Sh

PHa

b

a

ARRAA

KSSPN

1

bdrdcccTttc

1Asbatq

0d

Vaccine 29 (2011) 5340– 5346

Contents lists available at ScienceDirect

Vaccine

j ourna l ho me pag e: www.elsev ier .com/ locate /vacc ine

ingle chain variable fragment antibodies against Shiga toxins isolated from auman antibody phage display library

aola Neria, Naoko Shigemoria, Susumu Hamada-Tsutsumib,∗, Kentaro Tsukamotoa,ideyuki Arimitsua, Toshiyasu Shimizua, Yasushi Akahorib, Yoshikazu Kurosawab, Takao Tsuji a

Department of Microbiology, School of Medicine Fujita Health University, Toyoake, Aichi 470-1192, JapanDivision of Antibody Project, Institute for Comprehensive Medical Science, Fujita Health University, Toyoake, Aichi 470-1192, Japan

r t i c l e i n f o

rticle history:eceived 28 March 2011eceived in revised form 23 May 2011ccepted 25 May 2011vailable online 12 June 2011

a b s t r a c t

Shiga toxins (Stxs) are involved in the pathogenesis of hemolytic-uremic syndrome and other severesystemic complications following enterohemorrhagic Escherichia coli infection in humans. Passiveimmunotherapies using monoclonal antibodies have been shown to be effective for neutralizing thetoxic effects of Stxs. However, animal-derived monoclonal antibodies are sometimes immunogenic andtheir production is both laborious and expensive. We here report the isolation of single-chain variable

eywords:higa toxiningle chain variable fragment antibodyhage displayeutralization

fragment antibodies against Stxs by screening a phage display library constructed from a naïve humanrepertoire. An antibody among the selected clones designated B22 bound to the binding subunits of bothStx-1 and Stx-2, and strongly neutralized the cytotoxicity of Stx-1. This is the first example of a monova-lent antibody showing Stx-neutralizing activity. The B22 antibody is also completely naturally occurringin human, which reduces the possibility of adverse immunological effects, and can be easily producedusing bacterial protein synthesis systems.

. Introduction

Enterohemorrhagic Escherichia coli (EHEC) are important food-orne pathogens that cause a wide spectrum of diseases, includingiarrhea and hemorrhagic colitis [1]. EHEC infections usuallyesolve in 7–10 days but 5–10% of infected subjects, especially chil-ren under five years and the elderly, can develop life-threateningomplications such as hemolytic uremic syndrome (HUS) andentral nervous abnormalities [2]. The development of HUS is asso-iated with the production of Shiga toxins (Stxs) by EHEC bacteria.hese toxins released into the intestine enter the systemic circula-ion by translocation through intestinal epithelial cells [3] to reacharget tissues. Stxs damage cells that express globotriaosyl (Gb3)eramide, a surface glycolipid receptor [4].

EHEC strains produce two antigenically distinct types of Stx, Stx- and Stx-2 [5,6]. Both toxins consist of one enzymatically active

subunit non-covalently linked to a pentamer of five identical Bubunits. The A and B subunits of Stx-1 and Stx-2 are reported toe 55% and 57% homologous, respectively, at the deduced amino

cid sequence level [7]. After binding to Gb3 via the B pentamer,he Stx is internalized by endocytosis, and its A subunit is subse-uently cleaved into A1 and A2 fragments. The A1 fragment is then

∗ Corresponding author. Tel.: +81 562 93 9389; fax: +81 562 93 8835.E-mail address: ssmhmd@fujita-hu.ac.jp (S. Hamada-Tsutsumi).

264-410X/$ – see front matter © 2011 Elsevier Ltd. All rights reserved.oi:10.1016/j.vaccine.2011.05.093

© 2011 Elsevier Ltd. All rights reserved.

transported to the cytoplasm and exerts RNA N-glycosidase activ-ity toward 28S rRNA resulting in the inhibition of protein synthesis[8].

The treatment of EHEC infection with antibiotics is controver-sial because some of these compounds are thought to enhancethe release of Stxs into the intestine, thus increasing the risk ofHUS [9]. Hence, alternative therapies such as Gb3 mimicking com-pounds and neutralizing antibodies are of great interest. Syntheticcompounds mimicking Gb3 have been designed and proven to beeffective in neutralizing the cytotoxicity of Stxs in the intestineand/or in the systemic circulation [10–14]. Monoclonal antibod-ies against the A or B subunit of Stx-1 and Stx-2 have been widelyinvestigated for neutralizing capability against these toxins in thesystemic circulation [15–18]. However, the high production cost ofmonoclonal antibodies greatly limits their use clinically. Moreover,the immunogenicity of animal-derived monoclonal antibodies is apotential problem in terms of side-effects in humans.

Recently, phage display has been shown to be a cost-effectivetechnique for the production of antibody fragments such as a bind-ing fragment (Fab) or a single-chain variable fragment (scFv) in vitro[19,20]. Phage display libraries constructed from antibody genescollected from blood and lymphoid organs of immune or non-

immune individuals are used for the isolation of antibodies ofhuman origin against a wide variety of antigens [21]. In this study,we describe the isolation of antibodies against Stxs using a phagedisplay library constructed from a naïve human repertoire.

ne 29

2

2

TlaflTcMpcpb

2

SrwaappGGeGBtiwc�crlpIi

2

lT3titaaUw3(wovwttA

P. Neri et al. / Vacci

. Materials and methods

.1. Antibody library

The AIMS-5 library was constructed as described elsewhere [22].he structure of the pSCCA2.1-E8d vector used to construct thisibrary is shown in Fig. 1A. The variable region of heavy chain (VH)nd the full-length light chain (VL–CL) genes were joined using aexible peptide linker sequence to generate an scFv-CL segment.he 3′ end of this segment was then fused with a gene encoding thearboxy-terminal domain of pIII (a spike protein of bacteriophage13), which enables the expressed product (scFv-CL-pIII) to be dis-

layed on the surface of a phage virion. A 0.7 kbp Sal I-Sal I fragmentontaining the pIII coding region can then be removed to yield alasmid encoding a fusion of the scFv-CL with two immunoglobulininding domains of protein A (scFv-CL-pp).

.2. His-tagged recombinant B subunits of Stx-1 and Stx-2

The construction of plasmids expressing histidine-taggedtx-1B (Stx-1BH) and Stx-2BH, and the purification of theecombinant Stx-BH subunits has been described else-here [23,24]. A mutant of Stx-2BH harboring three amino

cid substitutions (Stx-2BH-WWG) was constructed using QuikChange II Kit (Stratagene, La Jolla, CA). Mutations atosition W29A/W33A/G61A (Fig. 1B) were introduced intoTrcHis2A expressing Stx-2BH. The mutagenic nucleotides were61A, GAATCAGGCTCCGCGTTTGCTGAAGTGC, and W29A/W33A,GGAAAGAATACGCGACCAGTCGCGCGAATCTGCAACCG. The pres-nce of the mutations was confirmed with an ABI Prism 3100enetic Analyzer (Applied Biosystems, Foster City, CA) using aigDye Terminator cycle sequencing kit ver.3.1 (Applied Biosys-ems). The plasmid expressing Stx-2BH-WWG was transformednto E. coli BL21 (Stratagene). To purify Stx-2BH-WWG, this strain

as grown at 30 ◦C in LB supplemented with 50 �g/ml ampi-illin. At the mid-logarithmic phase of growth, 1 mM isopropyl-d-thiogalactopyranoside (IPTG) was added, and the culture wasontinued for a further 4 h. Cells were pelleted by centrifugation,esuspended in phosphate buffered saline (PBS, pH 7.4) and thenysed by ultrasonication. The clarified supernatant of the lysate wasurified using Talon metal affinity resin (Clonetech Laboratories,

nc., Mountain View, CA). Stx-2BH-WWG was eluted with 150 mMmidazole and then dialyzed against PBS.

.3. Library screening method

The antibody library was subjected to three rounds of regu-ar panning with Stx-2BH. Briefly, maxisorp immunotube (Nunc,hermo Scientific, Roskilde, Denmark) was coated overnight with

ml Stx-2BH (10 �g/ml in PBS) at 4 ◦C with slow rotation. Theube was then washed with PBS and then blocked with 5% BSAn PBS for 1 h at room temperature (RT) with rotation. Phages at aiter of 2 × 1013 infectious particles for the first round of panning,nd 1012 for the second and third rounds, were added to the tubend allowed to bind to Stx-2BH for 2 h at RT with slow rotation.nbound phages were removed and the tube was washed 10 timesith PBS for the first round of panning, 20 times for the second and

0 times for the third. Bound phages were eluted with glycine–HCl0.1 M, pH 2.2) for 10 min at room temperature and then neutralizedith Tris–HCl (2 M). The eluted phages were rescued by infection

f E. coli DH12S (Invitrogen, Carlsbad, CA) and amplified. The phageirions were generated by superinfection of the amplified culture

ith helper phage M13KO7 (Invitrogen), and purified by precipi-

ation with 20% PEG-6000/2.5 M NaCl. The phages obtained afteritration were used as input for the subsequent rounds of panning.fter three rounds of regular panning with Stx-2BH, one subtrac-

(2011) 5340– 5346 5341

tive panning with Stx-2BH-WWG was performed. Approximately109 phages were then preincubated with 1 ml of Stx-2BH-WWG(10 �g/ml) for 2 h at RT. Subsequently, Stx-2BH-WWG-adsorbedphages were transferred to an immunotube coated with Stx-2BH,and incubated for 1 h at RT with slow rotation. After 30 washeswith PBS, the phages bound to Stx-2BH were eluted, infected intoE. coli DH12S, and tested for their binding specificity via an enzyme-linked immunosorbent assay (ELISA).

2.4. Binding specificity determination by ELISA

Colonies grown on LBGA agar (LB supplemented with 0.5%glucose and 100 �g/ml ampicillin) were picked and used for thesmall-scale production of scFv-CL-pIII antibodies. Single colonieswas grown overnight at 30 ◦C with vigorous shaking in 1.5 ml of2xYT medium (Bacto tryptone 16 g, Bacto yeast extract 10 g, NaCl5 g) supplemented with 0.05% glucose, 100 �g/ml ampicillin and1 mM IPTG. Culture supernatants were collected by centrifugationat 5000 rpm for 10 min, and tested for antigen binding speci-ficity by ELISA. Briefly, the wells of maxisorp plates were coatedwith 100 �l (2 �g/ml in PBS) of Stx-1BH, Stx-2BH or Stx-2B-WWG.After overnight incubation at 4 ◦C, the plates were washed withPBS/0.05% Tween20 (PBS-T) and then blocked with 5% BSA in PBSat 37 ◦C for 1 h. Culture supernatant (100 �l) was added to the wellswhich were further incubated for 1 h at 37 ◦C. After washing withPBS-T, rabbit anti pIII antibodies (1 �g/ml) followed by HRP conju-gated goat (Fab′)2 anti rabbit IgG (1:5000) were used for detection[22]. The reactions were visualized using o-phenylenediamine asthe substrate.

2.5. Expression and purification of scFv-CL-pp antibodies

Plasmids of the selected clones were digested with Sal I toremove the pIII fragment. After ligation, plasmids harboring scFv-CL-pp were transformed into E. coli DH12S, and used for antibodyproduction. Briefly, 10 ml of 2xYT supplemented with 1% glucoseand 100 �g/ml ampicillin were inoculated with a single colonyof transformed E. coli DH12S, and then incubated at 30 ◦C withvigorous shaking. A 500 ml volume of 2xYT supplemented with0.05% glucose and 100 �g/ml of ampicillin was then inoculatedwith 5 ml of overnight preculture, and grown at 30 ◦C with shakingto an OD600 of 0.5. To induce antibody expression, 1 M IPTG wasadded and the culture was continued for a further 18 h. Culturesupernatants were collected by centrifugation (8000 rpm, 10 min,4 ◦C). The scFv-CL-pp antibodies were precipitated by ammoniumsulfate, redissolved in PBS/0.05% NaN3, and purified with an IgG-conjugated column (IgG Sepharose 6 Fast Flow; GE Healthcare,Japan).

2.6. Multivalent form of scFv-CL antibodies

A cartilage oligomeric matrix protein (COMP) pentameriza-tion vector, pSCSCCC-COMP (Y. A., unpublished data), was used toconstruct the multivalent form of scFv-CL. The scFv-CL-COMP anti-bodies were produced as described above, and purified using Talonmetal affinity resin (Clontech Laboratories, Inc., Mountain View,CA).

2.7. Neutralization assay

The neutralization assay was performed essentially as described

previously [13]. Briefly, antibodies were mixed with an equal vol-ume of Stx-1 or Stx-2 (Nacalai Tesque, Inc., Tokyo, Japan), and keptat 37 ◦C for 1 h. A 100 �l aliquot of this mixture was then added toHeLa 229 monolayers. After 48 h incubation, the number of viable

5342 P. Neri et al. / Vaccine 29 (2011) 5340– 5346

Fig. 1. (A) Schematic diagram of the pSCCA2.1-E8d vector used to construct the AIMS-5 phage antibody library. VH, heavy chain variable domain; VL, light chain variabledomain; CL, light chain constant region; lac, E. coli LacZ promoter; pelB, pelB leader sequence; �pIII, carboxy-terminal region of pIII; pp, two IgG-binding domains of proteinA. (B) Amino acid sequence alignment of Stx-1B and Stx-2B. The hypothesized amino acids involved in the binding to the receptor are underlined. (C) Chrystal structure ofStx-2B (bottom view, modified from PDB ID 1R4P, Ref. [25]) showing mutations at position W29, G61 and W33. (D) Flow cytometric analysis of Stx-2BH and Stx-2BH-WWGb ere in4 t biotc

ctacfiP

2

apbwaw1r

Fpas

inding to HeLa 229 cells. Biotinylated Stx-2BH and Stx-2BH-WWG at 2 �g/ml w88-conjugated streptavidin. Black lines and broken lines in the histogram represenells not treated with biotinylated B subunit.

ells was determined using an Alamar Blue assay (Trek Diagnos-ic Systems, West Sussex, UK). The final concentrations of Stx-1nd Stx-2 in the assay were 17.5 pg/ml and 5 pg/ml, respectively,orresponding to 5 times the 50% cytotoxic dose (CD50) calculatedrom concentration-response curves. The CD50 and fifty percentnhibitory concentration (IC50) were estimated using GraphPadRISM (GraphPad Software, San Diego, CA).

.8. Competitive ELISA

The wells of a maxisorp plate (NUNC) were coated overnightt 4 ◦C with 2 �g/ml of Stx-1BH or Stx-2BH in carbonate buffer,H 9.6 (100 �l/well). The wells were then washed with PBS-T, andlocked with 5% BSA in PBS at 37 ◦C for 1 h. Antibodies were mixedith serial dilutions of Stx-1BH or Stx-2BH (from 0 to 50 �g/ml),

nd incubated at 37 ◦C for 2 h. A 100 �l aliquot of the mixtureas then added to the coated wells, and incubated at 37 ◦C for

h. ScFv-CL-pp antibodies were detected with a HRP-conjugatedabbit anti-streptavidin antibody. To detect scFv-CL-COMP antibod-

0

0.5

1

1.5

2

2.5

1st 2nd 3rd

Stx-1BHStx-2BH 0.0

0.5 1.0 1.5 2.0 2.5

0.0 0.5 1.0 1.5 2.0 2.5

0.0 0.5 1.0 1.5 2.0 2.5

1 2 3 4 5 6

A B Stx-2BH

Stx-2BH-WWG

Stx-1BH

Abs

orba

nce

(OD

492)

Round of panning

Abs

orba

nce

(OD

492)

ig. 2. (A) Enrichment in polyclonal antibody titers after three rounds of panning with Shages after the first, second and third rounds of panning were used for the production ond Stx-2BH by ELISA. (B) Binding specificity of monoclonal antibodies. Thirty colonies

cFv-CL-pIII. Antibodies secreted in the culture supernatants were tested by ELISA for the

cubated with the cells for 1 h on ice. The binding was detected with Alexa Fluorinylated Stx-2BH-WWG and Stx-2BH, respectively. The filled histogram represents

ies, a rabbit anti-human IgG lambda chain antibody (1 �g/ml) wasused as the second antibody, followed by HRP-conjugated goat anti-rabbit IgG antibody. The reaction was visualized using o-phenylenediamine as the substrate. The apparent affinity of each antibody wascalculated as the reciprocal Stx-1BH or Stx-2BH concentrations thatinhibit maximal binding by 50%.

2.9. Surface plasmon resonance analysis

The binding affinity of scFv-CL-pp and scFv-CL-COMP was deter-mined using Biacore 2000 (Biacore, Uppsala, Sweden). Stx-1BH andStx-2BH were diluted to 20 �g/ml in acetate buffer at pH 5.5 and5.0, respectively, and then immobilized on the flow cells of a CM5sensor chip (Biacore). The antibodies were serially diluted from50 to 3.125 �g/ml with HBS-EP buffer (Biacore) and injected over

the coated surface of the sensor chip at a flow rate of 20 �l/minat 25 ◦C. After each binding assay, the chip was regenerated with30 �l of glycine (pH 1.5). The dissociation constants at equilibrium(KD) were calculated from the association (Kon) and dissociation

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

Clone number

tx-2BH. E. coli DH12S cells harboring a mixture of the plasmids from the rescuedf the polyclonal scFv-CL-pIII protein. Antibodies were tested for binding to Stx-1BHwere picked after subtractive panning and used for the small-scale production ofir binding specificity to Stx-1BH, Stx-2BH and Stx-2BH-WWG.

P. Neri et al. / Vaccine 29 (2011) 5340– 5346 5343

Fig. 3. Neutralizing activity of B22-pp (A) and B22-COMP (B) against Stx-1. Two-fold serial dilutions of antibodies were mixed with an equal volume of Stx-1 and incubatedf y. TheB 00 and5

((w

2

ilRTabtfw3(

2

wlnda

3

3

nbuastrpwCflcws

or 1 h at 37 ◦C. The mixture was then added to HeLa 229 cells for a cytotoxicity assa22-COMP against Stx-2. The final concentrations of B22-pp and B22-COMP were 1

times CD50 (gray bar). Data are the mean ± S.E.M. of triplicate wells.

Koff) constant determined by local fitting using 1:1 binding modelLangmuir). The data were analyzed using Biacore evaluation soft-are.

.10. Flow cytometry

The binding of Stx-1BH and Stx-2BH to HeLa 229 cells was exam-ned by flow cytometry. Stx-1BH, Stx-2BH and Stx-2BH-WWG wereabeled with biotin using a Sulfo-NHS-LC Biotinylation kit (Pierce,ockford, IL), in accordance with the manufacturer’s instructions.o investigate the effects of the antibodies, biotinylated Stx-1BHnd Stx-2BH, both at a final concentration of 200 ng/ml, were incu-ated with or without antibodies for 1 h on ice. The mixture washen added to HeLa 229 cells (2 × 105 cells/100 �l) and incubatedor 30 min on ice. After washing with PBS, the cells were stainedith streptavidin conjugated with Alexa Fluor 488 (Invitrogen) for

0 min on ice, and analyzed using a FACSCalibur flow cytometerBecton Dickinson, San Jose, CA).

.11. Nucleic acid sequencing

The variable regions of the heavy (VH) and light (VL) chainsere sequenced, and the deduced nucleotide sequence was ana-

yzed by comparison with the closest germline. The germlineucleotide sequences are available from DDBJ/EMBL/GenBankatabases under the accession numbers M99651, X86359, X56178nd D87023.

. Results

.1. Binding specificity of scFv-CL-pIII antibodies

The phage library was subjected to three rounds of regular pan-ing with Stx-2BH. Phages that had been eluted and amplifiedy infection of E. coli DH12S after each round of panning weresed for the production of polyclonal scFv-CL-pIII. The polyclonalntibodies tested for Stx-1H and Stx-2BH binding by ELISA demon-trated enrichment in antibodies recognizing Stx-2BH after thehird round of panning (Fig. 2A). To screen for antibodies targetingeceptor-binding epitopes, we performed one round of subtractiveanning with a mutant Stx-2BH. Stx-2BH-WWG was constructedith mutations in all three Gb3 binding sites of Stx-2B (Fig. 1B and) and confirmed not to bind to the surface of HeLa 229 cells by

ow cytometry, in contrast to Stx-2BH that bind to the cells effi-iently (Fig. 1D). After the subtractive panning step, 30 coloniesere isolated and used for a small-scale production of monoclonal

cFv-CL-pIII. Antibodies secreted into the culture supernatant were

final Stx-1 concentration was 5 times CD50. (C) Neutralizing activity of B22-pp and 50 �g/ml, respectively. The final Stx-2 concentrations were 1 CD50 (black bar) and

tested for their binding specificity to Stx-1BH, Stx-2BH and Stx-2BH-WWG by ELISA (Fig. 2B). Antibody clone B22 was found tobind to Stx-2BH but not to Stx-2BH-WWG. Interestingly, B22 wasobserved to strongly bind to Stx-1BH. For large-scale preparation,we constructed a vector that expressed a protein A-conjugatedform of B22 (B22-pp), and the antibody protein was purified byIgG Sepharose column chromatography as described in Section 2.

3.2. Neutralizing activity against Stx-1 and Stx-2

The neutralizing activity of B22-pp against Stx-1 and Stx-2 wasanalyzed using HeLa 229 cells. B22-pp was preincubated withthe toxins, and the mixture was then subjected to a cytotoxic-ity assay. B22-pp completely neutralized the toxicity of Stx-1 ata 5 �g/ml concentration (Fig. 3A). The IC50 value calculated fromconcentration-dependent curves was 0.35 �g/ml (95% confidence;0.26–0.46 �g/ml). In contrast, B22-pp at 100 �g/ml did not neutral-ize the toxicity of Stx-2, even when a single CD50 dose of the toxinwas used instead of a 5 times CD50 level (Fig. 3C). No neutralizingactivity was observed when a control scFv-CL-pp antibody was used(data not shown).

3.3. Inhibition of Stx-1BH and Stx-2BH binding to HeLa 229 cellsby antibodies

To investigate the ability of B22-pp to interfere with the bind-ing of Stx-1BH and Stx-2BH to their cell-surface receptors, weperformed flow cytometric analysis using HeLa 229 cells. Whenbiotinylated Stx-1BH was preincubated with 5 �g/ml of B22-pp,the binding to HeLa 229 cells was completely inhibited (Fig. 4A).The binding of biotinylated Stx-2BH was however only partiallyinhibited by B22-pp (Fig. 4B), and a complete inhibition was notobserved even when 100 �g/ml of antibodies were used. No inhi-bition of the binding of biotinylated B subunits was observed whena control scFv-CL-pp antibody was used (data not shown).

3.4. Multivalent form of B22

To increase the avidity of the monovalent form of B22-pp, weconstructed a multivalent form of this antibody using a COMPpentamerization domain (B22-COMP). The neutralizing activity ofB22-COMP against Stx-1 and Stx-2 was then analyzed. B22-COMPcompletely neutralized the toxicity of Stx-1 at 500 ng/ml (Fig. 3B),

with an IC50 value of 78.8 ng/ml (95% confidence; 69.7–89.1 ng/ml).This was a five-fold higher effectiveness than B22-pp. However,although B22-COMP neutralized Stx-1 more efficiently than B22-pp, B22-COMP did not neutralize Stx-2 (Fig. 3C). B22-COMP also

5344 P. Neri et al. / Vaccine 29 (2011) 5340– 5346

Fig. 4. Flow cytometric analysis of Stx-BH subunits binding to HeLa 229 cells. Biotinylated Stx-1BH (A and C) and biotinylated Stx-2BH (B and D) were preincubated for1 h on ice with or without antibodies. The mixtures were then added to the cells, and kept on ice for 30 min. The binding was detected with Alexa Fluor 488-conjugateds B22-pF s and

a

i1a

3

SbBBnn

Fdbr

treptavidin. The concentrations of antibodies in the assay were 5 and 50 �g/ml for

illed histograms represent cells not treated with biotinylated B subunit, black linebsence, respectively, of the antibodies.

nhibited, although only partially, the binding of biotinylated Stx-BH and Stx-2BH toward HeLa 229 cells when added at 2 �g/mlnd 50 �g/ml, respectively (Fig. 4C and D).

.5. Binding affinity of B22-pp and B22-COMP

The binding affinities of B22-pp and B22-COMP to Stx-1BH andtx-2BH were measured by SPR. Stx-1BH and Stx-2BH were immo-ilized on the flow cells of the sensor chip, and the B22-pp and

22-COMP antibodies were injected over the coated-surface. Both22-pp and B22-COMP bound to Stx-1BH (Fig. 5A and B), buto binding to Stx-2BH was detected for unknown reasons (dataot shown). The apparent binding affinities of B22-pp and B22-

A B

0

200

400

600

800

1000

1200

0 50 100 150 200 250 300 350 0

200

400

600

800

0 50 100 150 20 Time (seTime (sec)

Res

pons

e (R

U)

Res

pons

e (R

U)

B22-pp B22-COMP

ig. 5. Sensograms showing the binding of B22-pp (A) and B22-COMP (B) to Stx-1BH. Stxiluted from 50 to 3.125 �g/ml, were injected over the coated surface of the sensor chip. Cinding affinities of B22-pp and B22-COMP to Stx-2BH determined by competitive ELISequired to inhibit 50% of the maximum binding.

p (A and B, respectively), and 2 and 50 �g/ml for B22-COMP (C and D, respectively).broken lines in each histogram represent biotinylated B subunit in the presence or

COMP for Stx-2BH were determined by competitive ELISA, andcalculated as the reciprocal B subunit concentration required for50% inhibition of the maximum binding. B22-pp and B22-COMPbound to Stx-2BH with an affinity in the 10−6 M and 10−7 M range,respectively (Fig. 5C). The kinetic and affinity constants of B22-ppand B22-COMP toward Stx-1BH and Stx-2BH are summarized inTable 1.

4. Discussion

There is now increasing interest in finding effective and spe-cific therapies to prevent the severe disorders associated withEHEC infection. Passive immunization with monoclonal antibod-

C

0 250 300 350 0

5 x

10-5

5 x

10-1

1

5 x

10-1

0

5 x

10-9

5 x

10-8

5 x

10-7

5 x

10-6

Stx-2BH (µg/mL)

0

20

40

60

80

100

120

140 B22-pp B22-COM P

c)

% b

indi

ng

-1BH was immobilized on a CM5 sensor chip, and the antibodies, two-fold seriallyurve fitting was carried out assuming a 1:1 binding model (Langmuir). (C) ApparentA. The affinities were calculated as the reciprocal of the B subunit concentration

P. Neri et al. / Vaccine 29

Table 1Kinetic and affinity constants of B22-pp and B22-COMP toward Stx-1BH and Stx-2BH.

Antigen Antibody Kon (1/Ms) Koff (1/s) KD (M)

Stx-1BHa B22-pp 1.46 × 105 1.54 × 10−3 1.05 × 10−8

B22-COMP 8.45 × 103 1.97 × 10−4 2.33 × 10−8

Stx-2BHb B22-pp 4.0 × 10−6

B22-COMP 5.5 × 10−7

a Data were obtained by surface plasmon resonance. The association (Kon) and dis-sociation (Koff) constants were determined by local fitting using a 1:1 binding model(Langmuir). Dissociation constants at equilibrium (KD) are calculated as Koff/Kon.Data were analyzed with Biacore evaluation software.

b Data were obtained by competitive ELISA. The apparent binding affinities (KD)ot

itbtaoSh

Fd

f B22-pp and B22-COMP were calculated as the reciprocal of the B subunit concen-ration required to inhibit 50% of the maximum binding.

es against Stxs has been shown to be one of the most promisingherapies in this regard. However, generating monoclonal anti-odies is an expensive and time-consuming process. Moreover,he immunogenicity of animal-derived antibodies in humans isnother potential impediment to their adoption for clinical use. To

vercome these issues, we attempted to isolate antibodies againsttxs using an scFv-CL antibody library constructed from a naïveuman repertoire. The library was first subjected to regular panning

IGHV3-9 GAAGTGCAGCTGGTGGAGTCTGGGGGB22-VH ..G.......................

IGHV3-9 TCCTGTGCAGCCTCTGGATTCACCTTB22-VH .......................... IGHV3-9 CCAGGGAAGGGCCTGGAGTGGGTCTC B22-VH .......................... IGHV3-9 GCGGACTCTGTGAAGGGCCGATTCACB22-VH .......................... IGHV3-9 CTGCAAATGAACAGTCTGAGAGCTGAB22-VH ..........................

IGHJ3 --------------TGATGCTTTTGAB22-VH GGTGGGAGCTACCGA.GC........ CDR 3IGHJ3 TCAG B22-VH AG..

IGLV3S1 TCTTCTGAGCTGACTCAGGACCCTGCB22-VL ..........................

IGLV3S1 ACATGC CAAGGAGACAGCCTCAGAAGB22-VL ...... .................... CDR 1IGLV3S1 CAGGCCCCTGTACTTGTCATCTATGGB22-VL .......................... IGLV3S1 TTCTCTGGCTCCAGCTCAGGAAACACB22-VL ..........................

IGLV3S1 GATGAGGCTGACTATTACTGTAACTCB22-VL .......................... IGLJ1 TTATGT CTTCGGAACTGGGACCAAGGB22-VL ...... ....................

ig. 6. Nucleotide sequence of the variable regions of the heavy (B22-VH) and light (Betermining regions in both B22-VH and B22-VL are underlined.

(2011) 5340– 5346 5345

with Stx-2BH. After the third round of panning, the enrichment inthe pool of antibodies that bound to Stx-2BH was evident. How-ever, selected clones showed binding not only to Stx-2BH but alsoto the Stx-2BH-WWG mutant, suggesting a lack of specificity forreceptor-binding epitopes (data not shown). In order to screenfor antibodies with minimal reaction to undesired epitopes, andthus improve their binding specificity, we performed a subtractivepanning round with Stx-2BH-WWG. In Stx-2BH-WWG, the aminoacids W29, G61 and W33, corresponding to sites 1, 2 and 3, respec-tively, of the hypothetical Gb3 binding sites of Stx-2B, are mutated[25]. Stx-2BH-WWG did not bind to HeLa 229 cells indicating thatthese amino acids play a role in the binding to Gb3 on the cellsurface.

Among the antibodies isolated after the subtraction step, B22bound to Stx-2BH but not to its mutant, indicating a specificity forthe receptor-binding epitopes. Interestingly, B22 also bound to Stx-1BH with high affinity. Although antigenic diversity within Stx-1and Stx-2 has been reported, the isolation of monoclonal antibodiessuch as B22 shows that some common epitopes between these tox-ins exist around the Gb3-binding residues. We have also reporteda similar cross reactivity profile for mouse polyclonal serum gen-

erated by the nasal immunization of Stx-2BH that binds to andneutralizes both Stx-1 and Stx-2 [26]. B22-pp exhibited strongneutralizing activity against Stx-1. Contrary to our expectations

AGGCTTGGTACAGCCTGGCAGGTCCCTGAGACTC..................................

TGATGA TTATGCCATGCACTGGGTCCGGCAAGCT...... ............................ CDR 1AGGTATTAGTTGGAATAGTGGTAGCATAGGCTAT.................................. CDR 2CATCTCCAGAGACAACGCCAAGAACTCCCTGTAT.................................. GGACACGGCCTTGTATTACTGTGCAAAAGATA--.............................CC.AG

TATCTGGGGCCAAGGGACAATGGTCACCGTCTCT.................................G

TGTGTCTGTGGCCTTGGGACAGACAGTCAGGATC..................................

CTATTATGCAAGCTGGTACCAGCAGAAGCCAGGA..................................

TAAAAACAACCGGCCCTCAGGGATCCCAGACCGA.................................. CDR 2AGCTTCCTTGACCATCACTGGGGCTCAGGCGGAA..................................

CCGGGACAGCAGTGGTAACCATCT.......................A CDR 3TCACCGTCCTAG............

22-VL) chains in comparison with the closest germline. Three complementarity

5 ne 29

hhesia

botmnamgioi1Bblttca

chrdlrapi

Ssrpi1papsba

A

Cfn

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[27] Terskikh AV, Le Doussal JM, Cramieri R, Fisch I, Mach JP, Kajava AV. Pept-abody: a new type of high avidity binding protein. Proc Natl Acad Sci USA

346 P. Neri et al. / Vacci

owever, this antibody was not able to neutralize Stx-2, which wead first selected as a target antigen. Stx-2 has been reported toxert a strong level of cytotoxicity against its target cells even atub picomolar concentrations, indicating that neutralizing antibod-es should completely interfere with the binding between this toxinnd the cells.

Taking into account the fact that increasing the valency of anti-odies results in higher affinity, we constructed a multivalent formf B22 using a COMP pentamerization domain, which is reportedo assemble spontaneously into a pentamer [27]. A 7-fold improve-

ent in the binding of Stx-2BH was achieved, but B22-COMP didot neutralize Stx-2. In contrast, despite no difference in the over-ll binding affinity toward Stx-1BH, B22-COMP neutralized Stx-1ore efficiently than the corresponding B22-pp monomer, sug-

esting the importance of achieving about an 8-fold improvementn the off-rate as a result of the multivalency. The decrease in then-rate might have been due to some kind of three-dimensionalnterference specific for the combination of B22-COMP and Stx-BH. Flow cytometric analysis showed that, in contrast to the22-pp monomer, B22-COMP only partially inhibited the bindingetween Stx-1BH and HeLa 229 cells, suggesting the influence of its

ow on-rate (Fig. 4C). We hypothesize that the difference betweenhe monomer and pentamer is attributable to the high concen-ration of Stx-1BH (200 ng/mL) used in the flow cytometric assayompared with that of Stx-1 (17.5 pg/mL) in the neutralizationssay.

Nucleotide sequence analysis of the VH and VL genes of B22 inomparison with those of germline genes revealed that mutationsad not been introduced into the complementarity determiningegions (Fig. 6). Antibody fragments isolated from naïve phageisplay libraries are reported to have low or moderate affinity

evels [28]. It is possible that a low affinity might be one of theeasons for the lack of neutralizing activity against Stx-2. Higherffinity antibodies against Stx-2 could be isolated using phage dis-lay libraries constructed from antibody repertoires of immune

ndividuals.In summary, we demonstrate the isolation of antibodies against

txs from a naïve phage display antibody library in our presenttudy. The obtained antibodies are fully human in nature, whicheduces the potential for an adverse immunological effect, as seenreviously for animal-derived antibodies in a clinical setting. B22

s the first example of a ‘monovalent’ antibody with strong Stx- neutralizing activity. Monovalent single-chain antibodies can beroduced very efficiently using bacterial protein synthesis systemsnd this is beneficial for reducing time and cost. Although the in vivorotective activity of B22 against Stx-1 remains to be assessed, wepeculate that, with some improvements, phage-display may welle an alternative method for the production of antibodies not onlygainst Stxs, but also other bacterial toxins.

cknowledgements

This work was supported in part by a grant-in-aid for the 21stentury Center of Excellence Program of Fujita Health Universityrom the Ministry of Education, Culture, Sports, Science, and Tech-ology (to Y.K.).

eferences

[1] Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producingEscherichia coli infections. Clin Microbiol Rev 1998;11:450–79.

[2] Karmali MA, Petric M, Lim C, Fleming PC, Arbus GS, Lior H. The associationbetween idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis 1985;151:775–82.

[

(2011) 5340– 5346

[3] Hurley BP, Jacewicz M, Thorpe CM, Lincicome LL, King AJ, Keusch GT, et al. Shigatoxin 1 and 2 translocate differently across polarized intestinal epithelial cells.Infect Immun 1999;67:6670–7.

[4] Lindberg AA, Brown JE, Stromberg N, Westling-Ryd M, Schultz JE, Karlsson KA.Identification of the carbohydrate receptor for Shiga toxin produced by Shigelladysenteriae type 1. J Biol Chem 1987;262:1779–85.

[5] Scotland SM, Smith HR, Rowe B. Two distinct toxins active on Vero cells fromEscherichia coli O157. Lancet 1985;2:885–6.

[6] Strockbine NA, Marques LR, Newland JW, Smith HW, Holmes RK, O’Brien AD.Two toxin-converting phages from Escherichia coli O157:H7 strain 933 encodeantigenically distinct toxins with similar biologic activities. Infect Immun1986;53:135–40.

[7] Jackson MP, Neill RJ, O’Brien AD, Holmes RK, Newland JW. Nucleotide sequenceanalysis and comparison of the structural genes for Shiga-like toxin I andShiga-like toxin II encoded by bacteriophages from Escherichia coli 933. FEMSMicrobiol Lett 1987;44:109–14.

[8] Endo Y, Tsurugi K, Yutsudo T, Takeda Y, Ogasawara T, Igarashi K. Site of actionof a Vero toxin (VT2) from Escherichia coli O157:H7 and of Shiga toxin oneukaryotic ribosomes. RNA N-glycosidase activity of the toxins. Eur J Biochem1988;171:45–50.

[9] Wong CS, Jelacic S, Habeeb RL, Watkins SL, Tarr PI. The risk of the hemolytic-uremic syndrome after antibiotics treatment of Escherichia coli O157:H7infections. N Engl J Med 2000;342:1930–6.

10] Mulvey GL, Marcato P, Kitov PI, Sadowska J, Bundle DR, Armstrong GD. Assess-ment in mice of the therapeutic potential of tailored, multivalent Shiga toxincarbohydrate ligands. J Infect Dis 2003;187:640–9.

11] Watanabe M, Matsuoka K, Kita E, Igai K, Higashi N, Miyagawa A, et al. Oraltherapeutic agents with highly clustered globotriose for treatment of Shigatoxigenic Escherichia coli infections. J Infect Dis 2004;189:360–8.

12] Nishikawa K, Matsuoka K, Watanabe M, Igai K, Hino K, Hatano K, et al. Identifica-tion of the optimal structure required for a Shiga toxin neutralizer with orientedcarbohydrates to function in the circulation. J Infect Dis 2005;191:2097–105.

13] Neri P, Nagano IS, Yokoyama S, Dohi H, Kobayashi K, Miura T, et al. Neutraliz-ing activity of polyvalent Gb3, Gb2 and galacto-trehalose models against Shigatoxins. Microbiol Immunol 2007;51:581–92.

14] Neri P, Tokoro S, Yokoyama S, Miura T, Murata T, Nishida Y, et al. MonovalentGb3-/Gb2-derivatives conjugated with a phosphatidyl residue: a novel class ofShiga toxin-neutralizing agent. Biol Pharm Bull 2007;30:1697–701.

15] Mukherjee J, Chios K, Fishwild D, Hudson D, O’Donnell S, Rich SM, et al. Produc-tion and characterization of protective human antibodies against Shiga Toxin1. Infect Immun 2002;70:5896–9.

16] Dowling TC, Chavaillaz PA, Young DG, Melton-Celsa A, O’Brien AD, Thuning-Roberson C, et al. Phase 1 safety and pharmacokinetic study of chimericmurine-human monoclonal antibody c alpha Stx2 administered intravenouslyto healthy adult volunteers. Antimicrob Agents Chemother 2005;49:1808–12.

17] Krautz-Peterson G, Chapman-Bonofiglio S, Boisvert K, Feng H, Herman IM, Tzi-pori S, et al. Intracellular neutralization of Shiga toxin 2 by an A subunit-specifichuman monoclonal antibody. Infect Immun 2008;6:1931–9.

18] Smith MJ, Melton-Chelsa AR, Sinclair JF, Carvalho HM, Robinson CM, O’BrienAD. Monoclonal antibody 11E10, which neutralizes Shiga Toxin type 2 (Stx2),recognizes three regions on the Stx2 A subunit, blocks the enzymatic action ofthe toxin in vitro, and alters the overall cellular distribution of the toxin. InfectImmun 2009;77:2730–40.

19] Arap MA. Phage display technology—applications and innovations. Gen MolBiol 2005;28:1–9.

20] Hollinger P, Hudson P. Engineered antibody fragments and the rise of singledomain. Nat Biotechnol 2005;23:1126–36.

21] Pansri P, Jaruseranee N, Rangnoi K, Kristensen P, Yamabhai M. A compact phagedisplay human scFv library for selection of antibodies to a wide variety ofantigens. BMC Biotechnol 2009;9:6.

22] Morino K, Katsumi H, Akahori Y, Iba Y, Shinohara M, Ukai Y, et al. Antibodyfusions with fluorescent proteins: a versatile reagent for profiling proteinexpression. J Immunol Methods 2001;257:175–84.

23] Shimizu T, Kawakami S, Sato T, Sasaki T, Higashide M, Hamabata T, et al. Ser-ine 31 residue of B subunit of Shiga toxin 2 is essential for the secretion inEnterohemorrhagic Escherichia coli. Infect Immun 2007;75:2189–200.

24] Tsuji T, Shimizu T, Sasaki K, Shimizu Y, Tsukamoto K, Arimitsu H, et al. Protectionof mice from Shiga toxin-2 toxemia by mucosal vaccine of Shiga toxin 2B-Hiswith Escherichia coli enterotoxin. Vaccine 2008;26:469–76.

25] Fraser ME, Fujinaga M, Cherney MM, Melton-Celsa AR, Twiddy EM, O’Brien AD,et al. Structure of Shiga toxin type 2 (Stx2) from Escherichia coli O157:H7. J BiolChem 2004;279:27511–7.

26] Tsuji T, Shimizu T, Sasaki K, Tsukamoto K, Arimitsu H, Ochi S, et al. A nasalvaccine comprising B-subunit derivative of Shiga toxin 2 for cross-protectionagainst Shiga toxin types 1 and 2. Vaccine 2008;26:2092–9.

1997;94:1663–8.28] Gherardi E, Milstein C. Original and artificial antibodies. Nature

1992;357:201–2.