1

RNA Interference

Department of Animal Science

National Chung Hsing University

Pin-Chi Tang

2

RNA processing in eukaryoteSmall RNAMechanism of RNA interferenceApplication of RNAi

Outline

3

The Analysis of Gene Function

Production of transgenic animals

Deletion of gene from genome

RNA interference

Gene targeting

4

The Central dogma of living Cells-1

5

RNA processing in eukaryote

6Biology, 6th ed., 2000

Transcription in Eukaryotes

7

Transcription in Eukaryotes

RNA polymerases needto interact with a varietyinteract with a variety

of proteinsof proteins

RNA polymerasebinding directly tobinding directly to

promoterpromoter sequences

multiplemultiple different RNApolymerases

a singlea single RNApolymerase

EukaryotesProkarytoes

8

Classes of genes transcribed by eukarytoic RNA polymerase

9

Formation of a polymerase IItranscription complex

TBP: TATA binding proteinTAF: TBP-associated factorsD: TFIIDB: TFIIBF: TFIIF

E: TFIIEH: TFIIH

At least 5 TFs are required forinitiation of transcription by RNApolymerase II in reconstituted in vitrosystem

The Cell, 1st ed., 1997

Transcription in eukaryotes

10

Transcription in eukaryotes

The Cell, 1st ed., 1997

Transcription of polymerase III genes

11

Transcription in eukaryotes

The Cell, 1st ed., 1997

Regulation of transcription in eukaryotes

Promoters and enhancersRegulatory proteins

Activators

Eukaryotic repressors

Chromatin structure

DNA methylation

12The Cell, 1st ed., 1997

Transcription in eukaryotes

Processing of rRNA

13The Cell, 1st ed., 1997

Transcription in eukaryotes

Site ofSite of a.aa.a. attachment. attachment

Processing of tRNAin prokaryotes and eukaryotes

14

Processing of tRNA - Modification of bases

Transcription in eukaryotes

The Cell, 1st ed., 1997

15

Transcription in eukaryotes

The Cell, 1st ed., 1997

Processing of eukaryotic mRNAs

Aligns mRNA on the ribosome during translationAligns mRNA on the ribosome during translation

16The Cell, 1st ed., 1997

Transcription in eukaryotes

Formation of the 3’ends of eukaryotic mRNAs

polyadenylationpolyadenylation signalsignal

StabilityStabilityTranslationTranslationRegulationRegulation

17

Transcription in eukaryotes

The Cell, 1st ed., 1997

Splicing of eukaryotic pre-mRNAs

18

Transcription in Eukaryotes

19

Small RNA

20

RNA worldRNA worldbefore the evolution of DNA

The discovery of catalytic RNA molecules

NonNon--proteinprotein--coding RNA molecules havecoding RNA molecules havebeen identifiedbeen identified

Acting aloneActing aloneororwith proteins, such aswith proteins, such as RNPsRNPs

(ribonucleic proteins(ribonucleic proteins))

21

Short interfering RNAs (siRNAs)

Micro RNAs (miRNAs)

regulate gene expressionregulate gene expression

at a postat a post--transcriptional leveltranscriptional level

in a sequencein a sequence--specific mannerspecific manner

22Plant Cell 2:279-289, 1990

A control (parental) V26 flower is

shown along with four different CHS

(chalcone synthase) transgenotes.

Four representative flowers are

shown in a row for each of four

transgenotes, identified at the left

of each row.

Phenotypes of chimeric CHS transgenotes and

variations among flowers on single plants

23Plant Cell 2:279-289, 1990

Heritability and variation among progeny of CHS transgenotesback-crossed to V26 (Parental).

24Plant Cell 2:279-289, 1990

Developmental pattern of expression of endogenous CHS messagesin violet flowers from control plants.

M 15mm 30mm 40mm 53mm 58mm 58mm

25

Developmental pattern of expression of introduced and endogenousCHS messages in white flowers of transgenote218.38.

Plant Cell 2:279-289, 1990

Lane 1: molecular weight marker

Lane 2: the undigested probe

Lane 3: a 40-mm corolla controlRNA

Lanes 4 through 9: contain RNaseprotected RNA fromcorollas of 218.38 flowers15 mm, 30 mm, 40 mm,53 mm, and 58 mm (twosamples) in length,respectively.

Lane 10: is a tRNA negative control

E: the endogenous CHS-protectedfragment at 96 bases

I: the introduced CHS-protectedRNA at 157 bases

P: the radiolabeled probe at 208bases

26

Comparison of steady-state CHSmessage levels in violet and whiteflowers from transgenote 218.41.

Plant Cell 2:279-289, 1990

Lane 1: molecular weight standard

Lanes labeled "2“: RNase protections ofRNA isolated from three separate40-mm-long violet revertantcorollas

Lanes labeled "3“: RNase protections of RNAisolated from three separate 40-mm-long white corollas

E: the position of the protected fragment forthe endogenous CHS transcript

I: the position of the protected fragmentfor the introduced CHS transcript.

27

The phenomenon ofpostpost--transcriptional gene silencingtranscriptional gene silencing

(PTGS)

•PTGS is ubiquitous in both the animal andplant kingdoms

•PTGS is responsible for important biologicalfunctions

•As a tool for the knocking out of geneexpression in the field of functional genomics

28

co-suppressionTomato

Polygalacturonase geneFruit ripening

Tobacco plantTransformed with -1 ,3-glucanase gene

Decrease in mRNA

C. elegansIntroduction of antisense or sense RNA intoembryos

29

Quelling

Neurospora crassa - fungusTransformation of albinoTransformation of albino--1 gene1 gene

Carotene biosynthesis, andintense orange phenotype

expectedexpected

~30 % albinoresultresult

30

Discovery of miRNAs

The first miRNA was discovered in C.elegans by Victor Ambros and his group.

They describe the identification of thefirst miRNA, lin4, and report thesequence complementarily between lin-4and the 3’UTR of the lin-14 mRNA.

>cel-lin-4 MIMAT0000002UCCCUGAGACCUCAAGUGUGA

(Cell,1993. 75, 843-854)

(by Dr. J. F. Lin)

31

Discovery of miRNAs

Lin4

Lin14

Life cycle of C.elegans

Science 1984. 226, 409

Lin4 and Lin14 were identified ina genetic screen for defects inthe temporal control of post-embryonic development.

Disrupt of Lin4 block L1L2

Disrupt of Lin14 promote L1L2

(by Dr. J. F. Lin)

32

Discovery of miRNAs

Lin4 encodes a 22-nucleotide non-coding RNA

Lin4 is partially complementary to 7 conserved sites located in 3’UTR of Lin14

Nature 2004 5:522

33

Gene transfer technology

Potent and unexpected responsesto foreign nucleic acids

The ability of some transgenes tosilence the expression of

homologous loci

34

Discovery of miRNAs

New Insight in Gene regulation

DNA

RNA

Protein

Transcription

Translation

replication Genomic DNA silencing-Methylation

Transcription control-Template recognition (TF and promoter)

RNA half-life (RNA degradation)-PolyA protection-RNA binding protein

Post-transcriptional regulation-microRNA

Protein half-life (Protein degradation)-Ubiquitination-SUMOlation

Protein sortingProtein-Protein Interaction

(by Dr. J. F. Lin)

35Nature 391:806-811, 1998

Effects of mex-3 RNA interference on levels of the endogenous mRNA

a. Negative controlb. Embryos from uninjected parent (showing normal pattern of endogenous mex-3 RNAc. Embryos from a parent injected with purified mex-3B antisense RNAd. Embryos from a parent injected with dsRNA corresponding to mex-3B

36

Microinjection of ds-ntl affects distribution of the endogenous mRNA.Ventral views are shown for the 6 hpf embryos. The other embryos areviewed from the dorsal side with anterior to the left. Arrowheads markequivalent positions of the notochord.

Biochem. Biophysiol. Res. Commun. 263:156-161, 1999

6hpf 10hpf 14hpf

Non-injected

Injected

zebrafish

37Nature 418:244-251, 2002

Double-stranded RNA can be introduced experimentally tosilence target genes interested

38

dsRNA triggers an interferon responseinterferon response

dsRNA

Activation of RPK

Inactivation of EIF2a

Activation of the 2’, 5’oligoadenlyate synthetase

RNase L activation

Non-specific suppression of translation

Apoptosis

39Apoptosis 5:107-114, 2000

Mechanism of PKR-induced apoptosis

(A) PKR activation regulates translational and transcriptional pathwaysresulting in the specific expression of selected proteins that triggeredcell death by engaging with the caspase pathway.

dsRNA responsive protein kinase

40Apoptosis 5:107-114, 2000

Mechanism of PKR-induced apoptosis

(B) Through an unknown mechanism,upon PKR activation, FADD recruitsprocaspase 8, activating it to its activeform, caspase 8 then in turn, activatesdownstream caspases such as caspase 3,6, 7, which cleave multiple targetstriggering cell death. Role of the caspase 9pathway in these events is unknown.

41Nature Cell Biology 2:70-75, 2000

MmGFP dsRNA specifically abrogates the expression of MmGFPin the MmGFP transgenic embryos

transgenic mouse embryos

Injected MmGFP dsRNA

Injected c-mos dsRNA

42Nature Cell Biology 2:70-75, 2000

Injection of E-cadherin dsRNA into the zygote reduce E-cadherinexpression and perturbs the development of injected embryos

Injected MmGFP dsRNA Injected E-cadherin dsRNA

43

Western blot analysis of E-cadherin expression

Nature Cell Biology 2:70-75, 2000

44Development 127:4147-4156, 2000

Effect of Mos and Plat dsRNA on the relativeabundance of Mos and Plat transcripts.

1. Uninjected oocytes2. Oocytes injected with Mos dsRNA at t=20 h3. Oocytes injected with Plat dsRNA at t=20 h4. Oocytes injected with water at t=20 h5. Uninjected oocytes at t=20 h

45Development 127:4147-4156, 2000

1. Oocytes injected with water2. Oocytes injected with sense RNA3. Oocytes injected with antisense RNA4. Oocytes injected with dsRNA5. Uninjected oocytes

Effect of Mos and Plat sense, antisense and dsRNA on therelative abundance of Mos and Plat transcripts.

Injected 106 molecules

Injected 105 molecules

46

Effect of Mos sense, antisense and dsRNA on MAPkinase and MPF activities.

Development 127:4147-4156, 2000

Oocytes were injected with 106 mol., or 105 mol. of either Mos sense, antisenseand dsRNA.

BA

47

Dicer participates in RNAi.

Nature 409:363-366, 2001

Extracts from S2 cells transfected withCasp9 dsRNA or Dicer dsRNA

48

Biogenesis of miRNAs

(Nature 2004 5:522 )

Dorsha/ Dicer: RNase-III enzyme

Exportin5: Ran-GTP dependentcargo transporter

RISC: RNA-induced silencingcomplex

(by Dr. J. F. Lin)

49

Biogenesis of miRNAs

•Transcriptional regulation:–Polymerase II transcription–Three types of miRNA•Intronic miRNAs–Transcriptional regulated with same promoter of its host

gene

•Polycistronic cluster miRNAs–Own promoter

•Intergenic miRNAs–Own promoter

(by Dr. J. F. Lin)

50

Biogenesis of miRNAs•Intronic miRNAs

(http://www.usc.edu/programs/pibbs/site/faculty/ying_s.htm)

(by Dr. J. F. Lin)

51Biochem. Biophy. Res. Comm. 287:1099-1104, 2001

Different constructs affect the effect of RNAi

MosMos inverted repeatinverted repeat

52Biochem. Biophy. Res. Comm. 287:1099-1104, 2001

Different constructs affect the effect of RNAi

53

Genetic and biochemical data indicate apossible two-step mechanism for RNAinterference (RNAi):

an initiation stepinitiation stepan effectoreffector stepstep

How does RNAi work?

54

http://www.nature.com/nrg/journal/v2/n2/animation/nrg0201_110a_swf_MEDIA1.html

Nature Reviews Genetics 2: 110-119, 2001

A model for the mechanism of RNAi

Guide sequences

55

A model for the mechanism of RNAi from siRNA

56Gene Therapy 13:478-486, 2006

miRNA processing and RNAi in mammals.

57

The RNAi pathway.

RISC: RNA induced silencingcomplex

miRNP: RISC-likeribonucleoprotein particles

58

Actions of miRNAs

Precursor miRNA

Dicer

21-23nt miRNA

Inhibit Translation Cleavage of target mRNA Deadenylation of target mRNA

(by Dr. J. F. Lin)

59

A model for the mechanism of RNAi from miRNA

60

Application of RNAi

61

Design of dsRNA triggersAvoidAvoid regions of the mRNA which might bind RNA

regulatory proteins, such as 55’’and 3and 3’’UTRUTR;

Avoid regions close to the start site (<100 nt):between +100 (AUG as +1) to the stop+100 (AUG as +1) to the stop codoncodon.

23 nt, the consensus 55’’--AA[N19]UUAA[N19]UU--33’’.

Sequence of <70% , >30% GC<70% , >30% GC , ideally 50%50%

Avoid highly GAvoid highly G--richrich

End with two 3two 3’’22--deoxythymidinedeoxythymidine residues

Select 33--6 sequences6 sequences per gene

Perform a BLASTBLAST

62

Delivery of dsRNA triggers

TransfectionTransfection reagentsreagents

Retroviral integrationRetroviral integration

TransposonTransposon hoppinghopping

Homologous recombinationHomologous recombination

Random plasmid integrationRandom plasmid integration

FeedingFeeding

63

‧Investigation of gene function

high-throughput genetic screen

‧Potential therapeutic tool

The applications of RNAi

64Nature Biotech. 21:629-630, 2003

RNA silencing pathways.

65Nature Biotech. 21:639-644, 2003

Target sites for HBV transcripts

Schematic of U6 promoterconstructs

Predicted folding of HBVU6no.2

66Nature Biotech. 21:639-644, 2003

HBsAg measurements in medium of shRNA-treated cultured cells

67Cancer Cell 2:17-23, 2002

Potential applications of RNAi in mammalians

68Gene Therapy 13:478-486, 2006

The potential uses of RNAi in ES cells.

69Gene Therapy 13:464-477, 2006

Schematic diagram to illustrate siRNA targets important for tumor-host interaction.siRNA technology can be used to target molecules that are important for tumorangiogenesis, invasion, metastasis and immune evasion.