Immunology and Cell Biology (2002) 80, 231–240

Research Article

Rac2-deficient mice display perturbed T-cell distribution and chemotaxis, but only minor abnormalities in TH1 responses

B E N A C R O K E R , 1 E M A N U E L A H A N D M A N , 2 J O H N D H A Y B A L L , 3 T R A C E Y M B A L D W I N , 2 V A L E N T I N A V O I G T , 4 L E O N I E A C L U S E , 1 F E N G - C H U N Y A N G , 5 D A V I D A W I L L I A M S 5 a n d A N D R E W W R O B E R T S 1

Divisions of 1Cancer and Haematology and 2Infection and Immunity, Walter and Eliza Hall Institute of Medical Research, Royal Melbourne Hospital, Parkville, Victoria, 3Hanson Centre, Institute of Medical and Veterinary Science and School of Pharmacy and Biomedical Sciences, University of South Australia, Adelaide, South Australia, 4Department of Microbiology, University of Western Australia, QEII Medical Centre, Nedlands, Western Australia, Australia and 5Howard Hughes Medical Institute, Herman B Wells Center for Pediatric Research, Section of Pediatric Hematology/Oncology, Indiana University School of Medicine, Indianapolis, Indiana, USA

Summary The haematopoietic-specific RhoGTPase, Rac2, has been indirectly implicated in T-lymphocytedevelopment and function, and as a pivotal regulator of T Helper 1 (TH1) responses. In other haematopoietic cells itregulates cytoskeletal rearrangement downstream of extracellular signals. Here we demonstrate that Rac2 deficiencyresults in an abnormal distribution of T lymphocytes in vivo and defects in T-lymphocyte migration and filamentousactin generation in response to chemoattractants in vitro. To investigate the requirement for Rac2 in IFN-γproduction and TH1 responses in vivo, Rac2-deficient mice were challenged with Leishmania major and immunizedwith ovalbumin-expressing cytomegalovirus. Despite a minor skewing towards a TH2 phenotype, Rac2-deficientmice displayed no increased susceptibility to L. major infection. Cytotoxic T-lymphocyte responses to cytomegalo-virus and ovalbumin were also normal. Although Rac2 is required for normal T-lymphocyte migration, its role in thegeneration of TH1 responses to infection in vivo is largely redundant.

Key words: chemotaxis, Rac2, T lymphocytes, TH1/ TH2.

Introduction

Regulated cytoskeletal remodelling is required for T-celldevelopment and is an important component of normalT-lymphocyte function. A family of proteins, the Rho guano-sine triphosphatases (RhoGTPases), are key coordinators ofactin cytoskeleton rearrangements downstream of extra-cellular signals. Accordingly, these proteins regulate complexcellular processes, such as motility, adhesion and the organ-ized assembly of receptors and signalling molecules in, andadjacent to, the cell membrane.1–3 One RhoGTPase, Rac2, isrestricted in expression to lymphocytes and haematopoieticcells, where it is coexpressed with the highly homologous, butubiquitously expressed GTPase, Rac1.4,5 The highly restrictedexpression pattern suggests that Rac2 is required for special-ized functions of haematopoietic cells. Indeed, Rac2 isnecessary for normal cytoskeletal rearrangement in primaryneutrophils,6 mast cells7 and stem cells,8 and Rac2-deficientmice display a peripheral blood neutrophilia and concomitanttissue deficiency of neutrophils, despite normal expression ofRac1.6

Recent reports have suggested that Rac2 may also playimportant roles in both T lymphopoiesis and T-cell function.Rac2 mRNA increases 30- to 50-fold in human T cellsstimulated with phytohemagglutinin A,9 and transgenicexpression of constitutively active Rac2 in the thymus leadsto increased apoptosis and thymic atrophy.10 When the activi-ties of both Rac1 and Rac2 are inhibited by overexpressionof a dominant negative form of Rac in T-cell lines, T-cellactivation downstream of the T-cell receptor and the costimu-latory molecules, CD28 and CD5 is substantially reduced.11–13

In Jurkat cells, antisense inhibition of Rac2 results indiminished actin polymerization triggered by ligation ofL-selectin.14 Further indirect evidence of key roles for Rac asa regulator of T-cell number and function can be inferredfrom the phenotype of Vav-deficient mice. Vav is a guaninenucleotide exchange factor (GEF) that activates Rac,15–17 andVav-deficient mice display abnormalities in thymocyte selec-tion, T-cell proliferation, actin polymerization and recruit-ment of the actin cytoskeleton to the CD3-TcR complex.18–23

Most recently and directly, Rac2 was found to be selectivelyexpressed in CD4+ T Helper 1 (TH1) cells and required fornormal IFN-γ production by primary cells in vitro.24

Collectively, these observations suggested that Rac2 waslikely to be required for normal T lymphopoiesis and T-cellfunction in vivo. These hypotheses were tested using Rac2-deficient mice and T cells freshly isolated from these mice.

Correspondence: Dr A Roberts, Walter and Eliza Hall Institute ofMedical Research, Royal Melbourne Hospital, Parkville, Victoria3050, Australia. Email: roberts@wehi.edu.au

Received 12 October 2001; accepted 21 January 2002.

232 BA Croker et al.

Materials and Methods

Mice

Rac2-deficient mice backcrossed nine generations onto the C57BL/6strain, and wild-type littermate or C57BL/6 mice were used in theseexperiments. The generation of Rac2-deficient mice has been des-cribed previously.6 Mice were bred and maintained under specificpathogen-free conditions at the Walter and Eliza Hall Institute ofMedical Research. Sex- and age-matched mice of 5–25 weeks of agewere used in these experiments. For reciprocal, labelled-lymphocytetransfer experiments, groups of three recipients of each genotypewere injected intravenously with unfractionated splenocytes (contain-ing equivalent numbers of CD4+ and CD8+ T cells for each geno-type, approximately 20 × 106 T cells for each independentexperiment) from pooled donors of each genotype, after incubatingwith 0.5 µmol/L CTG (CellTracker Green CMFDA; MolecularProbes, Eugene, OR, USA) according to the manufacturer’s instruc-tions. The frequency of labelled cells in recipient organs was deter-mined 5 h later by flow cytometric analysis of 100 000 leucocytes.For peripheral blood, recovery was calculated from the frequency oflabelled cells, the leucocyte count per mL, the number of cellsinjected and a presumed blood volume of 2 mL. Analyses of datawere performed using one-way ANOVA and, where appropriate, theStudent–Newman–Keuls test.

Phenotypic characterization of T-lymphocyte populations by flow cytometry

T-lymphocyte populations were characterized by flow cytometryusing FITC, Phycoerythrin (PE) or biotin-conjugated monoclonalantibodies specific for Thy1 (CD90), CD4, CD8 and (the T cellactivation marker) CD44 (kindly provided by Dr Andreas Strasser).Biotinylated antibodies were revealed with streptavidin-PE(Pharmingen, San Diego, USA).

In vitro lymphocyte chemotaxis assay

The recombinant mouse chemokines, 6CKine (CCL21, SLC, TCA-4,Exodus-2) and MIP-3β (CCL19, ELC, Exodus-3) (R & D Systems,Minneapolis, MN, USA) were used for migration and actin assays.For migration assays, 5 × 105 cells in 100 µL of RPMI/0.5% BSAwere added to the upper chamber of the 5.0 µm pore size transwellinsert (Costar, Corning, NY, USA). Various concentrations of thechemoattractant were added to the appropriate well. The transwellswere incubated at 37°C in 5% CO2 for 4 h. Migration of T lympho-cytes was determined by flow cytometry using antibodies specificfor Thy1, CD4 and CD8. Duplicate assays were performed for eachsample. Actin polymerization was quantified by incubating 5 × 105

purified lymph node T cells at 37°C for 5 min prior to the addition ofchemoattractant in varying concentrations for 15 s before cells werefixed, stained (80 nmol/L FITC-phalloidin (Sigma, Saint Louis,USA); 0.1 mg/mL l-α-lysophosphatidylcholine [Sigma], 3.6% for-maldehyde; PBS) and analysed by flow cytometry. Forty thousandevents were acquired and lymphocytes identified by forward and sidescatter characteristics. Increases in mean cellular fluorescence oflymphocyte populations relative to control samples were used todetermine percentage increases in filamentous actin (F-actin).

Adhesion

Plates that had not been treated with tissue culture (Becton Dickin-son, Franklin Lakes, NJ, USA) were coated with 1% BSA or100 nmol/cm2 of fibronectin fragments (H296, CH271 or CH296)25 inPBS overnight at 4°C. Plates were blocked with PBS/2% BSA at

room temperature for 30 min and washed twice with PBS, and5 × 105 purified lymph node T cells in RPMI/1% BSA were added tothe wells and incubated at 37°C in 10% CO2 for 1 h. Non-adherentcells were collected from the wells and counted to determine theproportion of adherent cells.

CCR7 expression

The expression of CCR7 mRNA was analysed by reverse-transcription PCR (RT-PCR). Murine leukaemia virus reverse tran-scriptase (Roche, Indianapolis, IN, USA) was used to prepare cDNAfrom 25 ng poly-A+ RNA isolated from splenocytes pooled fromthree mice. For CCR7 expression, TGTGCTTCTGCCAAGATG(forward primer) and TAGCCAGCATAGGCACTA (reverse primer)were used. Specificity was confirmed by Southern blot analysis usingCCTGGTTCCTGCCTCTCA as the radiolabelled internal probe. ForG3PDH expression, ACCACAGTCCATGCCATCAC (forwardprimer) and TCCACCACCCTGTTGCTGTA (reverse primer) wereused as a loading control.

In vivo challenge with Leishmania major

Ten mice per group were injected with 105 promastigotes of theLeishmania major cloned line V121.26 Mice were injected intrader-mally at the base of the tail and lesion scores measured weekly for upto 10 weeks postinfection. The lesion scores, which reflect thediameter of the lesion,27 were analysed by jittering individual lesionscores,28 using STATVIEW (Version 4.5; Abacus Concepts, Berkeley,CA, USA). The protocol for analysing Leishmania parasite burden ininguinal, axillary and brachial lymph nodes has been describedpreviously.29 Leishmania parasite burden was determined in wild-type and rac2–/– mice at 4 and 8 weeks postinfection. The number ofIL-4 and IFN-γ-producing spleen lymphocytes in response to totalsoluble Leishmania antigen was determined in wild-type and rac2–/–

mice at 4 and 8 weeks postinfection as described previously.30,31 Theprofile of serum immunoglobulin specific for solubilized Leishmaniaantigen was determined by ELISA at 4 and 8 weeks postinfection aspreviously described.31

In vivo challenge with cytomegalovirus

Wild-type and rac2–/– mice (n = 3) were immunized i.p. with2 × 104 p.f.u. of CMV K181 and CMV K181OVA (kindly provided byDr Malcom Lawson).32 Carboxyfluorescein diacetate, succinimidylester (CFSE)-labelled splenic mononuclear target cells (10 × 106)were pulsed with OVA257–264 and adoptively transferred, together withnon-pulsed reference cells (10 × 106) labelled at a higher fluorescenceintensity, into the immunized mice 10 days following immunization.Cells were recovered 18 h after the intravenous inoculation from thespleen and individual lymph nodes (cervical, axillary, inguinal,mesenteric) and analysed by flow cytometry. At day 10, serum wascollected via the retro-orbital plexus and isotype-specific antibodytitres against CMV and ovalbumin were determined by ELISA(Pharmingen).

Results

T-lymphocyte development is normal in Rac2-deficient ani-mals, despite abnormalities in peripheral blood and spleen.

Consistent with the findings reported for Rac2-deficientmice with a 129.B6F2 genetic background,6 analysis of adultC57BL/6 rac2–/– mice demonstrated a 60% increase in totalleucocyte number (wild type 7.6 ± 2.3 × 109 leucocytes/L;

T-cell defects in Rac2-deficient mice 233

rac2–/– 12.3 ± 3.2 × 109 leucocytes/L; n = 10–11; P < 0.005).A 90% increase in T-lymphocyte numbers in the peripheralblood compared with wild-type mice was observed (Table 1).Both CD4+ and CD8+ T-lymphocyte subsets were elevated inthe peripheral blood, with no disturbance in their relativefrequencies.

The weights and total cellularities of thymus, bonemarrow, spleen and lymph nodes were normal in rac2–/–

animals and histological examination of lymphoid organsrevealed no gross abnormalities. In the thymus, the propor-tions and total cell numbers of double-negative (CD4–CD8–),double-positive (CD4+CD8+) and single-positive (CD4+CD8–,CD4–CD8+) T lymphocytes were similar between wild-typeand rac2–/– mice (Table 1 and Fig. 1). However, in the spleen,CD8+ and CD4+ T-lymphocyte numbers were increased by30% and 40%, respectively, over wild-type mice (Table 1 andFig. 1). Immunohistochemical analysis of the spleen showeda normal distribution of T lymphocytes (data not shown). Inaddition, the proportion of CD8+ T lymphocytes was mildly,but reproducibly, elevated in lymph nodes (inguinal, axillary,brachial, superficial cervical, mesenteric) of Rac2-deficientanimals (Fig. 1; rac2–/– 26 ± 3.2%; wild type 21 ± 2.2%;n = 10–11; P < 0.001). T-cell numbers in the lymph node(inguinal, axillary, brachial, cervical, mesenteric) and bonemarrow of rac2–/– mice were normal (Table 1). Proliferationof unfractionated rac2–/– splenic T lymphocytes in response tothe T-cell mitogen, Concavalin A, was indistinguishable fromcontrol cells (data not shown). As previously observed forrac2–/– neutrophils, levels of Rac1 mRNA and Rac1 proteinwere not increased in rac2–/– T cells (data not shown).

Decreased T-lymphocyte chemotaxis in response to chemoattractants

As rac2–/– neutrophils, mast cells and stem cells displayabnormal migration in response to a variety of chemoattract-ants,6–8 the migration of rac2–/– lymphocytes in response totwo lymphocyte chemokines, 6CKine33 and MIP-3β34, wasexamined. Chemotaxis of unfractionated lymph node T lym-phocytes, induced by MIP-3β and 6CKine, was reduced by40–70% (Fig. 2a). This defect was observed in all T-cell

subsets analysed (Thy1+, CD4+, CD8+) for both MIP-3β and6CKine (Fig. 2b). Similar deficits were observed when highlypure (>98%) populations of lymph node T lymphocytes wereanalysed (data not shown), indicating that the defect wasintrinsic to T lymphocytes. The deficits in migration of lymphnode T lymphocytes in response to MIP-3β were less evidentat the higher dose of 800 ng/mL MIP-3β (Fig. 2a). In theabsence of chemoattractant, migration of lymph node lym-phocytes was similar between genotypes. However, in a zerogradient of MIP-3β (equal concentrations of MIP-3β in theupper and lower chamber of a transwell), migration of rac2–/–

lymphocytes was decreased relative to wild-type lymphocytes(data not shown), indicating that chemokinesis, or randommovement, was also reduced. The defect in migration was notameliorated by extending the duration of the assay for anadditional 2 h, suggesting that the deficit cannot be attributedsimply to a small decrease in speed. Further, these abnormal-ities were not explained by differences in chemokine receptorexpression. Expression of CCR7 mRNA, the receptor for6CKine and MIP-3β, was similar in splenocytes of bothgenotypes as measured by RT-PCR from poly A+ RNA acrossan intron/exon boundary (inset of Fig. 2a). The reductions inchemotaxis in response to 6CKine and MIP-3β were not dueto differences in the activation state of the rac2–/– lym-phocytes, as the proportion of naive CD4410 T lymphocyteswas indistinguishable between genotypes (data not shown).

Lymphocytes from mice deficient in chemokines and theirreceptors display markedly reduced homing to lymphoidorgans.35–38 For example, in transfer experiments, clearancefrom the circulation of CCR7-deficient lymphocytes isimpaired and their entry into peripheral lymph nodes (but notthe spleen) is diminished.37 To determine whether the deficitsin chemokine responses described above could affect T-cellhoming, reciprocal transfer experiments of CellTrackerGreen-labelled (Molecular Probes) splenocytes were per-formed, with the distribution of T cells analysed 5 h afterintravenous injection. A significantly higher percentage oftransferred rac2–/– T cells were retained in the circulationirrespective of the genotype of the recipient (Fig. 2c), whileentry into the spleen was indistinguishable between thegenotypes. The frequencies of labelled cells recovered from

Table 1 Distribution of T lymphocytes in wild-type and rac2–/– mice

Tissue Marker Cell number (×106) Wild type rac2–/–

Peripheral blood (n = 10–16) Thy1 1.5 ± 0.6 (109/L) 2.8 ± 0.8 (109/L)**CD4+CD8– 0.7 ± 0.4 (109/L) 1.2 ± 0.6 (109/L)*CD8+CD4– 0.6 ± 0.2 (109/L) 1.2 ± 0.3 (109/L)**

Thymus (n = 4–5) CD4–CD8– 5.0 ± 1.7 4.5 ± 1.6CD4+CD8– 4.5 ± 2.5 4.4 ± 1.1CD4–CD8+ 2.1 ± 0.8 2.1 ± 1.0CD4+CD8+ 75 ± 26 81 ± 10

Spleen (n = 5) Total 116 ± 12 102 ± 13Thy1 21 ± 2.0 28 ± 3.4**

CD4+CD8– 12 ± 1.3 17 ± 1.6**CD4–CD8+ 8.6 ± 1.1 11 ± 1.2*

Pooled lymph node (n = 4–7) Th1+ 22 ± 6.0 27 ± 9.8CD4+CD8– 13 ± 2.2 140 ± 4.2CD8+CD4– 11 ± 2.3 15 ± 4.3

Bone marrow (n = 11–12) Thy1 0.9 ± 0.2 0.8 ± 0.3

Thy1 is a marker for T lymphocytes. Figures represent mean ± SD. *P < 0.05; **P < 0.005.

234 BA Croker et al.

mesenteric and peripheral lymph nodes of recipient rac2–/–

mice were reduced by 25–30% in two independent experi-ments when rac2–/– donor T cells were injected rather thanwild-type T cells (Fig. 2c). This difference was not observedwhen wild-type mice were used as the recipients. Entry intolymph nodes by wild-type T cells was increased in rac2–/–

recipients when compared with wild-type recipients (P < 0.05for both mesenteric and peripheral lymph nodes). Collec-tively, these data suggest that the reduced chemokine-responsiveness of rac2–/– T cells contributes to their altereddistribution in vivo.

Reduced actin polymerization in T lymphocytes in response to MIP-3β

Cell motility requires rearrangement of the actin cytoskeleton,a process that requires globular monomers of actin (G-actin)to polymerize to form F-actin. Polymerization of F-actin inpurified lymph node T lymphocytes was quantified usingphalloidin-FITC following stimulation for 15 s (the optimaltime point) with 6CKine and MIP-3β. Actin polymerizationwas reduced by 30–40% in T lymphocytes in response toMIP-3β (Fig. 2d). Despite a significant defect in migratorycapacity of purified lymph node T lymphocytes in response to6CKine, no significant differences in actin polymerizationwere noted in response to 6CKine (Fig. 2d).

Normal β1-integrin-mediated adhesion to fibronectin peptides

Interactions between lymphocytes and extracellular matrixproteins, as well as specialized lymphoid endothelium andcytokine-activated endothelium, are required for chemotaxisand for migration of lymphocytes from the blood to the tissue.The α4β1 and α5β1 integrins, which bind activated endo-thelium and fibronectin, are highly expressed by T lympho-cytes,39 and variable defects in adhesion via β1 integrins havebeen noted previously in rac2–/– neutrophils,6 mast cells,7 andstem cells.8 However, for rac2–/– T lymphocytes, β1 integrin-mediated adhesion to the H296 peptide (α4β1 binding site),the CH271 peptide (α5β1 binding site) and the CH296peptide (α4β1 and α5β1 binding site) was normal (Fig. 2e),as measured in a static adhesion assay.

Rac2 deficiency does not increase susceptibility to in vivo challenge with Leishmania major

Rac2 has been directly implicated in CD4+ TH1 cell differen-tiation through the activation of TH1-specific signalling andIFN-γ production in vitro.24 Given our current data, wehypothesized that Rac2 was crucial for T-cell activation andcellular immunity in vivo. We examined the potential patho-physiological consequences of deficient TH1 responses by

Figure 1 Normal T-cell development in the thymus but abnormal frequencies of CD4+ and CD8+ T lymphocytes in spleen and lymphnodes of rac2–/– mice. Representative dot plots of wild-type and rac2–/– cells from thymus, spleen and lymph nodes stained withfluorescently conjugated antibodies to CD4 and CD8 are shown.

T-cell defects in Rac2-deficient mice 235

Figure 2 Chemotaxis and actin polymerization is deficient in rac2–/– T lymphocytes. (a) Migration of unfractionated lymph nodelymphocytes in response to different concentrations of MIP-3β and 6Ckine (mean ± SD of n = 3–7 per group). Reverse-transcription PCRanalysis of CCR7 expression (receptor for 6CKine and MIP-3β) using poly A+ RNA from splenocytes of wild-type and rac2–/– mice isshown in the inset. For each genotype, reactions were performed at two poly A+ RNA concentrations. �, wild type; �, rac2–/–. (b) Migrationof unfractionated wild-type and rac2–/– lymph node CD4+ and CD8+ T lymphocytes in response to 200 ng/mL MIP-3β and 800 ng/mL6Ckine (mean ± SD of n = 3–4 per group). (c) Recovery of CTG-labelled T lymphocytes from peripheral blood, spleen and mesenteric andperipheral lymph nodes (inguinal, axillary, brachial, cervical) 5 h following i.v. injection of 20 × 106 CTG-labelled T cells into wild-typeand rac2–/– animals (mean ± SD of n = 3–6 per group). �, wild-type donor cells; �, rac2–/– donor cells. (d) Generation of filamentous actin(F-actin) in wild-type and rac2–/– purified lymph node T lymphocytes in response to 15 s stimulation with MIP-3β and 6CKine. Increasesin F-actin were determined relative to unstimulated cells (mean ± SD of n = 3–5 per group). Lymph node lymphocytes from two mice werepooled for each experiment. (e) Adhesion of purified wild-type and rac2–/– lymph node T lymphocytes to fibronectin peptides that representbinding sites for α4β1 and α5β1 integrins (mean ± SD of n = 3–5 per group). *P < 0.05; **P < 0.005; rac2–/– versus wild type.

236 BA Croker et al.

challenging rac2–/– mice with L. major. Resolution of L. majorinfection relies upon development of a strong TH1 lymphocyteresponse which promotes IFN-γ production and macrophageactivation.40 Conversely, a strong TH2 response promotesIL-4-mediated disease progression.

Two groups of 10 wild-type mice and 10 rac2–/– mice wereinfected intradermally with 105 L. major promastigotes andthe lesion development was recorded weekly. The lesionscores shown in Fig. 3(a) are based on the size of the lesions;an increase in severity corresponds to a higher lesion score.There was no difference in the disease pattern in the rac2–/–

mice compared to controls over the 10-week period. Nosignificant differences in parasite burden were detected at 4and 8 weeks postinfection in lymph nodes from wild-type andrac2–/– mice, suggesting equivalent efficacy in immune

clearance of the parasite (Fig. 3b). Figure 3(c) shows thenumber of IL-4 and IFN-γ-producing cells (per million cells)in the spleen of infected wild-type and rac2–/– mice inresponse to stimulation with soluble L. major antigen. Thenumber of cytokine-producing cells was significantly higherat 8 weeks postinfection when the lesions began to heal.Although a small number of IL-4 producing cells weredetected in the wild-type control mice, the number wasincreased in the rac2–/– mice, suggesting a skew towards aTH2 profile. As an additional indicator of the polarity of theimmune response, the cytokine-controlled production of anti-L. major IgG1, IgG2c and IgG3 was determined at the 8-weektime point. The level of the anti-L .major, TH1-specific IgG3was reduced in rac2–/– serum compared to controls,whereas the anti-L. major, TH2-specific IgG1 was normal

Figure 3 In vivo challenge of wild-type and rac2–/– mice with Leishmania major. (a) The course of L. major infection in rac2–/– or wild-type mice. Each dot represents the jittered lesion score of an individual mouse, so that otherwise superimposed points can be separated.This allows the simultaneous display of all data points. (b) The parasite burden represents the log10 of the number of parasites present inthe lymph nodes (inguinal, axillary, brachial). �, wild type; �, rac2–/–. (c) The number of cytokine-producing spleen lymphocytes (SFC,spot forming cell) in response to solubilized L. major antigen is shown at 4 and 8 weeks postinfection. Error bars represent standarddeviations. *P < 0.05; n = 2–3, rac2–/– versus wild type. �, wild type; �, rac2–/–.

T-cell defects in Rac2-deficient mice 237

(Fig. 4). As C57BL/6 mice express IgG2c and not the TH1-specific IgG2a,41 the levels of anti-L. major IgG2c weremeasured and shown to be reduced in rac2–/– serum comparedto littermate controls. These data provide additional in vivoevidence of a moderate skewing towards a TH2 profile in theinfected rac2–/– mice and are consistent with previous obser-vations.24 Despite this, there was no significant difference inthe disease pattern in the two types of mice.

Anti-viral responses to cytomegalovirus are normal in Rac2-deficient mice

The in vivo requirement for Rac2 for cytotoxic T-lymphocyte(CTL) responses were next tested by immunizing withcytomegalovirus. Primary CMV infection is regulated byCD8+ and CD4+ T lymphocytes, natural killer cells andIFN-γ.42,43 Wild-type and rac2–/– mice were immunized withCMV K181 and ovalbumin expressing CMV (CMV K181OVA).Subsequently, the mice were challenged with CFSE-stained,adoptively transferred target cells sensitized with the domi-nant H-2Kb-restricted peptide epitope (SIINFEKL) fromOVA. Cells labelled with a greater intensity of CFSE, but notsensitized with OVA257–264, were also transferred into theanimals to provide a reference peak. The results of spleniccells from a representative animal from each experimentalgroup are shown in Fig. 5(a) (histograms for inguinal, cervi-cal, axillary and mesenteric lymph nodes not shown). Asexpected, no ovalbumin peptide-sensitized cells were lostfrom the spleen of CMV-K1810-immunized mice, demon-strating an absence of anti-OVA CTL activity. In contrast,CMV-K181OVA-immunized mice elicited a strong anti-OVA CTL response in the spleen where few peptide-sensitized cells could be detected in wild-type and rac2–/–

mice. In order to accurately quantify the differences in anti-OVA CTL activity between wild-type and Rac2-deficientmice, a mean ratio between the number of peptide-sensitizedcells and those cells without peptide, as recovered from miceimmunized with CMV K181, was determined. This ratio wasused to standardize the results obtained from the differentorgans of CMV-K181OVA-immunized mice to allow anaccurate determination of specific target cell lysis (Fig. 5b).The anti-OVA CTL activity was normal in the spleen andlymph nodes of rac2–/– mice. No differences were observed intitres of CMV- or OVA-specific IgG1 or IgG2c from miceimmunized with CMV K181 or CMV K181OVA (data notshown), indicating that TH1/TH2 polarization was normal inrac2–/– mice in response to CMV.

Discussion

In diverse cell types, Rac GTPase activity is an importantregulator of cytoskeletal rearrangement and transcriptionalactivation,1 and uniquely in haematopoietic cells this is con-tributed to by the expression of Rac2. The present study hasfocused on the in vivo consequences of Rac2 deficiency forT-cell development and function. Given the indirect evidencesuggesting roles for Rac2 proteins in thymocyte development,18–23

and the direct evidence indicating its importance in thegeneration of TH1 responses,24 the phenotype of Rac2-deficient mice was surprisingly subtle. The most prominentconsequences of the absence of Rac2 for T cells, both in vitroand in vivo, were defective responses to chemoattractants.Chemotaxis of rac2–/– lymph node T lymphocytes was signif-icantly reduced in response to 6CKine and MIP-3β. Actinpolymerization in response to the same stimuli was alsoreduced, although not uniformly for each chemokine, and notto the same extent as that seen in rac2–/– neutrophils stimu-lated with equivalent chemoattractants.6

As the response of lymphocytes to chemoattractant cuescontrols their recirculation between the blood and tissue,38

Figure 4 Serum IgG1, IgG2c and IgG3 specific for solubleLeishmania major antigen in wild-type and L. major mice,8 weeks postinfection. Each dot represents one mouse. The rela-tive levels of serum immunoglobulin were determined at a serumdilution of 1 : 100. Optical density (OD) was measured at405–490 nm. The average OD for the control without serum was0.045. *P < 0.05; rac2–/– (�) versus wild type (�) postinfection.

238 BA Croker et al.

such defective responses to chemoattractants could beexpected to manifest as altered distributions of T cells in vivo.Indeed, Rac2-deficient mice display a peripheral blood Tlymphocytosis and an increase in T-lymphocyte numbers inthe spleen. This phenotype is consistent with those observedfor mice deficient in CCR7, the receptor for 6CKine andMIP-3β,37 and mice possessing the paucity of lymph nodeT cells (plt) mutation, which prevents expression of MIP-3βand 6CKine in lymphoid tissues.44–47 Both these mice displaysimilar elevations in T lymphocytes in peripheral blood andspleen to those observed in Rac2-deficient mice, as well as

modest reductions in T lymphocytes in peripheral lymphnodes. In keeping with a contribution of deficient chemokineresponsiveness to the phenotype of Rac2-deficient mice,transferred rac2–/– T cells displayed abnormal distributionsin vivo, similar in pattern, but milder in degree, to thosepreviously reported for CCR7-deficient mice.37 rac2–/– T cellswere retained in the peripheral blood of recipients of eithergenotype to a greater extent than wild-type cells. A modestreduction in homing of transferred rac2–/– T cells tomesenteric and peripheral lymph nodes was observed whenrac2–/– mice were the recipients. This latter deficit was notconsistently reproduced in wild-type recipients, suggestingthat factors extrinsic to T cells were operating as well as theT cell intrinsic defect. The data also indicate that there isincreased homing of wild-type cells in rac2–/– recipientscompared with wild-type recipients. This pattern has alsobeen observed previously for CCR7-deficient recipients ofwild-type cells.37 We speculate that perturbed local environ-mental factors, such as compensatory increased concentra-tions of chemokines, are also operative in Rac2-deficientmice.

Two other possible causes for abnormal T-cell distributionin vivo that need to be considered are defects in selectin-mediated rolling and in integrin-mediated adhesion. The latteris unlikely to be a major contributor to the T lymphocytosis asβ1-mediated adhesion to fibronectin epitopes was normal inRac2-deficient T lymphocytes. Defects in L-selectin-mediatedrolling could be contributing to the Rac2-deficient phenotype.Previous studies in T-cell lines have proved the key effectorrole that Rac2 plays downstream of L-selectin ligation withrespect to cytoskeletal rearrangement,14 and we have demon-strated defective leucocyte rolling in primary cells from Rac2-deficient mice.6 However, the phenotype of Rac2 deficiencyis not identical to L-selectin deficiency. Most pertinently,isolated deficiency of L-selectin does not result in a two foldelevation of both CD4+ and CD8+ T cells in the blood.48,49 Insummary, the T-cell phenotype of Rac2-deficient mice mostclosely resembles that of the aforementioned chemokine andchemokine-receptor mutant mice, and is most simply consid-ered to reflect an incomplete deficiency in T-cell chemo-attractant signalling.

Very recently, it has been suggested that Rac2 plays apivotal role in the generation of TH1 responses by activatingIFN-γ production through concomitant activation of both theNF-kβ and p38 MAPK pathways.24 The current data from aL. major challenge confirm that Rac2 deficiency leads to askewing of the cytokine profile both in vitro and in vivo, aspredicted from in vitro data reported by Li et al.24 However,the lesion scores and parasite burdens induced by L. majorinfection were indistinguishable from wild-type mice. Underin vivo conditions, rac2–/– mice appear capable of generating asufficiently potent, IFN-γ driven, TH1 type, cellular responseto L. major infection. Similarly, the response of ovalbumin-specific, cytotoxic T lymphocytes to splenic mononuclearcells displaying ovalbumin peptides was normal in Rac2-deficient animals. The mouse model for leishmaniasis is aparticularly sensitive indicator of TH1 and TH2 responses. Thelack of effect in the rac2–/– mice provides evidence that thedefect evident in vitro in IFN-γ production and TH1-specificsignalling is either not significant, or more likely well com-pensated, in response to in vivo pathogenic challenge.

Figure 5 In vivo anti-CMV CTL activity in wild-type and rac2–/–

mice. Wild-type and rac2–/– mice (n = 3) were immunized i.p. with2 × 104 p.f.u. of CMV K181 and CMV K181OVA. CFSE-labelledsplenic mononuclear target cells (10 × 106) were loaded withOVA257–264 and adoptively transferred, together with referencecells (10 × 106) without peptide, labelled at a higher fluorescenceintensity, into the immunized mice 10 days following immuniza-tion. Cells were recovered from the spleen and individual lymphnodes (cervical, axillary, inguinal, mesenteric) 18 h after intra-venous transfer and analysed by flow cytometry. (a) Repre-sentative histograms of spleens from individual animals. (b)Specific target lysis of peptide-loaded cells. Error bars representthe mean and SD from three mice. �, wild type; �, rac2–/–.

T-cell defects in Rac2-deficient mice 239

Importantly, T-cell development is not perturbed in theabsence of Rac2. The normal size and composition of the thymusin Rac2-deficient mice contrasts strikingly with the severethymic atrophy observed in mice deficient in Vav, a majorupstream activator of Rac.18–20 Taken together, these dataimply other GTPases are more important for signalling down-stream of Vav during T-cell development, with the mostlikely candidate being Rac1. However, Rac1 expression is notincreased in the absence of Rac2, and further investigationsare required to determine whether either Rac1 or other relatedproteins such as Rac3 are the principal GTPase activitydownstream of Vav in this context. Future studies willmeasure the levels of active GTP-bound Rac1 in proliferatingT-cell cultures as we have recent evidence indicating compen-satory elevation in Rac1 activity in rac2–/– haematopoieticstem cells stimulated with SDF-1α.8 In a complementaryapproach, the in vivo consequences of diminished Rac1expression on a Rac2 null background are being investigatedin rac2–/– mice heterozygous for Rac1. Such studies shouldhelp define the physiological redundancy between Rac1 andRac2 in T cells.

Acknowledgements

This work was supported by the National Health and MedicalResearch Council of Australia (Neil Hamilton Fairley Fellow-ship to AWR, grant no. 9937321 to JDH and grant no.9937420 to VV) and by the Anti-Cancer Council of Victoria(Sir Edward Dunlop Clinical Fellowship to AWR). We thankKatya Gray and Robert Breese for animal husbandry.

References

1 Penninger JM, Crabtree GR. The actin cytoskeleton and lym-phocyte activation. Cell 1999; 96: 9–12.

2 Acuto O, Cantrell D. T cell activation and the cytoskeleton.Annu. Rev. Immunol. 2000; 18: 165–84.

3 Bauch A, Alt FW, Crabtree GR, Snapper SB. The cytoskeletonin lymphocyte signaling. Adv. Immunol. 2000; 75: 89–114.

4 Shirsat NV, Pignolo RJ, Kreider BL, Rovera G. A member of theras gene superfamily is expressed specifically in T, B andmyeloid hemopoietic cells. Oncogene 1990; 5: 769–72.

5 Moll J, Sansig G, Fattori E, van der Putten H. The murine rac1gene, cDNA cloning, tissue distribution and regulated expressionof rac1 mRNA by disassembly of actin microfilaments. Onco-gene 1991; 6: 863–6.

6 Roberts AW, Kim C, Zhen L et al. Deficiency of the hematopoi-etic cell-specific Rho family GTPase Rac2 is characterized byabnormalities in neutrophil function and host defense. Immunity1999; 10: 183–96.

7 Yang FC, Kapur R, King AJ et al. Rac2 stimulates Akt activationaffecting BAD/Bcl-XL expression while mediating survival andactin function in primary mast cells. Immunity 2000; 12: 557–68.

8 Yang FC, Atkinson SJ, Gu Y et al. Rac and Cdc42 GTPasescontrol hematopoietic stem cell shape, adhesion, migration, andmobilization. Proc. Natl Acad. Sci. USA 2001; 98: 5614–18.

9 Reibel L, Dorseuil O, Stancou R, Bertoglio J, Gacon G. A hemo-poietic specific gene encoding a small GTP binding protein isoverexpressed during T cell activation. Biochem. Biophys. Res.Commun. 1991; 175: 451–8.

10 Lores P, Morin L, Luna R, Gacon G. Enhanced apoptosis in thethymus of transgenic mice expressing constitutively activatedforms of human Rac2GTPase. Oncogene 1997; 15: 601–5.

11 Arrieumerlou C, Randriamampita C, Bismuth G, Trautmann A.Rac is involved in early TCR signaling. J. Immunol. 2000; 165:3182–9.

12 Jacinto E, Werlen G, Karin M. Cooperation between Syk andRac1 leads to synergistic JNK activation in T lymphocytes.Immunity 1998; 8: 31–41.

13 Gringhuis SI, de Leij LF, Coffer PJ, Vellenga E. Signalingthrough CD5 activates a pathway involving phosphatidylinositol3-kinase, Vav, and Rac1 in human mature T lymphocytes. Mol.Cell Biol. 1998; 18: 1725–35.

14 Brenner B, Gulbins E, Busch GL, Koppenhoefer U, Lang F,Linderkamp O. 1-selectin regulates actin polymerisation viaactivation of the small G-protein Rac2. Biochem. Biophys. Res.Commun. 1997; 231: 802–7.

15 Crespo P, Schuebel KE, Ostrom AA, Gutkind JS, Bustelo XR.Phosphotyrosine-dependent activation of Rac-1 GDP/GTP exchangeby the Vav proto-oncogene product. Nature 1997; 385: 169–72.

16 Han J, Luby-Phelps K, Das B et al. Role of substrates andproducts of PI 3-kinase in regulating activation of Rac-relatedguanosine triphosphatases by Vav. Science 1998; 279: 558–60.

17 Hehner SP, Hofmann TG, Dienz O, Droge W, Schmitz ML.Tyrosine-phosphorylated Vav1 as a point of integration forT-cell receptor- and CD28-mediated activation of JNK, p38, andinterleukin-2 transcription. J. Biol. Chem. 2000; 275: 18 160–71.

18 Tarakhovsky A, Turner M, Schaal S et al. Defective antigenreceptor-mediated proliferation of B and T cells in the absence ofVav. Nature 1995; 374: 467–70.

19 Zhang R, Alt FW, Davidson L, Orkin SH, Swat W. Defectivesignalling through the T- and B-cell antigen receptors in lym-phoid cells lacking the Vav proto-oncogene. Nature 1995; 374:470–3.

20 Fischer KD, Zmuldzinas A, Gardner S, Barbacid M, Bernstein A,Guidos C. Defective T-cell receptor signalling and positiveselection of Vav-deficient CD4+ CD8+ thymocytes. Nature1995; 374: 474–7.

21 Turner M, Mee PJ, Walters AE et al. A requirement for theRho-family GTP exchange factor Vav in positive and negativeselection of thymocytes. Immunity 1997; 7: 451–60.

22 Fischer KD, Kong YY, Nishina H et al. Vav is a regulator ofcytoskeletal reorganization mediated by the T-cell receptor.Curr. Biol. 1998; 8: 554–62.

23 Holsinger LJ, Graef IA, Swat W et al. Defects in actin-cap for-mation in Vav-deficient mice implicate an actin requirement forlymphocyte signal transduction. Curr. Biol. 1998; 8: 563–72.

24 Li B, Yu H, Zheng W et al. Role of the guanosine triphosphataseRac2 in T helper 1 cell differentiation. Science 2000; 288:2219–22.

25 Kimizuka F, Taguchi Y, Ohdate Y et al. Production and charac-terization of functional domains of human fibronectin expressedin Escherichia coli. J. Biochem. (Tokyo) 1991; 110: 284–91.

26 Handman E, Hocking RE, Mitchell GF, Spithill TW. Isolationand characterization of infective and non-infective clones ofLeishmania tropica. Mol. Biochem. Parasitol. 1983; 7: 111–26.

27 Handman E, Ceredig R, Mitchell GF. Murine cutaneous leish-maniasis disease patterns in intact and nude mice of variousgenotypes and examination of some differences between normaland infected macrophages. Aust. J. Exp. Biol. Med. Sci. 1979; 57:9–29.

28 Roberts LJ, Foote SJ, Handman E. A new standard for theassessment of disease progression in murine cutaneous leish-maniasis. Parasite Immunol. 2000; 22: 231–7.

29 Titus RG, Marchand M, Boon T, Louis JA. A limiting dilutionassay for quantifying Leishmania major in tissues of infectedmice. Parasite Immunol. 1985; 7: 545–55.

240 BA Croker et al.

30 Morris L, Troutt AB, Handman E, Kelso A. Changes in the pre-cursor frequencies of IL-4 and IFN-gamma secreting CD4+ cellscorrelate with resolution of lesions in murine cutaneous leish-maniasis. J. Immunol. 1992; 149: 2715–21.

31 Sjolander A, Baldwin TM, Curtis JM, Bengtsson KL, Handman E.Vaccination with recombinant Parasite Surface Antigen 2 fromLeishmania major induces a Th1 type of immune response butdoes not protect against infection. Vaccine 1998; 16: 2077–84.

32 Hudson JB, Walker DG, Altamirano M. Analysis in vitro of twobiologically distinct strains of murine cytomegalovirus. Arch.Virol. 1988; 102: 289–95.

33 Hromas R, Kim CH, Klemsz M et al. Isolation and character-ization of Exodus-2, a novel C-C chemokine with a unique37-amino acid carboxyl-terminal extension. J. Immunol. 1997;159: 2554–8.

34 Ngo VN, Tang HL, Cyster JG. Epstein–Barr virus-induced mole-cule 1 ligand chemokine is expressed by dendritic cells in lym-phoid tissues and strongly attracts naive T cells and activatedB cells. J. Exp. Med. 1998; 188: 181–91.

35 Ansel KM, Ngo VN, Hyman PL et al. A chemokine-driven posi-tive feedback loop organizes lymphoid follicles. Nature 2000;406: 309–14.

36 Forster R, Mattis AE, Kremmer E, Wolf E, Brem G, Lipp M.A putative chemokine receptor, BLR1, directs B cell migrationto defined lymphoid organs and specific anatomic compartmentsof the spleen. Cell 1996; 87: 1037–47.

37 Forster R, Schubel A, Breitfeld D et al. CCR7 coordinates theprimary immune response by establishing functional micro-environments in secondary lymphoid organs. Cell 1999; 99:23–33.

38 Warnock RA, Campbell JJ, Dorf ME, Matsuzawa A,McEvoy LM, Butcher EC. The role of chemokines in the micro-environmental control of T versus B cell arrest in Peyer’s patchhigh endothelial venules. J. Exp. Med. 2000; 191: 77–88.

39 Hemler ME. VLA proteins in the integrin family: structures,functions, and their role on leukocytes. Annu. Rev. Immunol.1990; 8: 365–400.

40 Solbach W, Laskay T. The host response to Leishmania infec-tion. Adv. Immunol. 2000; 74: 275–317.

41 Martin RM, Silva A, Lew AM. The Igh-1 sequence of the non-obese diabetic (NOD) mouse assigns it to the IgG2c isotype.Immunogenetics 1997; 46: 167–8.

42 Lucin P, Pavic I, Polic B, Jonjic S, Koszinowski UH. Gammainterferon-dependent clearance of cytomegalovirus infection insalivary glands. J. Virol. 1992; 66: 1977–84.

43 Reddehase MJ, Weiland F, Munch K, Jonjic S, Luske A,Koszinowski UH. Interstitial murine cytomegalovirus pneu-monia after irradiation: characterization of cells that limit viralreplication during established infection of the lungs. J. Virol.1985; 55: 264–73.

44 Nakano H, Gunn MD. Gene duplications at the chemokine locuson mouse chromosome 4: multiple strain-specific haplotypes andthe deletion of secondary lymphoid-organ chemokine and EBI-1ligand chemokine genes in the plt mutation. J. Immunol. 2001;166: 361–9.

45 Luther SA, Tang HL, Hyman PL, Farr AG, Cyster JG. Coexpres-sion of the chemokines ELC and SLC by T zone stromal cellsand deletion of the ELC gene in the plt/plt mouse. Proc. NatlAcad. Sci. USA 2000; 97: 12 694–9.

46 Nakano H, Mori S, Yonekawa H, Nariuchi H, Matsuzawa A,Kakiuchi T. A novel mutant gene involved in T-lymphocyte-specific homing into peripheral lymphoid organs on mousechromosome 4. Blood 1998; 91: 2886–95.

47 Nakano H, Tamura T, Yoshimoto T et al. Genetic defect in Tlymphocyte-specific homing into peripheral lymph nodes. Eur.J. Immunol. 1997; 27: 215–21.

48 Arbones ML, Ord DC, Ley K et al. Lymphocyte homing andleukocyte rolling and migration are impaired in L-selectin-deficient mice. Immunity 1994; 1: 247–60.

49 Steeber DA, Green NE, Sato S, Tedder TF. Lymphocyte migra-tion in L-selectin-deficient mice. Altered subset migration andaging of the immune system. J. Immunol. 1996; 157: 106–2006.