Screening of Splicing Events Using Blat Search and the Functions of Splicing Events Dr. A.H.M. Khurshid AlamDepartment of PharmacyRajshahi University

Outline

Chapter-IGeneral Introduction

Nucleic AcidNucleic acids (AA) are colorless, amorphous, high molecular-weight polymers. Chemically, NA are non-protein nitrogenous biomolecules consist of a chain of nucleotides. In other words, NA is a polymer of nucleotides and each nucleotide has the following structure-

All living organisms contain nucleic acid in the form of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) A sugar moietyNitrogenous base (purine and pyrimidine)Inorganic phosphate group

1. A sugar Moiety (Cyclic 5-member carbon sugar): The sugar present in NA is pentose. In case of DNA, deoxyribose is present and in case of RNA, it contains ribose.

2. Nitrogenous bases:Nitrogenous bases attached to the 1 carbon atom of the sugar by a nitrogen glycoside bond. The bases found in the NA are of 2 typesPyrimidine base-they have a single heterocyclic ringPurine base-they have two fused ring

In DNA Pyrimidines are Thymine (T) Cytosine (C) Purines are Adenine (A) Guanine (G) Base

In RNA Pyrimidines are Uracil (U) Cytosine (C) Purines are Adenine (A) Guanine (G)

3. An inorganic phosphate group: It is attached to the 5 carbon atom of the sugar by a phosphodiester linkase.

How the term Nucleic Acid is derivedMiescherAltman

Classification of NAAccording to the nature of sugar, NAs are generally classified into 2 main groups-The pentose nucleic acids or ribonucleic acids (RNA) containing riboseDeoxypentose nucleic acids or deoxyribonucleic acids (DNA) containing 2-deoxyribose

Isolation of NASat. with NaCl

Components of NAThe following chart shows the nature of the products obtained by hydrolysis of NA

DNA (Deoxyribonucleic acid ) is a nucleic acid containing the genetic instructions used in the development and functioning of all known living organisms.

DNA consists of two long polymers of simple units called nucleotides, with backbones made of sugars and phosphate groups joined by ester bonds. These two strands run in opposite directions to each other and are therefore anti-parallel. DNAChemical structure of DNA.

RNA (Ribonucleic acid) is made up of a long chain of components called nucleotides. Each nucleotide consists of a nucleobase, a ribose sugar, and a phosphate group.

The sequence of nucleotides allows RNA to encode genetic information. All cellular organisms use messenger RNA (mRNA) to carry the genetic information that directs the synthesis of proteins. RNAChemical structure of RNA.

Central DogmaCentral dogma was first stated Francis Crick in 1958 and the hypothesis was "DNA makes RNA makes protein."

Gene : A segment of DNA that carry genetic information are called genes. A gene is a molecular unit of heredity of a living organism.

So far, as many as 15 different genes have been associated with eye color inheritance. Some of the eye-color genes include OCA2 and HERC2. The once-held view that blue eye color is a simple recessive trait has been shown to be incorrect. Gene

Most of Genes are Fragmented in EukaryotesGenes are fragmented in human genome, avr. 10 exons

Exons: avr. 145 bp length and mainly responsible for protein

Introns: avr. 3,365 bp length, non protein coding region, and removed by splicing

Splicing Connects Two Exons Molecular Biology of the CELL, 5th editionA

Many Isoforms From a Single Gene by Splicingeg. Drosophila DSCAM (Down Syndrome Cell Adhesion Molecule) gene Each single gene generates a single transcript (protein)

Human genome would have almost 100,000 genes which produce at least 100,000 proteinsAfter completion of human genome in 2003, researchers found app. 25,000 genes but protein numbers were 100,000Alternative splicingThis basic disproportion is of

Types of Alternative SplicingLi Q et al., Nature Reviews Neuro.; 2007Five types of splicing patterns such as intron retention, alternative 5' and 3' splice site selections, skipping exon, and mutually exclusive exonIn addition, two more splicing patterns eg. alternative promoters and alternative poly-A sites are also present70% of human genes are alternatively splicedExons are represented by boxes and introns by solid lines

Exon2Exon3Exon2Exon3Exon1Exon1Alternative splicingAlternative Splicing Generates Multiple Isoformseg. skipping exonExon3Exon1

Regulation of Alternative SplicingTwo important factors such as cis-acting elements and trans-acting factors are necessary for splicing regulation

Cis-acting elements, eg. exonic and intronic splicing enhancers (ESE and ISE) and silencers (ESS and ISS) are present in exon and intron

Trans-acting factors, serine-arginine-rich proteins (SR proteins), SR-like proteins and heterogeneous nuclear ribonucleoproteins (hnRNPs)Black et al., Annual Reviews of Biochem.; 2003

P19 Cells and DifferentiationP19 cells are derived from a teratocarcinoma of mouse embryo

The genetic composition of the cells can be easily manipulated

It is easy to grow and maintain in the undifferentiated state

It can efficiently be induced to differentiate into many cell types

RA and cell aggregation can induce to differentiate into neurons & glial cells

Reason And Objective of This Study

The early responses of transcriptional regulation in neural differentiation of P19 cells are known a bitNothing is known about the early response of alternative splicing in neural differentiation of P19 cells To investigate the machinery of splicing factors during differentiationReasonObjectiveRegulation of splicing mechanism by splicing factors is known a bit but no report by alternatively spliced isoforms during differentiation(Chapter-IV)To clarify the biological function of alternative splicing in early stage of neural differentiation of P19 cells(Chapter-III)There is no report about the biological function of alternative splicing in early stage of neural differentiation

Experimental and DiscussionChapter-II: Screening Alternatively Spliced Genes to Identify Early Responses in Neural Differentiation of P19 Cells Chapter-III: Biological Function of Alternative Splicing in Neural Differentiation of P19 Cells Chapter-IV: Study Mechanism of Alternative Splicing

Chapter-IIScreening Alternatively Spliced Genes to Identify Early Responses in Neural Differentiation of P19 cells

P19 Cells and Neural InductionP19 cells: Embryonic carcinoma (EC) cell line derived from mouseRetinoic acid (RA) & Cell aggregationDifferentiate into neurons & glial cellsRA and/or cell aggregationTo know whether RA and/or cell aggregation have independent effect in early stage of neural differentiation of P19 cells

Teramoto et al., Oncology Report; 2005So Far Published Results Many gene transcripts are expressed in different cells including P19 cells during neural differentiation

Some of them are up-regulated or down-regulated during neural differentiationUp-regulation or down-regulation of gene transcripts are based on RA treatment and/or cell aggregation Takeyama et al., Biochem. Biophy. Res. Comm.; 1996

Reason And Objective of This StudyThere has been no report about the early responses for alternative splicing in P19 cells during neural differentiationTo find out the alternatively spliced isoforms which have early responses in neural differentiation of P19 cellsTo test whether these early responses of isoforms are RA and/or cell aggregation dependentReasonObjectiveRA alone changes alternative splicing of some genes in different cells but nothing is known in P19 cellsThere has been no report about the effect of cell aggregation on alternative splicing in cells (including P19 cells) and tissues

Experimental Methods (Chapter-II&III)

List of Tested Genes and Their Primers

GenesPrimers NameSequences (5' 3')Annealing temp CNo. of cycles5-HTR3-A5-HTR3-AE8S5-HTR3-AE9ASGGCACCTGGTCCTAGACAGAGAGGTAGCCCTCTTCCACCA5830mHuCmHuC E6SmHuC E7ASTTTGCTCAATATGGCCTACGTTGTACACGAAGATGCACCAG5735RBM25RBM25E3SRBM25E6ASAGAGGGCCGCGAAGACAGTAGGAGGGCGATTCAAATGAG5830RBM25E 8SRBM25E10ASTGATGAAAATTGTGGCCCTAGCCTTTGTCTTGGCATCAAC58RBM25ETer. 1SRBM25ETer. 1ASRBM25ETer. 2ASCCCGAGAGATCAGCAAATTCGAACAATTAGCAATGGCCACTATTCCCTTTCACGATCTCTGCT6030MAPK12MAPK12E4SMAPK12E7ASCATGAAGCATGAGACCCTGACCGGGTTACCACATATCCTG5532ACTN1ACTN1EF1aSACTN1EF2ASCGCCTCTTTCAACCACTTTGAGAGTTTGCCCAAATCATGA6027LGI1LGI1E1SLGI1I2ASLGI1E2ASLGI1E3ASGCACCGTTCCTCCTGATGTATACATGCCATATTGTTCTTGGGCACCGACTTAGCACATCAAGGAGTTCGACGTA6026LGI1E5SLGI1E6ASTCAAAGGCCTGGATTCCTTAATTCCACCAGCCACTTCAAC6026LGI2LGI2E1SLGI2E2ASCCACTTGCAGCTGTACCAAGGGAAAACATTCGGTCCTTGA5828LGI2E4SLGI2E6ASCCTCCGTGACCTGACTCACGTCAAGCTGGTCACTTCGTT5828LGI2E6SLGI2E7ASCTTAAGGGGTAATAAATTTGAATGTGACGTTCTTGGAGTTGAACGTG6025LGI3LGI3E1SLGI3E1ASLGI3E3ASAGTAGTTGCGGTCCCAGTTCCCTCTGAACAGGTTCTTGGAAGGCTCCATCCTGGATCT6025LGI4LGI4E1SLGI4E2ASLGI4E3ASTCCTGCTCCAAGGAGAACACGTGCAATGACGGCATCTTTAATGAAGGCATCACCCTCAAT6030LGI4E6SLGI4E7ASLGI4E8ASCTGCCGTTGCTCAGATACAAGTTGAGGCCAGCTTGAACTTTGTGAGGTTCCCCCTGATAG6030CUGBP2CUGBP2E11SCUGBP2E12ASGAGCCACTGTCGGATTGAATCTGAATGGAGGACTTGGCGC6030CUGBP2E13SCUGBP2E15ASCACTGCCCACTTTGTACAGCCTGATCCTAACCCCAGAAGC6028CUGBP1CUGBP1RRM3CUGBP1TerGCAGAGTATTGGTGCTGCTGGTCTCAGAGGGGAGCACTCA6028PTBPTBE7SPTBE9ASGCATCGACTTCTCCAAGCTCAGGTGCTGGGAATTCTGTCC6028Fgf8Fgf8E2SFgf8E3ASTGTTGCACTTGCTGGTTCTCCGGCTGTAGAGCTGGTAGG6032

Investigate Alternative Splicing Events Using Blat Search 55 alternative splicing events among 36 genes3 genes (5-HT3R-A, ACTN1 and CUGBP2) were clearly found to be changed within day 1However, alternative splicing of PTB changed slightly within day 1Blat search result after using Ref. Seq of a gene

Genomic Organization of 4 GenesWe studied several genes in P19 cells during neural differentiation. Among them, 4 genes showed different responses in early stage of neural differentiation of P19 cells

1234567891011121314151234567891011212012131415161718191. 5-HT3R-A2. ACTN13. CUGBP25-HT3R-A belongs to the family of ligand- gated ion channels It has 9 exonsIt has 3 splice site selection in exon 9It is expressed in neuron

Actinin Alpha 1 is a homodimeric moleculesIt has 21 exons It has mutually exclusive exons of 18 & 19It is expressed in neuron

CUGBP2 is a member of RNA-binding proteinsIt has 15 exons It has both 3 an 5 splice site selections of exon 11 and 12It is highly expressed in heart and also in neuron

PTB is a polypyrimidine tract binding proteinIt has 14 exonsIt has skipping exon 8

Cell aggregationRA treatmentNeural differentiationCUGBP2PTBACTN15-HT3R-AWhy 4 Genes?Any changes?

Expression Patterns of Isoforms of 5-HT3R-A in P19 Cells during Neural DifferentiationExon 9 (+) isoform is up-regulated within day15-HT3R-A gene89Exon 9 (+)Exon 9 (-)

5-HT3R-A-actinExpression of Isoforms of 5-HT3R-A in Early Stage of P19 CellsThe exon 9 (+) isoform is not detected, but it is up-regulated from 3 to 12 hours followed by down regulation upto 24 hours, after the induction of P19 cells and reaches 17% of total 5-HT3R-A (+ & -)

Exon 9 (-) isoform is up-regulated from 3 hours to 24 hoursExon 9 (+)Exon 9 (-)

Exon 9 (-)5-HT3R-A -actinRA and/or Cell Aggregation on Alternatively Spliced Isoforms of 5-HT3R-APercentage of exon 9 (+) Percentage of exon 9 (-) RA alone increases 15% of exon 9 (+) isoformRA alone up-regulates exon 9 (+) isoformExon 9 (+)

SummaryExon 9 (+) of 5-HT3R-A is alternatively spliced within day1 in differentiated P19 cellsThe amount of exon 9 (+) was maximum at 12 hours and reaches 17% when compared with at 0 hoursRA alone up-regulates the transcripts of 5-HT3R-AExon 9 (-) was the major product of 5-HT3R-AExon 9 (+)Exon 9 (-)RA increases the exon 9 (+), whereas decreases the exon 9 (-)

Expression Patterns of ACTN1 Gene in P19 Cells during Neural DifferentiationSM isoform of ACTN1 is up-regulated within day 1ACTN1 geneEF1aSMEF2NM = Non-muscle, SM = Smooth muscleNMNM

RA and/or Cell Aggregation on Alternatively Spliced Isoforms of ACTN1SM typeNM typeACTN1-actinRel. mRNA, ACTN1Cell aggregation alone affects the NM and SM isoforms of ACTN1Cell aggregation increases and decreases 25% NM & SM isoforms of ACTN1

SM type of ACTN1 is alternatively spliced within day1The amount of SM was maximum whereas the amount of NM was minimum at 12 hours and SM type reaches 18%Cell aggregation alone up-regulates SM type, in contrast cell aggregation down-regulates NM type in early stageSummaryNM type was major product of ACTN1

Expression Patterns of CUGBP2 Gene in P19 Cells during Neural DifferentiationExon 11 (+) and exon 11 (-) of CUGBP2 are regulated in early stageExon 11 (-)Exon 11 (+)

Expression of Isoforms of CUGBP2 in Early Stage of P19 CellsExon 11 (+) isoform was up-regulated upto 18 hours, followed by down-regulation from 18 hour to 24 hours

Exon 11 (-) isoform was down-regulated upto 12 hours then up-regulated from 12 to 24 hours

The changes of relative amount of exon 11 (+) and exon 11 (-) isoforms reach 15% of total CUGBP2

RA and/or Cell Aggregation on Spliced Isoforms of CUGBP2Each treatment affects exon 11 (+) and exon 11 (-) of CUGBP2 -actinCUGBP2Exon 11 (-)Exon 11 (+) Percentage of exon 11 (+)Percentage of exon 11 (-)Each treatment increases and decreases 25% exon 11 (+) & exon 11 (-) of CUGBP2

Exon 11 (+) and exon 11 (-) of CUGBP2 is alternatively spliced within day1The amount of exon 11 (+) was maximum whereas the exon 11 (-) was minimum at 12 hours and both isoforms change 15%Each treatment up-regulates exon 11 (+), in contrast each treatment down-regulates exon 11 (-) in early stageSummaryThe exon 11 (+) was major products of CUGBP2

RA and/or Cell Aggregation on Alternatively Spliced Isoforms of PTBRA and /or Cell aggregation is independent of PTB isoformsExon 8 (-)Exon 8 (+)-actinPTBmRNA789797PTB geneExon 8 (+)Exon 8 (-)89

Possible Mechanism of RA and/ or Cell Aggregation on Alternative Splicing RA treatment alone or cell aggregation alone or each treatment changes alternatively spliced isoforms

Chapter-IIIBiological Function of Alternative Splicing in Neural Differentiation of P19 Cells

Fgf8 on Neural Induction in P19 CellsWang et al., Molecular Biology of Cell; 2006P19 EC cellNeural stem cell

Fgf8 and Splicing VariantsFgf8 -member of FGF family -highly expressed in isthmus of mid-hindbrain junction and fore brain - structurally most complicated gene than other FGFs

Fgf8 gene structure has:- : skipping exon (1C) : 3splice site selection (1D) : 5splice site selection (1B) McArthur et al., Development; 1995Rosanno D, Am. J. Physiol.; 2003Fgf8in telenchephalon (arrowhead) and isthimic organizer (arrow)

Reason And Objective of This StudyFGF signaling is involved in neural differentiation of P19 cells

Fgf8 knockout mice die before embryonic day 9.5 (E9.5), which suggests its biological importance in early neural development

Fgf8 has 8 isoforms (a-h), but which isoforms are involved in neural differentiation remained unknown

ReasonObjective

To investigate which isoforms have biological function in early stage of neural differentiation

Fgf8b is the most predominant isoformSplicing Patterns & Expression of Fgf8 in P19 Cell during Neural DifferentiationI identified Fgf8a & b but not Fgf8c, d, e, f, g & h

Relative mRNA expressionExpression Analysis of Fgf8 in Early Stage of P19 CellsFgf8b elevation was maximum from 12 hours to 18 hours after RA treatment

Expression Analysis of Fgf8 Based on RA and/or Cell AggregationFgf8b elevation is cellular aggregation dependent Relative mRNA expression

Possible Mechanism of Fgf8b on Neural Induction in P19 CellsFgf8b but not all Fgf8 variants is impressive for P19 cell neural differentiation.

ConclusionFgf8a and Fgf8b were expressed rapidly but transiently within day 1 in neural differentiation of P19 cellFgf8b was predominant among Fgf8 isoformsElevated Fgf8b expression was cell aggregation dependentFgf8b but not other variants is important in early stage of neural differentiation of P19 cellSplicing factors may regulate the mechanism of elevation of alternatively spliced Fgf8b isoform in neural differentiation

Chapter-IV Study Mechanism of Alternative Splicing

Expression Analysis of Splicing Factors in Neural Differentiation of P19 Cells

RA and/or Cell Aggregation on Splicing Factors

Schematic Representation of CUGBP2 and Its Isoform CUGBP2 R3CUGBP2 is a member of CELF family proteinIt has 15 exons which encoded 524 amino acidsIt has 2 RRM in N-terminal, a linker region and 1RRM in C-terminal Exon 14 encoded amino acids are located in first two third of RRM3It is highly expressed in brain and heart tissuesIt acts as a splicing regulator

CUGBP2 R3 is an alternatively spliced product of CUGBP2It lacks exon 14 which makes it 480 amino acids in lengthLike CUGBP2, it has 2 RRM in N-terminal, a linker region but a partial RRM in C-terminalUCSC blat search suggest that 25% of CUGBP2 transcripts is responsible for CUGBP2 R3

So Far Published ResultsCUGBP2 R3Any function?

Reason And Objective of This StudyCUGBP2 has been known as positive and negative splicing regulatorTo investigate whether the alternatively spliced isoform of CUGBP2 has different function in splicing regulation

ReasonStill there has been no report about the different effect of CUGBP2 R3 in splicing regulationObjective

Expression Analysis of Alternatively Spliced Isoform of CUGBP2 in Tissues and CellsCUGBP2 is expressed as major product in brainThis result is consistent with alternative splicing patterns in brain

Suzuki et al., Genes to Cell; 2002 CUGBP2ACTN1 SM exon inclusionCUGBP2 R3Any function?CUGBP2 induced SM exon inclusion of ACTN1

Expression Analysis of Alternatively Spliced Isoform of ACTN1 in Tissues and CellsSM type is major in brain, neural and glial stage where CUGBP2 was highly expressed In kidney, liver and undifferentiated P 19 cells, NM type was major where the expression of CUGBP2 and CUGBP2 R3 was lowNM type SM type EF1aEF2SMmRNANM = Non-muscle, SM = Smooth muscleACTN1 geneEF1aNMSMEF2EF1aEF2NM

Transient Transfection Experimental Methods

SM typeNM type% of SM exon EF2aEffect of CUGBP2 and CUGBP2 R3 on ACNT1 minigeneEtr-1 is a RNA binding proteinLike CUGBP2, it has 2 RRM in N-terminal, a linker region and 1 RRM in C-terminalIt acts as a splicing regulator

CUGBP2 and CUGBP2 R3 induced SM exon inclusion of ACTN1Summary of ACTN1 by CUGBP2 and CUGBP2 R3

CUGBP2CUGBP2 R3Any different function?CUGBP2 Repressed Insulin Receptor (IR) Exon 11 Inclusion

IR exon 11 inclusion

Expression analysis of IR (Insulin Receptor) in TissuesIR is a heterotetramer with two extracellular -subunit and two identical trans membrane -subunitIR has 22 exons including skipping exon 11It is highly expressed in fetal tissues and cancer cells

Exon 11 (-) is major in brain where CUGBP2 was highly expressed.

Exon 11 (+) is major in kidney and liver, where CUGBP2 and CUGBP2 R3 were major products

% of exon inclusion Effect of CUGBP2 and CUGBP2 R3 on IR minigene

While CUGBP2 repressed IR exon inclusion interestingly CUGBP2 R3 induced IR exon inclusion

IR exon 11 inclusion Summary of IR by CUGBP2 and CUGBP2 R3

Possible Mechanism of Regulation of SplicingCUGBP2 R3 has different function in splicing regulation of IR gene

Chapter-V Summary

RA treatment and cell aggregation independently regulate alternative splicing in early stage of P19 cells

Chapter-IIThe alternatively spliced isoforms of 5-HT3R-A, ACTN1, and CUGBP2 showed early response in neural differentiation of P19 cellsThese spliced variants might play role in neurogenesisSR proteins might be involved in alternative splicing regulation in early stage of P19 cells

Chapter-IIIThe changes of alternatively spliced isoforms of Fgf8b was higher than that of Fgf8a

Fgf8b but not all Fgf8 variants might play role for neural differentiation of P19 cells

Fgf8b was abundant among all Fgf8 isoformsFgf8b was expressed rapidly but transiently in early stage of P19 cells during neural differentiation

Splicing factors might regulate elevated Fgf8b splicing mechanism during differentiation

CUGBP2 and CUGBP2 R3 induced SM exon inclusion of ACTN1Chapter-IVCUGBP2 R3 showed opposite function of CUGBP2 in regulation of IR splicing CUGBP2 repressed IR exon 11 inclusion, whereas CUGBP2 R3 promoted IR exon 11 inclusion

THANK YOU!

**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I**Bioinformatics_Workshop-IBioinformatics_Workshop-I