Click here to load reader

Simulation Theory

  • View
    1.039

  • Download
    1

Embed Size (px)

DESCRIPTION

 

Text of Simulation Theory

  • 1. REALITY HAS BECOME SCIENCE FICTION A collection of images and information by Jonathan Lippe For Millenaissance learning.

2. Reality Has Become Science Fiction

  • The purpose of this presentation is to explain that the reality most people agree upon to live in isnt the entire picture of what is going on.
  • Right in front of our eyes exists a more grand, splendid, incredible world that most of us choose not to observe.

3. PART I THE ORIGINS OF MAN 4. Who Created Man? God ? The Annunaki ? Aliens ? The Wingmakers ? 5. Which is our true home planet ? TIAMET MARS Nibiru / Planet X EARTH 6. My Answer: The Matrix This is a neurological simulation. Were all gamers souls inside of bodies. Body = Computer hardware. Soul = Operating system / software. Our experience that as of a user or simmer The Architect in Matrix Reloaded 7. Rules (Laws) to the Videogame Gravity Thermodynamics Conservervation of Mass Conservation of Energy Chaos and Order 8. Same Operating System, Just updated graphical user interface, gameplay, features and efficiency. Different versions of man, and Microsoft Windows Operating Systems Homo Sapien = Latest Upgrade 9. Same Game Updated Graphics Zelda: 1989 Zelda: 2001 The videogames look better than ever, and have more buttons and movement, but its still the same storyline, same objective. 10. PART II Understanding Human Life and Reality By interacting with and creating robots and computers / artificial intelligence. 11. Muscle, Skeletal, Nervous Layers of human beneath the surface. 12. Human Skeleton Computer Android / Robot / 1 stbuilding stage 1 ststage of human design 13. Muscle layer Human Robot 14. Communications Channels Human - Nerves, Veins Robot - Wires, Circuits 15. The next upgrade:Man and machine blended together. 16. Design Stages of building a creature. 17. Robot hands, human hands 18. Man and Machine = No Rise of the Machines but a Hybridization Best of both worlds.Incorporating Matrix like abilities into the human. 19. We are advanced robots. 20. God made man, Man made robot 21. Human Genetic Code: DNA 4 states - ATCG atcgtgcgagtcgtcgatgatgtcgctagtgtgtagc adenine, thiamine. cytosine, guananine

  • Computer Machine Code: Binary 0, 1
  • 2 states off and on
  • 010101010101011010101010101010101001

22. Pyramids and Structures on Mars 23. Nibiru / 12 thPlanet / Planet X 24. Nibiru 25. 26. 27. Tiamet / Asteroid Field 28. Our own human-made aircraft is far more bizarre than alien spacecraft. 29. What is the Matrix? 30. Both movies came out shortly after it was briefly announced on television that Asteroid XF-11 was on a collision course with Earth by the year 2028. 31. Kevin Warwick is a human cyborg who invents technology to enhance the human body in order to survive when the robots take over.Recently he connected his body to the Internet by having electrodes surgically implanted into his nervous system in New York and had someone across the Atlantic Ocean in England control his body remotely.Pictures of this and other experiments he conducted on himself are available on www.kevinwarwick.com. 32. The Core and 007 Die Another Day show what would happen if direct radiation from the sun could get through the protective layers of the atmosphere and touch the Earths surface. In both movies, there were secret bases located in Alaska and some other snowy cold region.In real life there is a government research facility called HAARP located in Alaska which conducts experiments loosely related to some of the things depicted in the movie. 33. So, is there any truth to the Bible Code or Numerology? The occult? Secret Societies? Astrology? 34. These 3 movies suggest there is life on Mars.The picture to the left is a NASA photograph of a Mars region called CYDONNIA.This photograph shows several pyramids (about 4) and a face structure.In the movie Mission to Mars, the astronauts land in the Cydonnia area. 35. Genetic Mutation Man made viruses. Genetic weapons. Viral weapons. Zombies used by the military created in laboratories by multinational corporations. Genetic enhancements. Secret genetic experiments. 36. Thirteenth Floor and Matrix suggest that we live in a computer generated reality and are experiencing a simulation of what we think is real life. 37. Movies that suggest what we think is reality is not.Vanilla Sky falls in the same category with Matrix and 13 thFloor with a manufactured reality. 38. TSUNAMIs GLOBAL WARMING Code Hunter depicts Hurricanes as an un-intended by-product of space to surface weaponry. Again, research HAARP 39. SETI Search for Extraterrestrial Intelligence - Real life organization. Organization depicted in Contact and The Arrival.. 40. = Al Pacinos character is very loosely based on real lifeRAY KURZWEIL .Ray Kurzweil is one of the leaders in virtual reality and Artificial Intelligence, and in real life created an artificial intelligent avatar known as RAMONA (movie was called SIMONE).You can learn more at his interesting website www .Kurzweilai.net and you can view Ramona as well as video presentations of his merging of virtual reality. 41. Biometrics Blood sample scanner Genetic Engineering, genetic family planning Eugenics Dystopia Department of Pre-Crime = Department of Homeland Security Biometrics / Retina scans, thumb scans Pre-cogs (precognition) Remote Viewing Fascism Big Brother Total Information Awareness 42. Genetic algorithms. Artificial Life. Artificial Intelligence Virtual Reality. Neural Networks Computer animation Ray Kurzweil www.kurzweilai.net In TRON and Virtuosity, peoples bodys were scanned by a laser and then recreated into the computer. 43. The movie SIGNS was based on the PHOENIX LIGHTS incident in Arizona in 1997 In the movie Joaquin Phoenix watches real video from the Phoenix Lights coverage on television In Independence Day, the president (Bill Pullman) visits Area 51. 44. You can make dinosaurs.You can clone humans.We can remove the aging strand in our DNA and live forever. 45. Pre-911 movie about manufacturing terrorist attacks to Save Americans freedoms 46. Monoliths are in these movies which were put in certain areas to detect stages of human intelligence evolution. We have now landed on the moon created the computer and harnessed the power of the atom. 47. Mind Control MK ULTRA Implanted Microchips Applied Digital Solutions Verichip Gulf War Syndrome 48. George Meeks invented the Spiricom which enabled him to get messages from dead people.He also took many pictures in a room with a lightbulb that does not shine the visible light frequencies and was able to capture photos of spirits.VISIThttp://www.worlditc.org/h_07_macy_meek.htmto learn about the research of George W Meek and how it relates to EVP 49. Secret Societies Freemasons, Skull and Bones Symbols on the dollar bill. 50. The government working either with the aliens or against the aliens.Aliens disguised as humans. 51. Time Travel 52. Childrens movies from the 80s. 53. Visionary movies from the 30s 54. 55. JDS Uniphase Lasers, X-ray, laser surgery, machines in airports Altair Technologies New England Metal Form / Microwave Specialties Ericsson computers ties w/ Lockheed Martin Jennings Technology Eaton Technology Manhattan Associates RFMD OATSystems ConnecTerra Globe Ranger TIBCO Software AIM Global Cipher Trust Vonage IBM Microsoft Sun Microsystems HP Oracle / Peoplesoft Cisco Worldcom 56. www.ee.ucf.edu 407-882-0260 ucf networking mcse If you want to know about the social, its 53-6-27 Great gumballs. Superglue the mfer My name is a bad word Jared Skalko was here 57. Reality does not exist in its solid form as we see it. Everything we see is a hologram. Reality is really just a bunch of waves, frequencies.Our eyes gather the frequencies and our brain converts it into images that we see in the same way a radio decodes sound waves into audible sound that we hear through a speaker and understand or a television decodes frequencies into understandable visual images that we see displayed through various heated red,green,blue phosphorus or liquid crystal dots that appear to make an image. You cant see a TV signal or a radio signal without a television or a radio to tune the invisible frequencies to our eyes, yet they are there. Reality really looks like a bunch of wavey lines. We experience things as physical and as painful or pleasureeable only because our nevers take in sensation information and our brain decodes it and reacts. All emotions are electro-chemical reactions.(Electronic signal from the brain releasing different elements or compounds into the body through its various cchannels.) The brain and human body is electronic.Just like a computer.Except that the source code for man is DNA and a computer is binary. 58. Buildup of Garbage Global Warming Extinction of Species Loss of Habitat Rainforest Doing nothing about it. Mind intention creates results. Non-locality space time makes no difference. Quantum energy matter patterns information War cost 200 billion dollars.Imagine using that on alternative energy development. Energy petrochemical. Global future studies. Bio,nano,info,tech Molecular barcode sprinkled in like dust Synthetic sentience Privacy is something we pride ourselves as a right. 59. 60. Aliens and Origins of Man

  • Origins of man
  • Government
  • Sightings/Abductees
  • Disclosure
  • Even if fake whats up
  • U.S. Technology
  • Alien Races
  • Annunaki
  • Dinosaurs
  • Regular Taught Version
  • Religious Version
  • Pyramid Building Civilizations
  • Atlantis, Lemuria
  • Genesis Elo

Search related