Supplementary Information A pair of floral regulators sets ... · Supplementary Figures . Supplementary Figure 1 Morning Hd3a expression is dependent on Ehd1 activity. Taichung 65

Supplementary Information

A pair of floral regulators sets critical daylength for Hd3a florigen expression in rice

Hironori Itoh1, Yasunori Nonoue2, Masahiro Yano3, Takeshi Izawa1

1 Photosynthesis and Photobiology Research Unit, National Institute of Agrobiological

Sciences, 2-1-2 Kannondai, Tsukuba 305-8602, JAPAN 2 Institute of the Society for Techno-innovation of Agriculture, Forestry and Fisheries,

Tsukuba 305-0854, JAPAN 3 QTL Genomics Research Center, National Institute of Agrobiological Sciences, 2-1-2

Kannondai, Tsukuba 305-8602, JAPAN

1Nature Genetics: doi:10.1038/ng.606

Supplementary Note

Circadian clocks in rice

To elucidate the repressive action of Ghd7, we performed a series of physiological

experiments. From the data shown in Figs. 3 and 4, we expected that interruption of morning

light would repress morning expression of Ghd7 and enable the subsequent blue-light

induction of Ehd1 the next morning, even under non-inductive LD conditions. In addition,

replacement of normal daylength with a light pulse of less than 1 h would be sufficient for the

induction of Ghd7 function and would maintain the suppressive activity of Ghd7 until the

next morning, because a short period of exposure to red light can fully activate Ghd7

expression (Supp. Fig. 9). However, replacement of normal daylength with complete

darkness (DD) or short light pulses (Supp. Fig. 12a) did not cause de-repression of Ehd1

expression the next morning (Supp. Fig. 12b). Furthermore, the same treatments disturbed

Ehd1 expression the next morning even under inductive SD conditions (Supp. Fig. 12b).

These results led us to speculate that such modification of daylength affected the circadian-

clock action in rice. We therefore examined the expression of three circadian-clock-related

genes, OsLHY, OsGI, and OsPRR1 (Supp. Fig. 12c). On the day of treatment (day 1), both

DD and short-light-period treatments primarily caused severe damping of the rhythmic

expression of OsGI and OsPRR1, but OsLHY mRNA levels during subjective day were only

slightly reduced by these alterations. However, the effects of these treatments on OsLHY

expression became obvious the next morning. Molecular genetic studies of circadian systems

in Arabidopsis have revealed that the plant circadian clock consists of interlocking

transcriptional feedback loops of LHY/CCA1, TOC1(PRR1), and other PRR genes, as

exemplified by the inhibition of TOC1 transcription by LHY/CCA1 activity and the promotion

of LHY/CCA1 transcription by TOC1 activity in a circadian-clock loop1. Our results strongly

suggest that the transcriptional induction of OsLHY requires the expression of OsGI and

OsPRR1 the previous day, but not vice versa. It is very likely that both OsGI and OsPRR1 are

gradually induced by light signals under normal daylength. Furthermore, it is possible that

OsLHY expression is gated to morning light; the gate may be set by OsGI and/or OsPRR1.

Because OsPRR1 is de-repressed in osgi-1 (Izawa, T. et al. in preparation), OsPRR1 may

compensate OsGI to make the gate for OsLHY the next morning. Although OsLHY expression

at subjective dawn of day 2 showed a damped pattern after DD or short light treatment at day

1 and did not recover rapidly in response to normal daylength treatment at day 2, OsGI and

OsPRR1 expression recovered when plants were returned to normal daylength at day 2 (Supp.


Fig. 12c), suggesting that the light-dependent transcriptional activation mechanisms of OsGI

and OsPRR1 differ from those of OsLHY. Accordingly, Ghd7 and Ehd1 expression was

impaired in these physiological experiments.

Control of critical daylength response of Ehd1 expression by Ghd7 function

We revealed that Ehd1 transcription was gated to light at subjective dawn and that blue light

in the morning was effective for this induction. In addition, this gated expression was

repressed by Ghd7 activity ascribed mainly to Ghd7 transcription in the morning of the

previous day. We therefore asked whether gradual changes in the expression of Ghd7 (Fig.

1g) can cause switching with an acute and accurate threshold for Ehd1 expression. In the WT,

a 25% decrease in Ghd7 mRNA levels in response to the 20-min difference from 13 h 30 m to

13 h 10 m corresponded to an approximately 400% increase in expression of Ehd1 (Supp. Fig.

4). A 50% decrease in Ghd7 mRNA levels in response to the 30-min change from 13 h 30 m

to 13 h corresponded to a 1000% increase in the expression of Ehd1 (Fig. 1d, g). In our

system of Ghd7 transcription induction by using heat-shock promoter (Fig. 5b), the 25%

reduction in Ghd7 mRNA levels caused by shortening the duration of heat-shock from 10 to 5

min enabled a 200% increase in Ehd1 expression the next morning. The 65% reduction in

Ghd7 mRNA levels with the change in heat-shock induction from 7.5 min to 2.5 min enabled

a 300% increase in Ehd1 mRNA. Thus, our reconstitution experiments demonstrated that a

relatively small change in the levels of Ghd7 mRNA can trigger a greater change in Ehd1

mRNA levels the next morning. However, we cannot rule out the involvement of post-

transcriptional regulation of Ghd7 and Ehd1 activity, depending on the photoperiod, in the

setting of critical daylength, because the changes in Ehd1 expression were still higher with

typical daylength changes than with these heat-shock treatments. In addition, de-repressed

Ehd1 mRNA levels were much higher in both se5 plants and the ghd7-deficient cultivar

(HOS) than in the wild-type plants under SD (Fig. 1 e,f), suggesting that basal repression by

Ghd7 exists independently of transcriptional regulation by these gating mechanisms.

Furthermore, Ehd1 encodes a member of a subfamily of B-type response regulators involved

in the plant two-component signaling cascade2 (His-to-Asp phosphor-relay), implying post-

transcriptional modification of Ehd1 activity.

Supplementary References

1. Harmer, S.L. The circadian system in higher plants. Annu. Rev. Plant Biol. 60, 357–

377 (2009).


2. Doi, K. et al. Ehd1, a B-type response regulator in rice, confers short-day promotion

of flowering and controls FT-like gene expression independently of Hd1. Genes Dev.

18, 926–936 (2004).


Supplementary Figures

Supplementary Figure 1 Morning Hd3a expression is dependent on Ehd1 activity.

Taichung 65 (T65) is a rice cultivar deficient in both Hd1 and Ehd1. #1-16 is a transgenic line

harboring a functional Ehd1 allele, and #7-1 is a transgenic line harboring a functional Hd1

allele. Plants were entrained under SD (12 h light, 12 h dark) for 12 days. Samples were

collected at dawn and 2 h after application of blue or red light at dawn. Representative results

of two independent experiments. Average values and standard deviations from three RT-PCR

data are shown.


Supplementary Figure 2 Diurnal expression of Ehd1, Ghd7, and Hd3a mRNAs under SD

and LD. (a) Ehd1, (b) Ghd7, (c) Hd3a. Wild-type plants were grown under LD (14.5 h light,

9.5 h dark) or SD (10 h light, 14 h dark) for 14 days. Samples were collected every 3 h from

dawn (08:00). Red and blue lines represent expression patterns of plants grown under LD and

SD, respectively. White and black bars at the bottom represent the light and dark periods,

respectively. Average values and standard deviations from three RT-PCR data are shown.


Supplementary Figure 3 Effects of Hd1 activity on expression of Hd3a, Ehd1, and Ghd7

in the morning. (a) Hd3a, (b) Ehd1, (c) Ghd7. Nipponbare, a japonica cultivar, was used as

control. NIL(Hd1) is a nearly isogenic line harboring the loss-of-function allele of Hd1 of an

indica rice, Kasalath. After entrainment with different daylengths (numbers of hours of

daylight are marked on the x-axis), samples were collected 3 h after dawn. (a, b) Relative

expression values are shown on a log scale. (a–c) Average values and standard deviations

from three RT-PCR data are shown. Results are representative of three independent

experiments. ‘n.t.’ indicates ‘not tested’.


Supplementary Figure 4 Changes in Hd3a, Ehd1, and Ghd7 mRNA levels in response to

10-min differences in daylength between 13 and 13.5 h. (a) Hd3a, (b) Ehd1, (c) Ghd7.

Hours and minutes of daylight are indicated on the x-axis. After entrainment with these

different daylengths for 5 days, wild-type plants were collected 3 h after dawn. (a, b) Relative

expression values are shown on a log scale. (a–c) Average values and standard deviations


experiments. P values (ANOVA) for 13:00-13:10-13:20; 2.2E-3 (Hd3a), 9.3E-3 (Ehd1), 4.8E-

4 (Ghd7); P values (ANOVA) for 13:10-13:20-13:30; 2.1E-4 (Hd3a), 6.1E-4 (Ehd1), 2.3E-2

(Ghd7).


Supplementary Figure 5 Analysis of RFT1 expression under different daylength

conditions. Numbers of hours of daylight are indicated on the x-axis. After entrainment with

the different daylengths for 5 days, the wild-type plants were collected 6 h after dawn.

Relative expression values are shown on a log scale. Average values and standard deviations


experiments.


Supplementary Figure 6 Graphical genotype of a nearly isogenic line, NIL(Ghd7). Lines

indicate chromosomes. Small bars on the chromosomes are landmarks used for genotyping

the materials obtained during repeated backcrossing. Thick red bar indicates introgressed

region of the Kasalath genomic region containing the functional Ghd7 locus. Only the small

genomic region of chromosome 7 of Kasalath containing the functional Ghd7 (in red) was

fixed in the line 03HF2-9B-128.


Supplementary Figure 7 Diurnal protein profile of HA-OsGI in rice plants expressing

HA-OsGI under endogenous promoter regulation. Plants were entrained under SD

conditions (10 h light, 14 h dark, subjective dawn at 08:00). Samples were then collected at

the indicated times. Twenty micrograms of protein extract was loaded per lane and probed

with α-HA antibody. Arrowhead indicates the position of HA-OsGI. Non-specific bands of

RbcS protein were used as loading controls (RbcS). We confirmed that introduction of this

construct complemented the late-flowering phenotype of the osgi-1 mutant in the T0

generation (data not shown). Photoperiod: 08:00–18:00.


Supplementary Figure 8 Gated expression of Ehd1 expression responsive to blue light in

wild-type plants. Wild-type (N8) plants were entrained under SD for 14 days. Plants were

transferred to continuous dark at dusk (0 on the y-axis). Replicate samples were then exposed

once to 2 h of blue light at times differing by 3 h. Black and gray bars in the panel at left

represent subjective night and day. Blue bands represent the 2 h of blue light. Arrowheads

represent the timing of harvest for RNA extraction. Average values and standard deviations

from three RT-PCR data are shown. Data are representative of two independent experiments.


Supplementary Figure 9 A 10-min red-light pulse is sufficient for induction of Ghd7.

Wild-type plants were grown under LD. A red-light pulse of different durations was then

applied at dawn. Samples were collected 2 h after dawn. Average values and standard

deviations from three RT-PCR data are shown. Data are representative of two independent

experiments.


Supplementary Figure 10 Characterization of blue-light-dependent induction of Ehd1.

Wild-type plants grown under SD were exposed to blue light for different lengths of time at

subjective dawn. Induction of Ehd1 mRNA was analyzed 2 h after the start of treatment.

Average values and standard deviations from three RT-PCR data are shown.


Supplementary Figure 11 Ghd7 expression in osgi-1 mutants grown under LD or SD.

osgi-1 plants were entrained by LD (a) or SD (b) for 14 days. Plants were transferred to

darkness at dusk (22:00 in a, 18:00 in b). Replicate samples were then exposed to a single 10-

min red-light pulse at times differing by 2 h. Red-light pulses given at the different times are

indicated in the panel at left; subjective dawn was at 08:00. Acute response of Ghd7

expression was analyzed 2 h after the beginning of exposure. Black and gray bars in the panel

at left represent subjective night and day, respectively. Red bands in the panel represent the

10-min red-light pulses. Arrowheads represent the timing of harvest for RNA extraction.

Average values and standard deviations from three RT-PCR data are shown. Data are

representative of two independent experiments.


Supplementary Fig. 12


Supplementary Figure 12 Effects of light in diurnal cycles on circadian-clock-related

gene expression. (a) Schematic representation of modifications of daylength conditions in

this experiment. Wild-type plants were entrained by SD (10 h light, 14 h dark) or LD (14.5 h

light, 9.5 h dark). The day before sampling (day 1), replicate samples that had received SD or

LD entrainment were subjected to one of three conditions: (1) normal light conditions as

control (SD or LD); (2) darkness after the application of a 1-h (for SD) or 0.5-h (for LD) light

pulse (SD-1 or LD-0.5); or (3) complete darkness from subjective dawn (SD-DD or LD-DD).

Plants were returned to normal light conditions at the next subjective dawn (day 2). White and

black bars indicate light and dark periods, respectively. Hatched bars indicate the replacement

of normal daylength with darkness. (b) Single 24-h continuous dark (DD) treatment causes a

severe failure of Ehd1 induction the next morning. Samples were collected every 3 h from

dawn on day 2. (c) Extremely short light periods or DD treatment impairs the rhythmic

expression of circadian-clock-related genes. Wild-type plants entrained under LD were

transferred to three different conditions, as shown in a. OsLHY (i), OsGI (ii), OsPRR1 (iii).

Samples were collected every 3 h from the beginning of the treatment day (day 1) to the end

of the next day (day 2). White and black bars represent light and dark periods, respectively.

Hatched bars indicate the replacement of normal daylength with darkness. Average values

and standard deviations from three RT-PCR data are shown.


Supplementary Figure 13 Molecular basis of critical daylength recognition for Hd3a

expression. (a) Network diagram of the photoperiodic regulation of Hd3a expression. The

blue-light-mediated floral promotion and red-light (or phytochrome) -mediated floral

repression pathways characterized in this study are indicated by blue and red lines,

respectively. The blue-light receptor for Ehd1 induction has not yet been determined. The

light signaling pathways were gated differently by circadian clocks in rice. The Hd1 pathway

(gray lines) is not essential for Ehd1-dependent regulation of Hd3a expression. (b) SD-

dependent Hd3a expression in the morning is controlled by both Ehd1 and Ghd7. Photo-

inducible phases of Ehd1 (blue dotted lines) and Ghd7 (red dotted lines) are shown. Because

the Ghd7 peak of the photo-inducible phase is set at midnight and the Ehd1 peak of the photo-

inducible phase is set at about dawn under SD conditions, Ehd1 expression is preferentially

induced by blue-light signals in the sunlight at subjective dawn. In turn, Hd3a expression is

activated (centre, left panel). If a single, short exposure to light is given in the middle of the

night (+NB (night break)), Ghd7 is induced through phytochrome signaling and the Ghd7

product suppresses Ehd1 induction by the morning light (centre, right panel). Under LD,

although both Ghd7 and Ehd1 expression can be induced at the same time, Ghd7 expressed in

the morning can suppress blue-light induction of Ehd1 the next morning (bottom panels),

leading to stable suppression of Hd3a expression under LD.


19

Supplementary Table 1 Primer and probe sequences used in this study Gene Forward (5′–3′) Reverse (5′–3′) Probe

Hd3a GCTAACGATGATCCCGAT CCTGCAATGTATAGCATGC CTGCTGCATGCTCACTATCATCAT

CC

Ehd1 GCGCTTTTGATTTCCTGC TTCGGAATATGTGCTGCC GTGAGGATCGAAGAGCTGAGCAA

CA

Ghd7 GTACGCGTCCAGAAAAGCT TTGGCGAAGCGACCTCTC TGCCGAGATGAGGCCCCGA

RFT1 CGTCCATGGTGACCCAACA CCGGGTCTACCATCACGAGT CGGTGGCAATGACATGAGGACGT

TC

OsLHY GGGTCGTCTGGCTTTTGAT CGGTACCCTGTTCTCCTTC AAAGGAGATTAGCAAGGAGGAA

GAAG

OsPRR1 ACCCATGTGTGGCGGC GCCAACTCGAAATGTCATTGA

A

CGGATGCTTGGTTTGTCGGAGAA

AAA

OsGI GCATAAGTTGTGGGTGCTTCC GAAAATACGCAGCTGGTGGAG AGATCCTCGGCTGTAAGTTGTTGG

AGGC

UBQ GAGCCTCTGTTCGTCAAGTA ACTCGATGGTCCATTAAACC TTGTGGTGCTGATGTCTACTTGTG

TC

Oshsp16

.9C

GGAAGCTTCAGTGAAAGCAGT

GAATTG

GGGGATCCAGCTCGATCAAAT

GCTTCAGT

(For cloning)

Ghd7 GGGGTACCGCTAGCTCTAGCT

AGTTGTTG

GGGAATTCAGTGGTATATACG

CACTGTA

(For cloning)

Nature Genetics: doi:10.1038/ng.606

Documents

Supplementary Information A pair of floral regulators sets ... · Supplementary Figures . Supplementary Figure 1 Morning Hd3a expression is dependent on Ehd1 activity. Taichung 65