Routine Molecular Epidemiology Routine Molecular Epidemiology for Enhanced Detection and for Enhanced Detection and

Control of Foodborne OutbreaksControl of Foodborne Outbreaks

Lee H. Harrison, MDLee H. Harrison, MD

Associate ProfessorAssociate Professor

Departments of Epidemiology and Departments of Epidemiology and MedicineMedicine

University of PittsburghUniversity of Pittsburgh

What is molecular epidemiology in infectious diseases?

PurposePurpose: : Determine modes of Determine modes of transmission and source of infectiontransmission and source of infection

PrincipalPrincipal: : Exploit pheno-/genotypic Exploit pheno-/genotypic differences between strains differences between strains

PracticePractice: : Molecular subtypingMolecular subtyping of of bacterial/fungal/viral/parasitic isolatesbacterial/fungal/viral/parasitic isolates

Molecular Epidemiology in Infectious Diseases: Why molecular methods?

Previously used methods:Previously used methods: – antimicrobial susceptibility patternsantimicrobial susceptibility patterns– serologic/biochemical typingserologic/biochemical typing

Examples:Examples:– 95% of invasive 95% of invasive H. influenzaeH. influenzae were serotype b were serotype b– L. monocytogenesL. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b): 3 major serotypes (1/2a, 1/2b, 4b)

Molecular Epidemiology in Infectious Diseases: Basic Types of Methods

Genotypic methodsGenotypic methods– DNA basedDNA based

– Heritable and stableHeritable and stable

– Not affected by isolation/culture conditionsNot affected by isolation/culture conditions Phenotypic methodsPhenotypic methods

– Rely on expressed characteristicsRely on expressed characteristics

– Affected by isolation/culture/test conditionsAffected by isolation/culture/test conditions

Molecular Epidemiology in Infectious Diseases: Common Methods

Analysis of chromosomal DNAAnalysis of chromosomal DNA– Restriction Restriction endonuclease analysisendonuclease analysis ( (REAREA))– Pulse field gel electrophoresis (PFGE)Pulse field gel electrophoresis (PFGE)– Restriction fragment length polymorphism (RFLP)Restriction fragment length polymorphism (RFLP)– rDNA gene restriction patterns (ribotyping)rDNA gene restriction patterns (ribotyping)– Nucleic acid sequencingNucleic acid sequencing– Nucleic acid hybridization of entire genomeNucleic acid hybridization of entire genome

Molecular Epidemiology in Infectious Diseases: Common Methods

Analysis of plasmid DNAAnalysis of plasmid DNA– Plasmid sizePlasmid size

– Restriction digestsRestriction digests Protein analysisProtein analysis

– Outer membrane protein (OMP) analysisOuter membrane protein (OMP) analysis

– Multilocus enzyme typing (MLE)Multilocus enzyme typing (MLE)

Click for larger picture

Recognition Sequences ofRecognition Sequences ofSelected Restriction EndonucleasesSelected Restriction Endonucleases

EndonucleaseEndonuclease

EcoREcoR I I

HindHind III III

HhaHha II II

Sequence Sequence GAATTC GAATTC

CTTAAG CTTAAG

AAGCTTAAGCTT

TTCGAATTCGAA

CCGGCCGG

GGCCGGCC

SourceSource

Escherichia coliEscherichia coli RY13 RY13

H. influenzaeH. influenzae Rd Rd

H. parainfluenze H. parainfluenze

DNA Cutting by DNA Cutting by HIND HIND III: StaggeredIII: StaggeredCuts Leaving “Sticky” EndsCuts Leaving “Sticky” Ends

TTCGAATAAGCTTCCCTGAGAAGCTTATTCGAAGGGACTC

TTCGAATA AAGCTTATTCG

AGCTTCCCTGAG AAGGGACTC++

General principals of molecular subtyping General principals of molecular subtyping using restriction endonucleasesusing restriction endonucleases

ElectrophoresisElectrophoresis

= Restriction endonuclease (“molecular scissors”)= Restriction endonuclease (“molecular scissors”)

..

..

.. ....

.. ..

..

..

.. = DNA sequence recognized by restriction endonuclease= DNA sequence recognized by restriction endonuclease

Bacterial chromosomal DNABacterial chromosomal DNA

Molecular Epidemiology in Infectious Diseases: Common Methods

Nucleic acid detectionNucleic acid detection –Plasmid sizePlasmid size

–Restriction digestsRestriction digests Phage typingPhage typing

Pulsed-Field Gel ElectrophoresisPulsed-Field Gel Electrophoresis

Genetic relatedness (dendrogram) analysisGenetic relatedness (dendrogram) analysis

Molecular Epidemiology in Infectious Diseases: Interpretation of Data

Heterogeneity within speciesHeterogeneity within species

Must have knowledge of frequency distribution Must have knowledge of frequency distribution

of subtypesof subtypes

Utility of individual method is species specificUtility of individual method is species specific

Molecular Epidemiology in Infectious Diseases: Requirements

Method must work with vast majority of isolatesMethod must work with vast majority of isolates

ReproducibilityReproducibility

Discrimination powerDiscrimination power

Ease of methodEase of method

Ease of interpretationEase of interpretation