plant P status and
decreases under high plant P status. AM colonisation has been shown to induce a
remodeling of PHT1 transcript profiles; such that there is preferential accumulation of
transcripts from specific PHT1 genes in cells in close proximity to the fungal symbiont
at the expense of transcripts from other PHT1 genes in root epidermal cells not in direct
contact with fungal hyphae5. The outcome of the remodeling is thought to be the
preferential delivery of PO43-
from the mycorrhizal symbiont to root cortex cells instead
of the uptake of PO43-
directly from the bulk soil solution5. A real-time PCR transcript
assay was used to quantify the abundance of transcripts from three jarrah EmPHT1
genes currently available for assay relative to an internal ACTIN reference gene
(EmACT1) in response to the fungal symbionts. The results revealed that there were
significantly less EmPHT1;1 and EmPHT1;2 transcripts in roots from the Scleroderma
sp. treatment compared to the NM control and A. occidentalis treatments (Fig. 2d). The
expression of EmPHT1;5 was similar across treatments. The down-regulation of
43
transcript abundance for EmPHT1;1 and EmPHT1;2 in plants exposed to Scleroderma
sp. combined with the apparent hyphal delivery of 33
P, indicates that these two PHT1
genes are likely to be responsible for the direct pathway of PO43-
uptake by plant roots.
Some plant PHT1 genes have been shown to reduce their expression in both AM5
and
ECM15
symbioses presumably due to a reduction in P uptake via the direct pathway
(roots). Here, based on the active involvement of Scleroderma sp. hyphae (ECM) in 33
P
uptake and P uptake from both hyphae-accessible compartments (HC and RDC) and
the reduced expression of two plant PHT1 genes, we suggest the PO43-
uptake shifts
from root epidermal to hyphal pathway in ECM plants. This finding may have
profound effects in our understanding of P nutrition of woody plants, which are highly
dependent on ECM associations for their growth, nutrition and survival4,7,8
.
In contrast, there was no difference in the transcript profiles for the three PHT1 genes
in roots of plants from NM and A. occidentalis treatments. This lack of remodeling of
the PHT1 transcript pool in response to A. occidentalis, combined with the observation
that hyphal-mediated 33
P uptake did not occur in plants associated with A. occidentalis
indicates that active PO43-
uptake occurs directly from the soil solution via plant roots in
the novel symbiosis between jarrah and A. occidentalis.
44
Fig. 2. Functional evidence for root-mediated P uptake in the novel (A.
occidentalis) symbiosis and hyphal-mediated P uptake in the ECM (Scleroderma
sp.) symbiosis. a, Specific activity of 33
P in shoot and 33
P-labelled sand (RDC). b,
Hyphal length density in the three different compartments. c, Plant-available P in
different compartments. d, Expression of three PHT1 genes in jarrah roots relative to an
internal reference gene (actin) determined by real-time PCR. The scale on the vertical
axis is a log2 scale based on ΔCt (the threshold cycle (Ct) of the target PHT1 gene
minus the Ct of the reference gene). A difference of one Ct value corresponds to a 2-
fold difference in transcript abundance. Bars with different letters are significantly
different at p < 0.05. Bars with and within each compartment are significantly
different from NM controls at p < 0.05 and p < 0.10, respectively. Error bars are SE (n
= 3).
b b
a
a a
b
200
100
0
100
200
300
400
500
600
700
Sp
ecif
ic a
ctiv
ity
at
har
ves
t(B
q g
-1D
W)
Shoot P-labelled sand
NM control A. occidentalis Scleroderma sp.
33
a
a
a
a a
a
b
b
a
30
35
40
45
50
EmPHT1;1 EmPHT1;2 EmPHT1;5
Rela
tive e
xpre
ssio
n (
40-∆
Ct)
NM control A. occidentalis Scleroderma sp.
b b b
a
b
b
a
aa
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Root hyphal compartment
Hyphal compartment Radiation compartment
Hyph
al le
ngth
(m
g-1
soil)
NM control A. occidentalis Scleroderma sp.
a b
c d
0
1
2
3
4
5
6
7
8
9
Root hyphal compartment
Hyphal compartment
Radiation compartment
Pla
nt-
av
ailab
le P
(µ
g P
g-1
soil)
NM control A. occidentalis Scleroderma sp.
45
Mannitol, sucrose and fructose were measured in roots by HPLC to identify fungal
presence and nutrition (Fig. 3). Mannitol is a sugar alcohol typically found in fungi
serving various physiological functions such as carbon storage16
and cryoprotection17
.
Plants generally do not synthesize mannitol but there are number of exceptions18
. The
exclusive presence of mannitol in mycorrhizal roots has been attributed to the fungal
structures associated with roots4,19
. Here, mannitol was only found in roots from the
Scleroderma sp. treatment, where hyphae formed typical ECM structures. No mannitol
was found in roots of either NM control or A. occidentalis treatments, both of which
had no sign of fungal colonisation. Moreover, mannitol was present in mycelia from
axenic cultures of both Scleroderma sp. and A. occidentalis growing on solid nutrient
medium (data not shown). Thus, the lack of mannitol in roots from the A. occidentalis
treatment is physiological support for the absence of microscopic fungal structures in
and on the roots here and in our previous work14
supporting our conclusion that A.
occidentalis does not colonise jarrah roots.
Sucrose is the major form of fixed carbon transported in the phloem of higher plants.
Mycorrhizal roots accumulate higher concentrations of sucrose than NM roots. The
sucrose is subsequently hydrolyzed to glucose and fructose by host cell wall invertase
to provide hexoses for fungal consumption4,19
. Roots from both Scleroderma sp. and A.
occidentalis treatments contained higher concentrations of sucrose than NM plants
suggesting that the host plant is a carbon source for both heterotrophic fungal partners
(Fig. 3). ECM plants support the C nutrition of their fungal partners through direct
supply of sucrose (and hexoses) at the root/fungal interface or via repression of their
root monocsaccharide importers to allow C flow from soil towards hyphae, or a
combination of these pathways20-21
. The washed river sand used in this experiment was
very poor in organic matter, and therefore the direct supply of fixed C from plant to the
ECM partner (Scleroderma sp.) is most likely under these experimental conditions,
with high sucrose concentration of ECM roots as preliminary evidence (Fig. 3). The
enhanced sucrose concentration in roots of jarrah plants associated with A. occidentalis
must have required a signal from the fungus as it did not occur in NM roots. However,
as A. occidentalis does not penetrate the roots, we hypothesize that the products of
sucrose breakdown (glucose and fructose) are exuded into the rhizosphere soil, which is
the main fungal habitat (Fig. 2b). The constant amount of fructose in roots across all
three treatments is consistent with this hypothesis. This could be due to the rapid
conversion of fructose to mannitol by hyphae
19 inside roots of the Scleroderma sp.
treatment or hypothetically due to quick exudation into the rhizosphere soil in A.
46
occidentalis treatment. Carbon flow from roots into the rhizosphere is a key
phenomenon for C cycling in soil and occurs via a variety of processes including C
flow to root-associated symbionts such as mycorrhizas22,23
.
Fig. 3. Jarrah roots contain mannitol only in the Scleroderma sp. treatment where
ECM colonisation occurred. Determinations for each sugar indicated by a different
letter are significantly different at p < 0.05. ND = not detected. Error bars are SE (n =
3).
Nutrient transfer via extraradical hyphae is considered to be the common strategy in
mycorrhizal symbioses1,2
aiding plants to access soil nutrients far away from the root
system. ECM fungi make extensive extraradical hyphal networks in soil and translocate
P over distances of up to at least 40 cm11
. We suggest that “nutrient transfer” is not the
underlying mechanism behind the improved nutrient uptake in the jarrah-A.
occidentalis symbiosis as fungal hyphae are not exploring the soil far from roots and
there was neither a physical contact (colonisation) between the partners nor a change in
the transcript profiles of ECM-responsive PHT1 genes in roots.
Biological weathering of soil to dissolve minerals and release plant nutrients (except
nitrogen) is accomplished mainly by plant roots and soil microbes through the
exudation of metabolites such as carboxylates, protons, respiration-derived CO2,
phenolic compounds and siderophores23,24
. It has been established that ECM fungi
exude carboxylates24
and protons25
to mobilize nutrients from primary silicate minerals,
such as the sand used here.
High performance liquid chromatography (HPLC) analysis showed that citrate was
the main carboxylate present in the rhizosphere soil, along with lower concentrations of
fumarate and shikimate, in all three treatments (Table 2). The rhizosphere from the A.
b
a
ND
a
a
ND
a
a
0
2
4
6
8
10
12
14
Sucrose Fructose Mannitol
Ro
ot
sug
ar c
on
cen
trat
ion
(m
g g
-1D
W)
NM control A. occidentalis Scleroderma sp.
47
occidentalis treatment had significantly higher concentrations of citrate and fumarate
compared to both Scleroderma sp. and NM treatments. The Scleroderma sp. treatment
had the lowest citrate among the treatments, and fumarate and shikimate concentrations
did not differ from NM controls. Low levels of carboxylates in rhizosphere soil of
ECM plants26-28
have been attributed mainly to high microspatial variability in
concentration and rapid microbial consumption24
. Here, we propose another factor that
might be associated with the low carboxylate concentration in the rhizosphere of ECM
plants. The active nutrient uptake in mycorrhizal symbioses occur via fungal hyphae
rather than plant roots1,2,4
. Carboxylates in ECM symbioses have been shown to
originate primarily from fungal hyphae dissolving nutrients surrounding hyphal tips28
.
In ECM plants, carboxylates are presumably released by extensive hyphae into a much
broader soil volume (hyphosphere) rather than into the immediate rhizosphere soil. Our
data also show that, in a classic ECM symbiosis (Scleroderma sp.), the plant exudation
of citrate is suppressed whereas in the presence of the novel symbiosis, exudation of
citrate is enhanced, although we cannot exclude that some or all of the additional citrate
is of fungal origin. Likewise, the significant enhancement of fumarate in the A.
occidentalis treatment compared to the NM control and Scleroderma sp. treatments
could suggest that this additional fumarate may be of fungal origin. Higher
concentrations of carboxylates in the rhizosphere of NM controls and A. occidentalis
treatments compared to the Scleroderma sp. treatment could be due to the fact that
active nutrient uptake is taking place directly via plant roots in the former two
treatments. We suggest citrate as the main carboxylate associated with nutrient release
and mobilization as observed here and in accordance with other studies23,29,30
correlating citrate production to release of nutrients from primary minerals such as
apatite and biotite.
A. occidentalis enhanced the shoot N content of jarrah plants while no positive effects
were observed with Scleroderma sp. The improved N nutrition is a well-known benefit
in ECM symbiosis, which is mainly associated with the capability of ECM fungi to
exude nutrient-mobilizing enzymes such as acid phosphatases, proteinases, and
polyphenol oxidase to release nutrients from organic sources in soil7,31,32
. The
Scleroderma sp. treatment had the largest root system among treatments but the lowest
shoot N concentration (Table 1) apparently due to dilution of N in a higher shoot
biomass. This is in keeping with the results for 33
P uptake and PHT1 gene expression in
the Scleroderma sp. treatment indicating that the active nutrient uptake does not occur
via roots but extraradical hyphae. However, the ECM symbiosis failed to improve the
48
N nutrition of jarrah plants probably due to the lack of sufficient substrate (organic
matter) in the river sand used for this study.
The A. occidentalis treatment had relatively higher root biomass than NM controls,
which might have contributed to higher N uptake. Moreover, ECM fungi can increase
bacterial biomass and activity and also modify the soil bacterial community via
exuding carboxylates, particularly citrate30
. The rhizosphere soil in the A. occidentalis
treatment had the highest citrate concentration among the treatments. Accordingly,
modification of rhizosphere soil by exuding citrate could potentially promote beneficial
bacteria including free-living nitrogen fixers leading to higher N availability for host
plants in the novel symbiosis. Consistent with this hypothesis, the Scleroderma sp.
treatment had the lowest citrate concentration in the rhizosphere soil accompanied by
the lowest shoot N concentration.
Table 2- Carboxylate concentration in the rhizosphere soil (µmol g-1
root DW)
Treatments Citrate Fumarate Shikimate
NM control 1234b (±113) 23b (±5) 87a (±13)
A. occidentalis 2525a (±120) 59a (±10) 82a (±17)
Scleroderma sp. 660c (±79) 18b (±3) 78a (±7)
Values within a column followed by different letters are significantly different at p ≤
0.05. Data are mean ± SE (n=3).
The present study shows clear functional differences between the jarrah-A.
occidentalis symbiosis and previously described mycorrhizal associations. Phosphorus
was likely to be the limiting nutrient in this experiment in order to explore the ability of
the fungus to improve P nutrition of host plants and the mechanisms involved. In this
novel symbiosis, fungal hyphae are found and function in the vicinity of root systems,
but do not colonise plant roots. Moreover, the 33
P baiting experiment did not support
the presence of “hyphal-mediated nutrient uptake” which is a well-established strategy
in mycorrhizal symbioses. The enhanced carboxylate release into the rhizosphere soil
correlates with higher shoot nutrient content (P, in particular) in plants harbouring this
novel symbiosis and may be the underlying mechanism. It will be of interest to
determine how much of the enhanced exudation can be attributed to either plant or
fungus. Our results also suggest that the function of mycorrhizas cannot be fully
explained by traditional views that focus on the features of root colonisation and the
49
contributions hyphae make to nutrient uptake. More investigations are warranted to
unearth other potential strategies that might be involved in this novel symbiosis such as
secretion of protons, nutrient-mobilizing enzymes or other unknown pathways.
Methods Summary
A three-compartment system (Fig. 1a) was used to track the symbiotic 33
P uptake.
Jarrah seedlings were exposed to A. occidentalis (the novel symbiont), Scleroderma sp.
(ab ECM fungus) and a NM control and grown for 16 weeks under controlled
environmental conditions. Non-destructive tracking of 33
P was done using a Geiger
counter to check the presence of radioactivity in shoots of growing plants.
Radioactivity in shoots of harvested plants was determined using a Packard TR 1500
liquid scintillation counter. We used ICP-OES (PerkinElmer, USA) and a combustion
analyzer (Elementar Vario Macro, Germany) to measure the nutrient concentration of
shoot tissues. Hyphae were extracted from soil using a membrane filter technique and
quantified on nitrocellulose gridded filters (0.45 µm HAWG, Millipore). Jarrah PHT1
cDNA sequences were obtained through PCR cloning from total root RNA isolated
using a CTAB-based method and reverse transcribed using the GoScriptTM
reverse
transcriptase kit (Promega). To get longer sequences for the amplified products we used
the SMART™ RACE cDNA Amplification Kit (Clontech) and the Advantage 2 kit
(Clontech). Root-expressed PHT1 cDNAs were amplified using primers
(Supplementary Table 1) designed based on the conserved sequences in PHT1 genes
from E. camaldulensis. The abundance of specific PHT1 gene transcripts was
determined relative to a jarrah actin gene (ACT) as an internal reference using SYBR
Green-based detection on the Applied Biosystems 7500 Fast Real Time PCR system.
Root carbohydrates were extracted using 80% ethanol and quantified by HPLC
analysis. The rhizosphere carboxylates were extracted from roots with the loose sand
removed using 0.2 mM CaCl2, filtered through Acrodisc syringe filters (0.2 µm) and
quantified by HPLC. Full methods and associated references are presented as
Supplementary Information.
50
References
1-Marschner, H. & Dell, B. Nutrient uptake in mycorrhizal symbiosis. Plant Soil. 159,
89–102 (1994).
2-Cameron, D. D., Leake, J. R. & Read, D. J. Mutualistic mycorrhiza in orchids:
evidence from plant-fungus carbon and nitrogen transfers in the green-leaved
terrestrial orchid Goodyera repens. New Phytol. 171, 405–416 (2006).
3-Finlay, R. D. Ecological aspects of mycorrhizal symbiosis: with special emphasis on
the functional diversity of interactions involving the extraradical mycelium. J.
Exp. Bot. 59, 1115-1126 (2008).
4-Smith, S. E. & Read, D. J. Mycorrhizal Symbiosis. 3rd
ed. Academic Press, London
UK (2008).
5-Karandashov, V. & Bucher, M. Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends Plant Sci. 10, 22-29 (2005).
6-Brundrett, M. C. Mycorrhizal associations and other means of nutrition of vascular
plants: Understanding the global diversity of host plants by resolving conflicting
information and developing reliable means of diagnosis. Plant Soil. 320, 37–77
(2009).
7-van der Heijden, M. G. A., Bardgett, R. D. & Straalen, N. M. The unseen majority:
soil microbes as drivers of plant diversity and productivity in terrestrial
ecosystems. Ecol. Let. 11, 296-310 (2008).
8-Read, D. J. & Perez-Moreno, J. Mycorrhizas and nutrient cycling in ecosystems—a
journey towards relevance?. New Phytol. 157, 475–492 (2003).
9-Bever, J. D. Negative feedback within a mutualism: host specific growth of
mycorrhizal fungi reduces plant benefit. Proc. R. Soc. Lond. 269, 2595-2601
(2002).
10-Li, X. L., George, E. & Marschner, H. Extension of the phosphorus depletion zone
in VA-mycorrhizal white clover in calcareous soil. Plant Soil. 136, 41-48 (1991).
11-Finlay, R. D. & Read, D. J. The structure and function of the vegetative mycelium
of ectomycorrhizal plants. II. The uptake and distribution of phosphorus by
mycelial strands interconnecting host plants. New Phytol. 103, 157–165 (1986).
12-Warcup, J. H. & McGee, P. A. The mycorrhizal associations of some Australian
Asteraceae. New Phytol. 95, 667-672 (1983).
13-Kope, H. H. & Warcup, J. H. Synthesised ectomycorrhizal associations of some
Australian herbs and shrubs. New Phytol. 104, 591–599 (1986).
14-Kariman, K., Barker, S. J., Finnegan, P. M. & Tibbett, M. Dual mycorrhizal
associations of jarrah (Eucalyptus marginata) in a nurse-pot system. Aust. J. Bot.
60, 661-668 (2012).
51
15-Loth-Pereda, V., Orsini, E., Courty, P. E., Lota, F., Kohler, A., Diss, L., Blaudez,
D., Chalot, M., Nehls, U., Bucher, M. & Martin, F. Structure and expression
profile of the phosphate Pht1 transporter gene family in mycorrhizal Populus
trichocarpa. Plant Physiol. 156, 2141–2154 (2011).
16-Koide, R. T., Shumway, D. L. & Stevens, C. M. Soluble carbohydrates of red pine
(Pinus resinosa) mycorrhizas and mycorrhizal fungi. Mycol. Res. 104, 834–840
(2000).
17-Tibbett, M., Sanders, F. E. & Cairney, J. W. G. Low-temperature induced changes
in trehalose, mannitol and arabitol associated with enhanced tolerance to freezing
in ectomycorrhizal basidiomycetes (Hebeloma spp.). Mycorrhiza 12, 249–255
(2002).
18-Stoop, J. M. H., Williamson, J. D. & Pharr, D. M. Mannitol metabolism in plants: a
method for coping with stress. Trends Plant Sci. 1, 139–144 (1996).
19-Stribley, D. P. & Read, D. J. The biology of mycorrhiza in th e Ericaceae. III.
Movement of carbon-14 from host to fungus. New Phytol. 73,731-741 (1974).
20-Nehls, U., Grunze, N., Willmann, M., Reich, M. & Kuster, H. Sugar for my honey:
carbohydrate partitioning in ectomycorrhizal symbiosis. Phytochem. 68, 82–91
(2007).
21-Nehls, U., Göhringer, F., Wittulsky, S. & Dietz, S. Fungal carbohydrate support in
the ectomycorrhizal symbiosis: a review. Plant Biol. 12, 292–301 (2010).
22-Jones, D. L, Nguyen, C. & Finlay, R. D. Carbon flow in the rhizosphere: carbon
trading at the soil-root interface. Plant Soil 321, 5–33 (2009).
23-Lambers, H., Mougel, C., Jaillard, B. & Hinsinger, P. Plant-microbe-soil
interactions in the rhizosphere: an evolutionary perspective. Plant Soil 321, 83–
115 (2009).
24-Landeweert, R., Hofflund, E., Finlay, R.D. & van Breemen, N. Linking plants to
rocks: Ectomycorrhizal fungi mobilize nutrients from minerals. Trends Ecol.
Evol. 16, 248-254 (2001).
25-Hoffland, E., Kuyper, T. W., Wallander, H., Plassard, C., Gorbushina, A. A.,
Haselwandter, K., Holmstrom, S., Landeweert, R., Lundstrom, U. S., Rosling, A.,
Sen, R., Smits, M. M., van Hees, P. A. W., van Breemen, N. The role of fungi in
weathering. Front. Ecol. Environ. 2, 258–264 (2004).
26-Leyval, C. & Berthelin, J. Rhizodeposition and net release of soluble organic
compounds by pine and beech seedlings inoculated with rhizobacteria and
ectomycorrhizal fungi. Biol. Fertil. Soils. 15, 259–267 (1993).
27-Wallander, H. Uptake of P from apatite by Pinus sylvestris seedlings colonised by
different ectomycorrhizal fungi. Plant Soil. 218, 249–256 (2000a).
28-Wallander, H. Use of strontium isotopes and foliar K content to estimate weathering
of biotite induced by pine seedlings colonised by ectomycorrhizal fungi from two
different soils. Plant Soil, 222, 215–229 (2000b).
52
29-Wallander, H., Wickman, T. & Jacks, G. Apatite as a P source in mycorrhizal and
NM Pinus sylvestris seedlings. Plant Soil. 196, 123-131 (1997).
30-Olsson, P. A. & Wallander, H. Interactions between ectomycorrhizal fungi and the
bacterial community in soils amended with various primary minerals. FEMS
Microbiol. Ecol. 27, 195-205 (1998).
31-Bending, G. D, & Read, D. J. The structure and function of the vegetative mycelium
of ectomycorrhizal plants VI. Activities of nutrient mobilising enzymes in birch
litter colonised by Paxillus involutus (Fr.) Fr. New Phytol. 130, 411-417 (1995).
32-Tibbett, M. & Sanders, F. E. Ectomycorrhizal symbiosis can enhance plant nutrition
through improved access to discrete organic nutrient patches of high resource
quality. Ann. Bot. 89, 783-789 (2002).
Supplementary Information (Full Methods)
Plant species and fungal isolates. Jarrah seeds were obtained from a single tree in
Dwellingup, Western Australia. A. occidentalis and Scleroderma sp. isolates were
collected from a jarrah forest rehabilitation site at Langford Park, Western Australia
and banksia woodland at Piney Lakes, Western Australia, respectively. A. occidentalis
is a mushroom belonging to the fungal family of Boletaceae and has wide distribution
across Australia31
. Methods for seed germination, inoculum production and
colonisation studies were previously described32
.
Experimental design. 33
PO43-
was purchased from Perkin Elmer (Wellesley, MA,
USA) and used to investigate the ability of fungi to transport 33
P from the RDC to
jarrah plants. For this purpose, 250 g of sand containing 928 KBq 33
PO43-
was placed in
plastic vials (7 x 7 cm) at the bottom of cylindrical PVC pots (15 x 35 cm). Vials were
topped up with 100 g clean sand (2 cm) before being buried in 3.250 kg of double-
pasteurized washed river sand. A double-thickness polyester mesh bag (40 µm pore
size) was filled with 4.150 kg of a mixture of fungal inoculums (peat-vermiculite
substrate cultures) and double-pasteurized washed river sand (1:10 v/v) and placed
above the radiation compartment. The 33
PO43-
source was located 7 to 12 cm away from
jarrah roots. Three pre-germinated jarrah seeds were planted in each pot and the pot
surface was covered with 3 cm of sterile plastic beads to minimise cross or
environmental contaminations. Plants were grown for 16 weeks in a controlled
environment cabinet with 16 h light (750 µM m-2
s-1
) / 8 h dark, 24/18 ºC temperature
and 60/70 % relative humidity. All plants received the 1 X modified33
Long Ashton
solution minus P once a fortnight started two weeks after planting (10 mL kg-1
soil):
53
K2SO4 2 mM, MgSO4.7H2O 1.5 mM, CaCl2.2H2O 3 mM, FeEDTA 0.1 mM,
(NH4)2SO4 4 mM, NaNO3 8 mM, H3BO3 46 µM, MnCl2.4H2O 9 µM, ZnSO4.7H2O 8
µM, CuSO4.5H2O 0.3 µM and Na2MoO4.2H2O 0.01 µM.
Measuring the 33
P activity. A Geiger counter (Mini 900 Ratemeter, Thermo
Scientific) was used to non-destructively track the 33
P uptake in shoots of growing
plants. Shoot radioactivity at harvest was determined in tissues oven-dried at 70 ºC for
72 h. A measured quantity (about 200 mg) of dried ground shoot tissue was digested in
a mixture of nitric:perchloric acid solution (4:1 v/v) and diluted to 10 mL with water. A
1.0 mL portion of the diluted digest was mixed with 3.0 mL of scintillation fluid (Irga-
Safe Plus, Perkin Elmer) and counted (TR 1500 liquid scintillation counter, Packard
Instrument Co.). The radioactivity measurement was corrected for decay and
background radiation. To measure 33
P in soil, the plant-available P was extracted using
a NaHCO3-based method34
before measuring the radioactivity as described above.
Radioactivity data were presented as specific activity (SA), which was considered as a
measure of radioactivity per mass of shoot tissues or growth medium.
Nutrient analysis. The acid digested samples from the 33
P measurements were used to
measure the shoot concentration of P, S, Mg, Fe, Zn and Cu using inductively coupled
plasma optical emission spectrometry (ICP-OES; Optima 5300 DV, PerkinElmer,
USA). A measured amount (about 60 mg) of dried ground shoot material was used to
measure the N percentage in a combustion analyzer (Elementar Vario Macro,
Germany). The plant-available P was extracted using a NaHCO3-based method34
before
the P concentration was determined using a Malachite green-based colorimetric assay34
.
Quantification of fungal hyphae in different compartments. Fungal hyphae were
extracted from soil by an aqueous solution and membrane filter technique36
with a
slight modification (5% ink (Black Sheafer) in white vinegar was used to stain hyphae
instead of lactoglycerol-trypan blue). Tennant’s formula37
was used to calculate the
hyphal length on each nitrocellulose gridded filter (0.45 µm Millipore).
Cloning of PHT1 genes and real-time PCR. Total RNA was isolated from jarrah
roots using a cetyltrimethylammonium bromide (CTAB)-based protocol38
with a slight
modification. Sodium D-isoascorbate was added to the extraction buffer just before use
to a final concentration of 100 mM. Total RNA (1.0 µg) was treated with DNase I
(RQ1 RNase-free DNase, Promega, USA) to remove genomic DNA contamination.
Oligo(dT)18 was used to prime cDNA synthesis (GoScriptTM
reverse transcriptase,
Promega) according to the supplier’s instructions. PHT1 cDNA fragments were
amplified by PCR using combinations of two forward primers (EcPT1-F and EcPT2-F)
54
and two reverse primers (EcPT4-R and EcPT5-R) (Supplementary Table 1) that were
designed based on conserved sequences in the PHT1 genes of E. camaldulensis39
. PCR
amplifications were carried out in 50 µl containing 3 µl of cDNA equivalent to 60 ng of
total RNA, 75 µM dNTP mix, 0.5 µM of each forward and reverse primer, 2 mM
MgCl2, 2.5 U of Taq DNA polymerase (Biotaq, Bioline) in 1X PCR buffer (Bioline).
The PCR program included 1.30 min of initial denaturation at 94 ºC followed by 30
cycles of denaturation at 94 ºC for 40 s, annealing of the primers at 56 ºC for 40 s and
extension at 72 ºC for 2 min. The amplicons were terminated by a final extension at 72
ºC for 10 min. PCR products were purified (Sure Clean Plus, Bioline) and ligated into
pJET1.2 (CloneJET™ PCR Cloning Kit, Fermentas). Plasmids with inserts of the
expected size were submitted to sequencing (Australian Genome Research Facility,
Perth, Australia). PHT1 sequences were confirmed by comparison to publicly available
sequence databases and used to design primers to amplify the 5’ and 3’ ends of PHT1
cDNAs by Rapid Amplification of cDNA Ends (RACE, SMART™ RACE cDNA
Amplification Kit and Advantage 2 Kit, Clontech). RACE products were purified,
ligated into pJET1.2 and sequenced as described above.
Three root-expressed PHT1 cDNAs were identified at the time of performing this
assay: EmPHT1;1 (1052 bp), EmPHT1;2 (980 bp) and EmPHT1;5 (752 bp). Gene
specific primers were designed for RT-PCR (Supplementary Table 1). In addition, a
fragment of a jarrah ACT gene was amplified using Actin-F and Actin-R primers40
and
sequenced to allow the design of gene specific primers to be used as an internal control
for the relative quantification assay (Supplementary Table 1). The SYBR green-based
real-time PCR (q-PCR) was carried out to quantify the transcripts from PHT1 genes
relative to ACT transcripts. Q-PCR reactions were performed in 96-well plates in a 10
µl reaction volume of 0.3 µM of each gene specific primer and 2.5 µl of cDNA
equivalent to 50 ng total RNA in 1x SYBR Green PCR master mix (Applied
Biosystems). All q-PCR experiments were performed on a 7500 FAST Real-time PCR
System (Applied Biosystems).
Quantification of root carbohydrates. Carbohydrates were extracted from freeze-
dried root samples using 80% ethanol41
. High-Performance Liquid Chromatography
(HPLC) was used to determine the concentration of sucrose, fructose and mannitol in
root extracts42,43
. Root extracts were injected into an HPLC separation module (W2695,
Waters, Milford, MA, USA) using acetonitrile/water as the mobile phase and
separation was achieved using a high performance carbohydrate column (5µm x 3.9mm
x 300mm, Waters). Sugars were detected using a refractometer (2414 Refractive Index
55
(RI) detector, Waters) with individual peak areas quantified. Sugar speciation and
concentration was determined after comparison to primary compound standard sets
covering each analyte.
Measuring the carboxylate concentration in rhizosphere soil. The root system was
shaken carefully to remove the bulk soil. The soil adhering to the root was defined as
the rhizosphere soil44
. The root system was gently shaken in a measured volume of 0.2
mM CaCl2 to wash off the rhizosphere soil. Syringe filters (0.2 µm Supor membrane
(Pall), Acrodisc) were used to filter a subsample of extract into 1 mL HPLC vials. The
filtered extracts were acidified with concentrated phosphoric acid (0.1% v/v) and frozen
at -20 ºC until analysis. The carboxylate concentration of rhizosphere extracts was
determined by HPLC45
using 600E pump, 717 plus autosampler, a 996 photodiode
array detector (Waters) and a C-18 reverse-phase column (Alltima).
Experimental design and statistical analysis. Plants were grown in a completely
randomized design with three replicates. The two fungal treatments were Scleroderma
sp. and A. occidentalis. The NM control received sterilized inoculum to equalize the
amount of nutrients and organic matter among treatments. Another set of controls was
also assessed. These had no 33
P and were used to calculate the background radiation in
soil and jarrah shoot tissues. ANOVA was performed (Statistical Analysis System,
version 9.2, SAS Institute, Inc.; Cary, NC, USA). Means were separated using the least
significant difference at a 5 % significance level unless otherwise stated.
Supplementary References
31-Watling, R. & Gregory, N.M. Observations on the boletes of the Cooloola
sandmass, Queensland and notes on their distribution in Australia. Proc. Royal
Soc. Queensland 97, 97-128 (1986).
32-Kariman, K., Barker, S. J., Finnegan, P. M. & Tibbett, M. Dual mycorrhizal
associations of jarrah (Eucalyptus marginata) in a nurse-pot system. Aust. J. Bot.
60, 661-668 (2012).
33-Cavagnaro, T. R., Smith, F. A., Lorimer, M. F, Haskard, K. A., Ayling, S. M. &
Smith S. E. Quantitative development of Paris type arbuscular mycorrhizas
formed between Asphodelus fistulosus and Glomus coronatum. New Phytol.
149:105–113. (2001).
34-Rayment, G. E. & Higginson, F. R. Australian Handbook of Soil and Water
Chemical Methods. Inkata Press: Melbourne, Australia (1992).
56
35-Motomizu, S., Wakimoto, T. & Toei, K. Spectrophotometric determination of
phosphate in river waters with molybdate blue and malachite green. Analyst
108, 361–367 (1983).
36-Jakobsen, I., Abbott, L. K. & Robson, A. D. External hyphae of vesicular-arbuscular
mycorrhizal fungi associated with Trifolium subterraneum L. 1. Spread of
hyphae and phosphorus inflow into roots. New Phytol. 120, 371–380 (1992).
37-Tennant, D. A test of a modified line intersect method estimating root length. J.
Ecol. 63, 995–1001 (1975).
38-Korimbocus, J., Coates, D., Barker, I. & Boonham N. Improved detection of
sugarcane yellow leaf virus using a real-time fluorescent (TaqMan) RT-PCR
assay. J. Vir. Methods 103, 109-120 (2002).
39-Koyama, T., Kato, N., Hibino, T., Kawazu, T., Kimura, T. & Sakka, K. Isolation
and expression analysis of phosphate transporter genes from Eucalyptus
camaldulensis. Plant Biotech. 23, 215-218 (2006).
40-Webster, C. G. Characterization of Hardenbergia Mosaic Virus and Development
of Microarrays for Detecting Viruses in Plants. PhD thesis, Murduch
University, Australia (2008).
41-Cononoco, E. A. Improving Yield of Wheat Experiencing Post Anthesis Water
Deficits through the Use of Shoot Carbohydrate Reserves. PhD thesis. The
University of Western Australia, Australia (2002).
42-Smith, J. S., Villalobos, M. C. & Cottemann, C, M. Quantitative determination of
sugars in various food products. J. Food Sci. 51, 1373-1375 (1986).
43-AOAC, Official Methods of Analysis of the Association of Official Agricultural
Chemists. 16th
edition, 5th
revision, AOAC International, Gaithersburg, MD,
USA (1999).
44-Veneklaas, E., Stevens, J., Cawthray, G., Turner, S., Grigg, A. & Lambers, H.
Chickpea and white lupin rhizosphere carboxylates vary with soil properties and
enhance phosphorus uptake. Plant Soil 248, 187-197 (2003).
45-Cawthray, G. R. An improved reversed-phase liquid chromatographic method for
the analysis of low-molecular mass organic acids in plant exudates. J.
Chromatogr. A. 1011, 233–240 (2003).
57
Acknowledgments: The authors are grateful to Tim Morald who collected an A.
occidentalis mushroom from a jarrah forest rehabilitation site (2007, Langford Park,
Jarrahdale WA) and Neale Bougher who kindly identified the Austroboletus species.
Authors are also thankful for technical advice from Lindsey Loweth, Gregory
Cawthray, Michael Smirk, Hazel Gaza, Stuart Pearse, Megan Ryan, Hossein Khabaz-
Saberi, Basu Regmi and Robert Creasy. We appreciate the University of Western
Australia postgraduate scholarships (SIRF/UIS) awarded to K.K. and also financial
support and grants from the Centre for Land Rehabilitation at the University of Western
Australia (M.T.) and the Australian Research Council (M.T., P.M.F.).
Author Contributions: The experimental work was carried out by K.K. who also
wrote the initial draft of the manuscript. The intellectual input and experimental design
were by K.K., S.J.B., P.M.F and M.T. The gene quantification assay was carried out
with the intellectual and scientific supervision of R.J. All authors contributed to the
manuscript editing.
Author Information: The GenBank accession numbers of jarrah PHT1 genes were as
follows: EmPHT1;1 (KC172372), EmPHT1;2 (KC172373), EmPHT1;5 (KC172376)
and EmACT1 (KC172377).
58
Supplementary Table 1. Oligonucleotide primer pairs used
Primer Direction Sequence (5’-3’) Product
size (bp)
EcPT1-F Forward CTTACTACTGGCGCATGAAGATGCC 403
EcPT4-R Reverse GGTGAACCAGTACCCAGGGA
EcPT1-F Forward CTTACTACTGGCGCATGAAGATGCC 574
EcPT5-R Reverse CCCAAAGTTGGCGAAGAAGAAGGT
EcPT2-F Forward GGTTCTTGCTGGACATCGCCT 175
EcPT4-R Reverse GGTGAACCAGTACCCAGGGA
EcPT2-F Forward GGTTCTTGCTGGACATCGCCT 346
EcPT5-R Reverse CCCAAAGTTGGCGAAGAAGAAGGT
Primers used for real-time PCR PCR
efficiency
EmPT1-F Forward GAGCCGTCGAGATGGTGTGTAGA 122 1.82
EmPT1-R Reverse CGACTATCTTGCCACTTCCTCCATTGA
EmPT2-F Forward CGATGAGGTGCCCACTGCT 138 1.96
EmPT2-R Reverse CACCTGCTCGACGACTCCGTAAT
EmPT5-F Forward GGACGATGAGGTGTCCACTGCTT 127 2.00
EmPT5-R Reverse TCTGTAATATTCGGCAACACGGGAAGT
Act2-F Forward GGTCCTGTTCCAACCATCCATGATT 136 1.99
Act2-R Reverse GGTAGAACCACCACTGAGGACAATGT
59
Chapter 4
Mycorrhizal symbiosis can induce tolerance in jarrah
(Eucalyptus marginata) exposed to toxic pulses of phosphorus
Khalil Kariman1,2
, Susan J. Barker2,3
, Patrick M. Finnegan2,3
and Mark Tibbett1,4
1School of Earth and Environment M087, The University of Western Australia,
Crawley, WA 6009, Australia
2School of Plant Biology M084, The University of Western Australia, Crawley, WA
6009, Australia
3Institute of Agriculture M082, The University of Western Australia, Crawley, WA
6009, Australia
4Department of Environmental Science and Technology (B37), School of Applied
Sciences, Cranfield University, Cranfield, Bedfordshire, MK 43 OAL, England
Abstract
Jarrah plants develop toxicity symptoms upon exposure to elevated phosphorus (P)
conditions like many other plants native to Australia and Sub-Saharan Africa. A nurse-
pot system was developed to establish arbuscular mycorrhizal (AM) and
ectomycorrhizal (ECM) associations with jarrah to investigate their potential role in
conferring tolerance against P toxicity. Two AM fungi (Rhizophagus irregularis and
Sutellospora calospora) along with two putative ECM fungi (Austroboletus
occidentalis and Scleroderma sp.) were used. The P transport dynamics of AM, ECM,
dual (AM + ECM) and non-mycorrhizal seedlings were monitored following two
pulses of P as phosphate. Both putative ECM fungi significantly enhanced the shoot P
content of jarrah plants growing under P-deficient conditions. In addition, S. calospora,
A. occidentalis and Scleroderma sp. all stimulated plant growth significantly. The
results revealed that jarrah is among the most sensitive species to P fertilization, with
toxicity symptoms observed at a shoot P concentration of no more than 5.5 mg P g-1
DW. All inoculated plants had significantly lower phytotoxicity symptoms compared to
non-mycorrhizal controls one week after addition of an elevated P dose of 30 mg P kg-1
soil. The reduced toxicity symptoms in all inoculated plants was apparently correlated
with lower shoot P concentration than NM plants even though the differences were not
statistically significant except for R. irregularis and dually inoculated plants. Following
60
exposure to toxicity-inducing levels of P, the shoot P concentration was 20 to 30%
lower in plants inoculated with R. irregularis, S. calospora, A. occidentalis or
Scleroderma sp., and 40% lower in the dually inoculated plants compared to non-
mycorrhizal controls. The induced P tolerance in inoculated plants correlated with
lower shoot P concentration, but was not associated with symbiosis type or the extent
of root colonisation. The AM fungus R. irregularis was the most effective at reducing
shoot P concentration under toxicity conditions.
Key words: arbuscular mycorrhiza (AM), ectomycorrhiza (ECM), jarrah, phosphorus
(P), tolerance, P pulse
Introduction
Phosphorus is a macronutrient essential for plant growth. It is a structural component
of nucleic acids and phospholipids, and is involved in many cellular functions such as
energy transfer and the regulation of enzyme activity. The availability of P to plants is,
however, limited in many soils. Australia, Sub-Saharan Africa, tropical Asia and South
America are among the main areas that have P-deficient soils (Handreck et al. 1997;
Runge-Metzger 1995, Smaling 2005; Trolove et al. 2003; Sanchez and Buol 1975). P
deficiency is considered to be the main critical factor determining plant productivity
and species diversity in terrestrial ecosystems (Lambers et al. 2010).
Many plant species have mechanisms to enhance the extraction of P from the soil.
Arbuscular mycorrhiza (AM), ectomycorrhiza (ECM) and cluster root formation are
among the main P acquisition strategies available to plants (Lambers and Shane 2007;
Lambers et al. 2009; Smith and Read 2008). AM fungi are found in the majority of
terrestrial ecosystems. In a survey of the literature, they were shown to colonise 74% of
angiosperm species from 336 plant families representing 99% of flowering plants
(Brundrett 2009). ECM fungi establish the second most widespread form of mycorrhiza
and have an intimate association with many woody plant species from about 30
families (Smith and Read 2008).
Plant species that are adapted to P-deficient soils can be exposed to elevated P
conditions via nutrient flushing, soil wetting, fertilization and also when new
plantations are established on previously fertilised soils having high levels of P. Many
low-P adapted plants, particularly those from Australia and South Africa, develop
toxicity symptoms upon exposure to elevated levels of P. The P toxicity response
occurs in at least some species because they cannot down-regulate their net P uptake,
61
perhaps as a consequence of having evolved on P-impoverished soils over millions of
years (Lambers et al. 2011; Hawkins et al. 2008; Shane et al. 2004a). P sensitive
species are found in the Fabaceae, Haemodoraceae, Mimosaceae Myrtaceae,
Proteaceae, Rutaceae, and generally are a feature of heaths and other sclerophyllous
plant communities (Hawkins et al. 2008; Grundon 1972; Dell et al. 1987, Handreck
1997; Heddle and Specht 1975; Shane et al. 2004b; Specht 1981; Specht et al. 1977;
Specht and Groves 1966; Thomson and Leishman 2004). Depending on the plant
species (Shane et al. 2004b), development of P toxicity symptoms can occur at a shoot
P concentration of less than 1 mg P g-1
DW, such as in Banksia ericifolia (Parks et al.
2000), or more than 40 mg P g-1
DW, as reported for Telopia speciosissima (Grose
1989).
The response of plants to P fertilisation may be linked to their response to root
colonisation by mycorrhizal fungi, but the details of this relationship are not clear.
Although mycorrhizal symbioses are renowned for increasing nutrients uptake in
nutrient-deficient plants, they also function to favour the growth of plants exposed to
nutrient toxicity conditions (Hildebrandt et al. 2007; Smith and Read 2008).
Mycorrhizal fungi can modify the P uptake in the host plant by inducing the plant to
reduce the expression of genes encoding high-affinity phosphate transporter (PHT)
proteins (Burleigh 2001; Burleigh and Harrison 1999; Karandashov and Bucher 2005;
Liu et al. 1998; Rosewarne et al. 1999). Much more information about shoot P
accumulation and toxicity development is required for plants that are commonly used
in combination with P fertiliser in the restoration of native ecosystems (Koch 2007).
This research was carried out to clarify the possible link between mycorrhizal
associations and P tolerance in Eucalyptus marginata (jarrah), an important restoration
species suspected of high P sensitivity. A nurse-pot system was used to establish
mycorrhizal associations of jarrah with the AM species Rhizophagus irregularis
(Błaszk., Wubet, Renker & Buscot) C. Walker & A. Schüßler comb. nov. and
Scutellospora calospora Nicol. & Gerd. and the putative ECM fungi Austroboletus
occidentalis Watling & N.M. Greg. and Scleroderma sp. The main aims were: (i) to
establish the role of the fungal symbionts in stimulating P uptake under P-deficient
conditions, (ii) to determine the ability of the selected fungi to confer tolerance against
toxic pulses of P, (iii) to reveal possible correlations between the induced tolerance and
the shoot P concentration, the mycorrhizal type and the extent of root colonisation, and
(iv) to ascertain the effect of these fungal species on plant growth.
62
Materials and Methods
Plant materials, fungal isolates and inoculum production
Jarrah capsules were obtained from a single tree near Dwellingup, Western Australia.
Seeds were released from the capsules by incubating at 42 ºC for three days. The four
fungal isolates used were S. calospora, A. occidentalis and Scleroderma sp. from west
Australian habitats and R. irregularis (DAOM197198), an exotic isolate from Pont
Rouge, Québec, Canada (Stockinger et al. 2009). Details about the fungal isolates and
inoculum production were as previously described (Kariman et al. 2012).
Nurse-pot system
A nurse-pot system was developed for the study of mycorrhizal associations of jarrah
seedlings (Kariman et al. 2012). A polyester mesh bag (40 µm pore size) was filled
with double-pasteurized washed river sand and placed in the centre of a plastic pot
containing the same matrix. The matrix outside the mesh bag was filled with a mixture
of double-pasteurized washed river sand and mycorrhizal inoculums. To provide equal
conditions for all treatments, AM and ECM plants were supplied with sterilized ECM
or AM inoculum, respectively. Non-mycorrhizal (NM) plants also received sterilized
AM and ECM inocula. Four pre-germinated jarrah seeds were planted outside the mesh
bag and designated as nurse seedlings. In this nurse-pot system, extraradical hyphae
from the nurse seedlings can penetrate into the mesh bag soil whereas plant roots
cannot pass through it. The experiment was conducted from June to September 2010 in
an unheated glasshouse with the average daytime temperature of 20 °C. All plants
received the 1 X modified Long Ashton solution minus P once a fortnight started two
weeks after planting (10 mL kg-1
soil): K2SO4 2 mM, MgSO4.7H2O 1.5 mM,
CaCl2.2H2O 3 mM, FeEDTA 0.1 mM, (NH4)2SO4 4 mM, NaNO3 8 mM, H3BO3 46
µM, MnCl2.4H2O 9 µM, ZnSO4.7H2O 8 µM, CuSO4.5H2O 0.3 µM and
Na2MoO4.2H2O 0.01 µM (Cavagnaro et al. 2001). We used sealed pots for this
experiment and watered them to field capacity three times a week. After 10 weeks
growth, four non-mycorrhizal test seedlings were transplanted into the mesh bag and
one test seedling was harvested weekly to check the colonisation (see Kariman et al.
2012 for more details).
63
P addition and toxicity analysis
After harvesting all four test seedlings for colonisation studies, one nurse seedling
was harvested from each pot for P analysis. One day after harvesting the first seedling,
the first P pulse was added to all nurse-pots at the ratio of 10 mg P kg-1
soil (as KH2PO4
in aqueous solution). A nurse seedling was harvested one day after addition of the P
pulse to measure the shoot P concentration. Seven days later, a second P pulse of 30 mg
P kg-1
soil was added. The plant toxicity symptoms were quantified one week after
adding the second P pulse and seedlings were harvested for growth response and P
accumulation under high P conditions. The P toxicity symptoms (including chlorotic
and necrotic areas on leaves) were quantified by ranking plants into six classes from 0
to 5, where 0 corresponded to the absence of toxicity symptoms; 1 from traces to 20 %
of symptomatic leaf tissue area (SLTA); 2 from 20 to 40 % SLTA; 3 from 40 to 60 %
of SLTA; 4 from 60 to 80 % of SLTA and 5 more than 80 % of SLTA.
Measured quantities of ground dried shoot tissues (about 200 mg) were digested in 5
ml nitric-perchloric acid solution (4:1 v/v) and the P concentration was determined
using a vanado-molybdate yellow method (Jackson 1973). The amount of P that
accumulated in the shoot tissues (mg P g-1
DW) following each P pulse was calculated
based on the differences in shoot P concentration between two subsequent harvests and
was designated as the incremental shoot P concentration.
Experimental design and data analysis
The experiment was conducted in a completely randomized design with three
replicates. There were two AM treatments (R. irregularis and S. calospora), two
putative ECM treatments (A. occidentalis and Scleroderma sp.), a dual treatment (R.
irregularis and Scleroderma sp.) and NM controls. All data were analyzed using the
Statistical Analysis System (SAS) version 9.2 (SAS Institute, Inc.; Cary NC, USA)
software package. Means were separated using LSD at 5% significance level unless
otherwise stated.
64
Results:
ECM fungi enhance P uptake in jarrah under P-deficient conditions
The washed river sand used for plant culture contained less than 6 mg P kg-1
(Colwell
P, data not shown). Therefore, the seedlings grown in the absence of P addition were
grown under P-deficient conditions according to previous reports on eucalypts (Burgess
et al. 1994; Aggangan et al. 1996). We assessed the shoot P content of seedlings prior
to the addition of P to assess the effect of mycorrhizal symbioses on P nutrition under
P-deficient conditions (Fig. 1). Jarrah plants inoculated with either putative ECM
fungus (A. occidentalis and Scleroderma sp.) had significantly higher shoot P content
than the NM controls and the other mycorrhizal treatments. With the AM fungus S.
calospora, jarrah plants had higher shoot P content than NM controls, or plants
inoculated with R. irregularis or the dually inoculated plants, although this difference
was not statistically significant.
Fig. 1. Shoot P content of jarrah seedlings growing under P-deficient conditions after
14 weeks growth. Plants were inoculated with the indicated fungi (except the un-
inoculated control plants). The dual treatment was co-inoculated with R. irregularis
(AM) and Scleroderma sp. (ECM). Bars labelled with different letters are significantly
different at p < 0.05 (n = 3).
bb
b
a
a
b
0
0.5
1
1.5
2
2.5
Sh
oo
t P
co
nte
nt (m
g P
pla
nt-1
)
65
P sensitivity in jarrah is dependent on mycorrhizal fungi
Fourteen-week-old jarrah seedlings developed mild and patchy symptoms of P
toxicity within three days of being exposed to 10 mg P kg-1
soil. The symptoms were
more severe in plants exposed to a higher dose of 30 mg P kg-1
soil 7 d after the first
dose. Irregular chlorotic spots appeared mainly around the midrib and progressed
toward the leaf margins (Fig. 2). However, the pattern and development of symptoms
differed among individual plants. All plants inoculated with potential mycorrhizal
partners had significantly reduced toxicity symptoms when examined one week after
the second P addition compared to NM control plants (Fig. 3). The extent of the
toxicity symptoms did not differ between plants inoculated with different fungi.
Fig. 2. Development of P toxicity symptoms on an individual leaf from an NM
seedling: a) one day before (rank 0), (b) 3 d after (rank 1) and c) 7 d after the second P
dose (rank 3). Fourteen-week-old jarrah seedlings were exposed to a single dose of 10
mg P kg-1
soil for 7 d before subjecting to a second dose of 30 mg P kg-1
soil for 7 d.
Fig. 3. The average phytotoxicity rank of jarrah plants 7 d after subjecting to the second
dose of P. Plants were inoculated with the indicated fungi and grown as described in
the legends for Fig. 1. Values are the average and standard error (n = 3). Bars labelled
with the same letter are not significantly different at p < 0.05.
a
bb b
b b
0
0.5
1
1.5
2
2.5
3
3.5
4
Ph
yto
tox
icit
y ra
nk
a b c
66
Mycorrhizal fungi ameliorate the toxic accumulation of P in jarrah shoots
The shoot P concentration of jarrah plants was determined before and after adding
two pulses of P (Fig. 4). Although the P content of plants under ECM treatments was
significantly greater than those in NM control, AM and dual treatment plants (Fig. 1),
the size differences among the plants in the various treatments caused the shoot P
concentration prior to P fertilization to be less variable (Fig. 4, open bars). Generally,
there was a decreasing trend in shoot P concentration for plants inoculated with fungi
compared to NM plants one week after the addition of the second dose of P (Fig. 4,
closed bars). The highest and lowest shoot P concentration belonged to NM control
plants and dually-inoculated plants, respectively, although these plants did not differ
significantly in shoot P concentration prior to the addition of the first P pulse (Fig. 4).
The shoot P concentration was 20 % to 30 % lower in plants inoculated with R.
irregularis (29 %), S. calospora (21%), A. occidentalis (22 %), Scleroderma sp. (19%)
and 42 % lower in the dual treatment (R. irregularis and Scleroderma sp.) compared to
the NM seedlings. There were no toxicity symptoms in any of the treatments one day
after adding the first P pulse. In each case, the shoot tissues had a concentration of less
than 1.8 mg P g-1
DW. The severe P toxicity symptoms in plants one week after adding
the second P pulse (Fig. 3) correlated with shoot P concentrations ranging from 5.5 to
9.5 mg P g-1
DW. Thus, the P toxicity symptoms developed at a shoot P concentration
somewhere between 1.8 and 5.5 mg P g-1
DW. R. irregularis alone and in combination
with Scleroderma sp. was the most effective in preventing shoot P accumulation
following addition of the second P pulse.
67
Fig. 4 Shoot P concentration of jarrah seedlings one day before first P addition (open
bars), one day after first P addition (checkered bars) and 7 d after the second P addition
(closed bars). Plants were inoculated with fungi and grown as indicated in the legend to
Fig. 1. Bars from each harvest labelled with different letters are significantly different
at the p < 0.05 level (n = 3).
The incremental increase in shoot P concentration was lower in mycorrhizal plants
The incremental increase in shoot P concentration in NM plants after one day
exposure to P fertilization was about 1 mg g-1
DW (Fig. 5). The level of shoot P was
significantly lower in plants inoculated with the putative ECM isolates A. occidentalis
and Scleroderma sp. compared to the NM controls and the other mycorrhizal
treatments. At this sampling time, the NM control plants had the greatest increase in
shoot P concentration, while the plants inoculated with Scleroderma sp. had lowest
increase in shoot P concentration (closed bars, Fig. 5).
One week after the second P addition, shoots of NM control plants had an
incremental increase in P concentration of about 7.5 mg g-1
DW (Fig. 5, open bar).
However, at this sampling point, plants inoculated with R. irregularis and the dual
inoculum had significantly smaller increases in shoot P concentration than the NM
control plants (Fig. 5, open bars). Plants inoculated with S. calospora, A. occidentalis
and Scleroderma sp. also had smaller increases in shoot P concentration than the NM
controls, but these differences were not statistically significant.
ab b abab
aab
a a a aa
a
a
bab ab
ab
b
0
2
4
6
8
10
12
Sh
oo
t P
co
ncen
tra
tio
n (m
g g
-1D
W)
68
Fig. 5 Incremental increase in shoot P concentration for jarrah seedlings 1 d after the
first P addition (closed bars) and 7 d after the second P addition (open bars). Plants
were inoculated with fungi and grown as indicated in the legend to Fig. 1. Bars of each
type labelled with the same letter are not significantly different at the p <0.05 level
(n=3).
Mycorrhizal fungi enhanced jarrah biomass production
Inoculation of jarrah with S. calospora, A. occidentalis or Scleroderma sp. caused a
significant increase in the root and shoot dry mass of jarrah plants after 16 weeks
growth and two P fertilisations, compared to NM controls (Fig. 6). Jarrah plants
inoculated with R. irregularis alone or in combination with Scleroderma sp. had
significantly lower shoot and root biomass compared to S. calospora, A. occidentalis
and Scleroderma sp. treatments (P < 0.1). A significant depression of root system
growth was observed in seedlings co-inoculated with R. irregularis and Scleroderma
sp.
a ababc
bcc
abc
a
bab ab
ab
b
0
1
2
3
4
5
6
7
8
9
10In
cre
men
tal s
ho
ot P
co
ncen
tra
tio
n
(mg g
-1D
W)
69
Fig. 6 Shoot and root dry mass of jarrah plants after 16 weeks growth and two P
fertilisations. Plants were inoculated with fungi and grown as indicated in the legend to
Fig. 1. ** and * represent significant differences from the control plants at p < 0.05 and
p < 0.10 (n = 3), respectively.
Discussion
Mycorrhiza and P uptake under P-deficient conditions
The presence of the putative ECM fungi A. occidentalis and Scleroderma sp. caused a
dramatic increase in shoot P content of jarrah plants grown under P-deficient conditions
in keeping with the existing literature on other eucalypts (Bougher et al. 1990, Jones et
al. 1998). As previously described (Kariman et al. 2012), the mycorrhizal colonisation
of jarrah plants were 2.3%, 29%, and 28.3% for R. irregularis (AM), S. calospora
(AM), and Scleroderma sp. (ECM) treatments, respectively. The dual treatment had
less than 1% AM and no ECM colonisation and A. occidentalis did not colonise jarrah
roots. The facilitation of P uptake by A. occidentalis is remarkable as this fungus did
not form mycorrhizal structures with jarrah roots (Kariman et al. 2012). These results
indicate that the P uptake of plants does not necessarily correlate with the root
colonisation ability of ECM isolates. Other potential factors could be behind the
enhanced P uptake by jarrah in the presence of A. occidentalis including the exudation
by the fungus, the plant or both of organic acids to release the P from primary minerals
(Landeweert et al. 2001) or of P-mobilizing enzymes that release P from soil organic
** ** **
*
*
****
0
0.5
1
1.5
2
2.5
3
3.5
Dry
ma
ss (
g p
lan
t-1)
Root Shoot
70
matter (Bending and Read 1995). In the case of plant exudation, this would require a
fungus-dependent elicitor, as the fungus was required for the enhanced P acquisition.
Neither AM fungus caused an increase in the shoot P content of jarrah plants growing
under P-deficient conditions. This result is in agreement with a report that AM fungi
have a low capacity to improve the P nutrition of E. coccifera (Jones et al. 1998). Even
though S. calospora had higher root colonisation than R. irregularis, the other AM
species examined, the shoot P content did not differ significantly between the two AM
treatments. In the dual treatment, the AM fungus (R. irregularis) seemingly dominated
the outcome, as there was neither an increase in the shoot P content nor a positive
growth response. This outcome suggests that ECM associations may not form and thus
would not provide a growth and nutritional benefits in the presence of non-compatible
AM-eucalypt symbiosis.
Mycorrhiza and tolerance to P toxicity
All four fungal isolates tested induced tolerance to P toxicity in jarrah, as judged by
the reduction in the P toxicity symptoms. The induced tolerance was associated with a
lower shoot P concentration in the inoculated plants. The shoot P concentration of
jarrah plants growing under P-deficient conditions was less than 1.5 mg P g-1
DW in
keeping with previous reports for jarrah (Dell et al. 1987) and E. urophylla (Aggangan
et al. 1996). The symptoms of P toxicity in jarrah had developed at a shoot P
concentration between 1.8 and 5.5 mg P g-1
DW, indicating that jarrah is a highly P-
sensitive species compared to other plants (Shane et al. 2004b and references therein).
A single dose of P fertiliser equivalent to an elemental dose of 40 kg Ha-1
is routinely
applied to jarrah forest rehabilitation sites (Koch and Samsa 2007). While it is
impossible to exactly correlate this field dose with our pot growth experiments,
especially as the soil conditions differ, it is clear from our results that a very low dose
of P can have a harmful effect on jarrah, especially if the plants are not involved in
mycorrhizal associations. This conclusion then produces an important consideration for
the management of jarrah forest restoration.
The observed shoot P concentrations and incremental increases in shoot P
concentration after P fertilisations indicate that jarrah plants had a reduced shoot P
concentration under elevated P conditions in response to all four fungal species in spite
of very low colonisation (R. irregularis and dual treatments) or no colonisation (A.
occidentalis treatment). One potential explanation for these results is that colonisation
caused a down-regulation of P acquisition capacity in jarrah. It is well established in
71
other plants that PHT proteins located in the plasmalemma of root epidermal cells and
root hairs that form the direct pathway of P uptake are down-regulated following
mycorrhizal colonisation (Burleigh 2001; Burleigh and Harrison 1999; Karandashov
and Bucher 2005; Liu et al. 1998; Rosewarne et al. 1999). Other potential mechanisms
might be involved in the observed induction of P tolerance such as a “dilution effect”
resulting from higher shoot biomass in some inoculated plants (S. calospora, A.
occidentalis and Scleroderma sp. treatments) or the accumulation of nutrients (here, P)
in fungal hyphae, as reported for certain nutrients and heavy metals (Hildebrandt et al.
2007). Different combinations of these potential mechanisms of P tolerance might be
active to various extents in the different symbioses.
The lowest jarrah shoot P concentration after P fertilisation was observed in
association with R. irregularis either alone or in combination with Sclorderma sp.
(ECM). These associations had AM colonisation rates of 2.3 and 0.8 %, respectively.
However, S. calospora, the other AM fungus tested here, had a much higher
colonisation rate of 29 % (Kariman et al., 2012) and this was accompanied by higher
trend for shoot P concentration. This could be primary evidence indicating that the AM
fungus provides a significant indirect pathway for P uptake in jarrah. Smith et al.
(2003; 2004) showed that there had been a misevaluation about the contribution made
by mycorrhizal fungi to P uptake by host plants, such that the mycorrhiza-mediated P
uptake could be much higher than previously presumed. Indeed, P can be almost
exclusively supplied to plants via the mycorrhizal pathway for some plant-fungus
combinations (Smith et al. 2003, 2004).
Our results indicate that the AM fungus R. irregularis is more effective than the
tested ECM isolates at reducing the jarrah shoot P concentration during a long term
exposure to elevated P conditions. Both putative ECM fungi had significantly lower
incremental increases in shoot P concentration one day after adding the first P pulse
compared to other treatments showing that the P has been provided to ECM plants at a
much lower rate during this short time. Conversely, after 7 day exposure to an elevated
P supply, plants associated with R. irregularis alone or together with Scleroderma sp.
had a significantly lower incremental increase in shoot P concentration. These results
suggest that this AM partner may have a low capacity to provide P for the host plant
than the ECM partners.
One implication of our findings is that pre-inoculation of jarrah seedlings in nurseries
with both AM and ECM fungi would be helpful in minimizing the P toxicity response.
This would be applicable where new plantations are being established in soils over-
72
fertilized with P. However, the AM fungus R. irregularis had no positive effects on
jarrah shoot and root biomass. Furthermore, R. irregularis inhibited ECM colonisation
and function (Kariman et al. 2012) in dually inoculated plants, resulting in the smallest
root system amongst treatments, which would affect the establishment and anchoring of
plants. Therefore, for optimal plantation or restoration success, further work is needed
to select fungal isolates that induce both positive growth responses and P tolerance in
jarrah.
Biomass production
ECM plants produced the largest biomass among the treatments regardless of their
colonisation ability confirming the studies showing substantial effects of ECM fungi on
eucalypt growth (Bougher et al. 1990; Jones et al. 1998; Thomson et al. 1994). To date,
several studies have shown significant contribution of fungi to plant growth without
forming any mycorrhizal structures or by forming non-typical structures (Neumann
1959; Kope and Warcup 1986; Warcup and McGee 1983; Kariman et al. 2012).
Two AM fungi had contrasting effects on jarrah growth and the positive growth
response was only observed with S. calospora. No significant growth response was
observed when plants were inoculated with the non-indigenous AM fungus R.
irregularis alone or in combination with Scleroderma sp. These plants had less than 1
% AM colonisation. Moreover, there was a significant depressive effect on root system
growth in the dually inoculated plants. This could be an example of a parasitic rather
than a mutualistic behaviour of the mycosymbionts (Johnson et al. 1997). The positive
growth response of jarrah to S. calospora was accompanied by a much higher
colonisation rate than observed for R. irregularis and dually inoculated plants.
Nevertheless, the extent of root colonisation does not necessarily have a direct
correlation with positive growth and nutritional responses (Smith et al. 2004; Jakobsen
1995).
The response of eucalypts to AM inoculation has been a matter of controversy during
the past decades due to inconsistent results. Gomez et al. (1987) observed no growth
stimulation in eight Eucalyptus species three months after inoculation with 30 AM
isolates. Other studies, however, reported positive effects of AM fungi on growth of
different Eucalyptus species (Adjoud et al. 1996; Chen et al. 2000). This study
confirms the inconsistency of growth response in AM-eucalypt symbioses by showing
that two different AM isolates have opposite effects on jarrah. The mentioned studies
suggest that the growth response in AM-eucalypt symbioses is strongly dependent on
73
the AM fungus (e.g. different fungal nutrient demands or different life history
strategies), the plant species and the experimental conditions.
In conclusion, we demonstrated that both AM and ECM symbionts could induce
tolerance to elevated P in jarrah plants by reducing the shoot P concentration. The
protective effect was independent of the type of fungal association and the extent of
mycorrhizal colonisation. Following exposure to elevated P conditions, inoculated
plants had 20 to 40 % lower shoot P concentrations compared to NM controls.
Moreover, ECM species formed more efficient symbioses with jarrah plants in terms of
plant growth benefits and P nutrition under P-deficient conditions. Finally, the findings
suggest that mycorrhization is a potential strategy to reduce the development of P
toxicity symptoms in P sensitive plant species.
Acknowledgments
The authors appreciate postgraduate SIRF and UIS scholarships awarded to KK by
the University of Western Australia and also the financial support and grants from the
Centre for Land Rehabilitation and Australian Research Council.
Literature Cited
Adjoud D, Plenchette C, Halli-Hargas R, Lapeyrie F (1996) Response of 11 eucalyptus
species to inoculation with three arbuscular mycorrhizal fungi. Mycorrhiza 6:129-
135
Aggangan NS, Dell B, Malajczuk N (1996) Effects of soil pH on the ectomycorrhizal
response of Eucalyptus urophylla seedlings. New Phytol 134: 539-546
Bending GD, Read DJ. (1995) The structure and function of the vegetative mycelium
of ectomycorrhizal plants VI. Activities of nutrient mobilising enzymes in birch
litter colonised by Paxillus involutus (Fr.) Fr. New Phytol 130: 411-417
Bougher NL, Grove TS and Malajczuk N (1990) Growth and phosphorus acquisition of
karri (Eucalyptus diversicolor F. Muell.) seedlings inoculated with ectomycorrhizal
fungi in relation to phosphorus supply. New Phytol 114:77-85
Brundrett MC (2009) Mycorrhizal associations and other means of nutrition of vascular
plants: understanding the global diversity of host plants by resolving conflicting
information and developing reliable means of diagnosis. Plant Soil 320: 37-77
Burgess T, Dell B, Malajczuk N (1994) Variation in mycorrhizal development and
growth stimulation by 20 Pisolithus isolates inoculated on to Eucalyptus grandis W
Hill ex Maiden. New Phytol 127: 731-739
74
Burleigh SH (2001) Relative quantitative RT-PCR to study the expression of plant
nutrient transporters in arbuscular mycorrhizas. Plant Sci 160: 899–904
Burleigh SH, Harrison MJ (1999) The down-regulation of Mt4-like genes by phosphate
fertilization occurs systemically and involves phosphate translocation to the shoots.
Plant Physiol 119: 241-248
Cavagnaro TR, Smith FA, Lorimer MF, Haskard KA, Ayling SM, Smith SE (2001)
Quantitative development of Paris type arbuscular mycorrhizas formed between
Asphodelus fistulosus and Glomus coronatum. New Phytol 149: 105–113
Chen YL, Brundrett MC, Dell B (2000) Effects of ectomycorrhizas and vesicular–
arbuscular mycorrhizas, alone or in competition, on root colonisation and growth of
Eucalyptus globulus and E. urophylla. New Phytol 146: 545–556
Dell B, Jones S, Wilson SA (1987) Phosphorus nutrition of jarrah (Eucalyptus
marginata) seedlings. Plant Soil 97: 369-379
Gomez TCR, Faria LP, Lin MT (1987) Mycorrhization of eight species of Eucalyptus
with VAM fungi, Durban, South Africa. pp. 86–93
Grose MJ (1989). Phosphorus nutrition of seedlings of Waratah, Telopea speciosissima
(Sm.) R.Br. (Proteaceae). Aust J Bot 37: 313-320
Grundon NJ (1972) Mineral nutrition of some Queensland heath plants. J Ecol 60: 171-
18
Handreck KA (1997) Phosphorous requirements of Australian native plants. Aust J Soil
Res 35: 241-289
Hawkins HJ, Hettasch H, Mesjasz-Przybylowicz J, Przybylowicz W, Craner MD
(2008) Phosphorus toxicity in the Proteaceae: A problem in post-agricultural lands.
Sci Hortic 117: 354–365
Heddle EM, Specht RL (1975) Dark island heath (90-mile plain, South Australia).8.
Effect of fertilizers on composition and growth, 1950-1972. Aust J Bot 23: 151-164
Hildebrandt U, Regvar M, Bothe H (2007). Arbuscular mycorrhiza and heavy metal
tolerance - Phytochem 68: 139-146
Jackson ML (1973) Soil chemical analysis. Parentice Hall India Pvt Ltd, New Delhi
Jakobsen I (1995) Transport of phosphorus and carbon in VA mycorrhizas. In
'Mycorrhiza, structure, function, molecular biology and biotechnology'. (Eds A
Varma and B Hock) pp. 297-324. (Springer Verlag: Berlin, Germany)
Johnson NC, Graham JH, Smith FA (1997) Functioning of mycorrhizal associations
along the mutualism-parasitism continuum. New Phytol 135: 575-586
Jones MD, Durall DM, Tinker PB (1998) Comparison of arbuscular and
ectomycorrhizal Eucalyptus coccifera: growth response, phosphorus uptake
efficiency and external hyphal production. New Phytol 140: 125-134
75
Karandashov V, Bucher M (2005) Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends Plant Sci 10: 22-29
Kariman K, Barker SJ, Finnegan PM, Tibbett Mark (2012) Dual mycorrhizal
associations of jarrah (Eucalyptus marginata) in a nurse-pot system. Aust J Bot 60:
661-668
Koch JM (2007) Alcoa’s mining and restoration process in South Western Australia.
Rest Ecol 15: S11-S16
Koch JM, Samsa GP (2007) Restoring jarrah forest trees after bauxite mining in
Western Australia. Rest Ecol 15: S17–S25
Kope HH, Warcup JH (1986) Synthesised ectomycorrhizal associations of some
Australian herbs and shrubs. New Phytol 104: 591–599
Lambers H, Shane MW (2007) Role of root clusters in phosphorus acquisition and
increasing biological diversity in agriculture. In: Spiertz JHJ, Struik PC, van Laar
HH (eds) Scale and complexity in plant systems research: Gene-plant-crop
relations. Springer, Dordrecht, Netherlands, pp 237–250
Lambers H, Mougel C, Jaillard B, Hinsinger P (2009) Plant-microbe-soil interactions in
the rhizosphere: an evolutionary perspective. Plant Soil 321: 83-115
Lambers H, Brundrett MC, Raven JA, Hopper SD (2010) Plant mineral nutrition in
ancient landscapes: high plant species diversity on infertile soils is linked to
functional diversity for nutritional strategies. Plant Soil 334: 11–31
Lambers H, Finnegan PM, Laliberté E, Pearse SJ, Ryan MH, Shane MW, Veneklaas EJ
(2011) Phosphorus nutrition of Proteaceae in severely phosphorus-impoverished
soils: are there lessons to be learned for future crops? Plant Physiol 156: 1058-1066
Landeweert R, Hofflund E, Finlay RD, Breeman N (2001) Linking plants to rocks:
Ectomycorrhizal fungi mobilize nutrients from minerals. Trends Ecol Evol 16: 248-
254.
Li HY, Zhu YG, Marschner P, Smith FA, Smith SE (2005) Wheat responses to
arbuscular mycorrhizal fungi in a highly calcareous soil differ from those of
clover, and change with plant development and P supply. Plant Soil 277: 221-232
Liu H, Trieu AT, Blaylock LA, Harrison MJ (1998) Cloning and characterization of
two phosphate transporters from Medicago truncatula roots: Regulation in response
to phosphate and to colonisation by arbuscular mycorrhizal (AM) fungi. Mol Plant
Microbe Interact 11: 14-22
Neumann R (1959) Relationships between Pisolithus tinctorius (Mich. ex. Pers) Coker
et Couch. and Eucalyptus camaldulensis Dehn. Bull Res Counc Zsr Sect D Bot 7:
116-120
Parks SE, Haigh AM, Creswell GC (2000) Stem tissue phosphorus as an index of the
phosphorus status of Banksia ericifolia L. Plant Soil 227: 59-65
76
Rosewarne GM, Barker SJ, Smith SE, Smith FA, Schachtman DP (1999) A
Lycopersicon esculentum phosphate transporter (LePT1) involved in phosphorus
uptake from a vesicular-arbuscular mycorrhizal fungus. New Phytol 144: 507-516
Runge-Metzger A (1995) Closing The Cycle: Obstacles To Efficient P Management
For Improved Global Food Security. in SCOPE 54 -Phosphorus in the Global
Environment -Transfers, Cycles and Management
Sanchez PA, Buol SW (1975) Soils of the tropics and the world food crisis. Science
188: 598-603
Shane MW, Szota C, Lambers H (2004a) A Root trait accounting for the extreme
phosphorus sensitivity of Hakea prostrata (Proteaceae). Plant Cell and Environ 27:
991-1004
Shane MW, McCully ME, Lambers H (2004b) Tissue and cellular phosphorus storage
during development of phosphorus toxicity in Hakea prostrata (Proteaceae). J Exp
Bot 55: 1033-1044
Smaling E (2005) Harvest for the world, Inaugural address, International Institute for
Geo-Information Science and Earth Observation, 2 November 2005, Enschede, The
Netherlands
Smith SE, Read DJ (2008) Mycorrhizal symbiosis. 3rd
ed Academic Press, London UK
Smith SE, Smith FA, Jakobsen I (2003) Mycorrhizal fungi can dominate phosphate
supply to plants irrespective of growth responses. Plant Physiol 133: 16-20
Smith SE, Smith FA, Jakobsen I (2004) Functional diversity in arbuscular mycorrhizal
(AM) symbioses: the contribution of the mycorrhizal P uptake pathway is not
correlated with mycorrhizal responses in growth or total P uptake. New Phytol 162:
511-524
Specht RL (1981) Nutrient release from decomposing leaf litter of Banksia ornata,
Dark Island heathland, South Australia. Aust J Ecol 6: 59-63
Specht RL, Conner DJ, Cliford HT (1977) The heath-savanna problem: the effect of
fertilizer on sand-heath vegetation of North Stradbroke Island, Queensland. Aust J
Ecol 2: 179-186
Specht RL, Groves RH (1966) A comparison of phosphorus nutrition of Australian
heath and introduced econimic plants Aust J Bot 14: 201-221
Stockinger H, Walker C, Schussler A (2009) 'Glomus intraradices DAOM197198', a
model fungus in arbuscular mycorrhiza research, is not Glomus intraradices. New
Phytol 183: 1176-1187
Thomson BD, Grove TS, Malajczuk N, Hardy GESJ (1994) The effectiveness of
ectomycorrhizal fungi in increasing the growth of Eucalyptus globulus Labill. in
relation to root colonisation and hyphal development in soil. New Phytol 126: 517-
524
77
Thomson VP, Leishman MR (2004) Survival of native plants of Hawkesbury
Sandstone communities with additional nutrients: effect of plant age and habitat.
Aust J Bot 52: 141-147
Trolove SN, Hedley MJ, Kirk GJD, Bolan NS, Loganathan P (2003) Progress in
selected areas of rhizosphere research on P acquisition. Aust J Soil Sci 41: 471–499
Warcup JH, McGee PA (1983) The mycorrhizal associations of some Australian
Asteraceae. New Phytol 95: 667-672
78
79
Chapter 5
Symbiotic associations and response of jarrah (Eucalyptus
marginata) to phosphate, phosphite and arsenate toxicities
Khalil Kariman1,2
, Susan J. Barker2,3
, Ricarda Jost2 Patrick M. Finnegan
2,3and Mark
Tibbett1,4
1School of Earth and Environment, The University of Western Australia, Crawley, WA
6009, Australia
2School of Plant Biology, The University of Western Australia, Crawley, WA 6009,
Australia
3Institute of Agriculture, The University of Western Australia, Crawley, WA 6009,
Australia
4Department of Environmental Science and Technology (B37), School of Applied
Sciences, Cranfield University, Cranfield, Bedfordshire, MK 43 OAL, England
Jarrah (Eucalyptus marginata) is an Australian native tree with the capacity to form
arbuscular mycorrhizal (AM), ectomycorrhizal (ECM) and novel symbiotic
associations during its life cycle. Many plant species adapted to P-impoverished soils
including jarrah develop toxicity symptoms upon exposure to high doses of phosphate
(Pi) and its analogues. The present study was undertaken to investigate the effects of
Scutellospora calospora (AM), Scleroderma sp. (ECM) and Austroboletus occidentalis
(novel symbiosis) on response of jarrah to highly toxic pulses (1.5 mmol kg-1
soil) of
Pi, phosphite (Phi) and arsenate (AsV). The AM colonisation of jarrah plants declined
after 14 weeks growth, which is a common phenomenon occurring in early stages of
AM-eucalypt symbioses. However, addition of Pi and Phi pulses reversed this natural
trend, with the AM colonisation increasing after four weeks by six-fold and two-fold,
respectively, compared to untreated AM plants. There was no root colonisation for
either Scleroderma sp. or A. occidentalis treatments. However, all inoculated plants had
significantly higher shoot and root dry biomass and shoot P content under P-deficient
conditions compared to non-mycorrhizal (NM) plants indicating that both non-AM
fungi used novel symbiotic pathway that did not involve colonisation. Tolerance to Pi
toxicity was only observed for the AM treatment while all fungal treatments could
induce tolerance against the Phi toxicity. The induced Pi tolerance was not correlated
with lower shoot P concentration or content of AM plants while the Phi tolerance was
80
achieved because of lower Phi uptake in all inoculated plants. All plants were dead a
week after the AsV pulse even though inoculated plants had significantly lower shoot
As concentration than NM controls. The expression profile of plant high affinity
phosphate transporter (PHT1 family) genes was not altered in response to any of the
fungal species tested. Interestingly, the transcript abundance for four PHT1 genes
(EmPHT1;1, EmPHT1;2, EmPHT1;3 and EmPHT1;4) increased in roots of NM plants
in response to the toxic Pi dose and the transcript abundance for three genes
(EmPHT1;1, EmPHT1;3 and EmPHT1;4) increased in response to the toxic Phi and
AsV doses. Our findings support the hypothesis that P-sensitive species are not able to
down-regulate the expression of their PHT1 genes when exposed to high P conditions
and expression of some PHT1 genes actually increases.
Introduction
Phosphorus (P) deficiency is common in many soils around the world including
Australia, Sub-Saharan Africa, tropical regions in Asia and South America (Sanchez
and Buol, 1975; Runge-Metzger, 1995; Handreck et al., 1997; Trolove et al., 2003;
Smaling, 2005). Adaptation to low P soils could potentially be linked to P sensitivity
across native plant communities. Many Australian native species develop phytotoxicity
symptoms when exposed to high levels of phosphate (Pi) and its analogues such as
phosphite (Phi) and arsenate (AsV) (Handreck, 1997; Howard et al., 2000; Barrett,
2001; Tynan et al., 2001; Smith et al., 2003; Shane et al., 2004; Thomson and
Leishman, 2004; Hawkins et al., 2008). reads: According to Handreck (1997), an Olsen
extractable P concentration (inorganic plus organic P in the extract) of about 20 mg P
kg-1
soil is lethal to the seedlings of P-sensitive native species.
Inorganic Pi is the primary source of P that plants uptake. Phosphite, which is
currently the only available treatment to effectively combat Phytophthora cinnamomi
‘dieback’ in plants (Dell et al., 2005), is generally considered to be a non-metabolizable
form of P as it cannot be assimilated into organic P compounds by plants (Guest and
Grant, 1991). Therefore, application of Phi can result in development of phytotoxicity
reactions in plants (Sukarno et al., 1993, 1996, 1998; Ticconi et al., 2001; Varadarajan
et al., 2002). However, there are also reports showing positive nutritional effects of Phi
on plants (Jabahi-Hare and Kendrick, 1987; Lovatt and Mikkelsen, 2006), which are
almost certainly due to microbe-mediated oxidation of Phi to Pi in soil (Ohtake et al.,
1996). Arsenate and arsenite (AsIII) are the most common oxidation states of As found
81
in nature. Contamination of groundwater and soil by As compounds is a result of
natural processes such as eruption of volcanoes and erosion of mineral deposits or
anthropogenic activities such as mining, agriculture (application of arsenical pesticides
and herbicides), forestry and drilling (Smith et al., 2003). In the cell, AsV can disturb
the energy production through respiration by substituting for P in the production of
ATP, forming a ADP-As complex that uncouples ATP synthesis (Meharg and Hartley-
Whitaker, 2002; Finnegan and Chen 2012). Phosphite and AsV enter plant roots
through the same mechanism as Pi i.e. Pi transporters of the PHT1 family located in the
plasma membrane of epidermal and root hair cells (Guest and Grant, 1991; Meharg and
Macnair, 1992; Finnegan and Chen, 2012).
The toxicity induced by Pi, AsV and Phi might be affected by soil biological
properties such as mycorrhizas. Symbiotic associations have been shown to induce
tolerance against high P conditions in jarrah (Eucalyptus marginata Donn ex Sm.)
(Kariman et al., 2012). Mycorrhizal fungi have the capability to induce the down-
regulation of PHT1 genes transcript levels in roots (Karandashov and Bucher, 2005).
Therefore, there might be a link between tolerance to Pi, Phi and AsV toxicities in
mycorrhizal plants and the expression of PHT1 genes located in root epidermal cells.
Jarrah plants can form arbuscular mycorrhizal (AM) and ectomycorrhizal (ECM)
associations along with a novel symbiosis involving Basidiomycete fungi, in which
root colonisation does not occur (Kariman et al., in preparation: Chapter 3). ECM and
novel symbioses can substantially improve the growth and nutrition of eucalypts (Jones
et al., 1998; Chen et al., 2000, Kariman et al., 2012; Kariman et al., in preparation:
Chapter 3). However, the AM-eucalypt symbiosis is not always accompanied by
growth and nutritional benefits and the positive responses may depend on the plant-
fungus species combination and origin and also on the experimental conditions (Gomez
et al., 1987; Muchovej and Amorim, 1990; Jones et al., 1998; Chen et al., 2000;
Kariman et al., 2012).
Experiments were conducted to investigate whether the toxic effects of Pi, Phi and
AsV on jarrah could be moderated by mycorrhizal symbioses. We hypothesize that the
expression of plant PHT1 genes (at a transcript level) would be affected by symbiotic
associations or toxicity conditions. To answer these questions we grew jarrah plants
alone or in symbiosis with Scutellospora calospora (Nicol. & Gerd.) (AM),
Scleroderma sp. (ECM) or A. occidentalis (Watling & N.M. Greg.) (novel symbiosis,
Chapter 3) to i) determine the growth and P nutrition of non-mycorrhizal (NM) and
inoculated jarrah plants under P-deficient conditions, ii) clarify the role of selected
82
fungi in inducing tolerance against toxic pulses of Pi, Phi and AsV by monitoring the P
and As uptake after short and long term exposures and iii) quantify the transcript
abundance from five PHT1 genes in jarrah roots in response to different symbiotic
associations or toxic pulses of Pi, Phi and AsV.
Results
Plant biomass
Jarrah seedlings inoculated with each of three fungal species had significantly higher
shoot and root dry biomass compared to NM controls after 18 weeks growth under P-
deficient conditions. There was no significant difference between the shoot or root
biomass among different inoculated treatments.
Fig. 1. Shoot and root dry biomass of jarrah plants after 18 weeks growth under P-
deficient conditions. Bars labelled with different letters are significantly different at p <
0.05. Error bars are SE (n = 3).
Mycorrhizal colonisation
There was no root colonisation for A. occidentalis and Scleroderma sp. treatments
and both fungi used a novel symbiotic pathway as they conferred growth (Fig. 1) and P
nutritional benefits (Fig. 4B, open bars) to the host. For the AM fungus S. calospora,
there was 12 % colonisation after 14 weeks growth, which dropped down to 3 % four
weeks later (Fig. 2). However, four weeks after the Pi and Phi pulses, the AM
colonisation increased by more than six fold (20%) and two fold (7%), respectively,
compared to untreated AM plants. The AsV-treated plants were harvested seven days
after adding the pulse and the colonisation was unchanged from that of untreated AM
plants at 14 weeks (12%). Considering the colonisation results and growth benefits in
b
aa
a
b
a
a a
1.5
1.0
0.5
0.0
0.5
1.0
1.5
Dry
bio
mas
s (g
pla
nt-1
)
Shoot Root
NM Control Scleroderma sp. A. occidentalisS. calospora
83
all inoculated plants, there were only AM (S. calospora) and novel symbioses (A.
occidentalis and Scleroderma sp.) occurring in this experiment.
Fig. 2. The percentage of mycorrhizal colonisation in the AM (S. calospora) treatment.
The root colonisation was measured for untreated plants after 14 and 18 weeks growth
and also for 18-week-old plants which were exposed to Pi (closed bar) or Phi (grey bar)
pulses for four weeks or 15-week-old plants that had been exposed to AsV (steriped
bar) for one week. Error bars are SE (n = 3).
Tolerance to phosphate, phosphite and arsenate toxicities
There were no toxicity symptoms in the set of NM seedlings, which were not exposed
to Pi, Phi or AsV pulses. Tolerance to a normally toxic pulse of Pi was only observed
for the AM plants, which had significantly lower toxicity ranks compared to NM plants
one week and four weeks after adding the Pi pulse (Fig. 3A and B). When a toxic pulse
of Phi was applied, slight toxicity symptoms were observed in all treatments one week
after the pulse. At that point the phytotoxicity ranks did not differ significantly between
treatments. Four weeks after the Phi pulse, however, all inoculated plants had
significantly lower toxicity symptoms compared to NM plants. There was no tolerance
against the AsV toxicity, regardless of mycorrhizal status, and all plants had died
within a week after the pulse.
0
5
10
15
20
25
Untreated 14 weeks
Untreated 18 weeks
Phosphate 18 weeks
Phosphite 18 weeks
Arsenate 15 weeks
Per
cen
tag
e o
f A
M c
olo
niz
atio
n
84
Fig 3. Phytotoxicity ranks of jarrah plants exposed to toxic pulses of Pi, Phi and AsV
one week (A) and four weeks (B) after the pulse. For each treatment, bars labelled with
different letters are significantly different at p < 0.05. Error bars are SE (n = 3).
Shoot P concentration and content in the phosphate treatment
AM plants had significantly higher shoot P concentration compared to other
treatments one day before exposure to the toxic Pi pulse (Fig. 4A, open bars). One day
after the pulse, all inoculated plants had significantly lower shoot P concentration than
NM plants (Fig. 4A, checkered bars). Four weeks after the Pi pulse, AM plants had
significantly higher shoot P concentration than NM controls (Fig. 4A, closed bars)
while there was no significant difference in shoot P concentration between both
Scleroderma sp. and A. occidentalis treatments and NM controls (Fig. 4A, closed bars).
All three fungal species could enhance the shoot P content of plants under P-deficient
conditions compared to NM controls (Fig. 4B, open bars). A day after the Pi pulse, all
plants had nearly the same shoot P content (Fig. 4B, checkered bars). All inoculated
plants had significantly higher shoot P content than NM controls four weeks after
adding the Pi pulse (Fig. 4B, closed bars).
Shoot P concentration and content in the phosphite treatment
There was no significant difference between the shoot P concentrations among
treatments one day after the Phi pulse (Fig. 4C, checkered bars). Four weeks after the
pulse, all inoculated plants had significantly lower shoot P concentration than NM
controls (Fig. 4C, closed bars). The results also revealed that the uptake of Phi is much
slower than Pi as the shoot P concentration of NM plants was less than half of the Pi
treatment during the same exposure periods (1 day and 4 weeks after the pulse).
The A. occidentalis inoculated plants had significantly higher shoot P content than
NM controls after one day of exposure to the Phi pulse (Fig. 4D, checkered bars) while
S. calospora and Scleroderma sp. treatments had slightly (not significant) higher P
a
a
a
b
a
a
a
a
aa
a
a
0
1
2
3
4
5
Phosphate Phosphite Arsenate
Phy
toto
xic
ity r
ank
NM Control S. calospora Scleroderma sp. A. occidentalisA
aa
b
b
a
b
a
b
0
1
2
3
4
5
Phosphate Phosphite
Phyto
toxic
ity r
ank
NM Control S. calospora Scleroderma sp. A. occidentalisB
85
contents than NM plants. After longer exposure to the pulse (4 weeks), the shoot P
content did not differ significantly across treatments (Fig. 4D, closed bars).
Shoot As concentration and content in the arsenate treatment
All inoculated plants had significantly lower shoot As concentration compared to NM
controls one day and one week after addition of the AsV pulse (Fig. 4E). Inoculated
plants also had lower As content one day after adding the AsV pulse compared to NM
controls (Fig. 4F). However, all plants were dead a week later and there was no
significant difference in shoot As content between treatments.
86
Fig. 4. Phosphorus and As uptake of NM and inoculated jarrah plants. A and B: shoot P
concentration and content of plants one day before (open bars), one day after
(checkered bars) and four weeks after (closed bar) the Pi pulse. C and D: shoot P
concentration and content one d before (open bars), one day after (checkered bars) and
four weeks after (closed bars) the Phi pulse. E and F: shoot As concentration and
content after one day (checkered bars) and one week (closed bars) exposure to the AsV
pulse. Bars labelled with different letters are significantly different at p < 0.05. Error
bars are SE (n = 3).
b a b b
ab b b
b
a ab
ab
0
2
4
6
8
10
12
14
16
18
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oo
t P
co
nce
ntr
atio
n
(mg
g-1
DW
)
A
c a b b
a a a a
b
aa
a
0
2
4
6
8
10
12
14
16
18
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oo
t P
co
nte
nt (m
g p
lan
t-1)
B
ba
b b
aa a a
a
b
b
b
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oo
t P
co
nce
ntr
atio
n(m
g g
-1D
W)
C
c
ab b
bab ab
a
a a
a
a
0
0.5
1
1.5
2
2.5
3
3.5
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oot P c
on
ten
t (m
g p
lan
t-1)
D
a b b b
a
b bb
0500
100015002000250030003500400045005000
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oo
t As
con
cen
trat
ion
(µg
g-1
DW
)
E
ab b b
a
a
a a
0
500
1000
1500
2000
2500
NM Control S. calospora Scleroderma sp. A. occidentalis
Sh
oo
t As
con
ten
t (µ
g p
lan
t-1)
F
87
Shoot free Pi concentration
The shoot free Pi concentration was measured to reveal any possible correlation with
the Pi and Phi tolerance observed four weeks after the corresponding pulses (Fig. 5).
Similar to the shoot total P results, the AM plants had the highest free Pi concentration
in their shoot tissues four weeks after the Pi pulse (Fig. 5A). The shoot free Pi
concentration in the Scleroderma sp. treatment was also higher than NM controls while
the A. occidentalis treatment had nearly the same free Pi as NM plants. The difference
between shoot total P and free Pi was less than 3 mg P g-1
DW, which could be
attributed to organic P compounds.
Four weeks after the Phi pulse, NM plants had the highest shoot free Pi concentration
similar to the total P concentrations (Fig. 5B). The detection of a relatively high
proportion of free Pi inside the shoot tissues of the Phi-treated plants shows that a
portion of the Phi has been oxidised to Pi in soil or inside the plant tissues.
Response of EmPHT1 transcript abundance to mycorrhiza and toxicity conditions
The transcript abundance from five jarrah EmPHT1 genes was quantified in 14-week-
old plants prior to addition of the toxic pulses (Fig. 6A). Jarrah plants did not down-
regulate the transcript abundance from these five EmPHT1 genes in response to any of
the fungal treatments.
The transcript abundance of the five EmPHT1 genes was quantified in NM plants one
day after addition of the different toxic pulses (Fig. 6B). None of the EmPHT1 gene
transcripts were reduced in abundance in response to addition of Pi, Phi or AsV.
Interestingly, transcript abundance for certain EmPHT1 genes was increased under
toxicity conditions. Jarrah plants accumulated significantly more transcripts for
EmPHT1;1, EmPHT1;2, EmPHT1;3 and EmPHT1;4 in response to Pi and EmPHT1;1,
EmPHT1;3 and EmPHT1;4 in response to Phi and AsV pulses.
88
Fig. 5. Shoot free Pi concentration of jarrah plants. Concentration of free Pi inside the
shoot tissues four weeks after the Pi (A) and Phi (B) pulses. Bars labelled with different
letters are significantly different at p < 0.05. Error bars are SE (n = 3).
Fig. 6. Transcript abundance from five EmPHT1 genes in jarrah roots relative to an
internal reference gene (EmACT1) determined by real-time PCR. A: transcript
abundance from EmPHT1 genes in response to three different fungal species. B:
transcript abundance from EmPHT1 genes in NM plants under normal conditions
(closed bars) or one day after addition of Pi (checkered bars), Phi (striped bars) and
AsV (gray bars) pulses. The scale on the vertical axis is a log2 scale based on ΔCt (the
threshold cycle (Ct) of the target EmPHT1 gene minus the Ct of the reference gene). A
difference of one Ct value corresponds to a 2-fold difference in transcript abundance.
Bars with different letters are significantly different at p < 0.05. Error bars are SE (n =
3).
c
aab
bc
0
2
4
6
8
10
12
14
16
NM Control S. calospora Scleroderma sp. A. occidentalis
Shoot fr
ee P
concentr
ati
on
(mg P
g-1
DW
)A
a
bb
b
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
NM Control S. calospora Scleroderma sp. A. occidentalis
Shoo
t fr
ee P
concentr
ati
on
(mg P
g-1
DW
)
B
a a
a
a
a
aa
a
a
a
aa
a
a
a
a a
a
a
a
30
35
40
45
50
EmPHT1;1 EmPHT1;2 EmPHT1;3 EmPHT1;4 EmPHT1;5
Rela
tiv
e e
xp
ressio
n (4
0-Δ
Ct)
NM Control S. calospora Scleroderma sp. A. occidentalisA
b b
b
c
a
a a
a
b
a
a
b a
aa
a
b a
ab
a
30
35
40
45
50
EmPHT1;1 EmPHT1;2 EmPHT1;3 EmPHT1;4 EmPHT1;5
Rela
tive e
xpre
ssio
n (4
0-Δ
Ct)
Untreated Phosphate Phosphite ArsenateB
89
Discussion
Plant biomass
Inoculation of jarrah with S. calospora, Scleroderma sp. or A. occidentalis
significantly enhanced the shoot and root dry biomass compared to NM controls (Fig.
1) as observed in previous experiments (Kariman et al., 2012; Kariman et al., in
preparation: Chapter 3). In our previous study, both basidiomycete treatments
(Scleroderma sp. or A. occidentalis) had significantly higher shoot biomass than the
AM treatment S. calospora (Kariman et al., 2012). However, in the present work there
was no significant difference between the shoot biomass in different inoculated
treatments. Plants colonised by the AM fungus S. calospora performed much better
than in our previous work in terms of both biomass production and P nutrition under P-
deficient conditions (see below). Variable results including positive, neutral or negative
physiological responses have been documented for eucalypts associated with different
AM fungi (Gomez et al., 1987; Muchovej and Amorim, 1990; Adjoud et al., 1996;
Kariman et al., 2012). However, in our previous work (Kariman et al., 2012) there were
four seedlings in each nurse-pot, which might have caused a competition between
seedlings leading to a slighter positive growth response compared to the present work
having one seedling per pot.
Mycorrhizal colonisation
The A. occidentalis isolate established a novel symbiotic association with jarrah
plants where a growth benefit occurred without root colonisation, as was also observed
previously (Kariman et al., 2012; Kariman et al., in preparation: Chapter 3). In the
earlier study, the ECM isolate Scleroderma sp. formed a classic ECM colonisation only
in one replicate. Two other replicates did not colonise roots and behaved like the A.
occidentalis treatment (Kariman et al., 2012). Here again, in the present study,
Scleroderma sp. behaved like A. occidentalis and did not form mycorrhizal structures
in any of three replicates. These two fungi always provided clear growth and nutritional
benefits regardless of their colonisation ability (Kariman et al., 2012; Kariman et al., in
preparation: Chapter 3). We accordingly suggest Scleroderma sp. as a fungus with dual
functional capacity, sometime behaving like a typical ECM fungus and sometimes
establishing the novel symbiotic association like A. occidentalis.
Our experiments were carried out in an unheated glasshouse. The temperature
dropped down to 6 and 7 ºC in the night time in our nurse-pot study (Kariman et al.,
2012; Chapter 2) and the present work, respectively, and only one replicate (out of 6)
90
formed ECM colonisation with jarrah roots. However, in our preliminary experiment
(data not shown) and 33
P experiment (Kariman et al., in preparation: Chapter 3) the
minimum temperatures were 14 and 18 ºC, and under those conditions Scleroderma sp.
formed ECM colonisation in all six replicates. Hence, there might be a correlation
between temperature and the dual behaviour of Scleroderma sp. The temperature drop
to below 10 ºC could be a potential signal for the fungus to establish a novel symbiotic
association. Regardless of what drives this dual behaviour, the colonisation results from
our current and previous experiments (Kariman et al., 2012, Chapter 2; Kariman et al.,
in preparation: Chapter 3) revealed that the novel symbiotic association is an alternative
pathway for ECM fungi to provide a benefit to the host plant. In other words, putative
ECM fungi such as Scleroderma sp. have the potential to establish both novel
symbiotic and ECM associations during their symbiotic life cycle. It will be interesting
to determine if similar benefits are gained by other so-called ‘non-mycorrhizal’ plant
species when grown in the company of such fungi.
The AM colonisation of jarrah plants by S. calospora declined after 14 weeks growth
(Fig. 2), which is in line with the existing literature about AM-eucalypt symbioses,
which shows that AM colonisation decreases after seedlings have grown for a while
and is replaced by ECM colonisation (Chen et al., 2000, Adams et al., 2006). Addition
of Pi often leads to a decrease in mycorrhizal colonisation (Jasper and Davy, 1993;
Bobbink, 1998; Cornwell et al., 2001) although other studies show that AM
colonisation was enhanced (Bolan et al., 1984) or it was not affected in higher Pi
conditions (Duke et al., 1994; Kabir et al., 1997). However, in the present study, four
weeks after the addition of the Pi and Phi pulses, the AM colonisation increased by six-
fold and two-fold, respectively, compared to untreated AM plants. Both P sources (Pi
and Phi) somehow reduced the drop in colonisation. Accordingly, we hypothesize that
three-month-old seedling eucalypts do not suppress their AM relationships if they
receive enough or even toxic levels of P.
Inconsistent results have been reported for the effects of Phi treatment on AM
colonisation. Similar to our results, an increase in AM colonisation has been reported
for plant species such as Agonis flexuosa (Howard et al., 2000), leek (Jabahi-Hare and
Kendrick, 1987) and lettuce (Clarke, 1978) after Phi application. The increased AM
colonisation in Phi-treated plants has been attributed to differences in host nutritional
uptake or altered root metabolism (Jabahi-Hare and Kendrick, 1987; Howard et al.,
2000). However, there are some other reports showing that Phi application decreased
AM colonisation in plants such as maize (Seymour et al., 1994) and onion (Sukarno,
91
1996, 1998). The negative effects of Phi on mycorrhizal colonisation have been
attributed to accumulation of Phi near root tips (Guest and Grant, 1991) resulting in
damage to fine roots and consequently reduction of sites for AM and ECM formation
(Howard et al., 2000). Clearly more research is required to better understand the
responses of plants to Phi, especially the consequence of this treatment to plants
growing in natural habitats.
P uptake under P-deficient conditions
All inoculated plants had significantly higher shoot P content than NM plants under
P-deficient conditions (Fig. 4 B, open bars). In our previous study, the AM jarrah plants
(S. calospora) had slightly higher shoot P content than NM plants but the difference
was not statistically significant (Kariman et al., 2012). Here, S. calospora behaved
extraordinary well compared to our previous study by having the highest shoot P
content among treatments. The EmPHT1 transcript results might clarify the high
performance of S. calospora in terms of P uptake as this AM fungus did not reduce the
expression of any jarrah EmPHT1 genes. Therefore, the shoot P content of the AM
plants might have come from both direct (plant roots) and indirect (mycorrhizal)
pathways but the actual contribution of each pathway is not clear and warrants
additional study.
Tolerance to phosphate toxicity and Pi uptake dynamics
The Pi pulse applied was 1.5 mmol kg-1
soil (equal to 46 mg P kg-1
soil) and Pi
tolerance was only observed for the AM treatment (Fig. 3 A and B). The other two
fungal treatments (Scleroderma sp. and A. occidentalis) did not induce Pi tolerance in
the present study while they were able to induce tolerance against a lower Pi pulse of
30 mg P kg-1
soil (Kariman et al., in preparation: Chapter 4). All inoculated plants in
the present study had significantly lower shoot P concentration than NM plants one day
after the Pi pulse. This was correlated with the higher shoot biomass of inoculated
plants resulting in P dilution within shoot tissues designated as the “dilution effect”.
Interestingly, AM plants had the highest shoot P concentration (about 15 mg P g-1
DW)
four weeks after adding the Pi pulse and still showed the lowest toxicity symptoms
among treatments. Therefore, the Pi tolerance in AM plants is not necessarily
correlated with lower shoot P concentration.
Plants inoculated with Scleroderma sp. and A. occidentalis had lower toxicity
symptoms upon exposure to a lower Pi pulse of 30 mg P kg-1
soil (Kariman et al., in
92
preparation: Chapter 4), probably because their shoot P concentrations (less than 7.5
mg P g-1
DW) were about 20 % less than in NM plants. In the present experiment,
however, there was no Pi tolerance for these treatments. Plants received a higher pulse
(46 mg P kg-1
soil) and the shoot P concentration was more than 12 mg P g-1
DW. We
thus conclude that the Pi tolerance in both Scleroderma sp. and A. occidentalis
treatments (ECM and novel symbioses) that was previously reported (Kariman et al., in
preparation: Chapter 4) was due to dilution effects and can be seen at Pi pulses of less
than 30 mg P kg-1
under these experimental conditions. Moreover, all the inoculated
plants had significantly higher shoot P content than NM controls four weeks after the Pi
pulse indicating that symbiotic associations do not cause jarrah plants to reduce their
net P uptake under Pi toxicity conditions.
One possible mechanism for the induced P tolerance could be that AM plants have
the ability to assimilate inorganic P into organic pools and therefore do not accumulate
free Pi, which causes toxicity symptoms. Therefore, the shoot free Pi concentration of
plants was measured to test this hypothesis. The results were almost similar to those of
shoot total P and AM plants had the highest free Pi concentration within their shoot
tissues among treatments (Fig. 5 A). The difference between shoot total P and free P
was less than 3 mg P g-1
DW, which presumably derive from organic P compounds.
Therefore, the Pi tolerance in AM jarrah plants is not linked with the plants ability to
quickly assimilate inorganic P into organic P pools. Plant species have been shown to
reduce the expression of their PHT1 genes in response to AM (Karandashov and
Bucher, 2005) and ECM (Loth-Pereda et al., 2011) colonisation. However, this is not
apparently the mechanism for the induced Pi tolerance in AM jarrah plants as we did
not observe the reduced transcript abundance for any of the five PHT1 genes tested.
Other potential mechanisms could be involved such as accumulation of inorganic P in
the stem tissues or sequestration of Pi molecules in vacuoles to avoid their interference
with normal cell functions. However, it is not clear how such a difference in
mechanisms of nutrient storage might be determined given that the symbiotic fungi are
contained in the root system.
Tolerance to phosphite toxicity and Phi uptake dynamics
From a plant perspective, Phi is a non-metabolizable form of P (Guest and Grant,
1991) and the positive nutritional effects of Phi on plants (Jabahi-Hare and Kendrick,
1987; Lovatt and Mikkelsen, 2006) are most likely due to microbe-mediated oxidation
of Phi to Pi in soil (Ohtake et al., 1996) and/or suppression of plant diseases (Thao and
93
Yamakawa, 2009). Here, there were slight phytotoxicity symptoms in all plants a week
after the Phi pulse (Fig. 3 A) and the shoot P concentrations did not differ significantly
between treatments (Fig. 4 C). Four weeks after the pulse, the shoot P concentration of
jarrah plants was significantly less in all the fungal species treatments than the NM
control (Fig. 4 C), which is apparently correlated with the reduced phytotoxicity
symptoms in all inoculated plants (Fig. 3 B). The results also showed that the uptake of
Phi is much slower than Pi in NM plants as the P concentration was nearly half that of
the comparable Pi treatment. Furthermore, there was no significant difference between
the shoot P content of plants 4 weeks after the Phi pulse. This means that inoculated
plants with higher shoot biomass had the same shoot P content as NM plants indicating
lower net Phi uptake in inoculated plants. Interestingly, this reduction of uptake did not
occur in the Pi treatment and all inoculated plants had significantly higher shoot P
content than NM plants. This suggests that both AM and novel symbiotic associations
can differentiate Phi (a toxic P source) from Pi (metabolizable P source) and
consequently reduce the Phi uptake of plants. It is possible that the PHT1 gene
expression difference observed for EmPHT1;2 between these two treatments (Figure
6B) may provide an explanation for the differences observed. Further analysis of the
temporal and spatial expression of this particular PHT1 gene family member is
warranted.
The shoot free Pi concentration was also determined in plants exposed to the Phi
pulse for four weeks. This was done to see if mycorrhizal fungi can oxidise Phi to Pi in
the soil as a potential mechanism for the Phi tolerance observed. The results did not
support this hypothesis as NM plants had the highest free Pi concentration similar to
the shoot total P results (Fig. 5 B). This might mean that these fungal species are not
involved in oxidation of Phi to Pi in the soil. The free Pi concentration of plants (mg P
g-1
DW) was about 20% of shoot total P. Accordingly, about 80% of shoot total P
comes from Phi molecules (and organic P compounds) and about 20% comes from
shoot free Pi suggesting that plants exposed to the Phi pulse took up more intact
molecules of Phi than the oxidised form (Pi) from soil.
There was a relatively high proportion of Pi (about 20% of shoot total P) in shoots of
all Phi-treated plants, which was higher than shoot total P in untreated plants (Fig. 4A,
open bars). This suggests that the Phi addition has somehow increased the Pi pool in
plants. One possible mechanism is oxidation of Phi to Pi either within plant tissues or
in the soil. All inoculated treatments had significantly lower concentrations of shoot
total P (mainly originated from Phi molecules) and free Pi than NM controls suggesting
94
that this trend might be correlated with the uptake feature and soil is the primary source
of Pi molecules where the Phi oxidation occurred.
Tolerance to arsenate toxicity and AsV uptake dynamics
Mycorrhizal fungi can induce tolerance against the AsV toxicity by mechanisms such
as reducing AsV to AsIII, binding of phytochelatins to As to make peptide-metal
complexes, accumulation inside fungal vacuoles and down-regulation of plant high
affinity PHT1 genes (Meharg and Macnair, 1992; Sharples et al., 2000; Hildebrandt et
al., 2007). Although the induced tolerance to As toxicity can be due to the improved
growth and Pi uptake (Ahmed et al., 2006; Xu et al., 2008; Christopherson et al., 2009),
the As tolerance have also been observed where AM symbioses do not enhance growth
or Pi nutrition of host plants (Li et al., 2006; Grace et al., 2009). In the present study,
there was no tolerance against the AsV toxicity in terms of reducing the phytotoxicity
symptoms and all plants were dead a week after adding the pulse (Fig. 3 A), apparently
due to higher toxicity of AsV than Pi and Phi molecules. The average As toxicity
threshold for crop plants is about 40 µg g-1
DW (Sheppard et al., 1992), which is far
below the concentrations observed in this experiment and the apparent reason for death
of all treated jarrah plants. The results, however, showed that different fungal
treatments can reduce the shoot As concentration upon exposure to AsV toxicity.
Although one week later, the shoot As content of plants did not differ significantly
across treatments, inoculated plants had lower shoot As content one day after adding
the AsV pulse compared to NM controls (Fig. 4 B). It seems that inoculated plants
reduce their net AsV uptake similar to the other toxic analogue (Phi) as they had higher
shoot biomass but nearly the same shoot As content as NM plants. Here, we did not
observe the reduced transcript abundance of plant PHT1 genes under AsV toxicity
conditions so the reduced As uptake in inoculated plants might be due to one of the
other mechanisms mentioned above, or the changed function of additional PHT1 gene
family members that were not identified in this study. Jarrah plants received the same
concentration (1.5 mmol kg-1
soil) of Pi, Phi and AsV but developed different extents
of phytotoxicity symptoms. Our results demonstrate that AsV is the most toxic
analogue and Pi and Phi are the second and third most toxic analogues, respectively.
AM symbioses can reduce sen
95
The transcript abundance of EmPHT1 genes in non-mycorrhizal and inoculated plants
We are aware of five PHT1 genes in E. marginata, although there are likely to be
additional genes, based on the situation in other plants. The abundance of transcripts
from several jarrah EmPHT1 genes was quantified by real time PCR for 14-week old
plants prior to addition of different pulses, to determine if there was a correlation with
symbiotic associations. Down-regulation of PHT1 genes can occur in mycorrhizal roots
regardless of the soil P status (Karandashov and Bucher, 2005) and we therefore did not
quantify PHT1 transcripts in inoculated plants subjected to the pulses. Jarrah plants did
not reduce the expression of their PHT1 genes in response to any of fungal species
tested which were representatives of AM and novel symbioses (Fig. 6 A).
The expression profile of PHT1 genes is not altered in roots of plants harbouring the
novel symbiosis (Kariman et al, in preparation: Chapter 3). In our previous study,
Scleroderma sp. behaved like a typical ECM fungus having a high colonisation rate of
77 % and two PHT1 genes (EmPHT1;1 and EmPHT1;2) had significantly lower
transcripts in ECM roots than NM controls. Recently, Loth-Pereda et al. (2011) have
shown that poplar plants reduce the expression of two PHT1 genes in response to both
AM and ECM symbioses. However, in the present study Scleroderma sp. used the
novel symbiotic pathway (no colonisation) and the expression of PHT1 genes was not
affected.
Surprisingly, jarrah plants did not down-regulate their PHT1 gene transcripts in
response to the AM fungus S. calospora. Many plants species down-regulate the
expression of their PHT1 genes in response to AM colonisation (Karandashov and
Bucher, 2005). However, there are exceptions where gene expression was not affected.
Burleigh reported (2001) the reduced expression of the PHT1 gene MtPT2 in Medicago
trancatula following colonisation with the AM fungi Glomus versiforme, G.
intraradices, G. caledonium and G. claroideum, G. mosseae and S. calospora but not
with Gigaspora rosea. This lack of down-regulation response in certain AM symbioses
has been attributed to the inability of the fungal partner to supply P for the host plant
(Burleigh, 2001). Here, S. calospora was quite effective in improving the P nutrition of
jarrah plants under these experimental conditions. Therefore, the lack of down-
regulation response for plant PHT1 genes is not necessarily correlated with the inability
of the AM fungi to supply P for their host plants. However, the PHT1 family can
contain a large number of genes including 9 PHT1 genes in Arabidopsis thaliana
(Muchhal et al., 1996) and 13 genes in Oryza sativa (Paszkowski et al., 2002; Glassop et
al., 2007) and 12 PHT1 genes in Populus trichocarpa (Loth-Pereda et al., 2001).
96
Therefore, there might be some unidentified PHT1 gene members in jarrah roots with
different responses to AM symbiosis.
Expression of PHT1 genes in response to phosphate, phosphite and arsenate toxicities
Plant species that are not P sensitive reduce the expression of PHT1 genes in their
roots in response to high P conditions (Burleigh and Harrison, 1999; Rausch and
Bucher, 2002; Grunwald et al., 2009). Conversely, none of the jarrah PHT1 genes that
we examined were reduced in their expression in response to any of the three analogues
tested (Fig. 6 B). In fact, the transcript abundances of some PHT1 genes were increased
under toxicity conditions.
The enhanced transcript abundance of PHT1 genes could have occurred to i) take up
more of these three analogue molecules from soil solution or ii) to facilitate the internal
translocation of the additional target molecules inside plant tissues. As previously
described, the transcripts of EmPHT1;1 and EmPHT1;2 were down-regulated
following the ECM colonisation (Kariman et al., in preparation: Chapter 3), which
could be evidence for involvement of these two genes in the direct pathway (via root
epidermal cells) of P uptake from the soil. Thus, enhanced expression of these two
genes after adding the Pi pulse might mean that jarrah plants actually increase their Pi
uptake from the soil solution under P toxicity conditions. Nevertheless, changed
transcript abundance may not necessarily reflect a change in the activity of the
respective transporter. We therefore suggest that native plants regulate the expression
of their PHT1 genes in response to the external P concentration (soil) rather than the
plant internal P status. Although the P sensitivity of Australian native plants has been
studied well during the past decades, this is the first report showing that native plants
cannot reduce expression of their PHT1 genes upon exposure to a toxic dose of Pi.
Conclusion
Our results showed that the addition of P sources (Pi and Phi) can enhance AM
colonisation, which declined in untreated jarrah plants. All fungal species could
enhance jarrah growth and shoot P content under P-deficient conditions. Symbiotic
associations have the potential to induce tolerance against toxicity caused by Pi, Phi
and probably lower pulses of AsV. Inoculated jarrah plants did not decrease their net Pi
uptake under toxicity conditions, whereas they reduced the uptake of both toxic
analogues (Phi and AsV). The induced tolerance for the plant toxic Pi analogue (Phi)
could be due to the reduced uptake combined with a dilution effect. However, the Pi
97
tolerance is not correlated with lower P uptake in AM plants. Finally, we suggest that
the expression of PHT1 genes in P-sensitive species is regulated by external P
concentration in soil rather than the internal plant P status as jarrah plants up-regulated
some PHT1 transcripts under Pi toxicity.
Materials and Methods
Plant materials, fungal isolates and inoculum production
Jarrah seed capsules were obtained from a single tree near Dwellingup, Western
Australia. Capsules were incubated at 42 ºC for three days to release the seeds. The
three fungal isolates used were S. calospora WUM 12 (3) (AM), Scleroderma sp.
(ECM) and A. occidentalis (novel symbiosis). Details about the fungal isolates,
inoculum production, root staining and colonisation studies were previously described
(Kariman et al., 2012). The AM colonisation was an average value of more than 300
grid intersect observations on three subsamples.
Experimental design and treatments
Jarrah plants were grown alone or in symbiosis with the three fungal isolates.
Fourteen weeks after planting, three replicates from all NM and inoculated treatments
were harvested to analyze the mycorrhizal colonisation and shoot P concentration of
plants. The washed river sand used for plant growth contained less than 6 mg P kg-1
soil
(data not shown) and therefore these plants were considered to have grown under P-
deficient conditions. Plants subsequently received a toxic pulse (1.5 mmol kg-1
soil) of
Pi (KH2PO4), Phi (KH2PO3) or AsV (Na2HAsO4) in aqueous solution. Three replicates
were harvested one day after adding the pulses to monitor the P and As uptake during
the short term exposure. The remaining plants were harvested four weeks after the
pulse except the AsV-treated plants, which were harvested one week after the pulse.
Growth conditions
To prepare the growth medium, double-pasteurized washed river sand was mixed
with AM inoculum (10:1 w/w) and subsequently mixed with ECM inoculum (10:1 v/v).
To provide equal conditions for all treatments, AM and ECM plants were supplied with
sterilized ECM or AM inoculum, respectively. Non-mycorrhizal plants also received
sterilized AM and ECM inocula. Square plastic pots (8 x 8 x 18 cm) were lined with
double plastic bags and filled with 1 kg of the growth medium prepared as described
above. One pre-germinated jarrah seed (Kariman et al., 2012) was planted in each pot
98
and the pot surface was covered with 3 cm of sterile plastic beads to minimise cross or
environmental contaminations. All plants received 1 X modified Long Ashton solution
minus P once a fortnight starting two weeks after planting (10 mL kg-1
soil): K2SO4 2
mM, MgSO4.7H2O 1.5 mM, CaCl2.2H2O 3 mM, FeEDTA 0.1 mM, (NH4)2SO4 4 mM,
NaNO3 8 mM, H3BO3 46 µM, MnCl2.4H2O 9 µM, ZnSO4.7H2O 8 µM, CuSO4.5H2O
0.3 µM and Na2MoO4.2H2O 0.01 µM (Cavagnaro et al., 2001). We used sealed pots for
this experiment and watered them to field capacity three times a week. The experiment
was conducted from February to June 2012 in an unheated glasshouse with the average
daytime temperature of 22 °C.
Nutrient analysis and phytotoxicity assessment
Measured quantities of ground dried shoot tissues (about 200 mg) were digested in
5 ml nitric-perchloric acid solution (4:1 v/v). The shoot total P and As concentrations
were determined using inductively coupled plasma optical emission spectrometry (ICP-
OES; Optima 5300 DV, PerkinElmer, USA). A measured amount (about 40 mg) of
dried ground tissues was homogenized in 1 mL acetic acid and used to measure the
shoot free Pi concentration using the ammonium molybdate method (Ames, 1966).
Phytotoxicity symptoms (including chlorotic and necrotic areas on leaves) were
quantified by ranking plants into six classes from 0 to 5, where 0 corresponded to the
absence of toxicity symptoms; 1 from traces to 20 % of symptomatic leaf tissue area
(SLTA); 2 from 20 to 40 % SLTA; 3 from 40 to 60 % of SLTA; 4 from 60 to 80 % of
SLTA and 5 more than 80 % of SLTA.
Phosphate transporter (PHT) genes and real time PCR
Complementary cDNAs from five EmPHT1 genes were cloned and sequenced from
jarrah roots as previously described (Kariman et al., in preparation: Chapter 3). Total
root RNA was isolated using a CTAB-based method (Korimbocus et al., 2002) with a
slight modification. Sodium D-isoascorbate was added to the extraction buffer just
before use to a final concentration of 100 mM. Total RNA (1.0 µg) was treated with
DNase I (RQ1 RNase-free DNase, Promega, USA) and subsequently reverse
transcribed using the GoScriptTM
reverse transcriptase kit (Promega). Gene specific
primers were designed for five PHT1 genes and a jarrah actin gene (internal control) for
the gene quantification assay (Table 1). The SYBR green-based real-time PCR (q-PCR)
was carried out to quantify the transcripts from PHT1 genes relative to EmACT1
transcripts. Q-PCR reactions were performed in 96-well plates in a 10 µl reaction
99
volume of 0.3 µM of each gene specific primer and 2.5 µl of cDNA equivalent to 50 ng
total RNA in 1x SYBR Green PCR master mix (Applied Biosystems). All q-PCR
experiments were performed on a 7500 FAST Real-time PCR System (Applied
Biosystems).
Statistical analyses
The experiment was conducted in a completely randomized design with three
replicates. All data were analyzed using the Statistical Analysis System (SAS) version
9.2 (SAS Institute, Inc.; Cary NC, USA) software package. Means were separated using
LSD at 5% significance level.
Table 1. Gene specific primers used for real time PCR
Primer Direction Sequence (5’-3’) Product
size (bp)
EmPT1-F Forward GAGCCGTCGAGATGGTGTGTAGA 122
EmPT1-R Reverse CGACTATCTTGCCACTTCCTCCATTGA
EmPT2-F Forward CGATGAGGTGCCCACTGCT 138
EmPT2-R Reverse CACCTGCTCGACGACTCCGTAAT
EmPT3-F Forward CAACAACTTCGGCTTGTTCAGCAGA 183
EmPT3-R Reverse ACTTCCTCAATTGCGTTCATGGTGTC
EmPT4-F Forward TGGACATCGCCTTCTATAGCCAGAATCTT 113
EmPT4-R Reverse GCCCAATCCGGTACACCTCTTCTATG
EmPT5-F Forward GGACGATGAGGTGTCCACTGCTT 127
EmPT5-R Reverse TCTGTAATATTCGGCAACACGGGAAGT
Act2-F Forward GGTCCTGTTCCAACCATCCATGATT 136
Act2-R Reverse GGTAGAACCACCACTGAGGACAATGT
Acknowledgments: We appreciate the University of Western Australia postgraduate
scholarships (SIRF/UIS) awarded to K.K. and also financial support and grants from
the Centre for Land Rehabilitation at the University of Western Australia (M.T.) and
the Australian Research Council (M.T., P.M.F.).
100
Literature Cited
Adams F, Reddell P, Webb MJ, Shipton WA (2006) Arbuscular mycorrhizas and
ectomycorrhizas on Eucalyptus grandis (Myrtaceae) trees and seedlings in native
forests of tropical north-eastern Australia. Aust J Bot 54: 271-281
Adjoud D, Plenchette C, HalliHargas R, Lapeyrie F (1996) Response of 11 eucalyptus
species to inoculation with three arbuscular mycorrhizal fungi. Mycorrhiza 6:129-
135
Ahmed FRS, Killham K, Alexander I (2006) Influences of arbuscular mycorrhizal
fungus Glomus mosseae on growth and nutrition of lentil irrigated with arsenic
contaminated water. Plant Soil 283: 33-41
Ames BN (1966) Assay of inorganic phosphate, total phosphate and phosphatises.
Methods Enzymol 8: 115-118
Barrett S (2001) Phytotoxic effects of phosphite on native plant communities in
southern Western Australia. PhD Thesis. Murdoch University, Perth
Bobbink R (1998) Impacts of tropospheric ozone and airborne nitrogenous pollutants
on natural and semi-natural ecosystems: a commentary. New Phytol 139: 161-168
Bolan NS, Robson AD, Barrow NJ (1984) Increasing phosphorus supply can
increase the infection of plant roots by vesicular-arbuscular mycorrhizal fungi.
Soil Biol Biochem 16: 419-420.
Burleigh SH, Harrison MJ (1999) The down-regulation of Mt4-like genes by phosphate
fertilization occurs systemically and involves phosphate translocation to the shoots.
Plant Physiol 119: 241–248
Burleigh SH (2001) Relative quantitative RT-PCR to study the expression of plant
nutrient transporters in arbuscular mycorrhizas. Plant Sci 160: 899–904
Cavagnaro, TR, Smith FA, Lorimer MF, Haskard KA, Ayling SM, Smith SE (2001)
Quantitative development of Paris type arbuscular mycorrhizas formed between
Asphodelus fistulosus and Glomus coronatum. New Phytol 149:105–113
Chen YL, Brundrett MC, Dell B (2000) Effects of ectomycorrhizas and vesicular–
arbuscular mycorrhizas, alone or in competition, on root colonisation and growth of
Eucalyptus globulus and E. urophylla. New Phytol 146: 545–556
Christophersen HM, Smith SE, Pope S, Smith FA (2009) No evidence for competition
between arsenate and phosphate for uptake from soil by medic or barley. Environ
Int 35: 485–490.
Clarke CA (1978) Effects of pesticides on VA mycorrhizae. Rothamsted Experimental
Station Report for 1978, Part 1: 236-237
Cornwell WK, Bedford BL, Chapin CT (2001) Occurrence of arbuscular mycorrhizal
fungi in a phosphorus-poor wetland and mycorrhizal response to phosphorus
fertilization. Am J Bot 88: 1824–1829
101
Dell B, Hardy GESJ, Vear K (2005) History of Phytophthora cinnamomi management
in Western Australia In MC Calver, H Bigler-Cole, G Bolton, J Dargavel, A
Gaynor, P Horwitz, J Mills, G Wardell-Johnson, Eds, A forest consciousness:
Proceedings of the 6th
National Conference of the Australian Forest History
Society. Millpress Science Publishers, Rotterdam, 391-406
Duke SE, Jackson RB, Caldwell MM (1994) Local reduction of mycorrhizal arbuscle
frequency in enriched soil microsites. Can J Bot 72: 998-1001
Finnegan PM, Chen W (2012) Arsenic toxicity: the effects on plant metabolism. Front
Physiol 3: 182
Glassop D, Godwin RM, Smith SE, Smith FW (2007) Rice phosphate transporters
associated with phosphate uptake in rice colonised with arbuscular mycorrhizal
fungi. Can J Bot 85: 644-651
Gomez TCR, Faria LP, Lin MT (1987) Mycorrhization of eight species of eucalypts
with VAM fungi. In: DM Sylvia, LL Hung, JH Graham (eds) Mycorrhizae in the
next decade: practical applications and research priorities (7th NACOM).
Gainesville University, Florida, p 125
Grace EJ, Smith FA, Smith SE. (2009) Deciphering the arbuscular mycorrhizal
pathway of P uptake in non-responsive hosts. In: Azco´n-Aguilar C, Barea JM,
Gianinazzi S, Gianinazzi-Pearson V, eds. Mycorrhizas: functional processes and
ecological impact. Springer-Verlag, Berlin Heidelberg, 89–106.
Grunwald U, Guo W, Fischer K, Isayenkov S, Ludwig-Müller J, Hause B, Yan X,
Kuester H, Franken P (2009) Overlapping expression patterns and differential
transcript levels of phosphate transporter genes in arbuscular mycorrhizal, Pi-
fertilised and phytohormone-treated Medicago truncatula roots. Planta 229: 1023–
1034
Guest D, Grant BR (1991) The complex action of phosphonates as antifungal agents.
Biol Rev 66: 159–187
Handreck KA (1997) Phosphorous requirements of Australian native plants. Aust J Soil
Res 35: 241-289
Hawkins HJ, Hettasch H, Mesjasz-Przybylowicz J, Przybylowicz W, Craner MD
(2008) Phosphorus toxicity in the Proteaceae: A problem in post-agricultural lands.
Sci Hortic 117: 354–365
Hildebrandt U, Regvar M, Bothe H (2007) Arbuscular mycorrhiza and heavy metal
tolerance. Phytochem 68: 139–146
Howard K, Dell B, Hardy GE (2000) Phosphite and mycorrhizal formation in seedlings
of three Australian Myrtaceae. Aust J Bot 48: 725-729
Jabahi-Hare SH, Kendrick WB (1987) Response of an endomycorrhizal fungus in
Allium porrum L. to different concentrations of the systemic fungicides metalaxyl
(Ridomil) and fosetyl-Al (Aliette). Soil Biol Biochem 19: 95–99
102
Jasper DA, Davy JA (1993) Root characteristics of native plant species in relation to the
benefit of mycorrhizal colonisation for phosphorus uptake. Plant Soil 155/156: 281-
284.
Jones MD, Durall DM, Tinker PB (1998) Comparison of arbuscular and
ectomycorrhizal Eucalyptus coccifera: growth response, phosphorus uptake
efficiency and external hyphal production. New Phytol 140: 125-134
Kabir ZIP, O'Halloran IP, Fyles JW, Hamel C (1997) Seasonal changes of arbuscular
mycorrhizal fungi as affected by tillage practices and fertilization: hyphal density
and mycorrhizal root colonisation. Plant Soil 193: 285-293
Karandashov V, Bucher M (2005) Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends Plant Sci. 10: 22-29
Kariman K, Barker SJ, Finnegan PM, Tibbett M (2012) Dual mycorrhizal associations
of jarrah (Eucalyptus marginata) in a nurse-pot system. Aust J Bot 60: 661-668
Kariman K, Barker SJ, Jost R, Finnegan PM, Tibbett M (in preparation: Chapter 3) A
novel plant-fungus symbiosis benefits the host without forming mycorrhizal
structures.
Kariman K, Barker SJ, Finnegan PM, Tibbett M (in preparation: Chapter 4)
Mycorrhizal symbiosis can induce tolerance in jarrah (Eucalyptus marginata)
exposed to toxic pulses of phosphorus
Korimbocus J, Coates D, Barker I, Boonham N (2002) Improved detection of
sugarcane yellow leaf virus using a real-time fluorescent (TaqMan) RT-PCR
assay. J Vir Methods 103: 109-120 (2002)
Li HY, Smith SE, Holloway R, Zhu YG, Smith FA (2006) Arbuscular mycorrhizal
fungi contribute to phosphorus uptake by wheat grown in a phophorus-fixing soil
even in the absence of positive growth response. New Phytol 172: 536–543.
Loth-Pereda V, Orsini E, Courty PE, Lota F, Kohler A, Diss L, Blaudez D, Chalot M,
Nehls U, Bucher M, Martin F (2011) Structure and expression profile of the
phosphate Pht1 transporter gene family in mycorrhizal Populus trichocarpa. Plant
Physiol 156: 2141–2154
Lovatt CJ, Mikkelsen RL (2006) Phosphite fertilizers: What are they? Can you use
them? What can they do? Better Crops 90: 11-13
Meharg AA, Macnair MR (1990) An altered phosphate uptake system in arsenate
tolerant Holcus lanatus. New Phytol 116: 29–35
Meharg AA, Macnair MR (1992) Suppression of the high affinity phosphate uptake
system: a mechanism of arsenate tolerance in Holcus lanatus L. J Exp Bot 43: 519–
524
Meharg AA, Hartley-Whitaker J (2002) Arsenic uptake and metabolism in arsenic
resistant and non-resistant plant species. Tansley Review. New Phytol 154: 29-43
103
Muchhal US, Pardo JM, Raghothama KG (1996) Phosphate transporters from the
higher plant Arabidopsis thaliana. Proc Natl Acad Sci USA 93: 10519–10523
Muchovej RMC, Amorim EFC (1990) Development and effect of endo- and
ectomycorrhizal fungi on seedlings of Eucalyptus grandis. In: Abstracts of the 8th
NACOM, Jackson, Wyo, p 251
Ohtake H, Wu H, Imazu K, Anbe Y, Kato J, Kuroda A (1996) Bacterial phosphonate
degradation, phosphite oxidation and polyphosphate accumulation. Res Cons Recy
18: 125–134
Paszkowski U, Kroken S, Roux C, Briggs SP (2002) Rice phosphate transporters
include an evolutionarily divergent gene specifically activated in arbuscular
mycorrhizal symbiosis. Proc Natl Acad Sci U S A 99: 13324-13329
Rausch C, Bucher M (2002) Molecular mechanisms of phosphate transport in plants.
Planta 216: 23–37
Runge-Metzger, A (1995) Closing the cycle: obstacles to efficient P management for
improved global food security. In: H Tiessen (Ed.). Phosphorus in the global
environment. John Wiley & Sons Ltd, NewYork
Sanchez PA, Buol SW (1975) Soils of the tropics and the world food crisis. Science
188: 598-603
Shane MW, McCully ME, Lambers H (2004) Tissue and cellular phosphorus storage
during development of phosphorus toxicity in Hakea prostrata (Proteaceae). J Exp
Bot 55: 1033-1044
Sharples JM, Meharg AA, Chambers SM, Cairney JWG (2000) Mechanism of Arsenate
Resistance in the Ericoid Mycorrhizal Fungus Hymenoscyphus ericae. Plant Physiol
124: 1327-1334
Sheppard BS, Caruso JA, Heitkemper DT, Wolnik KA (1992) Arsenic speciation by ion
chroma- tography with induced coupled plasma mass spectrometry detection.
Analyst 117: 971-975
Smaling E (2005) Harvest for the world, inaugural address, International Institute for
Geo-Information Science and Earth Observation, Enschede, The Netherlands
Smith E, Smith J, Biswas T, Correll R, Naidu R (2003) Arsenic in Australian
environment: an overview. J Environ Sci Health, Part A 38: 223-239
Sukarno N, Smith SE, Scott ES (1993) The effect of fungicides on vesicular- arbuscular
mycorrhizal symbiosis: I. The effects on vesicular-arbuscular mycorrhizal fungi and
plant growth. New Phytol 25: 139–147
Sukarno N, Smith FA, Smith SE, Scott ES (1996) The effects of fungicides on vesicular-
arbuscular mycorrhizal symbiosis. II. The effects on area of interface and efficiency
of P uptake and transfer to plant. New Phytol 132: 583–592
Sukarno N, Smith FA, Scott ES, Jones GP, Smith SE (1998) The effect of fungicides on
vesicular-arbuscular mycorrhizal symbiosis. III. The influence of VA mycorrhiza
104
on phytotoxic effects following application of fosetyl-Al and phosphonate. New
Phytol 139: 321–330
Thao HTB, Yamakawa T (2009) Phosphite (phosphorous acid): fungicide, fertilizer or
bio-stimulator? Soil Sci Plant Nutr 55: 228–234.
Ticconi CA, Delatorre CA, Abel S (2001) Attenuation of phosphate starvation responses
by phosphite in Arabidopsis. Plant Physiol 127: 963–972
Thomson VP, Leishman MR (2004) Survival of native plants of Hawkesbury
Sandstone communities with additional nutrients: effect of plant age and habitat.
Aust J Bot 52: 141-147
Trolove SN, Hedley MJ, Kirk GJD, Bolan NS, Loganathan P (2003) Progress in
selected areas of rhizosphere research on P acquisition. Aust J Soil Sci 41: 471–499
Tynan KM, Wilkinson CJ, Holmes JM, Dell B, Colquhoun IJ, McComb JA, Hardy
GESJ (2001) The long-term ability of phosphite to control Phytophthora
cinnamomi in two native plant communities of Western Australia. Aust J Bot 49:
761-770
Varadarajan DK, Karthikeyan AS, Matilda PD, Raghothama KG (2002) Phosphite, an
analog of phosphate, suppresses the coordinated expression of genes under
phosphate starvation. Plant Physiol 129: 1232–1240
Xu P, Christie P, Liu Y, Zhang J, Li X (2008) The arbuscular mycorrhizal fungus
Glomus mosseae can enhance arsenic tolerance in Medicago truncatula by
increasing plant phosphorus status and restricting arsenate uptake. Environ Poll
156: 215–220
105
Chapter 6
General Discussion and Conclusion
This PhD thesis has provided fundamental insights on fungal symbiotic associations
of jarrah. In the first glasshouse experiment (Chapter 2), I developed a nurse-pot system
to explore the extent and temporal colonisation dynamics of AM, ECM and dual (AM
& ECM) mycorrhizal associations of jarrah and their potential growth and nutritional
benefits. The results also uncovered an unusual plant-fungus association in which
benefits were achieved without root colonisation.
I was compelled by curiosity to answer this question: How a fungus could be as
beneficial for the host plant as a mycorrhiza even without a physical contact
(colonisation) between the two symbiotic partners? Therefore, I developed a
radioisotope tracer experiment (Chapter 3) using 33
P and a multi-compartment system
to shed more light on this new symbiosis. Mycorrhiza have been defined and classified
according to the type of symbiotic structures formed between plant roots and fungal
hyphae. However, the presented results open up a new perspective of plant-fungus
relationships, indicating that the benefits rendered to the host plants are not necessarily
correlated with formation of specialised ECM symbiotic structures. Indeed, in the novel
symbiosis the rhizosphere biochemistry is modified in order to achieve higher nutrient
availability for plant uptake rather than direct nutrient transfer via hyphae. Recent
studies have highlighted the key role of ECM fungi in soil biodegradation and nutrient
cycling (Landeweert et al., 2001; Pritsch and Garbaye, 2011). However, the existing
literature has focused on the fungal hyphae involved in ECM associations or their
saprophytic stages rather than the hyphae involved in a completely novel form of
symbiosis (Chapter 3).
During the recent decades and along with the green revolution, P fertilisers have been
added to many P-impoverished soils to achieve higher yields for commercial crop
plants. Thus, the soil P levels have risen beyond the tolerance of many low-P adapted
species in agricultural and forest environments, which is considered a serious threat for
biodiversity and function of native communities (Handreck et al., 1997; Lambers et al.,
2010). Many Australian native species are sensitive to P fertilization and finding
sustainable ways to address this issue is of environmental and ecological importance. I
focused on mycorrhizal associations as a potential biological approach to deal with P
sensitivity. In this regard, I studied symbiotic associations of jarrah and their effect on
the expression of plant PHT1 genes and P uptake across the P deficiency-toxicity
106
continuum. The toxicity experiments (Chapters 4 and 5) provided new insights into the
P sensitivity of jarrah plants. P-sensitive native plants are thought to be unable to
reduce the expression of their PHT1 genes under P toxicity conditions (Shane et al.,
2004; Hawkins et al., 2008) but this has not been investigated previously. This is the
first study showing the molecular mechanism behind the P sensitivity in a low-P
adapted plant, which is apparently the inability to reduce the expression of PHT1 genes
in roots when exposed to toxic doses of Pi. AM, ECM and novel symbioses showed a
good potential to induce tolerance against Pi and its analogues, suggesting the
mycosymbionts as functional biological components to deal with toxicity caused by
these analogues.
There were two main hypotheses for this research i) ECM fungi are better symbiotic
partners for jarrah compared to AM species in terms of positive growth and nutritional
responses and ii) fungal symbionts have the potential to induce tolerance of jarrah to
toxic pulses of Pi, Phi and AsV and the tolerance might be linked with the expression
of PHT1 genes in roots. The main findings of this study are briefly discussed with
regard to these hypotheses and the existing knowledge of this field. Here, I integrate the
findings of all experiments and the implications and future research directions of this
area:
1- Jarrah growth and nutrition
For AM symbioses, a positive growth response was only observed with S. calospora
while R. irregularis had no effects or sometimes depressive effects on jarrah growth
(Chapters 2 and 5). The variable results observed in jarrah-AM symbioses support the
reports from research on other eucalypts (Gomez et al., 1987; Adjoud et al., 1996;
Chen et al., 2000). There are likely to be major differences between these two AM
fungal isolates due to their taxonomic separation (Kruger et al., 2012) and original
habitat (Western Australia vs Canada). However, a clear understanding of neutral or
negative jarrah responses to different AM fungi requires further investigations. Besides,
the positive growth and P nutritional responses in plants inoculated with S. calospora
(Chapter 5) was achieved with relatively low AM colonisation, supporting the notion
that positive responses are not necessarily linked with the extent of root colonisation in
AM symbiosis (Jakobsen, 1995; Smith et al., 2004).
The colonisation results for Scleroderma sp. and A. occidentalis indicated that the
ECM structures and hyphal nutrient uptake are not the only factors reflecting the fungal
contribution to better growth and nutrition of the host plants. Acidifying the
107
rhizosphere soil by increasing the concentration of carboxylates (Chapter 3), is
apparently a significant factor leading to the enhanced nutrient availability in the novel
symbiosis where the root colonisation does not occur. However, there might be other
functional pathways in the novel symbiosis such as proton exudation (Hoffland et al.,
2004), mineralisation of organic matter (Bending and Read, 1995; Tibbett and Sanders,
2002) or other unknown mechanisms. The two ECM isolates were collected from forest
habitats, where ECM fungi play a major role in decomposing soil organic matter and
nutrient cycling (Pritsch and Garbaye, 2011). Therefore, it would be worthwhile to
examine the fungal ability to decompose organic matter (via secretion of nutrient
mobilising enzymes) while having a novel symbiotic relationship.
The washed river sand used in this study was fairly poor in organic matter, which is
the primary N source for ECM hyphae (Bending and Read, 1995; Tibbett and Sanders,
2002). The improved N nutrition in the A. occidentalis treatment (Chapter 3) was
surprising as the ECM symbiosis (Scleroderma sp.) failed to do so. The highest citrate
concentration was observed in the rhizosphere of jarrah plants associated with A.
occidentalis, which could potentially modify the soil bacterial communities and
promote free living N2 fixers (Olsson and Wallander, 1998). The N2 fixing bacteria
might have been endemic to the sterile fungal cultures or recruited during the
experiment. However, this is a speculative hypothesis but one that warrants testing.
2- Mycorrhizal relationships
Jarrah plants had a very low AM colonisation with both R. irregularis and S.
calospora in keeping with the existing literature about AM colonisation of jarrah and
other eucalypts (Brundrett and Abbott, 1991; Howard et al., 2000). The AM
colonisation of jarrah seedlings was not increased by using a nurse-pot system (Chapter
2). Apparently, the established network of extraradical hyphae does not increase the
naturally low AM colonisation of jarrah whereas nurse-pot systems have been
successfully used to enhance the AM colonisation of certain crops including tomato
and barley (Brundrett et al., 1985; Finlay et al., 1989; Arnebrant and Finlay, 1993;
Rosewarne et al., 1997). However, in classic nurse-pot systems test plants are
transplanted into hyphal networks originating from roots of highly colonised species
such as leek, not from the same plant species. I used jarrah as both test and nurse plant
to be able to study both AM and ECM associations, simultaneously. It would be
interesting to see if the same results would be achieved for AM colonisation if test
108
jarrah seedlings were transplanted into hyphal networks associated with highly
colonised nurse plants such as leek.
Addition of two P sources (Pi and Phi) inhibited the decline of AM colonisation,
which naturally happens after 2-3 months in AM-eucalypt symbioses for unidentified
reasons (Chen et al., 2000, Adams et al., 2006). AM fungi do not always have positive
effects on P nutrition of eucalypts (Jones et al., 1998; Chapter 2), which could be
potentially linked with decline or suppression of the AM symbiosis shortly after
establishment. Therefore, adequate or even toxic supplies of Pi might be able to extend
the AM symbiosis in jarrah (and other eucalypts), which is an interesting hypothesis to
be tested.
Three individual experiments (Chapters 2, 3 and 5) showed that Scleroderma sp. is a
fungus with dual behaviour capable of establishing both ECM and novel symbioses.
This suggests that the novel symbiosis is an alternative pathway for at least some ECM
fungi. There was preliminary evidence for a possible correlation between minimum
growth temperature and this dual behaviour. Scleroderma sp. mostly established the
novel symbiosis when the temperature dropped below 7 ºC at night during the growth
season. A. occidentalis, however, seems to be a typical fungus for the novel symbiosis,
always establishing the novel symbiosis with jarrah plants. The 33
P experiment
(Chapter 3) showed that hyphae do not extend beyond the rhizosphere in the novel
symbiosis, which was accompanied by the lack of hyphal 33
P transfer to jarrah. In the
ECM association, however, the direct hyphal connection with roots was accompanied
by hyphal networks extended well beyond the rhizosphere. Therefore, lack of ECM
structures and less extensive hyphal networks (bounded to rhizosphere and vicinity)
could be considered to be two simple factors that differentiate novel from ECM
symbiosis where clear positive growth and nutritional benefits exist for the plant host.
Another important investigation would be to establish the mutuality of the interaction
between jarrah and both these fungal species when they are in the novel symbiosis
form.
The novel symbiosis was observed for A. occidentalis and Scleroderma sp. isolates,
which belong to fungal families of Boletaceae and Sclerodremataceae, respectively.
Considering the diverse basidiomycete communities associated with forest habitats, it
would be interesting to determine how widespread this novel symbiosis is across plant
and fungal communities.
109
3- Symbiotic associations and tolerance to Pi, Phi and AsV toxicities
AM fungi showed greater potential to induce tolerance against Pi toxicity than the
ECM or novel symbiotic fungi, and the tolerance was not correlated with lower shoot P
concentration (Chapters 4 and 5). This shows that the induced tolerance is due to some
unknown mechanisms other than lower Pi uptake or the dilution effect caused by higher
shoot biomass in mycorrhizal plants. Although both S. calospora and R. iregularis
induced Pi tolerance, only the former stimulated jarrah growth significantly (Chapters 2
and 5). I accordingly propose that AM fungi with positive responses such as S.
calospora could be promising potential candidates to deal with Pi toxicity in jarrah. For
example, pre-inoculation of jarrah seedlings with AM fungi in nurseries prior
transferring to natural (or disturbed) habitats could be an application of this finding.
However, in ECM and novel symbioses the Pi tolerance was only achieved when
symbiotic plants had lower shoot P concentration than NM controls (Chapter 4),
suggesting the dilution effect as the main mechanism for Pi tolerance in these cases.
Both AM and novel symbioses could induce tolerance against Phi toxicity via
reduced Phi uptake in inoculated plants. In the last experiment (Chapter 5), all
inoculated plants had significantly higher shoot P content than NM controls four weeks
after the Pi pulse whereas the shoot P content did not differ significantly across
inoculated treatments four weeks after the Phi pulse. It seems that the symbiotic
associations somehow differentiate Phi from Pi as a toxic P form and consequently
reduce the Phi uptake of host plants. Accumulation of Phi inside fungal mycelia could
be one potential mechanism here, as has been observed for other toxic molecules in
AM symbioses (Hildebrandt et al., 2007). Furthermore, the expression of EmPHT1;2
was unchanged in plants receiving the Phi pulse whereas the Pi-treated plants had
higher expression of EmPHT1;2 than untreated NM controls, which might be
correlated with lower uptake of Phi than Pi in NM plants (Chapter 5). Finally, the
dilution effect could always be considered as a mechanism of tolerance in all types of
symbioses with positive growth responses.
Although none of the fungi could help jarrah plants survive the AsV toxicity, they
were quite effective at reducing the shoot As concentration (Chapter 5). Reduction of
AsV to AsIII inside fungal hyphae and exporting the produced AsIII into soil, As
accumulation inside fungal vacuoles and the growth dilution effect are among the
potential mechanisms behind the reduced shoot As concentration in inoculated jarrah
plants (Sharples et al., 2000; Hildebrandt et al., 2007). Lower expression of plant PHT1
genes has also been reported as a mechanism for AsV tolerance in AM symbiosis
110
(Meharg and Macnair, 1992). This is not apparently the underlying mechanism for the
present study as neither AM nor novel symbioses caused plants to reduce the
expression of their PHT1 genes in roots. Similar to the Phi results, the expression of
EmPHT1;2 was not affected by the AsV pulse while the Pi-treated plants had higher
transcript abundance than untreated NM controls, suggesting that this PHT1 gene might
not be involved in transport of Phi and AsV in jarrah plants. Future detailed assessment
of the spatial and nutritional expression patterns of this particular PHT1 gene family
member are justified by these observations.
4- Symbiotic associations and expression of PHT1 genes in roots
Many plant species reduce the expression of their PHT1 genes in response to AM
symbiosis (Karandashov and Bucher, 2005) but there is only one study on an ECM
symbiosis (Loth-Pereda et al., 2011) showing that two PHT1 genes had reduced
expression in poplar plants inoculated with both AM and ECM fungi. This is the
second report showing that ECM plants (Scleroderma sp.) reduced the expression of
some PHT1 genes in roots, which was evidently linked with hyphal 33
P uptake (Chapter
3). However, when ECM fungi do not colonise plant roots and establish a novel
symbiosis, the expression of PHT1 genes is not affected as observed for A. occidentalis
(Chapters 3 and 5) and Scleroderma sp. (Chapter 5). This is presumably due to the lack
of hyphal nutrient uptake in the proposed novel symbiosis.
The AM fungus S. calospora failed to repress the expression of jarrah PHT1 genes,
which was an observation in contrast to the reports on other plant species (Karandashov
and Bucher, 2005). Nonetheless, there is a study showing that the AM fungus
Gigaspora rosea was not able to affect the expression of the PHT1 gene MtPT2 in
Medicago truncatula, while this gene had lower transcript abundances in plants
colonised by other AM species tested (Burleigh, 2001). However, it is also relevant that
jarrah was not inclined to reduce the expression of most of the assessed PHT1 gene
family members, even following exposure to highly toxic concentration of Pi, Pi and
AsV (Chapter 5). In addition, AM-eucalypt symbioses are different from AM
relationships in other plant species in terms of being transitory events (Chen et al.,
2000; Adams et al., 2006; Chapter 5). Accordingly, I hypothesize that the lack of
change in the expression of PHT1 genes in AM jarrah roots could be related with either
the genetic characteristics of jarrah as a low-P adapted species or the transitory nature
of AM-eucalypt symbioses. It will be important to ensure that all members of the PHT1
gene family have been identified before these additional experiments are conducted.
111
5- Conclusion and future research directions
This research has contributed to understanding the dual mycorrhizal associations of
jarrah and led to the discovery of a new plant-fungus symbiosis. The observations of
the novel symbiosis indicate that basidiomycete fungi can establish beneficial
symbioses without colonising plant roots apparently via their modifying functions in
the rhizosphere soil. This new symbiosis could be a widespread phenomenon across
plant/fungal communities. Together, the results of this thesis show that ECM fungi,
regardless of their colonisation ability, are superior symbiotic partners for jarrah to AM
fungi in terms of conferring growth and nutritional benefits. Positive growth responses
in AM-jarrah symbioses might depend on the fungal taxonomic position, origin of
isolates or experimental conditions. Finally, although all ECM, novel and AM
symbioses can have protective effects against Pi toxicity, AM symbioses function
better upon exposure to higher Pi pulses.
I propose the following research directions to address the hypotheses and questions
arising from this thesis:
- Determine the distribution of novel symbiosis among plant/fungal communities.
Representative woody plant species and basidiomycete fungi from different
families can be used to find out how widespread could be this novel symbiosis.
- Clarify if the dual behaviour of some ECM fungi such as Scleroderma sp. is
correlated with low minimum temperature during the growth season.
- Explore the molecular basis in the ECM-novel continuum to provide
fundamental insights into plant-fungus signalling pathways. For example,
expression of genes associated with nutrient uptake and certain secondary
metabolites such as carboxylates could only be down-regulated in ECM plants,
not in the novel symbiosis.
- Determine if the high carboxylate concentration in the rhizosphere soil in the
novel symbiosis has a plant or fungal origin.
- Shed more light on the mutuality of the novel symbiosis by showing how the
plant partner actually feeds the fungus. The hypothesis is that host plants exude
the hexoses such as glucose and fructose into the rhizosphere soil to feed the
fungal partner.
- Investigate how the ECM fungi involved in the novel symbiosis can decompose
the soil organic matter to release nutrients, by focusing on certain enzymes such
as acid phosphatases, proteinases or polyphenol oxidases.
112
- Study the effects of ECM colonisation on the expression of nutrient transporters
other than P, in particular N. There was preliminary evidence for the reduced N
uptake by roots of ECM plants.
- Investigate the contrasting physiological effects of different AM fungi on
eucalypts in more detail, focusing on endemic fungi.
- Clarify if adequate or even toxic supplies of Pi can extend the duration of
symbiotic relationships between eucalypts and AM fungi, which decline
naturally under low P conditions.
- Elucidate the mechanism of Pi tolerance in AM jarrah plants. The tolerance was
neither correlated with lower shoot P concentration nor the expression of PHT1
genes. Localisation of P in different plant organs could be helpful in
understanding the tolerance mechanism.
- Study the mechanism of tolerance to toxic Pi analogues (Phi and AsV) in all
ECM, novel and AM symbioses. Accumulation of these toxic molecules inside
fungal mycelia could be a potential mechanism here.
- Clarify if the inability to reduce the PHT1 gene expression under Pi toxicity
conditions is linked with P sensitivity in other Australian native plant species.
- Determine if eucalypts generally do not alter the expression of their PHT1
genes in AM symbioses, which would be opposite of the existing literature for
other plant species.
Finis
Literature Cited
Adams F, Reddell P, Webb MJ, Shipton WA (2006) Arbuscular mycorrhizas and
ectomycorrhizas on Eucalyptus grandis (Myrtaceae) trees and seedlings in native
forests of tropical north-eastern Australia. Aust J Bot 54: 271-281
Adjoud D, Plenchette C, HalliHargas R and Lapeyrie F (1996) Response of 11
eucalyptus species to inoculation with three arbuscular mycorrhizal fungi.
Mycorrhiza 6: 129-135
Arnebrant KEH, Finlay RD (1993) Nitrogen translocation between Alnus glutinosa (L.)
Gaertn. seedlings inoculated with Frankia sp. and Pinus contorta Doug. ex Loud
seedlings connected by a common mycelium. New Phytol 124: 213-242
Bending GD, Read DJ (1995) The structure and function of the vegetative mycelium of
ectomycorrhizal plants VI. Activities of nutrient mobilising enzymes in birch
litter colonized by Paxillus involutus (Fr.) Fr. New Phytol 130: 411-417
113
Brundrett MC, Abbott LK (1991) Roots of jarrah forest plants.1. Mycorrhizal
associations of shrubs and herbaceous plants. Aust J Bot 39: 445-457
Brundrett MC, Pichel Y, Peterson RL (1985) A developmental study of the early stages
in vesicular-arbuscular mycorrhiza formation. Can J Bot 63: 184-194
Burleigh SH (2001) Relative quantitative RT-PCR to study the expression of plant
nutrient transporters in arbuscular mycorrhizas. Plant Sci 160: 899–904
Chen YL, Dell B, Brundrett MC (2000) Effects of ectomycorrhizas and vesicular-
arbuscular mycorrhizas, alone or in competition, on root colonisation and growth
of Eucalyptus globulus and E. urophylla. New Phytol 146: 545-556
Finlay RD, Odham HEG, Soderstrom B (1989) Uptake, translocation and assimilation
of nitrogen from 15N-labelled ammonium and nitrate sources by intact
ectomycorrhizal systems of Fagus sylvatica infected with Paxillus involutus. New
Phytol 113: 47-55
Gomez TCR, Faria LP and Lin MT (1987) Mycorrhization of eight species of
Eucalyptus with VAM fungi, Durban, South Africa. pp. 86–93
Hoffland E, Kuyper TW, Wallander H, Plassard C, Gorbushina AA, Haselwandter K,
Holmstrom S, Landeweert R, Lundstrom US, Rosling A, Sen R, Smits MM, van
Hees PAW, van Breemen N (2004) The role of fungi in weathering. Front Ecol
Enviro 2: 258–264
Handreck KA (1997). Phosphorous requirements of Australian native plants. Aust J
Soil Res 35: 241-289
Hawkins HJ, Hettasch H, Mesjasz-Przybylowicz J, Przybylowicz W, Craner MD
(2008) Phosphorus toxicity in the Proteaceae: A problem in post-agricultural lands.
Sci Hortic 117: 354–365
Hildebrandt U., Regvar M., Bothe H. (2007). Arbuscular mycorrhiza and heavy metal
tolerance - Phytochem 68: 139-146
Howard K, Dell B, Hardy GE (2000) Phosphite and mycorrhizal formation in seedlings
of three Australian Myrtaceae. Aust J Bot 48: 725-729
Jakobsen I (1995) Transport of phosphorus and carbon in VA mycorrhizas. In
'Mycorrhiza, structure, function, molecular biology and biotechnology'. (Eds A
Varma and B Hock) pp. 297-324. (Springer Verlag: Berlin, Germany)
Jones MD, Durall DM, Tinker PB (1998) Comparison of arbuscular and
ectomycorrhizal Eucalyptus coccifera: growth response, phosphorus uptake
efficiency and external hyphal production. New Phytol 140: 125-134
Karandashov V, Bucher M (2005) Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends Plant Sci 10: 22-29
114
Krüger M, Krüger C, Walker C, Stockinger H, Schüßler A (2012) Phylogenetic
reference data for systematics and phylotaxonomy of arbuscular mycorrhizal
fungi from phylum to species-level. New Phytol 193: 970-984
Lambers H, Brundrett MC, Raven JA, Hopper SD (2010) Plant mineral nutrition in
ancient landscapes: high plant species diversity on infertile soils is linked to
functional diversity for nutritional strategies. Plant Soil 334: 11–31
Landeweert R, Hofflund E, Finlay RD, van Breemen N (2001) Linking plants to rocks:
Ectomycorrhizal fungi mobilize nutrients from minerals. Trends Ecol Evol 16:
248-254
Loth-Pereda V, Orsini E, Courty PE, Lota F, Kohler A, Diss L, Blaudez D, Chalot M,
Nehls U, Bucher M, Martin F (2011) Structure and expression profile of the
phosphate Pht1 transporter gene family in mycorrhizal Populus trichocarpa. Plant
Physiol 156: 2141–2154
Meharg AA, Macnair MR (1992) Suppression of the high affinity phosphate uptake
system: a mechanism of arsenate tolerance in Holcus lanatus L. J Exp Bot 43: 519–
524
Olsson PA, Wallander H (1998) Interactions between ectomycorrhizal fungi and the
bacterial community in soils amended with various primary minerals. FEMS
Microbiol Ecol 27: 195-205
Pritsch K, Garbaye J (2011) Enzyme secretion by ECM fungi and exploitation of
mineral nutrients from soil organic matter. Ann Forest Sci 68: 25-33
Rosewarne GM, Barker SJ, Smith SE (1997) Production of near-synchronous fungal
colonisation in tomato for developmental and molecular analyses of mycorrhiza.
Mycol Res 101:l 966-970
Shane MW, Szota C, Lambers H (2004) A root trait accounting for the extreme
phosphorus sensitivity of Hakea prostrata (Proteaceae). Plant Cell Environ 27: 991-
1004
Sharples JM, Meharg AA, Chambers SM, Cairney JWG (2000) Mechanism of Arsenate
Resistance in the Ericoid Mycorrhizal Fungus Hymenoscyphus ericae. Plant Physiol
124: 1327-1334
Smith SE, Smith FA, Jakobsen I (2004) Functional diversity in arbuscular mycorrhizal
(AM) symbioses: the contribution of the mycorrhizal P uptake pathway is not
correlated with mycorrhizal responses in growth or total P uptake. New Phytol 162:
511-524
Tibbett M, Sanders FE (2002) Ectomycorrhizal symbiosis can enhance plant nutrition
through improved access to discrete organic nutrient patches of high resource
quality. Ann Bot 89: 783-789