ORIGINAL ARTICLE

Reduced activity of ATP synthase in mitochondria causescytoplasmic male sterility in chili pepper

Jinjie Li • Devendra Pandeya • Yeong Deuk Jo •

Wing Yee Liu • Byoung-Cheorl Kang

Received: 8 October 2012 / Accepted: 22 November 2012 / Published online: 30 December 2012

� Springer-Verlag Berlin Heidelberg 2012

Abstract Cytoplasmic male sterility (CMS) is a mater-

nally inherited trait characterized by the inability to produce

functional pollen. The CMS-associated protein Orf507

(reported as Orf456 in previous researches) was previously

identified as a candidate gene for mediating male sterility in

pepper. Here, we performed yeast two-hybrid analysis to

screen for interacting proteins, and found that the ATP

synthase 6 kDa subunit containing a mitochondrial signal

peptide (MtATP6) specifically interacted with Orf507. In

addition, the two proteins were found to be interacted in vivo

using bimolecular fluorescence complementation (BiFC)

and co-immunoprecipitation (Co-IP) assays. Further func-

tional characterization of Orf507 revealed that the encoded

protein is toxic to bacterial cells. Analysis of tissue-specific

expression of ATP synthase 6 kDa showed that the tran-

scription level was much lower in anthers of the CMS line

than in their wild type counterparts. In CMS plants, ATP

synthase activity and content were reduced by more than half

compared to that of the normal plants. Taken together, it can

be concluded that reduced ATP synthase activity and ATP

content might have affected pollen development in CMS

plants. Here, we hypothesize that Orf507 might cause

MtATP6 to be nonfunctional by changing the latter’s con-

formation or producing an inhibitor that prevents the normal

functioning of MtATP6. Thus, further functional analysis of

mitochondrial Orf507 will provide insights into the mecha-

nisms underlying CMS in plants.

Keywords ATP synthase � Capsicum � Cytoplasmic male

sterility � Functional analysis of Orf507 � Protein–protein

interaction

Abbreviations

BiFC Bimolecular fluorescence complementation

CMS Cytoplasmic male sterility

Co-IP Co-immunoprecipitation

MtATP6 ATPase 6 kDa subunit

MRR Mitochondrial retrograde regulation

ORF Open reading frame

Y2H Yeast two hybrid

Introduction

Cytoplasmic male sterility (CMS) is characterized by

maternally inherited defects in functional pollen develop-

ment, although vegetative development remains unaffected.

J. Li and D. Pandeya contributed equally to this work.

J. Li � D. Pandeya � Y. D. Jo � W. Y. Liu � B.-C. Kang (&)

Department of Plant Science, Plant Genomics and Breeding

Institute, and Research Institute of Agriculture and Life

Sciences, College of Agricultural Sciences,

Seoul National University, Seoul, Republic of Korea

e-mail: bk54@snu.ac.kr

Y. D. Jo

e-mail: unifaith@hanmail.net

J. Li

Key Laboratory of Crop Genomics and Genetic Improvement

of Ministry of Agriculture and Beijing Key Lab of Crop Genetic

Improvement, China Agriculture University, 100094 Beijing,

China

D. Pandeya

Institute of Plant Genomics and Biotechnology, Texas A&M

University, College Station, Texas 77843, USA

W. Y. Liu

School of Biological Sciences, The University of Hong Kong,

5N01, Kadoorie Biological Sciences Building, Pokfulam Road,

Hong Kong, China

123

Planta (2013) 237:1097–1109

DOI 10.1007/s00425-012-1824-6

This type of sterility has been reported in more than 150 plant

species (Kaul 1988) and has been used for the commercial

production of F1 hybrid seeds. The failure of pollen devel-

opment in CMS is associated with mitochondrial open

reading frames (ORFs) resulting from mitochondrial DNA

rearrangement (Linke and Borner 2005; Chase 2007). Such

chimeric ORFs are composed of fragments derived from

other genes and/or non-coding sequences, leading to novel

functions in mitochondria. The mitochondrial ORF, urf13,

correlated with CMS-T (Texas type maize CMS) male-

sterile cytoplasm, was first identified in maize (Dewey et al.

1987). In petunia, the CMS-associated pcf gene is composed

of the N-terminal region of atp9, regions of cox2, and an

unidentified ORF (Young and Hanson 1987). To date, more

than 12 mitochondrial DNA regions associated with CMS

have been identified, and most of them encode subunits of

ATP synthase (Hanson and Bentolila 2004). The mito-

chondrial electron transport proteins are clustered into

complexes known as I-IV and F0F1–ATP synthase (complex

V). The F0F1–ATP synthase, a key enzyme for the synthesis

of ATP for cellular biosynthesis, comprises three parts: F0,

F1, and FA (Siedow and Umbach 1995; Xu et al. 2008). F1

carries the catalytic binding sites for ATP synthesis/hydro-

lysis, F0 is embedded in the inner membrane as a channel for

proton transport (Pedersen et al. 2000), and FA may be linked

between F1 and F0 (Wang et al. 2006). It has been reported

that alterations of mitochondrial-encoded subunits of the

F0F1–ATP synthase, such as ATP6, ATP8, and ATP9 of F0

and ATPA of F1, induce CMS in plants (Young and Hanson

1987; Hanson et al. 1989; Gagliardi and Leaver 1999; Sabar

et al. 2003; Yang et al. 2009). In sunflower, sterile plants

expressing mitochondrial ORF522 showed a specific

decreased ATP synthase activity (Sabar et al. 2003). The

chimeric mitochondrial ORF522 shares sequence similarity

with ORFB, a plant-type ATP8, which might result in

competition between two proteins leading to decreased

activity of the F0F1–ATP synthase complex (Sabar et al.

2003). In CMS-HongLian rice, sterility is associated with the

expression of atp6-OrfH79 which might disturb the forma-

tion of the F0F1–ATPase complex, resulting in decreased

activity of ATPase and pollen abortion (Zhang et al. 2007).

Besides these mitochondrial genes, nuclear genes encode

most of the subunits in this enzyme complex, for instance,

TaFAd and OsATP6 (Zhang et al. 2006; Xu et al. 2008).

However, little is known about the relationship of the nuclear

encoded subunits of F0F1–ATP synthase with CMS (Xu et al.

2008).

In plant mitochondrial genomes, it is still not clear how the

CMS-associated ORFs result in mitochondrial dysfunction

(Hanson and Bentolila 2004). One report demonstrated that

the mitochondrial OrfH79 from CMS-HongLian rice inhibits

the growth of Saccharomyces cerevisiae (Peng et al. 2009).

In addition, several studies have found that CMS-associated

genes, including T-maize urf13, sunflower Orf522, radish

Orf138 and BT-rice Orf79, encode peptides that are toxic to

E. coli (Dewey et al. 1987; Nikai et al. 1995; Duroc et al.

2005; Wang et al. 2006). However, the exact mechanism of

toxicity in E. coli has not been reported for any of the ORFs,

and how it relates to CMS is also unknown.

In a previous study, a CMS-associated gene, Orf456,

was identified as a strong candidate for determining the

male-sterile phenotype in pepper (Kim et al. 2007).

Recently, it has been found that Orf456 sequence might

have been resulted from a sequencing error at 30 end of

Orf507 (Gulyas et al. 2010). To discover the molecular

mechanism of Orf507 in male sterility in pepper, we uti-

lized yeast two-hybrid (Y2H), bimolecular fluorescence

complementation (BiFC) and co-immunoprecipitation

(Co-IP) analyses and found that ATPase 6 kDa subunit

(MtATP6) specifically interacts with Orf507. The results

reported here suggest that the interaction between Orf507

and MtATP6 affects the activity of ATP synthase, resulting

in a deficiency of ATP synthesis that might cause pollen

abortion in the CMS line. This is the first report that a

CMS-associated ORF interacts with a nuclear-encoded

ATP synthase subunit and leads to reduced ATP content.

Materials and methods

Plant material

Near-isogenic male sterile (Milyang A, CMS), maintainer

(Milyang B), and male fertile restorer (Milyang K) lines of

Capsicum annuum L. were used in this study. These plants

were kindly provided by J.H. Yoo (Monsanto, Chochiwon,

Korea).

Yeast two-hybrid analysis

The full-length Orf456 cDNA was cloned into the pBD

vector (HybriZAP�-2.1 Two-Hybrid Predigested Vector

Kit, Stratagene) and used as bait in a yeast two-hybrid

screen with a Capsicum cDNA library (pAD:cDNA con-

structs). pBD:Orf456 and pAD:cDNA library constructs

were cotransformed into YRG-2 yeast strains containing

the HIS3 and lacZ reporter genes according to the manu-

facturer’s protocol. Yeast two-hybrid analysis was per-

formed on selective media lacking leucine, tryptophan, and

histidine (-Trp/-Leu/-His). Empty vectors pBD and pAD

were used as negative controls, and interaction between

pBD:WT and pAD:WT (controls from the HybriZAP�-2.1

Two-Hybrid Predigested Vector Kit) were used as positive

controls. In addition, protein interactions were determined

by detection of the expression of lacZ via filter lift assays

following the manufacturer’s protocols.

1098 Planta (2013) 237:1097–1109

123

Physical interaction of Orf507 with MtATP6 was also

tested using yeast two-hybrid analysis. Full-length cDNAs

of Orf507 and MtATP6 were fused to the sequences

encoding the Gal4 activation domain (AD) and the Gal4

DNA binding domain (BD) in pDEST22 and pDEST32

(ProQuest; Invitrogen, Carlsbad, CA, USA). The constructs

were transformed into yeast strain Mav203. Yeast trans-

formation and analyses were performed using the ProQuest

Two-Hybrid System with Gateway Technology (Invitro-

gen). Yeast transformants were cultured on synthetic

complete medium (SC) lacking leucine (-Leu) and trypto-

phan (-Trp). After 60 h incubation at 30 �C, three colonies

were inoculated and grown at 30 �C for 17 h in SC-Leu-

Trp liquid medium. The next day, 15 ll of each cell culture

was dropped onto selection plates (-Leu/-Trp/-Ura) for

screening expression of reporter genes. Interactions were

analyzed based on the growth of yeast cells on the medium.

Bimolecular fluorescence complementation (BiFC)

assays

Nicotiana benthamiana plants were grown in a growth

chamber at 25 �C with a 16 h light/8 h dark cycle. For

bimolecular fluorescence complementation (BiFC) assays,

full-length sequences of MtATP6 and Orf507 were cloned

into pSPY-NE and pSPY-CE vectors and introduced into

Agrobacterium tumefaciens strain GV3101. Agrobacterium

was grown at 28 �C overnight in LB medium containing

antibiotics (50 mg/l kanamycin and 50 mg/l rifampicin).

Agrobacterium cells were pelleted, resuspended in infil-

tration media (10 mM MgCl2, 10 mM MES, 20 lM

acetosyringone), adjusted to 0.8 OD600, and incubated at

room temperature for at least 3 h. Agrobacterium carrying

pSPY-NE-Orf507 and pSPY-CE-MtATP6 or reverse con-

structs were mixed at a 1:1 ratio and infiltrated into

N. benthamiana leaves. The leaf sections were observed

via confocal microscopy (Delta Vision RT, Applied Pre-

cision) 4 days after infiltration.

Co-immunoprecipitation (Co-IP) analysis

Full-length Orf507 and MtATP6 cDNAs were individually

cloned into Gateway Topo vectors (Invitrogen) and trans-

ferred into PEG202 and PEG201 vectors, respectively, by

LR recombination reactions. After restriction digestion and

sequence confirmation, the plasmids were transformed into

Agrobacterium strain GV3101. The overnight culture was

incubated until the OD600 value reached 1, and the pellet was

resuspended in buffer containing 10 mM MgCl2 and 10 mM

acetosyringone. The cultures containing PEG201-MtATP6

and PEG202-Orf507 were mixed 1:1 (v/v) and infiltrated into

N. benthamiana leaves twice at a 12-h interval. The leaf

samples were harvested after 2 days of infiltration, and total

protein was isolated and incubated with protein A agarose

resin (Sigma-Aldrich, St. Louis, MO, USA) overnight. Anti-

HA antibody 1/1,000 (v/v) (Sigma-Aldrich) was added and

incubated overnight at 4 �C. The next day, the resin was

collected by centrifugation and washed three times. The

protein was eluted with 29 sample buffer after boiling at

95 �C for 5 min. The proteins were separated via SDS-

PAGE and immunoblotted with anti-FLAG antibody

1/1,000 (v/v) (Sigma-Aldrich).

Genetic mapping

Seventy individuals of the AC F2 population from C. ann-

uum cv. NuMex RNaky (RNaky) 9 C. chinense PI159234

(CA4) were used for mapping the MtATP6 locus. Infor-

mation about population and genetic map used in this study

was described by Livingstone et al. (1999). The genetic

map comprised 450 molecular markers which include SSR

and RFLP markers. Allele-specific markers with two mis-

matched reverse primers developed from the sequences of

MtATP6 from RNaky and CA4 were used in genotyping

(Table 1).

Quantitative real-time RT-PCR analysis

Total RNA was isolated from stems, leaves, ovules, and

anthers (obtained from floral buds which were 3–5 mm in

size) of Milyang A, B, and K using the Hybrid-RTM RNA

extraction kit (GeneAll Biotechnology, Seoul, Republic of

Korea) according to manufacturer’s description. cDNA

was synthesized from 2 lg of total RNA using the MMLV

reverse transcription kit (Promega, Madison, WI, USA).

After a fivefold dilution of the reverse transcription prod-

ucts, real-time PCR was performed according to the

methods of Kang et al. (2012) with minor modification

using gene-specific primer sets for Actin, ATP synthase

6 kDa subunit, and ATP synthase ß subunit (listed in

Table 1). The standard curves for each primer set were

generated by RT-PCR reactions in which serially diluted

(1:1, 1:5, 1:25, 1:125, and 1:625) cDNAs were used as

templates. Real-time PCR reactions were performed in

20 ll with 10 mM Tris–HCl (pH 8.3), 50 mM KCl,

1.5 mM MgCl2, 0.25 mM each dNTP, 5 pmol each primer,

1.25 lM Syto9 (Invitrogen), 5 ll diluted reverse tran-

scription products, and 1 unit rTaq polymerase (Takara,

Shiga, Japan) using a Roter-GeneTM 6000 thermocycler

(Corbett, Mortlake, Australia). Amplifications were carried

out under the following conditions: 95 �C for 4 min fol-

lowed by 55 cycles of 95 �C for 15 s, 57 �C for 15 s, and

72 �C. The relative expression levels for ATP synthase

6 kDa subunit and ATP synthase ß subunit to Actin were

calculated based on the Ct value analyzed in thrice-repe-

ated reactions of real-time PCR for each sample.

Planta (2013) 237:1097–1109 1099

123

Subcellular localization and in vivo interaction assays

The subcellular localization was performed according to Li

et al. (2010) with minor modification. The MtATP6–GFP

construct was introduced via particle gun bombardment into

onion epidermal cell layers on agar plates for transient gene

expression. After 20-h incubation at 25 �C, the epidermal

cells were stained with 50 nM of MitoTracker (Invitrogen),

a mitochondrial marker, for 30 min and then washed three

times with PBS buffer (137 mM NaCl, 1.4 mM KH2PO4,

4.3 mM Na2HPO4, 2.7 mM KCl, pH 7.4). Fluorescence was

observed using a confocal scanning microscope (Zeiss,

http://www.zeiss.com) with excitation wavelengths of

488 nm for GFP and 578 nm for MitoTracker.

Mitochondrial protein extraction and histochemical

staining

About 40 g of etiolated seedlings of Milyang A and B was

used for isolation of mitochondria as described by Kim

et al. (2007). Mitochondrial membranes isolated from

seedlings of Milyang A and B were resuspended by vor-

texing with protein extraction buffer (50 mM Tris–HCl

(pH 7.5), 100 mM NaCl, 10 mM MgCl2, 2 mM EDTA,

10 % glycerol, 0.5 % Triton X-100, 1 mM PMSF, 1 mM

DTT), and subsequently sonicated for 20 s. The homoge-

nates were centrifuged for 15 min at 1,600g at 4 �C. The

supernatants were recovered, and the protein concentration

was determined with the Protein Assay reagent (Bio-Rad,

Hercules, CA, USA). Equal amounts of protein samples

(200 lg) were loaded onto 12 % native polyacrylamide

gels, and gel electrophoresis was carried out at 4 �C. His-

tochemical staining was performed as described by Zerb-

etto et al. (1997). For complex V (ATPase) activity

determination, the gel was incubated overnight in 35 mM

Tris, 270 mM glycine, 14 mM MgSO4, 0.2 % Pb(NO3)2,

and 8 mM ATP, pH 7.8. For complex II (succinate dehy-

drogenase) activity determination, the gel was incubated

for 2 h with 4.5 mM EDTA, 10 mM KCN, 0.2 mM

phenazine methasulfate, 84 mM succinic acid, and 50 mM

NTB in 1.5 mM phosphate buffer (pH 7.4). All the gels

were fixed in 50 % methanol and 10 % acetic acid for

15 min and preserved in 10 % acetic acid. Gels were

photographed and band intensities were estimated as the

volume of optical density (OD)/ml squared of band area

using Image J software.

Mitochondrial ATP determination

Mitochondrial ATP was extracted from etiolated seedlings

of CMS and restorer lines in lysis buffer without protease

inhibitors (50 mM Tris–HCl, pH 7.5, 100 mM NaCl,

1 mM EDTA, 0.2 % TritonX-100, and 2 % glycerol). ATP

was quantified based on the requirement of luciferase for

ATP in producing light (emission maximum *560 nm at

pH 7.8) according to the manufacturer’s protocol (ATP

Determination Kit, Invitrogen). A standard curve of ATP

concentrations from 10 nM to1 lM was used in the

analysis.

Bacterial growth inhibition tests and protein expression

A full-length cDNA, 114 bp N-terminal region (1–114 bp),

276 bp middle region (115–390 bp), and 117 bp C-termi-

nal region (391–507 bp) of Orf507 were introduced into

Gateway-mediated expression vector pDEST17 (Invitro-

gen) by LR recombination reactions. The expression clones

were transformed into BL21, Rosseta2, RossetaDE3, and

Codonplus competent cells. Overnight grown cultures were

incubated at 37 �C till OD600 values of 0.6 were reached.

0.5 mM IPTG was added to the cultures, and they were

grown at 30 �C. OD values were measured at 30-min

Table 1 Primers used in this study

Gene Forward primer (50 ? 30) Reverse primer (50 ? 30)

RNaky MtATP6a atgaggcaattcgatccatggcc gttcttcctatcctccgctgcc

CA4 MtATP6a atgaggcaattcgatccatggcc gttcttcctatcctccgctgca

ATP synthase 6 kDa subunitb cccaacatgcgggattttatgca ggatgctactttaccagagacgg

ATP synthase beta subunitb gccttggtgatgacctcgtc gtgcccctggaaagtacgtc

Actinb cttctcggattcaccatggc gacttgcttttgcttttcctcg

Pro35S:ATP synthase-GFPc tctagaatgaggcaattcgatccatggcc ggatccgttcttatgcctctgcgcaaatcg

pSYNE:ATP synthasec tctagaatgaggcaattcgatccatggcc ggatccgttcttatgcctctgcgcaaatcg

pSYCE:CoxIVOrf507c tctagaatgcccaaaagtcccatgtatttc ggatccctcggttgctccattgttttttaga

a Allele-specific markers with two mismatched reverse primers used for genetic mapping of MtATP6. Nucleotides which are designed to be

mismatched to nuclear DNA sequence were underlinedb Gene-specific primer sets for RT-PCRc Primer sets used for vector construction

1100 Planta (2013) 237:1097–1109

123

intervals. The experiment was repeated three times. Protein

extraction and SDS-PAGE analysis were performed

according to the manufacturer’s (Invitrogen) protocol.

Results

Orf507 physically interacts with MtATP6

To isolate mitochondrial Orf456-interacting proteins, we

utilized yeast two-hybrid analysis. Yeast two-hybrid

screening of a Capsicum cDNA library, using pBD:Orf456

as bait, identified a number of interactors including a prey

clone encoding mitochondrial ATP synthase 6 kDa subunit

(MtATP6; Table 2). Yeast cells transformed with

pBD:Orf456 and pAD:MtATP6 grew normally on selec-

tion media (-Trp/-Leu/-His), indicating that Orf456

strongly interacts with MtATP6. When the interaction was

measured in a b-galactosidase activity filter assay, yeast

cells containing pBD:Orf456 and pAD:MtATP6 showed

strong b-galactosidase activity compared to the negative

control (Fig. 1a). These results demonstrated that MtATP6

specifically interacts with Orf456. Recently, it has been

found that Orf456 sequence might have been resulted from

a sequencing error at 30 end of Orf507 (Gulyas et al. 2010).

Hence, we tested whether Orf507 also interacts with

MtATP6 in yeast two-hybrid assays, and found that there

was a strong interaction between Orf507 and MtATP6

(Fig. 1b).

In vivo interaction between MtATP6 and Orf507 was

also tested using BiFC and Co-IP analyses. Yellow fluo-

rescence signals were observed in leaf tissues via confocal

microscopy when plants were transformed with Agrobac-

teria harboring MtATP6 and Orf507 fused to split halves of

the yellow fluorescent protein (Fig. 1c), indicating that

there is physical interaction between the proteins that

reconstitutes the fluoroprotein. Hence, BiFC assays support

a physical interaction between Orf507 and MtATP6.

For Co-IP analysis, MtATP6 was cloned into PEG201

(HA-tagged), and Orf507 was cloned into PEG202 (FLAG

tagged) vectors. Anti-HA antibody was used for resin

binding (immunoprecipitation), and anti-FLAG antibody

was used for immunoblot analysis. A signal was detected at

22 kDa by anti-FLAG antibody (Fig. 1d), which is possible

only if there is a complex including FLAG-Orf507 and

HA-MtATP6, brought about by the physical interaction of

MtATP6 and Orf507 proteins.

MtATP6 is a mitochondria-targeted protein encoded

in chromosome 4

We next sought to characterize the MtATP6 gene. To map

MtATP6 using a mapping population, we cloned MtATP6

from two parents, RNaky and CA4. The sequencing results

indicated that MtATP6 comprises 278 bp (RNaky) or

275 bp (CA4) with two exons and one intron. A three base

pair deletion was detected in the intron of MtATP6 from

CA4. Based on the sequence variation, allele-specific

markers with two mismatched reverse primers (Table 1)

were designed for genotyping. MtATP6 was mapped on a

region between two markers, NP1234 and TG132 on

chromosome 4 (Fig. 2a).

The Ipsort (http://ipsort.hgc.jp/), TargetP (http://www.

cbs.dtu.dk/services/TargetP/), and ChloroP (http://www.

cbs.dtu.dk/services/ChloroP/) programs were used to pre-

dict the cellular localization of Orf507 interactors, as

shown in Table 2. To confirm this prediction, MtATP6,

NAD-malate dehydrogenase, and ubiquitin carrier like

protein with predicted mitochondrial transit peptides at

their N-termini were fused to GFP. Transient expression of

GFP fusion proteins in the leaves of N. benthamiana was

observed by confocal microscopy. Only MtATP6-GFP

fusion protein was visualized in a mitochondrion-like

organelle (data not shown). To confirm this result, onion

epidermal cell layers were bombarded with the MtATP6-

GFP construct, and stained with MitoTracker. As shown in

Fig. 2b, the co-localization of MtATP6-GFP with mito-

chondrion-specific MitoTracker revealed that the MtATP6-

GFP fusion was found in the mitochondria.

The full-length MtATP6 cDNA consists of a 168 bp

ORF encoding 55 amino acids with a predicted molecular

mass of 6.7 kDa (GenBank Accession number: FJB22040).

Analysis of the predicted amino acid sequence of MtATP6

showed that it has a mitochondrial targeting sequence at the

N-terminus (predicted by PSORT) and one transmembrane

domain (predicted by ENSEMBLE; http://pongo.biocomp.

unibo.it/pongo). In the NCBI GenBank database, MtATP6

homologs were identified in monocotyledonous plants

such as rice (Oryza sativa) and barley (Hordeum vulgare),

as well as in dicotyledonous plants such as A. thaliana

and tomato (Solanum lycopersicum), indicating that

MtATP6 has been highly conserved among higher plants

(Fig. 2c, d).

The transcript of MtATP6 is upregulated in the CMS

line

The expression pattern of MtATP6 was analyzed using

real-time RT-PCR for tissues of Milyang A (CMS line),

Milyang B (maintainer line), and Milyang K (restorer line).

In Milyang A, the transcription level of MtATP6 was about

two times higher than those of other tissues including leaf,

stem, and ovule (Fig. 3a). However, expression of MtATP6

was significantly higher in anthers of Milyang B and

Milyang K (11.8- and 9.1-fold higher, respectively) com-

pared to those of Miyang A or other tissues of Milyang B

Planta (2013) 237:1097–1109 1101

123

and Milyang K. Except for a 2.9-fold difference between

Milyang B and Milyang K stems, expression levels of

MtATP6 were relatively similar in leaves and stems of

Milyang A, Milyang B, and Milyang K (Fig. 3b). Expres-

sion patterns of the gene encoding the b subunit of the F1

section of F0F1–ATP synthase among pepper lines and

tissues were similar to that of MtATP6 (Fig. 3c).

Mitochondria F1F0–ATP synthase activity and ATP

synthesis in the CMS line

The rice homolog of MtATP6 was previously identified as

a subunit of the mitochondrial F1F0–ATP synthase

(Heazlewood et al. 2003). To determine whether the

interaction between Orf507 and MtATP6 affects the

activity of the F1F0–ATP synthase, we tested the activity

of the native ATP synthase in mitochondria isolated from

etiolated seedlings of CMS and restorer lines. Histo-

chemical staining indicated that the activity of F1F0–ATP

synthase in the CMS line was less than half than that of

the restorer line (Fig. 4a). However, similar activity of

succinate dehydrogenase was found in CMS and restorer

lines (Fig. 4a).

To confirm whether mitochondrial ATP synthesis was

also affected in the CMS line, we measured the mito-

chondrial ATP content in etiolated seedlings of CMS and

restorer lines. Mitochondrial ATP levels were decreased in

the CMS line compared to the restorer line (Fig. 4b),

indicating a deficiency of ATP synthesis in CMS

mitochondria.

Bacterial growth inhibition and binding domains reside

in N-terminal and middle regions of Orf507

Previously, it was reported that the CMS-associated ORF

of rice, OrfH79, has a toxic effect in yeast cells (Peng et al.

2009). Here, we found that there was growth inhibition of

bacterial cells harboring Orf507 peptides (Fig. 5a). To

study which part of the Orf507 peptide has a toxic effect on

bacterial growth, partial sequences of Orf507 were cloned

into an expression vector and transformed into the bacteria.

The results showed that the N-terminal sequence has the

highest inhibition activity, although the middle sequence

also showed growth inhibition activity. In contrast, the

bacteria harboring the C-terminal sequence did not show

growth inhibition (Fig. 5a). SDS-PAGE followed by Coo-

massie blue staining showed that the N-terminal and mid-

dle region sequences of Orf507 were expressed abundantly.

However, full-length and C-terminal sequences were not

expressed (Fig. 5b).

As the N-terminal and middle regions of Orf507

exhibited bacterial growth inhibition activity, we per-

formed yeast two-hybrid analyses using partial sequences

of Orf507 and MtATP6 to see whether there is a link

between bacterial growth inhibition and binding activity.

Table 2 Orf456 interactors identified in yeast two-hybrid screening

Selective

media

b-gal

activity

Gene functiona Localizationb

H H Rice mitochondrial ATP

synthase 6 kDa subunit

Mitochondria

L L NAD-malate dehydrogenase Mitochondria

M M Voltage-dependent anion-

selective channel

Mitochondria

H H 60S acidic ribosomal protein With signal

peptide

M L 60S ribosomal RNA L1 Cytosol

M M 60S ribosomal protein, L13 like

protein

No signal

peptide

H H 60S ribosomal protein L15 Mitochondria

L M Elongation factor 1-alpha

subunit

No signal

peptide

L L Elongation factor 1-alpha

subunit

No signal

peptide

M L Elongation factor 1-alpha

subunit

No signal

peptide

L M GDP dissociation inhibitor With signal

peptide

L L Unknown No signal

peptide

L M Unknown No signal

peptide

L M Putative d-adenosylmethionine

decarboxylase proenzyme

No signal

peptide

H H Putative mrp protein, function in

ATP binding

Chloroplast

H H PUR alpha-1 protein No signal

peptide

H M Unknown No signal

peptide

L L Pepper 60S rRNA protein L13a Mitochondria

L L eIF4A No signal

peptide

L L Translation initiation factor No signal

peptide

L L 26S proteasome regulatory

subunit

Chloroplast

L L Histon H3 like mRNA No signal

peptide

M H RNA polymerase No signal

peptide

M L Pepper ATP citrate lyase mRNA Mitochondria

M M Ubiquitin carrier like protein Mitochondria

H high, M medium, L lowa Putative gene function was analysed by SGN website (http://

solgenomics.net/)b Protein localization was predicted by iPSORT, TargetP, and ChloroP

software

1102 Planta (2013) 237:1097–1109

123

The results of the analysis using partial sequences of

MtATP6 revealed that the full-length sequence is required

for physical interaction with Orf507 (data not shown).

However, the results of the analysis using partial sequences

of Orf507 revealed that all of the partial sequences

(N-terminal, middle, and C-terminal) interacted with full-

length MtATP6, albeit with different intensity. The N-ter-

minal region has the highest and C-terminal region has the

lowest binding affinity (Fig. 5c).

Discussion

The failure of CMS lines to develop functional pollen is

associated with mitochondrial DNA rearrangement

(Hanson 1991; Linke and Borner 2005). Rearrangement of

ORFs in chili pepper due to the recombination of mtDNA

was reported by Kim et al. (2001), and a new ORF, Orf456,

was identified and characterized as a candidate gene for

mediating CMS in pepper (Kim et al. 2007). Recently,

further characterization of Orf456 revealed that Orf456

sequence might have been resulted from a sequencing error

at 30 end of Orf507 (Gulyas et al. 2010).

In the present work, yeast two-hybrid screening of a

Capsicum cDNA library, using Orf456 as bait, identified a

number of interacting proteins, including MtATP6 (Fig. 1;

Table 2). Orf507 was also found to physically interact with

MtATP6 in yeast two-hybrid assays. Interaction was fur-

ther verified by in vivo studies, including BiFC and Co-IP

analyses. The interaction between a mitochondrion-enco-

ded protein, Orf507, and a nuclear-encoded protein,

MtATP6, leads us to speculate that regulation of MtATP6

by Orf507 might lead to a decrease or absence of MtATP6

function.

The analysis of interaction between MtATP6 and

Orf507 using the yeast two-hybrid system has limitations,

in that the yeast two-hybrid system often results in false

positives and Orf507, which is a mitochondrial membrane

Fig. 1 Physical interaction of Orf507 with MtATP6. a Interaction of

Orf456, a truncated form of Orf507, with MtATP6 by yeast two-

hybrid analysis. pBD:Orf456 was used as bait and pAD:MtATP6 was

used as prey. Yeast transformants expressing both ‘bait’ and ‘prey’

recombinant proteins were grown on control plates (-Trp/-Leu). Three

different concentrations of yeast cells were then cultured on selective

media (-Trp/-Leu/-His). Protein interactions determined by detection

of the activity of ß-gal are shown in the middle panel. Empty pBD

(bait) and pAD (prey) plasmids were used as negative controls (NC).

pBD:WT and pAD:WT were used as positive controls (PC).

b Interaction of Orf507 with MtATP6 by Yeast two-hybrid analysis.

pDEST32:Orf507 was used as a bait and pDEST22:MtATP6 was used

as prey. Three different concentrations of the yeast grown on selective

media (-Leu/-Trp) were cultured onto Sc-Leu-Trp-Ura plates and

interaction was determined according to the growth of the yeast cells.

Self activation tests were also performed (3rd and 4th panels). PC

(positive control), NC (negative control, empty vectors). c Bimolec-

ular fluorescence complementation (BiFC) assay for the in vivo

interaction of Orf507 with MtATP6. Confocal micrographs of N.benthamiana leaf sections infiltrated with positive control (PC),

negative control (NC), and pSPYNE:Orf507 and pSPYCE:MtATP6

(third panel) are shown. DIC (Differential interference contrast), Chl

(chlorophyll autofluorescence), YFP (Yellow fluorescent protein),

merged (DIC, Chl and YFP). d Co-Immunoprecipitation (Co-IP)

assay to test in vivo interaction of Orf507 with MtATP6. Total protein

obtained from plants infiltrated with PEG201/PEG202, PEG201-

MtATP6, PEG202-Orf507, or PEG201-MtATP6/PEG202-Orf507

was immunoprecipitated with antiHA antibody. The eluted protein

samples were loaded in 15 % SDS-PAGE and immunoblotted with

antiFLAG antibody

Planta (2013) 237:1097–1109 1103

123

protein that may show a different interaction pattern in the

nucleus where protein–protein interaction occurs in the

yeast two-hybrid system (Bruckner et al. 2009). In this

study, five candidates were selected through primary

screening using the yeast two-hybrid method (Table 2).

Among them, only MtATP6 showed strong and specific

interaction with Orf507 in other analyses using BiFC and

Co-IP methods. Interaction of several mitochondrial pro-

teins in yeast two-hybrid assays has also been reported by

other research groups (Marzo et al. 1998; Naithani et al.

2003; Aphasizhev et al. 2003). For example, yeast two-

hybrid analysis was used to determine the interaction of

Bax, which is a mitochondrial membrane protein, with

adenine nucleotide translocator. This interaction was fur-

ther confirmed by co-immunoprecipitation analysis using

solubilized mitochondria, which demonstrated in vivo

interaction (Marzo et al. 1998).

Mitochondrial F0F1–ATP synthase produces and

hydrolyzes most of the cell’s energy; therefore, it is critical

for the survival of all living organisms. In previous studies,

plant mitochondrial F0F1–ATP synthases were separately

purified from spinach, potato, and Arabidopsis, and some

of the genes encoding subunits of the F1 complex were

identified and sequenced (Hamasur and Glaser 1991, 1992;

Jansch et al. 1996; Millar et al. 2001). However, less is

known about the composition of the F0 complex. Rice

MtATP6 (RMtATP6) was purified from the F0 part of

F0F1–ATP synthase by blue native polyacrylamide gel

(Heazlewood et al. 2003), and the gene encoding this

subunit was cloned and identified by Zhang et al. (2003,

2006). RMtATP6 was localized in mitochondria and

increased RMtATP6 was shown to have a role in main-

taining or enhancing the activity of the F0F1–ATP synthase

under salt and osmotic stresses (Zhang et al. 2006). In this

study, we cloned MtATP6 in pepper and mapped it to

chromosome 4. It encodes a protein with 69 % amino acid

identity to RMtATP6. The pepper MtATP6 also was tar-

geted to the mitochondria. Therefore, we conclude that the

nuclear-encoded pepper MtATP6 may be a subunit of F0 in

the mitochondrial F0F1–ATP synthase complex.

Nuclear control of the expression of mitochondrial

proteins is well documented. For instance, a nuclear gene

encoding a mitochondrial protein plays a role in restoration

of fertility (Chase 2007). Mitochondrial regulation of

Fig. 2 Genetic mapping, localization, and sequence analysis of

MtATP6. a Genetic mapping of the MtATP6 locus with allele-

specific markers. The MtATP6 gene was mapped to within a region

between two markers, NP1234 and TG132, on chromosome 4 in

pepper. PCR-based allele-specific marker information is listed in

Table 1. b Transient expression of the MtATP6-GFP fusion in onion

epidermal cells. The left panel shows the differential interference

contrast (DIC) image. The second panel shows the epidermal cells

stained with Mitotracker, a mitochondrial marker. The third panelshows the GFP fluorescence image. The merging of the three images

is shown in the right panel. Scale bar, 10 lm. c Amino acid sequence

alignment of MtATP6 homologs prepared using the ClustalW

program. The transmembrane domain (TMD) is indicated with

asterisks. Hv ATP syn (barley, Hordeum vulgare ATP synthase

6 kDa subunit, cDNA accession number: AK252871); Os (rice, Oryzasativa, GAN: AB055076); Zm (maize, Zea mays, GAN: ACG36451);

At (Arabidopsis thaliana, At3g4643); Ca (pepper, Capsicum annuum,

GAN: FJB22040), Sl (tomato, Solanum lycopersicum, cDNA number:

AK224636); Lu (linseed, Linum usitatissimum, GAN:EU829257).

d Cladogram based on the alignment in c

1104 Planta (2013) 237:1097–1109

123

nuclear genes which is known as mitochondrial retrograde

regulation (MRR) in CMS anthers has been reported sev-

eral times, and some nuclear genes show altered expression

patterns in CMS lines (Carlsson et al. 2007). Expression of

TaFAd encoding the FAd subunit of the F0F1–ATP synthase

is repressed in anthers of CMS plants with Timopheevii

cytoplasm (Xu et al. 2008). MRR may regulate the tran-

scription of nuclear genes involved in pollen and/or

microspore development, energy metabolism, and signal

transduction by altering the expression of nuclear

transcription factors (Linke and Borner 2005; Carlsson

et al. 2007). The expression level of pepper MtATP6 was

much lower in anthers of the CMS lines than anthers from

restorer and fertile lines in which MtATP6 expression was

highly up-regulated compared to leaf and stem tissues.

Another nuclear DNA-encoded gene for an F0F1–ATP

synthase subunit, ATP synthase ß subunit, showed a similar

expression pattern with MtATP6, implying that expression

of genes for complete assembly of the F0F1–ATP synthase

complex may be under MRR. It is not understood clearly

Fig. 3 Expression profiles of MtATP6 in fertile and sterile lines.

Plants were grown for 3 months after germination in green house. The

transcription of MtATP6 and ATP synthase ß subunit was examined

using real-time RT-PCR. Values for expression were normalized to

those of Actin. a Quantification of MtATP6 expression in anthers,

leaves, stems, and ovules in Milyang A. b Quantification of MtATP6expression in anthers, leaves, and stems of Milyang A, Milyang B,

and Milyang K. c Quantification of ATP synthase ß subunitexpression in anthers, leaves, and stems of Milyang A, Milyang B,

and Milyang K

Planta (2013) 237:1097–1109 1105

123

how mitochondria transduce the signal to control the

transcription of nuclear genes in plants. Reduction of

mitochondrial transmembrane potential has been suggested

as one of the signals that affect expression of target genes

in the nucleus (Kuzmin et al. 2004). In yeast, control of

nuclear gene expression by the RTG-dependent pathway

has been well studied using respiratory-deficient cells

lacking mtDNA (Butow and Avadhani 2004). Failure in the

operation of the TCA cycle cues signal transduction to

induce the expression of many nuclear genes, most of

which are required for metabolic compensation. An alter-

native signaling pathway that is independent from regula-

tion of RTG genes has been also suggested. For example,

Fig. 4 Activities of mitochondrial ATP synthase in fertile and sterile

lines. a Histochemical enzymatic staining in native-PAGE gels.

Solubilized mitochondrial proteins (250 lg) isolated from seedlings

of the restorer (F, Milyang B) and sterile (S, Milyang A) lines were

fractioned by native polyacrylamide gel electrophoresis. Gels were

stained with Coomassie brilliant blue (CBB) or incubated with

appropriate reagents to visualize the activities of ATP synthase and

succinate dehydrogenase (Succinate DHase). Quantification of the

enzyme activities is shown below the gels. Data are average of three

independent experiments (average ± SD). b Mitochondrial ATP

contents in fertile and sterile lines (average ± SD)

Fig. 5 Bacterial growth inhibition and binding activity of Orf507.

a The graph represents the growth of bacteria harboring constructs for

expression of the full length (FL), N-terminal region (N0), middle

region (M0), or C-terminal region (C0) of Orf507 before and after

IPTG induction. b Coomassie Brilliant Blue (CBB)-stained gel

showing expression at 3 h after IPTG induction of N0 and M0 regions

of Orf507 (asterisks), but not of FL or C0. M, molecular weight

markers. c Physical interaction of MtATP6 with full-length and

partial sequences of Orf507. Different concentrations of yeast cells

harboring full-length MtATP6 and full-length or partial sequences of

Orf507 were cultured on Sc-Leu-Trp-Ura selection medium. Protein

interaction was determined based on the growth of the yeast cells on

the selection medium. NC represents negative control (empty vectors)

and PC represents positive control

1106 Planta (2013) 237:1097–1109

123

mutation of the Oxa1 protein, which functions in the

assembly of the ATP synthase complex and cytochrome C

oxidase, induces the expression of a nuclear DNA-encoded

ABC-transporter, PDR5 (Zhang and Moye-Rowley 2001).

It is possible that mitochondrial dysfunction that was

caused by the action of Orf507 induced the transduction of

signaling to affect the transcription pattern of nuclear genes

including those for F0F1–ATP synthase subunits. Further

studies are required to explore the direct relationships of

the CMS-related proteins in pepper.

In higher plants, the demand for ATP is highly increased

during pollen development (Sabar et al. 2003), and

decreased mitochondrial ATP synthesis may be a causal

factor in disruption of pollen or microspore development

(Yang et al. 2009). The total amount of ATP is decreased in

reproductive and vegetative tissues of CMS lines compared

to those in maintainer lines of tobacco (Bergman et al.

2000) and rapeseed (Teixeira et al. 2005) although the ATP

to ADP ratio is specifically decreased in floral buds of

CMS tobacco or does not show significant differences

between tissues of rapeseed lines. In addition, the reduced

activity of ATP synthase in etiolated seedlings of CMS

sunflower implies that normal ATP production may be

hampered by CMS-associated gene products (Sabar et al.

2003). However, the link between the action of CMS-

associated gene products and impaired activity of ATP

synthase has not been elucidated experimentally. It was

reported that Arabidopsis transgenic plants expressing

Orf456 in mitochondria display defective pollen develop-

ment and maturation (Kim et al. 2007). The enzyme

activity of F0F1–ATP synthase in the CMS line was spe-

cifically reduced to 38 % that of its restorer line (Fig. 4a).

Mitochondrial ATP synthesis is driven by electron trans-

port in the inner membrane. Destruction of the F0F1–ATP

synthase may also affect electron transport, which would

intensify the disruptions of ATP synthesis. In our experi-

ment, the mitochondrial ATP content in the CMS line was

one half of that in the normal line (Fig. 4b). In a similar

experiment, it was reported that ATP levels are decreased

by 41 % in Saccharomyces cerevisiae expressing OrfH79

from CMS-HongLian rice (Peng et al. 2009). Although our

experiments were performed using mitochondria from eti-

olated seedlings, impaired activity of ATP synthase and

reduced amounts of ATP likely resulted from the action of

the CMS-associated gene product, Orf507, because Orf507

was shown to be normally expressed in etiolated seedlings

(Kim et al. 2007). Therefore, we speculate that the cyto-

plasmic male sterility of Milyang A might be caused by

reduced activity of MtATP6. Thus, our functional analysis

of mitochondrial Orf507 could provide new insights into

the mechanisms responsible for CMS in plants.

Though several studies have been performed to eluci-

date the underlying mechanism of CMS in plants, the exact

mechanism is not known. In one of these studies, it was

reported that a mitochondrial gene, OrfH79, from CMS-

HongLian rice has toxicity to yeast cells, causing growth

inhibition (Peng et al. 2009). We introduced Orf507 into an

E. coli strain and also observed growth inhibition. The

N-terminal region of Orf507 displayed the highest bacterial

growth inhibition. This result is consistent with previous

reports, as CMS-associated genes including T-maize urf13,

sunflower Orf522, radish Orf138, and BT-rice Orf79

encode peptides that are toxic to E. coli (Dewey et al. 1987;

Nikai et al. 1995; Duroc et al. 2005; Wang et al. 2006).

However, the exact link between toxicity of ORFs and

CMS is not understood. It is possible that proteins encoded

by the CMS-associated ORFs disrupt the functions of

proteins required for the pollen development via a mech-

anism that also has toxic effect in bacteria.

The N-terminal and middle region peptides of Orf507

were expressed in E. coli (Fig. 5b). However, expression of

the full length and the C-terminal region was not detected.

To express full length and C-terminal regions of the pro-

tein, we analyzed the frequency of rare codons in the

Orf507 sequence and used different E. coli strains. How-

ever, the sequences were still not expressed. At this point,

we do not know the reason behind the failure of full length

and C-terminal region protein expression in E. coli. The

C-terminal peptide might have a role in inhibiting Orf507

expression, since the protein was able to be expressed in

E. coli when the C-terminal sequence was absent. Fur-

thermore, the yeast two-hybrid data using the partial

sequences of Orf507 showed that the N-terminal region has

the highest binding activity and the C-terminal region has

the lowest binding activity with MtATP6. This suggests

that the N-terminal and middle regions of Orf507 bind

MtATP6 causing it to be nonfunctional and leading to

defective pollen development and consequently CMS.

In conclusion, F0F1–ATP synthase activity was found to

be affected in a CMS line, probably resulting from the

interaction between mitochondrial Orf507 and nuclear-

encoded MtATP6. Dysfunction of this enzyme complex

might impact the increased energy demands during pollen

development, resulting in pollen abortion in the CMS line.

Further molecular analyses of the CMS line expressing

mitochondrial Orf507 should provide insights regarding the

role of MtATP6 in the regulation of F0F1–ATP synthase

activity, as well as the mechanisms underlying CMS in

plants.

Acknowledgments This research was supported by a grant (code:

0636-20120009) from the Vegetable Breeding Research Center

through R&D Convergence Center Support Program, Ministry for

Food, Agriculture, Forestry and Fisheries, Republic of Korea and by

Technology Development Program for Agriculture and Forestry

(code:308020-5), Ministry for Food, Agriculture, Forestry and Fish-

eries, Republic of Korea.

Planta (2013) 237:1097–1109 1107

123

References

Aphasizhev R, Aphasizheva I, Nelson RE, Simpson L (2003) A

100 kD complex of two RNA-binding proteins from mitochon-

dria of Leishmania tarentolae catalyzes RNA annealing and

interacts with several RNA editing components. RNA 9:62–76

Bergman P, Edqvist J, Farbos I, Glimelius K (2000) Male-sterile

tobacco displays abnormal mitochondrial atp1 transcript accu-

mulation and reduced floral ATP/ADP ratio. Plant Mol Biol

42:531–544

Bruckner A, Polge C, Lentze N, Auerbach D, Schlattner U (2009)

Yeast two-hybrid, a powerful tool for systems biology. Int J Mol

Sci 10:2763–2788

Butow RA, Avadhani NG (2004) Mitochondrial signaling: the

retrograde response. Mol Cell 14:1–15

Carlsson J, Lagercrantz U, Sundstrom J, Teixeira R, Wellmer F,

Meyerowitz EM, Glimelius K (2007) Microarray analysis

reveals altered expression of a large number of nuclear genes

in developing cytoplasmic male sterile Brassica napus flowers.

Plant J 49:452–462

Chase CD (2007) Cytoplasmic male sterility: a window to the world of

plant mitochondrial–nuclear interactions. Trends Genet 23:81–90

Dewey RE, Timothy DH, Levings CS (1987) A mitochondrial protein

associated with cytoplasmic male sterility in the T-cytoplasm of

maize. Proc Natl Acad Sci USA 84:5374–5378

Duroc Y, Gaillard C, Hiard S, Defrance M-C, Pelletier G, Budar F

(2005) Biochemical and functional characterization of ORF138,

a mitochondrial protein responsible for ogura cytoplasmic male

sterility in Brassiceae. Biochimie 87:1089–1100

Gagliardi D, Leaver CJ (1999) Polyadenylation accelerates the

degradation of the mitochondria mRNA associated with cyto-

plasmic male sterility in sunflower. EMBO J 18:3757–3766

Gulyas G, Shin Y, Kim H, Lee JS, Hirata Y (2010) Altered transcript

reveals an Orf507 sterility-related gene in chili pepper (Capsi-cum annum L.). Plant Mol Biol Rep 28:605–612

Hamasur B, Glaser E (1991) F1F0-ATPase of plant mitochondria:

isolation and polypeptide composition. Biochem Biophys Res

Commun 170:1352–1358

Hamasur B, Glaser E (1992) Plant mitochondrial F1F0-ATPase:

identification of the individual subunits and properties of the

purified spinach leaf mitochondrial ATP synthase. Eur J

Biochem 205:409–416

Hanson MR (1991) Plant mitochondrial mutations and male sterility.

Annu Rev Genet 25:461–486

Hanson MR, Bentolila S (2004) Interaction of mitochondria and

nuclear genes that affect male gametophyte development. Plant

Cell 16:S154–S169

Hanson MR, Pruitt KD, Nivison HT (1989) Male sterility loci in plant

mitochondrial genes. Plant Mol Cell Biol 6:61–85

Heazlewood JL, Howell KA, Whelan J, Millar AH (2003) Towards an

analysis of the rice mitochondrial proteome. Plant Physiol

132:230–242

Jansch L, Kruft V, Schmitz UK, Braun HP (1996) New insights into

the composition, molecular mass and stoichiometry of the

protein complexes of plant mitochondria. Plant J 9:357–368

Kang WH, Seo JK, Chung BN, Kim KH, Kang BC (2012) Helicase

domain encoded by Cucumber mosaic virus RNA1 determines

systemic infection of Cmr1 in pepper. PLoS One 7:e43136

Kaul MLH (1988) Male sterility in higher plants. Springer, Berlin

Kim DH, Kang JG, Kim S, Kim BD (2001) Identification of coxII and

atp6 regions as associated to CMS in Capsicum annuum by using

RFLP and long accurate PCR. J Korean Soc Hort Sci 2:121–127

Kim DH, Kang JG, Kim BD (2007) Isolation and characterization of

the cytoplasmic male sterility associated orf456 gene of chili

pepper (Capsicum annuum L.). Plant Mol Biol 63:519–532

Kuzmin EV, Karpova OV, Elthon TE, Newton KJ (2004) Mitochon-

drial respiratory deficiencies signal up-regulation of genes for

heat shock proteins. J Biol Chem 279:20672–20677

Li J, Pandeya D, Nath K, Zulfugarov S, Yoo SC, Zhang H, Yoo JH,

Cho SW, Koh HJ, Kim DS, Seo HS, Kang BC, Lee CH, Paek NC

(2010) Zebra-Necrosis, a thylakoid-bound protein, is critical for

photoprotection of developing chloroplasts during early leaf

development. Plant J 62:713–725

Linke B, Borner T (2005) Mitochondrial effects on flower and pollen

development. Mitochondrion 5:389–402

Livingstone KD, Lackney VK, Blauth JR, van Wijk R, Jahn MK

(1999) Genome mapping in Capsicum and the evolution of

genome structure in the Solanaceae. Genetics 152:1183–1202

Marzo I, Brenner C, Zamzami N, Jurgensmeier JM, Susin SA, Vieira

HL, Prevost MC, Xie Z, Matsuyama S, Reed JC, Kroemer G

(1998) Bax and adenine nucleotide translocator cooperate in the

mitochondrial control of apoptosis. Science 281:2027–2031

Millar AH, Sweetlove LJ, Giege P, Leaver CJ (2001) Analysis of the

Arabidopsis mitochondrial proteome. Plant Physiol 127:1711–1727

Naithani S, Saracco SA, Butler CA, Fox TD (2003) Interactions

among COX1, COX2, and COX3 mRNA-specific translational

activator proteins on the inner surface of the mitochondrial inner

membrane of Saccharomyces cerevisiae. Mol Biol Cell

14:324–333

Nikai S, Noda D, Kondo M (1995) High level expression of a

mitochondrial orf522 gene from the male sterile sunflower is

lethal to E. coli. Breed Sci 45:233–236

Pedersen PL, Ko YH, Hong S (2000) ATP synthase in the year 2000;

evolving views about the structures of these remarkable enzyme

complexes. J Bioenerg Biomembr 32:325–332

Peng X, Li F, Li S, Zhu Y (2009) Expression of a mitochondrial gene

orfH79 from the CMS-HongLian rice inhibits Saccharomycescerevisiae growth and causes excessive ROS accumulation and

decrease in ATP. Biotechnol Lett 31:409–414

Sabar M, Gagliardi D, Balk J, Leaver C (2003) ORFB is a subunit of

F1F0-ATP synthase: insight into the basis of cytoplasmic male

sterility in sunflower. EMBO Rep 4:381–385

Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer

and molecular biology. Plant Cell 7:821–831

Teixeira RT, Knorpp C, Glimelius K (2005) Modified sucrose, starch,

and ATP levels in two alloplasmic male-sterile lines of B. napus.

J Exp Bot 56:1245–1253

Wang Z, Zou Y, Li X, Zhang Q, Chen L, Wu H, Su D, Chen Y, Guo J,

Luo D, Long Y, Zhong Y, Liu YG (2006) Cytoplasmic male

sterility of rice with Boro II cytoplasm is caused by a cytotoxic

peptide and is restored by two related PPR motif genes via

distinct modes of mRNA silencing. Plant Cell 18:676–687

Xu P, Yang YW, Zhang ZZ, Chen WH, Zhang CQ, Zhang LX, Zou

SX, Ma ZQ (2008) Expression of the nuclear gene TaFAd is

under mitochondrial retrograde regulation in anthers of male

sterile wheat plants with Timopheevii cytoplasm. J Exp Bot

59:1375–1381

Yang JH, Huai Y, Zhang MF (2009) Mitochondrial atpA gene is

altered in a new orf220-type cytoplasmic male-sterile line of

stem mustard (Brassica juncea). Mol Biol Rep 36:273–280

Young EG, Hanson MR (1987) A fused mitochondrial gene

associated with cytoplasmic male sterility is developmentally

regulated. Cell 50:41–49

Zerbetto E, Vergani L, Dabbeni-Sala F (1997) Quantification of

muscle mitochondrial oxidative phosphorylation enzymes via

histochemical staining of blue native polyacrylamide gels.

Electrophoresis 18:2059–2064

Zhang XX, Liu SK (2003) Identification and characterization of

mitochondrial ATP synthase small subunit gene in rice (Oryzasativa L.). Mol Breed 1:605–612

1108 Planta (2013) 237:1097–1109

123

Zhang X, Moye-Rowley WS (2001) Saccharomyces cerevisiaemultidrug resistance gene expression inversely correlates with

the status of the F(0) component of the mitochondrial ATPase.

J Biol Chem 276:47844–47852

Zhang XX, Takano T, Liu SK (2006) Identification of a mitochondrial

ATP synthase small subunit gene (RMtATP6) expressed in

response to salts and osmotic stresses in rice (Oryza sativa L.).

J Exp Bot 56:1–8

Zhang H, Li SQ, Li P, Wan CX, Chen ZY, Zhu YG (2007) A

Honglian CMS line of rice displays aberrant F0 of F0F1-ATPase.

Plant Cell Rep 26:1065–1071

Planta (2013) 237:1097–1109 1109

123