23
DNA RNA Protein Reverse transcriptase RNA-dependent RNA polymerase DNA polymerase RNA polymerase Ribosome Enzymes in the central dogma Cellular enzymes (Mostly) RNA virus enzymes

Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

  • Upload
    others

  • View
    4

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

DNA

RNA

Protein

Reversetranscriptase

RNA-dependent RNA polymerase

DNA polymerase

RNA polymerase

Ribosome

Enzymes in the central dogmaCellular enzymes

(Mostly) RNA virusenzymes

Page 2: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

5’3’

3’5’

DNA template

RNA

The process of transcription

Page 3: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 3.14

The three steps of transcription: initiation, elongation and termination

5’

5’

3’

Template strand

Non-template strandRNA polymerase

DNA

RNA

Page 4: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

E. coli promoter

Fig. 6.6

Page 5: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

The following DNA contains a promoter.

What is the sequence of the RNA made?

A. 5’-OHUCUCACUAGCUppp-3’

B. 5’-pppUCUCACUAGCUOH-3’

C. 5’-pAGAGUGAUCGAp-3’

D. 5’-pppAGAGUGAUCGAOH-3’

E. 5’-pppAGAGUGAUCGAp-3’

5’-AGTACGTACTTGACATAGATGCGCGCTCGATGTATAATGCGCCACCAGAGTGATCGA3’-TCATGCATGAACTGTATCTACGCGCGAGCTACATATTACGCGGTGGTCTCACTAGCT

-10-35

- Clicker Question -

Page 6: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

E. coli RNA polymerase

β‘βα

α

β‘βα

α

σ70Core (α2ββ’)

σ70

+

Holo-enzyme (α2ββ’σ)

Page 7: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.3

Sigma factor is needed for promoter binding

(α2ββ’)

(α2ββ’σ)

β‘βα

α

σ70

β‘βα

α

Page 8: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Nuclease

DMS: Chemical that methylates unpaired As

Nuclease S1: Nuclease that cleaves only single stranded DNA

32P

Autorad

Fig. 6.16Technique: see DNase/DMS footprinting(Weaver Ch. 5, p. 116-119)

Experiment to test whether the RNA polymerase melts the region around the transcription start site

Page 9: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.17

Evidence that the RNA polymerase melts the region around the transcription start site

Melted region

RNA polymerase: + + - -Nuclease S1: - + + -

Page 10: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

In the shown experiment, the lane labeled R-S+ contains no RNA polymerase, but is still treated with Nuclease S1.

Why is this control experiment important?

It tells you that:

A. Nuclease S1 cleaves ssDNA.

B. Nuclease S1 does not cleave the DNAwhen RNA polymerase was not there.

C. RNA polymerase does not cleave dsDNA.

D. RNA polymerase is active in transcription.

- Clicker Question -

Page 11: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.11

Evidence that the sigma subunit is reused

1) Add holoenzyme

2)

Incorporation of γ32P-ATP/GTP

(α2ββ’σ)

(α2ββ’)

Page 12: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.14bFig. 6.13b

Evidence that sigma stays bound during transcription elongation

Page 13: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

The steps of transcription initiation in bacteria

Fig. 6.9?

Page 14: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.26

The alpha subunit of RNA polymerase can bind upstream (UP) elements in strong promoters

Page 15: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.30

Nucleotides cross-link to the RNA polymerase β subunit

Fig. 6.29

SDS-PAGE/ autorad

Page 16: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.33

Both β and β’ subunits interact with DNA during transcription

SDS-PAGE/ autorad

β‘βα

α32P

DNA*

cross-linker

Page 17: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.43a

Model of the transition from closed (RPc) to open (RPo) promoter complex

β’ β’

β

α

σ

α

Page 18: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

An E. coli strain has acquired a lethal mutation in the promoter -10 box of an essential gene.

Researchers subjected the strain to a mutagen, and selected a secondary mutation (i.e not in the same gene), which restored growth. Which of the following genes is most likely to carry the secondary mutation?

A. RNA polymerase α subunit.

B. RNA polymerase β subunit.

C. RNA polymerase β’ subunit.

D. RNA polymerase σ subunit.

E. RNA polymerase ε subunit.

- Clicker Question -

Page 19: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

You have isolated an antibiotic which kills E. coli cells by interacting with RNA polymerase.You discover that the antibiotic causes low production of ribosomal RNA but does not affect most mRNAs.

Which of the following RNA polymerase subunits is most likely to interact with the drug?

A. RNA polymerase α subunit.

B. RNA polymerase β subunit.

C. RNA polymerase β’ subunit.

D. RNA polymerase σ subunit.

E. RNA polymerase ε subunit.

- Clicker Question -

Page 20: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Model for Rho-independent (simple)

transcription termination in bacteria

UUUUUU5’ 3’

RNA 3’end of simple terminator:

Fig. 6.46

Page 21: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.50

Some terminators depend on the protein RhoDNA:RNA Free RNA

Heavy Light Heavy Light

DNA/RNA separated in CsCl density gradients

Page 22: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Fig. 6.51

Model for Rho-dependent

transcription termination in bacteria

Page 23: Protein - University of Colorado Boulderdosequis.colorado.edu/.../Lectures/Lecture3_2010.pdf · Pa gene a Pb gene b Gene b is immediately downstream of gene a in E. coli and has its

Pa Pbgene a gene b

Gene b is immediately downstream of gene a in E. coli and has its own promoter and a Rho-dependent terminator.An E. coli strain has acquired a mutation that causes the appearance of an RNA containing both genes a and b, but no sequence downstream of gene b.

In which part of the genome is the mutation most likely to be?

A. In the promoter for gene a.

B. In the promoter for gene b.

C. At the end of gene a.

D. The RNA polymerase σ subunit gene.

E. The Rho factor gene.

- Clicker Question -